CA2408913A1 - Melanin-concentrating hormone antagonist - Google Patents

Melanin-concentrating hormone antagonist Download PDF

Info

Publication number
CA2408913A1
CA2408913A1 CA002408913A CA2408913A CA2408913A1 CA 2408913 A1 CA2408913 A1 CA 2408913A1 CA 002408913 A CA002408913 A CA 002408913A CA 2408913 A CA2408913 A CA 2408913A CA 2408913 A1 CA2408913 A1 CA 2408913A1
Authority
CA
Canada
Prior art keywords
substituted
group
ring
compound
nitrogen
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Abandoned
Application number
CA002408913A
Other languages
French (fr)
Inventor
Yuji Ishihara
Jun Terauchi
Nobuhiro Suzuki
Shiro Takekawa
Kazuyoshi Aso
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Takeda Pharmaceutical Co Ltd
Original Assignee
Individual
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Individual filed Critical Individual
Publication of CA2408913A1 publication Critical patent/CA2408913A1/en
Abandoned legal-status Critical Current

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07D—HETEROCYCLIC COMPOUNDS
    • C07D223/00—Heterocyclic compounds containing seven-membered rings having one nitrogen atom as the only ring hetero atom
    • C07D223/14—Heterocyclic compounds containing seven-membered rings having one nitrogen atom as the only ring hetero atom condensed with carbocyclic rings or ring systems
    • C07D223/16—Benzazepines; Hydrogenated benzazepines
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/33—Heterocyclic compounds
    • A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/40—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having five-membered rings with one nitrogen as the only ring hetero atom, e.g. sulpiride, succinimide, tolmetin, buflomedil
    • A61K31/403—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having five-membered rings with one nitrogen as the only ring hetero atom, e.g. sulpiride, succinimide, tolmetin, buflomedil condensed with carbocyclic rings, e.g. carbazole
    • A61K31/404—Indoles, e.g. pindolol
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/33—Heterocyclic compounds
    • A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/435—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with one nitrogen as the only ring hetero atom
    • A61K31/44—Non condensed pyridines; Hydrogenated derivatives thereof
    • A61K31/445—Non condensed piperidines, e.g. piperocaine
    • A61K31/4523—Non condensed piperidines, e.g. piperocaine containing further heterocyclic ring systems
    • A61K31/454—Non condensed piperidines, e.g. piperocaine containing further heterocyclic ring systems containing a five-membered ring with nitrogen as a ring hetero atom, e.g. pimozide, domperidone
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/33—Heterocyclic compounds
    • A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/435—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with one nitrogen as the only ring hetero atom
    • A61K31/47—Quinolines; Isoquinolines
    • A61K31/4709—Non-condensed quinolines and containing further heterocyclic rings
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/33—Heterocyclic compounds
    • A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/435—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with one nitrogen as the only ring hetero atom
    • A61K31/47—Quinolines; Isoquinolines
    • A61K31/472—Non-condensed isoquinolines, e.g. papaverine
    • A61K31/4725—Non-condensed isoquinolines, e.g. papaverine containing further heterocyclic rings
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/33—Heterocyclic compounds
    • A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/535—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with at least one nitrogen and one oxygen as the ring hetero atoms, e.g. 1,2-oxazines
    • A61K31/5375—1,4-Oxazines, e.g. morpholine
    • A61K31/538—1,4-Oxazines, e.g. morpholine ortho- or peri-condensed with carbocyclic ring systems
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/33—Heterocyclic compounds
    • A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/54—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with at least one nitrogen and one sulfur as the ring hetero atoms, e.g. sulthiame
    • A61K31/541—Non-condensed thiazines containing further heterocyclic rings
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/33—Heterocyclic compounds
    • A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/55—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having seven-membered rings, e.g. azelastine, pentylenetetrazole
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/33—Heterocyclic compounds
    • A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/55—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having seven-membered rings, e.g. azelastine, pentylenetetrazole
    • A61K31/551—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having seven-membered rings, e.g. azelastine, pentylenetetrazole having two nitrogen atoms, e.g. dilazep
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P3/00—Drugs for disorders of the metabolism
    • A61P3/04—Anorexiants; Antiobesity agents
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P43/00—Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07D—HETEROCYCLIC COMPOUNDS
    • C07D209/00—Heterocyclic compounds containing five-membered rings, condensed with other rings, with one nitrogen atom as the only ring hetero atom
    • C07D209/02—Heterocyclic compounds containing five-membered rings, condensed with other rings, with one nitrogen atom as the only ring hetero atom condensed with one carbocyclic ring
    • C07D209/04—Indoles; Hydrogenated indoles
    • C07D209/08—Indoles; Hydrogenated indoles with only hydrogen atoms or radicals containing only hydrogen and carbon atoms, directly attached to carbon atoms of the hetero ring
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07D—HETEROCYCLIC COMPOUNDS
    • C07D215/00—Heterocyclic compounds containing quinoline or hydrogenated quinoline ring systems
    • C07D215/02—Heterocyclic compounds containing quinoline or hydrogenated quinoline ring systems having no bond between the ring nitrogen atom and a non-ring member or having only hydrogen atoms or carbon atoms directly attached to the ring nitrogen atom
    • C07D215/12—Heterocyclic compounds containing quinoline or hydrogenated quinoline ring systems having no bond between the ring nitrogen atom and a non-ring member or having only hydrogen atoms or carbon atoms directly attached to the ring nitrogen atom with substituted hydrocarbon radicals attached to ring carbon atoms
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07D—HETEROCYCLIC COMPOUNDS
    • C07D215/00—Heterocyclic compounds containing quinoline or hydrogenated quinoline ring systems
    • C07D215/02—Heterocyclic compounds containing quinoline or hydrogenated quinoline ring systems having no bond between the ring nitrogen atom and a non-ring member or having only hydrogen atoms or carbon atoms directly attached to the ring nitrogen atom
    • C07D215/12—Heterocyclic compounds containing quinoline or hydrogenated quinoline ring systems having no bond between the ring nitrogen atom and a non-ring member or having only hydrogen atoms or carbon atoms directly attached to the ring nitrogen atom with substituted hydrocarbon radicals attached to ring carbon atoms
    • C07D215/14—Radicals substituted by oxygen atoms
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07D—HETEROCYCLIC COMPOUNDS
    • C07D231/00—Heterocyclic compounds containing 1,2-diazole or hydrogenated 1,2-diazole rings
    • C07D231/02—Heterocyclic compounds containing 1,2-diazole or hydrogenated 1,2-diazole rings not condensed with other rings
    • C07D231/10—Heterocyclic compounds containing 1,2-diazole or hydrogenated 1,2-diazole rings not condensed with other rings having two or three double bonds between ring members or between ring members and non-ring members
    • C07D231/12—Heterocyclic compounds containing 1,2-diazole or hydrogenated 1,2-diazole rings not condensed with other rings having two or three double bonds between ring members or between ring members and non-ring members with only hydrogen atoms, hydrocarbon or substituted hydrocarbon radicals, directly attached to ring carbon atoms
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07D—HETEROCYCLIC COMPOUNDS
    • C07D233/00—Heterocyclic compounds containing 1,3-diazole or hydrogenated 1,3-diazole rings, not condensed with other rings
    • C07D233/54—Heterocyclic compounds containing 1,3-diazole or hydrogenated 1,3-diazole rings, not condensed with other rings having two double bonds between ring members or between ring members and non-ring members
    • C07D233/56—Heterocyclic compounds containing 1,3-diazole or hydrogenated 1,3-diazole rings, not condensed with other rings having two double bonds between ring members or between ring members and non-ring members with only hydrogen atoms or radicals containing only hydrogen and carbon atoms, attached to ring carbon atoms
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07D—HETEROCYCLIC COMPOUNDS
    • C07D249/00—Heterocyclic compounds containing five-membered rings having three nitrogen atoms as the only ring hetero atoms
    • C07D249/02—Heterocyclic compounds containing five-membered rings having three nitrogen atoms as the only ring hetero atoms not condensed with other rings
    • C07D249/08—1,2,4-Triazoles; Hydrogenated 1,2,4-triazoles
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07D—HETEROCYCLIC COMPOUNDS
    • C07D265/00—Heterocyclic compounds containing six-membered rings having one nitrogen atom and one oxygen atom as the only ring hetero atoms
    • C07D265/28—1,4-Oxazines; Hydrogenated 1,4-oxazines
    • C07D265/34—1,4-Oxazines; Hydrogenated 1,4-oxazines condensed with carbocyclic rings
    • C07D265/36—1,4-Oxazines; Hydrogenated 1,4-oxazines condensed with carbocyclic rings condensed with one six-membered ring
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07D—HETEROCYCLIC COMPOUNDS
    • C07D401/00—Heterocyclic compounds containing two or more hetero rings, having nitrogen atoms as the only ring hetero atoms, at least one ring being a six-membered ring with only one nitrogen atom
    • C07D401/02—Heterocyclic compounds containing two or more hetero rings, having nitrogen atoms as the only ring hetero atoms, at least one ring being a six-membered ring with only one nitrogen atom containing two hetero rings
    • C07D401/06—Heterocyclic compounds containing two or more hetero rings, having nitrogen atoms as the only ring hetero atoms, at least one ring being a six-membered ring with only one nitrogen atom containing two hetero rings linked by a carbon chain containing only aliphatic carbon atoms
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07D—HETEROCYCLIC COMPOUNDS
    • C07D401/00—Heterocyclic compounds containing two or more hetero rings, having nitrogen atoms as the only ring hetero atoms, at least one ring being a six-membered ring with only one nitrogen atom
    • C07D401/02—Heterocyclic compounds containing two or more hetero rings, having nitrogen atoms as the only ring hetero atoms, at least one ring being a six-membered ring with only one nitrogen atom containing two hetero rings
    • C07D401/12—Heterocyclic compounds containing two or more hetero rings, having nitrogen atoms as the only ring hetero atoms, at least one ring being a six-membered ring with only one nitrogen atom containing two hetero rings linked by a chain containing hetero atoms as chain links
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07D—HETEROCYCLIC COMPOUNDS
    • C07D401/00—Heterocyclic compounds containing two or more hetero rings, having nitrogen atoms as the only ring hetero atoms, at least one ring being a six-membered ring with only one nitrogen atom
    • C07D401/14—Heterocyclic compounds containing two or more hetero rings, having nitrogen atoms as the only ring hetero atoms, at least one ring being a six-membered ring with only one nitrogen atom containing three or more hetero rings
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07D—HETEROCYCLIC COMPOUNDS
    • C07D403/00—Heterocyclic compounds containing two or more hetero rings, having nitrogen atoms as the only ring hetero atoms, not provided for by group C07D401/00
    • C07D403/02—Heterocyclic compounds containing two or more hetero rings, having nitrogen atoms as the only ring hetero atoms, not provided for by group C07D401/00 containing two hetero rings
    • C07D403/06—Heterocyclic compounds containing two or more hetero rings, having nitrogen atoms as the only ring hetero atoms, not provided for by group C07D401/00 containing two hetero rings linked by a carbon chain containing only aliphatic carbon atoms
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07D—HETEROCYCLIC COMPOUNDS
    • C07D403/00—Heterocyclic compounds containing two or more hetero rings, having nitrogen atoms as the only ring hetero atoms, not provided for by group C07D401/00
    • C07D403/02—Heterocyclic compounds containing two or more hetero rings, having nitrogen atoms as the only ring hetero atoms, not provided for by group C07D401/00 containing two hetero rings
    • C07D403/12—Heterocyclic compounds containing two or more hetero rings, having nitrogen atoms as the only ring hetero atoms, not provided for by group C07D401/00 containing two hetero rings linked by a chain containing hetero atoms as chain links
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07D—HETEROCYCLIC COMPOUNDS
    • C07D405/00—Heterocyclic compounds containing both one or more hetero rings having oxygen atoms as the only ring hetero atoms, and one or more rings having nitrogen as the only ring hetero atom
    • C07D405/02—Heterocyclic compounds containing both one or more hetero rings having oxygen atoms as the only ring hetero atoms, and one or more rings having nitrogen as the only ring hetero atom containing two hetero rings
    • C07D405/12—Heterocyclic compounds containing both one or more hetero rings having oxygen atoms as the only ring hetero atoms, and one or more rings having nitrogen as the only ring hetero atom containing two hetero rings linked by a chain containing hetero atoms as chain links
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07D—HETEROCYCLIC COMPOUNDS
    • C07D405/00—Heterocyclic compounds containing both one or more hetero rings having oxygen atoms as the only ring hetero atoms, and one or more rings having nitrogen as the only ring hetero atom
    • C07D405/14—Heterocyclic compounds containing both one or more hetero rings having oxygen atoms as the only ring hetero atoms, and one or more rings having nitrogen as the only ring hetero atom containing three or more hetero rings
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07D—HETEROCYCLIC COMPOUNDS
    • C07D413/00—Heterocyclic compounds containing two or more hetero rings, at least one ring having nitrogen and oxygen atoms as the only ring hetero atoms
    • C07D413/02—Heterocyclic compounds containing two or more hetero rings, at least one ring having nitrogen and oxygen atoms as the only ring hetero atoms containing two hetero rings
    • C07D413/06—Heterocyclic compounds containing two or more hetero rings, at least one ring having nitrogen and oxygen atoms as the only ring hetero atoms containing two hetero rings linked by a carbon chain containing only aliphatic carbon atoms
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07D—HETEROCYCLIC COMPOUNDS
    • C07D413/00—Heterocyclic compounds containing two or more hetero rings, at least one ring having nitrogen and oxygen atoms as the only ring hetero atoms
    • C07D413/02—Heterocyclic compounds containing two or more hetero rings, at least one ring having nitrogen and oxygen atoms as the only ring hetero atoms containing two hetero rings
    • C07D413/12—Heterocyclic compounds containing two or more hetero rings, at least one ring having nitrogen and oxygen atoms as the only ring hetero atoms containing two hetero rings linked by a chain containing hetero atoms as chain links
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07D—HETEROCYCLIC COMPOUNDS
    • C07D417/00—Heterocyclic compounds containing two or more hetero rings, at least one ring having nitrogen and sulfur atoms as the only ring hetero atoms, not provided for by group C07D415/00
    • C07D417/02—Heterocyclic compounds containing two or more hetero rings, at least one ring having nitrogen and sulfur atoms as the only ring hetero atoms, not provided for by group C07D415/00 containing two hetero rings
    • C07D417/06—Heterocyclic compounds containing two or more hetero rings, at least one ring having nitrogen and sulfur atoms as the only ring hetero atoms, not provided for by group C07D415/00 containing two hetero rings linked by a carbon chain containing only aliphatic carbon atoms

Abstract

A melanin-concentrating hormone antagonist which contains a compound represented by the formula or a salt thereof: (I) wherein R represents hydrogen, halogeno, or an optionally substituted cyclic group; X represents a bond or a spacer in which the main chain has one to ten atoms; Y represents a spacer in which the main chain has one to six atoms; ring A represents a benzene ring which may have other substituent(s); ring B represents a five- to nine-membered nitrogenous nonaromatic heterocycle which may have other substituent(s); and R1 and R2 are the same or different and each represents hydrogen, an optionally substituted hydrocarbon group, or an optionally substituted heterocyclic group, or R1 and R2 may form an optionally substituted nitrogenous heterocycle in cooperation with the adjacent nitroge n atom and R2 may form an optionally substituted nitrogenous heterocycle in cooperation with the adjacent nitrogen atom and Y. The antagonist is useful as a preventive/remedy for adiposity, etc.

Description

Melanin-Concentrating Hormone Antagonist TECHNICAL FIELD
The present invention relates to a melanin concentrating hormone antagonist which is useful as an agent for preventing or treating obesity, etc.
BACKGROUND ART
Feeding behavior is an essential action for many living beings including humans. Therefore, if irregularities in feeding behavior occur, disorders, often connected to diseases, will occur in normal life maintaining activities. Accompanying recent changes of our dietary environment, obesity is now becoming a social problem. In addition, not only is obesity a serious risk factor for life-style diseases such as diabetes, hypertension, and arteriosclerosis; it is also widely known that increased body weight places excessive burdens on joints such as knee joints, causing arthritis and pain.
The "diet boom," etc. show that there is a potentially great percentage of the population hoping to reduce body weight; on the other hand, many cases of feeding problems such as overeating, occurring due to causes such as hereditary neurosis or neurosis due to stress, have been reported.

,' Therefore, research on and development of agents for preventing or treating obesity, or agents for inhibiting eating, have been vigorously done for a long time. The centrally acting anorectic drug, Mazindol, is now being marketed.
Many appetite control factors such as leptin, have recently been discovered, and the development of anti-obesity agents or anorectic agents which will regulate the functions of these appetite control factors is progressing.
In particular, it is known that melanin-concentrating hormone (hereinafter also abbreviated as "MCH") originates in the hypothalamus and has orexigenic action. In addition, it has been reported that even though the daily behavior of MCH knock-out mice was normal, the amount of feeding by MCH
knock-out mice was significantly reduced and their body weights were lighter than those of normal mice [Nature, Vol.
396, p.670, 1998]. This indicates that, if a MCH
antagonist was produced, it can be expected to be an excellent anorectic agent or anti-obesity agent; but at present there are no known compound, especially non-peptide type compounds, which possess MCH antagonistic actions.
On the other hand, the following compounds are known as amine derivatives.
1) JP 10-504315 A describes a compound represented by the formula:

., a RZ
R' R3 CU - N q- (CR4R5) m -NR~RB
g-(R ) wherein Rl is hydrogen, halogen, C1_6 alkyl, C3_6 cycloalky, COC1_6 alkyl, C1_6 alkoxy, hydroxy, hydroxy-C1_6 alkyl, hydroxy-C1_6 alkoxy, acyl, nitro, trifluoromethyl, cyano, CHO SR9 SOR9 SO R9 SO NR1°R11 CO R1° NR1°SO R11 CONR1°Rli z . z . z . z CO NRl°Rll CONRl° ( CH ) CO R11 ( CH ) NRl°Rll ( CH ) CONRl°Rli z ~ 2 p 2 ~ 2 p ~ 2 p i ( CHz ) pNRl°CORll, ( CHz ) pCOz-C1_6 al kyl, COz ( CHz ) pORl°, CONHNRl°Rll, NRl°Rll, NRl°COzRll, NRl°CONRl°Rll, CRl°=NOR11, CNRl°=NORM (wherein Rl° and Rll are independently hydrogen, or C1_6 alkyl and p is 1 to 4 ) ;
Rz and R3 are independently hydrogen, halogen, C1_6 alkyl, C3_6 cycloalkyl, C3_6 cycloalkenyl, C1_6 alkoxy, acyl, aryl, acyloxy, hydroxy, nitro, trifluoromethyl, cyano, hydroxy-C1_6 alkyl, C1_6 alkyl-0-C1_6 alkyl, COzRI°, CONR1°R11, NR1oR11 (wherein Rl° and Rll are independently hydrogen, or C1_6 alkyl) ;
R9 and RS are independently hydrogen or C1_6 alkyl;
R6 is hydrogen, halogen, hydroxy, C1_6 alkyl or C1_6 alkoxy;
R' and Re are independently hydrogen, C1_6 alkyl, aralkyl or they, together with the nitrogen to which they are attached, may form a 5- to 7-heterocyclic ring containing one or two heteroatoms selected from oxygen, nitrogen and sulfur which may be substituted:
A is oxygen, S (0) q (wherein q is 0, 1 or 2 ) , CR4=CRS or CRgRs (wherein R4 and RS are independently hydrogen or C1_6 alkyl) , or A is NR12 (wherein Rl2 is hydrogen or C1_6 alkyl) B is (CR13R14) q (wherein q is 2, 3 or 4, R13 and Rl4 are independently hydrogen or C1_6 alkyl) , or B is (CR13R1') r-D
(wherein r is 0, 1 or 2, D is oxygen, sulfur or CR13=CR14):
m is 1 to 4; and n is 1 or 2: or a salt thereof, which has 5-HT1D antagonistic activity.
As specific examples thereof, there are described 1-(4'-acetamidomethyl-2'-methylbiphenyl-4-carbonyl)-5-chloro-2,3-dihydro-6-(2-dimethylaminoethoxy)-1H-indole, 1-(4'-acetamidomethyl-2'-methylbiphenyl-4-carbonyl)-2,3-dihydro-6-(3-dimethylaminopropyl)-5-ethoxy-1H-indole, etc.
2) JP 9-506885 A (W095/17398) describes a compound represented by the formula:
R~ R2 p Ra CO N A- (CR5R6) m-NR7R8 (R4)"
wherein P is a 5- to 7-membered heterocyclic ring containing one to three heteroatoms selected from oxygen, nitrogen and sulfur;
R1, Rz and R3 are independently hydrogen, halogen, C1_6 alkyl, C3_6 cycloalky, C3_6 cylcoalkenyl, C1_6 alkoxy, acyl aryl, 5 acyloxy, hydroxy, nitro, trifluoromethyl, cyano, COzR9, CONR1°R11, NR1oR11 (wherein R9, R1° and R11 are independently hydrogen, or C1_6 alkyl) ;
R' is hydrogen, halogen, hydroxy, C1_6 alkyl or C1_6 alkoxy;
RS and R6 are independently hydrogen or C1_6 alkyl;
R' and Re are independently hydrogen, C1_6 alkyl, aralkyl or they, together with the nitrogen to which they are attached, may form a 5- to 7-heterocyclic ring containing one or two heteroatoms selected from oxygen, nitrogen and sulfur which may be substituted;
A is oxygen, S (0) n (wherein n is 0, 1 or 2) , or A is NR12 (wherein R12 is hydrogen or C1_6 alkyl) , or A is CRS=CR6 or CRSR6 (wherein RS and R6 are independently hydrogen or C1_s alkyl);
m is 1 to 4;
n is 1 or 2;
B is (CR13R19) q (wherein q is 2, 3 or 4, R13 and R14 are independently hydrogen or C1_6 alkyl) , or B is (CR13R19) r-D
(wherein r is 0, 1 or 2, D is oxygen, sulfur or CR13=CRl°) ;
or a salt thereof, which has 5-HT1D antagonistic activity.
As specific examples thereof, there are described [7-,.

(2-dimethylaminoethoxy)-6-methoxy-3,4-dihydro-2H-quinolin-1-yl]-[2'-methyl-4'-(5-methyl-1,2,4-oxadiazol-3-yl)biphenyl-4-yl]methanone, [7-(2-dimethylaminopropyl)-6-methoxy-3,4-dihydro-2H-quinolin-1-yl]-[2'-methyl-4'-(5-methyl-1,2,4-oxadiazol-3-yl)biphenyl-4-yl]methanone, etc.
3) JP 6-211800 A describes a compound represented by the formula:

R~
C=0 \i R2 wherein R1 is hydrogen atom, a halogen atom, hydroxy group, a lower alkanoyloxy group, amino-lower alkoxy group which may have a group selected from a lower alkyl group and a lower alkanoyl group as a substituent, a carboxy-substituted lower alkoxy group, a lower alkoxycarbonyl-substituted lower alkoxy group, or an aminocarbonyl lower alkoxy group which may have a lower alkyl group as a substituent; R9 is hydrogen atom, a group of -NR6R' (wherein R6 and R' are the same or different and are hydrogen atom, a lower alkyl group, a lower alkenyl group or benzoyl group having a halogen atom on the phenyl ring), a lower alkenyloxy group, a hydroxy-substituted lower alkyl group, a group of -O-CO-ANRBR9 (wherein A is a lower alkylene group, R8 and R9 are the same or different and are hydrogen atom or a lower alkylene group, or RB and R9, together with the nitrogen atom to which they are attached, may form a 5-to 6-membered saturated or unsaturated heterocyclic ring through or without through oxygen or nitrogen atom, said heterocyclic ring may have a lower alkyl group on the heterocyclic ring as a substituent) , a group of -O-R1° (Rlo is an amino acid residue), a lower alkoxycarbonyl-substituted lower alkylidene group, a lower alkoxycarbonyl-substituted lower alkyl group, a carboxy-substituted lower alkyl group, a group of -ACONR11R12 (A is as defined above, Rll and R12 are the same or different and are hydrogen atom, a lower alkyl group which may have hydroxy group, piperidinyl group which may have a phenyl-lower alkyl group on the piperidine ring, a carbamoyl-substituted lower alkyl group, a pyridyl-substituted lower alkyl group, pyridyl group, a group of -ANR39R9° (A is as defined above, R39 and R4° are the same or different and are hydrogen atom or a lower alkyl group which may have hydroxy group, or R39 and R9°, together with the nitrogen atom to which they are attached, may form a 5- to 6-membered saturated heterocyclic ring thorough or without thorough nitrogen or oxygen atom, said heterocyclic ring may have a lower alkyl on the heterocyclic ring as a substituent), a pyrazinyl-substituted lower alkyl group which may have a lower alkyl group on the pyrazine ring as a substituent, a pyrrolyl-substituted lower alkyl group which may have a lower alkyl group on the pyrrole ring, a pyrrolidinyl-substituted lower alkyl group which may have a lower alkyl group on the pyrrolidine ring, or phenyl group which may have a halogen atom on the phenyl ring, or R11 and R12, together with the nitrogen atom to which they are attached, may form a 5- to 7-membered heterocyclic ring through or without thorough nitrogen or oxygen atom, said heterocyclic ring may be substituted with a lower alkyl group or a pyrrolidinylcarbonyl-lower alkyl group, each of which may have one to two groups selected from the group consisting of a lower alkyl group, a lower alkoxycarbonyl group, amino group which may have a group selected from the group consisting of a lower alkyl group or a lower alkanoyl group as a substituent, a lower alkoxycarbonyl-substituted lower alkyl group, phenyl group which may have a halogen atom on the phenyl ring, a cyano-substituted lower alkyl group, a lower alkenyl group, an oxiranyl-substituted lower alkyl group, a carbamoyl-substituted lower alkyl group and amino group which may have hydroxy group and a lower alkyl group as a substituent), a group -OACONR23R29 (A is as defined above, R23 and R24 are the same or different and are hydrogen atom, a lower alkyl group, a lower alkoxycarbonyl-substituted lower alkyl group, a carboxy-substituted lower alkyl group, piperidinyl group which may have a lower alkyl group on the piperidine ring, or a group of -B-NRZSAR24A
(wherein B is a lower alkylene group, R23A and R24A are the same or different and are hydrogen atom or a lower alkyl group, or R23A and R24A, together with the nitrogen atom to which they are attached, may form a 5- to 6-membered saturated heterocyclic ring through or without through nitrogen atom or oxygen atom) , or Rz3 and R24, together with the nitrogen atom to which they are attached, may form a 5-to 7-membered saturated heterocyclic ring through or without through nitrogen atom or oxygen atom, said heterocyclic ring may have a lower alkyl group on the heterocyclic ring as a substituent), a pyrrolidinylcarbonyl-lower alkoxy group having a lower alkoxycarbonyl group on the pyrrolidine ring, a lower alkoxy-substituted lower alkanoyloxy group, a group of -BOCOANRZSR2s (A is as defined above, B is lower alkylene group, R25 and R26 are the same or different and are hydrogen atom or a lower alkyl group), amino-substituted lower alkylidene group which may have a lower alkyl group as a substituent, a group of -OANRZ'R28 (A is as defined above, Rz' and R28 are the same or different and are hydrogen atom, a lower alkyl group, a lower alkenyl group, a lower alkynyl group, a lower alkylsulfonyl group, an aminothiocarbonyl group which may have a lower alkyl group as a substituent, a group of N
\R42 wherein R91 is hydrogen atom or cyano group, R°2 is a lower alkyl group or amino group which may have a lower alkyl group as a substituent), carbamoyl group, a lower alkoxycarbonyl group, cycloalkyl group, a phenyl-lower 10 alkyl group which may have a halogen atom as a substituent on the phenyl group, a cyano-substituted lower alkyl group, a halogen atom-substituted lower alkylsulfonyl group or an amino-substituted lower alkyl group which may have a lower alkyl group, or R2' and R28, together with the nitrogen atom to which they are attached, may form a 5- to 10-membered monocyclic or bicyclic, and saturated or unsaturated heterocyclic ring, said heterocyclic ring may have oxo group, a lower alkyl group, a lower alkoxycarbonyl group, a lower alkanoyl group or a lower alkanoylamino group on the heterocyclic ring as a substituent), cyano group, a cyano-substituted lower alkyl group, a lower alkoxy group having phenylsulfonyloxy group whose phenyl ring may have a lower alkyl group as a substituent or hydroxy group, a group -ANR29R3° (A is as defined above, R29 is hydrogen atom or a lower alkyl group, R3° is a lower alkenyl group, cycloalkyl group or a lower alkynyl group, or R29 and R3°, together the nitrogen atom to which they are attached, may form a 5- or 6-membered saturated heterocyclic ring through or without through nitrogen atom or oxygen atom, said heterocyclic ring may have a lower alkyl group, a lower alkanoyl group, amino group which may have a group selected from the group consisting of a lower alkyl group and a lower alkanoyl group, a lower alkylsulfonyl group, a lower alkoxycarbonyl group, or aminocarbonyl group which may be substituted with a lower alkyl group on the heterocyclic ring as a substituent), a phenylsulfonyloxy-substituted lower alkyl group which may have an lower alkyl group on the phenyl ring, a phthalimide-substituted lower alkyl group, a cyano-substituted lower alkylidene group, a halogen atom-substituted alkyl group, an imidazolyl-substituted lower alkyl group, 1, 2, 4-triazolyl-substituted lower alkoxy group, 1, 2, 3, 4-tetrazolyl-substitued lower alkoxy group, 1, 2, 3, 5-tetrazolyl-substitued lower alkoxy group, 1, 2, 3, 4-tetrazolyl-substituted lower alkyl group, l, 2, 3, 5-tetrzolyl-substituted lower alkyl group, 1, 2, 4-triazolyl-substituted lower alkyl group, a carboxy-substituted lower alkoxy group, a lower alkoxycarbonyl-substituted lower alkoxy group, a pyridylthio-substituted lower alkoxy group, a pyrimidinylthio-substituted lower alkoxy group which may have a lower alkyl group on the pyrimidine ring, an imidazolylthio-substituted lower alkoxy group, a pyridylsulfinyl-substituted lower alkoxy group, a pyridylsulfonyl-substituted lower alkoxy group, an imidazolylsulfinyl-substituted lower alkoxy group or an imidazolylsulfonyl-substituted lower alkoxy group; R5 is hydrogen atom or hydroxy group, or R4 and RS together form oxo group; RZ is hydrogen atom, a lower alkyl group, hydroxy group, a halogen atom or a lower alkoxy group; R3 is a group of ~ ~R~3)m -NHCO
(wherein R13 is a halogen atom, hydroxy group, carbamoyl group, a lower alkyl group, a piperazinyl-lower alkoxy group having a lower alkanoyl group at 4-position of the piperazine ring, an imidazolyl-substituted lower alkoxy group, piperidinyl-lower alkoxy group having a lower alkanoylamino group on the piperidine ring, a 1, 2, 4-triazolyl-substituted lower alkoxy group, a ureido-substituted lower alkoxy group which may have a lower alkyl group or an amino-substituted lower alkoxy group which may have a lower alkyl group as a substituent; m is 0 or an integer of 1 to 3, a phenyl-lower alkanoylamino group which have one to three groups selected from the group consisting of a halogen atom, a lower alkoxy group, a lower alkyl group and nitro group on the phenyl ring as a substituent, a group of -N
~ (CH2) (n is 1 or 2) or a group of the bond between 4 and 5 positions of the benzazepine ring represent a single bond or a double bond; provided that, when R1 is hydrogen atom or a halogen atom, and R9 is hydrogen atom, a group of -NR6R' (R6 and R' are the above R6 and R' other than benzoyl group having a halogen atom on the phenyl ring as a substituent), a group of -0-COANReR9 (A is as defined above, Re and R9 are the same or different and are hydrogen atom or a lower alkyl ) , a hydroxy group-substituted lower alkyl group, a carboxy-substituted lower alkoxy group, a lower alkoxycarbonyl-substituted lower alkoxy group or a group -O-A-NRZ'R28 (A is as defined above, R2' and Rze are the same or different and are hydrogen atom or a lower alkyl group), RS is hydrogen atom or hydroxy group or R' and R5 together form oxo group, and further R3 is a group of CR13) m -NHCO
, R13 must be carbamoyl group, a piperazinyl-lower alkoxy group having a lower alkanoyl group at 4-position of the piperazine ring, a piperidinyl-lower alkoxy group having a lower alkanoylamino group on the piperidine ring, 1, 2, 4-triazolyl-substituted lower alkoxy group or a ureido-substituted lower alkoxy group which may have a lower alkyl group; or a salt thereof, which has vasopressin antagonistic activity or oxytocin antagonistic activity.
As specific examples, there are described N-[4-[[7-[3 (dimethylamino)propoxy]-2,3,4,5-tetrahydro-1H-1-benzazepin 1-yl]carbonyl]phenyl]-2-methylbenzamide, etc.
There has been great desire for the development of a melanin-concentrating hormone antagonist which is useful as an agent for preventing or treating obesity, excellent in oral absorbency, and safe.
DISCLOSURE OF INVENTION
As a result of intensive studies of compounds with a MCH antagonistic action, the present inventors found that a derivative which is obtained by introducing a group of the formula: R-X- where each symbol is as defined hereafter, into a compound of the formula:

_ ~R -1.1 HN B I j Y N \ 2 _~
R

wherein each symbol is as defined hereinafter, had an excellent MCH antagonistic actions, to complete the present invention.
Namely, the present invention relates to:
10 1) A melanin-concentrating hormone antagonist which comprises a compound represented by the formula:

~R
R -X-N B ( j Y-N\ 2 (I) R
wherein R is hydrogen atom, a halogen atom or a cyclic group which may be substituted;
15 X is a bond or a spacer having a main chain of 1 to 10 atoms;
Y is a spacer having a main chain of 1 to 6 atoms:
ring A is benzene ring which may be further substituted;
ring B is a 5- to 9-membered nitrogen-containing non-aromatic heterocyclic ring which may be further substituted; and R1 and RZ are the same or different and are hydrogen atom, a hydrocarbon group which may be substituted or a heterocyclic group which may be substituted; or R1 and R2, together with the adjacent nitrogen atom, may form a nitrogen-containing heterocyclic ring which may be substituted; or R2, together with the adjacent nitrogen atom and Y, may form a nitrogen-containing heterocyclic ring which may be substituted;
or a salt thereof;
2) The antagonist according to the above 1), wherein R is a cyclic group which may be substituted; X is a spacer having a main chain of 1 to 6 atoms; and R1 and Rz are the same or different and are hydrogen atom or a hydrocarbon group which may be substituted; or R1 and R2, together with the adjacent nitrogen atom, form a nitrogen-containing heterocyclic ring which may be substituted; or R2, together with the adjacent nitrogen atom and Y, form a nitrogen-containing heterocyclic ring which may be substituted;
3) The antagonist according to the above 1) which is an agent for preventing or treating diseases caused by melanin-concentrating hormone 4) The antagonist according to the above 1) which is an agent for preventing or treating obesity;
5) A compound represented by the formula:
1 i Ar-X-N B ( j Y N \ 2 ~ ( I ) R
wherein Arl is a cyclic group which may be substituted;
X is a bond or a spacer having a main chain of 1 to 10 atoms;
Y is a spacer having a main chain of 1 to 6 atoms;
ring A is benzene ring which may be further substituted;
ring B1 is a 5- to 9-membered nitrogen-containing non-aromatic heterocyclic ring which may be further substituted; and R1 and RZ are the same or different and are hydrogen atom, a hydrocarbon group which may be substituted or a heterocyclic group which may be substituted; or R1 and R2, together with the adjacent nitrogen atom, may form a nitrogen-containing heterocyclic ring which may be substituted; or R2, together with the adjacent nitrogen atom and Y, may form a nitrogen-containing heterocyclic ring (except piperidine) which may be substituted;
provided that, when X is C0, ring B1 is not azepane or 4,5 dihydroazepine each of which may be further substituted, or Arl is not biphenylyl which may be substituted, and that Y
is not -CO-(C(Ra)H)na- (Ra is hydrogen atom or a hydrocarbon group which may be substituted, na is an integer of 1 to 10) and does not have a bicyclic nitrogen-containing heterocyclic ring substituted with amino group;
or a salt thereof;
6) The compound according to the above 5), wherein X
is a spacer having a main chain of 1 to 10 atoms; and R1 and RZ are the same or different and are hydrogen atom or a hydrocarbon group which may be substituted; or R1 and R2, together with the adjacent nitrogen atom, form a nitrogen-containing heterocyclic ring which may be substituted; or R2, together with the adjacent nitrogen atom and Y, form a nitrogen-containing heterocyclic ring (except piperidine) which may be substituted;
7) The compound according to the above 5), wherein the cyclicgroup represented by Arl is aromatic group;
an 8) The compound according to the above 7), wherein the aromatic group is a group formed by removing an optional one hydrogen atom from an aromatic ring assembly formed by 2 or 3 members selected from C6_19 monocyclic or condensed polycyclic aromatic hydrocarbon and 5- to 10-membered aromatic heterocyclic ring;
9) The compound according to the above 5), wherein the spacer represented by X and Y is a bivalent group consisting of 1 to 3 members selected from -O-, -S-, -CO-, -SO-, -SOZ-, -NR8- (Re is hydrogen atom, optionally halogenated C1_6 alkyl, optionally halogenated C1_6 alkyl-carbonyl or optionally halogenated C1_6 alkylsulfonyl), and a divalent C1_6 non-cyclic hydrocarbon group which may be substituted;
10) The compound according to the above 5), wherein X
is C0:
11) The compound according to the above 5), wherein Y
is Cz_6 alkenylene which may be substituted:
12) The compound according to the above 5), wherein the group represented by the formula:
N B' ~ A
i to is ~w ~w ~w / N / or N /
13) The compound according to the above 5), wherein R1 and R2. together with the adjacent nitrogen atom. firm a nitrogen-containing heterocyclic ring which may be substituted;
14) The compound according to the above 5), wherein R1 and R5 are C1_6 alkyl;
15) A pharmaceutical composition comprising the compound according to the above 5), or a salt thereof;
16) A prodrug of the compound according to the above 5) ;
17) A process for producing a compound represented by the formula:

1 ~ ~ _ /R
Ar-X-N B I j Y N \ 2 ~ ( I ) ~~ R
5 wherein each symbol is as defined in the above 5), or a salt thereof, which comprises reacting a compound represented by the formula:
Ar' X L (11b) wherein L is a leaving group and the other symbols are as 10 defined above, or a salt thereof with a compound represented by the formula:

1 w _ /R
H N B I j Y N\ 2~ (Illb) R
wherein each symbol is as defined above, or a salt thereof;
18) A compound represented by the formula:
R -X-N B ~ j Ya C -N~Z Rb wherein R is hydrogen atom, a halogen atom or a cyclic group which may be substituted;
X is a bond or a spacer having a main chain of 1 to 10 atoms;

Ya is a spacer having a main chain of 1 to 5 atoms:
ring A is benzene ring which may be further substituted;
ring B is a 5- to 9-membered nitrogen-containing non-aromatic heterocyclic ring which may be further substituted:
Z is CH or N; and Rb is hydrogen atom or a hydrocarbon group which may be substituted;
provided that Ya does not have a bicyclic nitrogen containing heterocyclic ring substituted with amino group:
or a salt thereof:
19) The compound according to the above 18), wherein R is hydrogen atom;
20) The compound according to the above 18), wherein Ya is - (CHZ) W1C0 (CHZ) W2- (w1 and w2 are an integer of 0 to 5 and w1 + w2 is 0 to 5 ) ;
21) The compound according to the above 18), wherein Z is CH;
22) The compound according to the above 18), wherein Rb is C6_19 aryl which may be substituted;
23) The compound according to the above 18), wherein the group represented by the formula:
N B ~ A

is -N I \ I ~ ~ ~ -N \
i ~ i iN / N / / .
or 24) A pharmaceutical composition comprising the compound according to the above 18), or a salt thereof;
25) A prodrug of the compound according to the above 18);
26) A process for producing a compound represented by the formula:

R -X-N B ~ A Ya C -N Z Rb ( I ' ' >
U
wherein each symbol is as defined in the above 18), or a salt thereof, which comprises reacting a compound represented by the formula:
R X L (I la) wherein L is a leaving group and the other symbols are as defined above, or a salt thereof, with a compound represented by the formula:
H-N B ~ j Ya C -N~Z Rb ( I I I c) wherein each symbol is as defined above, or a salt thereof;
27) A compound represented by the formula II II R' R -X-N B I A C (CH2) w~ C -N / p~ ( I ' ' ' ' ) ~R2 .~,-~
wherein R is hydrogen atom, a halogen atom or a cyclic group which may be substituted:
X is a bond or a spacer having a main chain of 1 to 10 atoms:
ring A is benzene ring which may be further substituted;
ring B is a 5- to 9-membered nitrogen-containing non-aromatic heterocyclic ring which may be further substituted:
w7 is an integer of 0 to 4; and R1 and Rz are the same or different and are hydrogen atom, a hydrocarbon group which may be substituted or a heterocyclic group which may be substituted; or R1 and R2, together with the adjacent nitrogen atom, may form a nitrogen-containing heterocyclic ring which may be substituted; or a salt thereof;
28) A pharmaceutical composition comprising the compound according to the above 27) or a salt thereof:
2 9 ) A prodrug of the compound according to the above 27 ) 30) A compound represented by the formula:

R -X-N B ~ A 0 (CH2) ,~ N Z R~ ( ~ , , , , , ) U
wherein R is hydrogen atom, a halogen atom or a cyclic group which may be substituted;
X is a bond or a spacer having a main chain of 1 to 10 atoms;
ring A is benzene ring which may be further substituted;
ring B is a 5- to 9-membered nitrogen-containing non-aromatic heterocyclic group which may be further substituted;
w2 is an integer of 0 to 5;
Z is CH or N;
Rc is a hydrocarbon group which may be substituted;
or a salt thereof;
31 ) The compound according to the above 30 ) , wherein Z is CH;
32) The compound according to the above 30), wherein Rc is C6_19 aryl which may be substituted;
33) A pharmaceutical composition comprising the compound according to the above 30) or a salt thereof;
34) A prodrug of the compound according to the above 30);
35) The antagonist according to the above 1) which is an anorectic agent;

36) A pharmaceutical which comprises the melanin-concentrating hormone antagonist according to the above 1) in combination with at least one species selected from the group consisting of an agent for treating diabetes, an 5 agent for treating hypertension and an agent for treating arteriosclerosis;
37) A method for preventing or treating diseases caused by a melanin-concentrating hormone in a mammal in need thereof, which comprises administering to said mammal 10 an effective amount of a compound represented by the formula (I), or a salt thereof;
38) A method for preventing or treating obesity in a mammal in need thereof, which comprises administering to said mammal an effective amount of a compound represented 15 by the formula:

~R
R -X-N B ~ A Yb-N ( ~ , , , ) wherein R is hydrogen atom, a halogen atom or a cyclic group which may be substituted;
X is a bond or a spacer having a main chain of 1 to 10 20 atoms;
Yb is a spacer having a main chain of 1 to 6 atoms;
ring A is benzene ring which may be further substituted;
ring B is a 5- to 9-membered nitrogen-containing non-aromatic heterocyclic ring which may be further substituted; and R1 and Rz are the same or different and are hydrogen atom, a hydrocarbon group which may be substituted or a heterocyclic group which may be substituted; or R1 and R2, together with the adjacent nitrogen atom, may form a nitrogen-containing heterocyclic ring (except piperidine) which may be substituted; or R2, together with the adjacent nitrogen atom and Y, may form a nitrogen-containing heterocyclic ring which may be substituted;
provided that Yb is not -CO-(C(Ra)H)na- (Ra is hydrogen atom or a hydrocarbon group which may be substituted, na is an integer of 1 to 10);
or a salt thereof;
39) Use of a compound represented by the formula (I) or a salt thereof, for the manufacture of a pharmaceutical preparation for preventing or treating diseases caused by a melanin-concentrating hormone;
40) Use of a compound represented by the formula (I " ') or a salt thereof, for the manufacture of a pharmaceutical preparation for preventing or treating obesity; and the like.
Examples of the "cyclic group" in the "cyclic group which may be substituted" represented by R and Arl include aromatic groups, non-aromatic cyclic hydrocarbon groups, non-aromatic heterocyclic groups and the like.
Here, examples of the "aromatic groups" include monocyclic aromatic groups, condensed aromatic groups, ring assembly aromatic groups and the like.
Examples of the monocyclic aromatic groups include univalent groups which can be formed by removing an optional one hydrogen atom from a monocyclic aromatic ring.
Example of the "monocyclic aromatic ring" include benzene ring and a 5- or 6-membered aromatic heterocyclic ring.
Examples of the "5- or 6-membered aromatic heterocyclic ring" include a 5- or 6-membered aromatic heterocyclic ring containing one or more (for example, 1 to 3) hetero atoms selected from nitrogen, sulfur and oxygen atoms in addition to carbon atoms, and the like.
Specifically, thiophene, furan, pyrrole, imidazole, pyrazole, thiazole, isothiazole, oxazole, isoxazole, pyridine, pyrazine, pyrimidine, pyridazine, 1,2,4-oxadiazole, 1,3,4-oxadiazole, 1,2,4-thiadiazole, 1,3,4-thiadiazole, furazan, etc., can be mentioned.
Specific examples of the "monocyclic aromatic groups"
include phenyl, 2- or 3-thienyl, 2-, 3-, or 4-pyridyl, 2-or 3-furyl, 2-, 4- or 5-thiazolyl, 2-, 4- or 5-oxazolyl, 1-, 3- or 4-pyrazolyl, 2-pyrazinyl, 2-, 4- or 5-pyrimidinyl, 1-, 2- or 3-pyrrolyl, 1-, 2- or 4-imidazolyl, 3- or 4-pyridazinyl, 3-isothiazolyl, 3-isoxazolyl, 1,2,4-oxadiazol-5-yl, 1,2,4-oxadiazol-3-yl, etc.
The "condensed aromatic groups" mean a univalent group that can be formed by removing an optional one hydrogen atom from condensed polycyclic (preferably bicyclic to tetracyclic, more preferably bicyclic or tricyclic) aromatic rings, etc. Examples of the "condensed aromatic groups" include condensed polycyclic aromatic hydrocarbons, condensed polycyclic aromatic heterocyclic rings, etc.
Examples of the "condensed polycyclic aromatic hydrocarbons" include C9_19 condensed polycyclic (bicyclic or tricyclic) aromatic hydrocarbons (e. g. naphthalene, indene, fluorene, anthracene, etc.), etc.
Examples of the "condensed polycyclic aromatic heterocyclic rings" include 9- to 14-membered, preferably, 9- or 10-membered, condensed polycyclic aromatic heterocyclic rings containing one or more (for example, 1 to 4 atoms) hetero atoms selected from nitrogen, sulfur and oxygen atoms in addition to carbon atoms, and the like.
Specific examples of the "condensed polycyclic aromatic heterocyclic rings" include benzofuran, benzimidazole, benzoxazole, benzothiazole, benzisothiazole, naphtho[2,3-b]thiophene, isoquinoline, quinoline, indole, quinoxaline, phenanthridine, phenothiadine, phenoxazine, phthalazine, naphthyridine, quinazoline, cinnoline, carbazole, [3- carboline, acridine, phenazine, phthalimide, thioxanthene, etc.
Specific examples of the "condensed aromatic groups"
include 1-naphthyl; 2-naphthyl; 2-, 3-, 4-, 5- or 8-quinolyl; 1-, 3-, 4-, 5-, 6-, 7- or 8-isoquinolyl; 1-, 2-, 3-, 4-, 5-, 6- or 7-indolyl; 1-, 2-, 4- or 5-isoindolyl; 1-, 5- or 6-phthalazinyl; 2-, 3- or 5-quinoxalinyl; 2-, 3-, 4-, 5- or 6-benzofuranyl; 2-, 4-, 5- or 6-benzothiazolyl; 1-;
2-, 4-, 5- or 6-benzimidazolyl; etc.
The "ring assembly aromatic group" means a group formed by removing an optional one hydrogen atom from an aromatic ring assembly in which 2 or more (preferably 2 or 3) aromatic rings axe directly bonded by single bonds, and in which the number of bonds which directly bond the rings, is less by one than the number of ring systems.
Examples of the aromatic ring assembly include an aromatic ring assemblies formed by 2 or 3 (preferably 2) species selected from C6-19 monocyclic or condensed polycyclic aromatic hydrocarbons (e.g. benzene and naphthalene) and 5- to 10-membered (preferably 5 or 6 membered) aromatic heterocyclic rings, etc.
Preferred example of the aromatic ring assemblies include aromatic ring assembles comprising 2 or 3 aromatic rings selected from benzene, naphthalene, pyridine, pyrimidine, thiophene, furan, thiazole, isothiazole, oxazole, isoxazole, 1,2,4-oxadiazole, 1,3,4-oxadiazole, 1,2,4-thiadiazole, 1,3,4-thiadiazole, quinoline, isoquinoline, indole, benzothiophene, benzoxazole, benzothiazole and benzofuran.
Specific examples of the "ring assembly aromatic 5 groups" include 2-, 3- or 4-biphenylyl; 3-(1-naphthyl) 1,2,4-oxadiazol-5-yl; 3-(2-naphthyl)-1, 2, 4-oxadiazol-5 yl; 3-(2-benzofuranyl)-1,2,4-oxadiazol-5-yl; 3-phenyl 1,2,4-oxadiazol-5-yl; 3-(2-benzoxazolyl)-1,2,4-oxadiazol-5 yl; 3-(3-indolyl)-1,2,4-oxadiazol-5-yl; 3-(2-indolyl) 10 1,2,4-oxadiazol-5-yl; 4-phenylthiazol-2-yl; 4-(2-benzofuranyl)thiazol-2-yl; 4-phenyl-1,3-oxazol-5-yl; 5-phenyl-isothiazol-4-yl; 5-phenyloxazol-2-yl; 4-(2-thienyl)phenyl; 4-(3-thienyl)phenyl; 3-(3-pyridyl)phenyl;
4-(3-pyridyl)phenyl; 6-phenyl-3-pyridyl; 5-phenyl-1,3,4-15 oxadiazol-2-yl; 4-(2-naphthyl)phenyl; 4-(2-benzofuranyl)phenyl; 4,4'-terphenyl; 5-phenyl-2-pyridyl; 2-phenyl-5-pyrimidinyl; 4-(4-pyridyl)phenyl; 2-phenyl-1,3-oxazol-5-yl; 2,4-diphenyl-1,3-oxazol-5-yl; 3-phenyl-isoxazol-5-yl; 5-phenyl-2-furyl; 4-(2-furyl)phenyl; etc.
20 Preferred groups among the above "aromatic groups" are "a group formed by removing an optional one hydrogen atom from an aromatic ring assembly formed by 2 or 3 members selected from a C6_14 monocyclic or condensed polycyclic aromatic hydrocarbon and 5- to 10-membered aromatic 25 heterocyclic ring (preferably, 2-, 3- or 4-biphenylyl; 6-phenyl-3-pyridyl, 5-phenyl-2-pyridyl, etc.)".
Examples of the "non-aromatic cyclic hydrocarbon groups" include C3_g cycloalkyl, C3_8 cycloalkenyl, etc.
Here, specific examples of the C3_e cycloalkyl include cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, cycloheptyl, cyclooctyl. etc.
Specific examples of the C3_8 cycloalkenyl include cyclopropenyl, cyclobutenyl, cyclopentenyl, cyclohexenyl, cycloheptenyl, cyclooctenyl, etc.
Among the above "non-aromatic cyclic hydrocarbon groups", C3_e cycloalkyl is preferred, and cyclohexyl is particularly preferred.
Examples of "non-aromatic heterocyclic groups" include monocyclic non-aromatic heterocyclic groups, condensed polycyclic non-aromatic heterocyclic groups, and the like.
Examples of the "monocyclic non-aromatic heterocyclic groups" include univalent groups formed by removing an optional one hydrogen atom from monocyclic non-aromatic heterocyclic ring. Examples of the "monocyclic non-aromatic heterocyclic ring" include 5- to 8-membered monocyclic non-aromatic heterocyclic rings containing one or more (e. g. 1 to 3) hetero atoms selected from nitrogen, sulfur and oxygen atoms in addition to carbon atoms.
Specifically, tetrahydrothiophene, tetrahydrofuran, pyrrolidine, imidazoline, imidazolidine, pyrazoline, pyrazolidine, tetrahydrothiazole, tetrahydroisothiazole, tetrahydrooxazole, tetrahydroisoxazole, piperidine, tetrahydropyridine, dihydropyridine, piperazine, morpholine, thiomorpholine, tetrahydropyrimidine, tetrahydropyridazine, hexamethyleneimine, etc. can be mentioned.
The "condensed polycyclic non-aromatic heterocyclic group" means a univalent group formed by removing an optional one hydrogen atom from a condensed polycyclic (preferably bicyclic to tetracyclic, more preferably bicyclic or tricyclic) non-aromatic heterocyclic ring.
Examples of the "condensed polycyclic non-aromatic heterocyclic ring" include 9- to 14-membered, preferably 9-or 10-membered condensed polycyclic non-aromatic heterocyclic rings which contain one or more (e.g. 1 to 4) hetero atoms selected from nitrogen, sulfur and oxygen atoms in addition to carbon atoms. Specifically, dihydrobenzofuran, dihydrobenzimidazole, dihydrobenzoxazole, dihydrobenzothiazole, dihydrobenzisothiazole, dihydronaphtho[2,3-b~thiophene, tetrahydroisoquinoline, tetrahydroquinoline, indoline, isoindoline, tetrahydroquinoxaline, tetrahydrophenanthridine, hexahydrophenothiadine, hexahydrophenoxazine, tetrahydrophthaladine, tetrahydronaphthyridine, tetrahydroquinazoline, tetrahydrocinnoline, tetrahydrocarbazole, tetrahydro-~-carboline, tetrahydroacridine, tetrahydrophenazine, tetrahydrothioxantene, etc., can be mentioned.
Among the above "non-aromatic heterocyclic groups", "5- to 8-membered monocyclic non-aromatic heterocyclic groups (preferably piperidino; piperazinyl; pyrrolidinyl;
etc.)" are preferred.
Examples of the "substituent" in the "cyclic group which may be substituted" represented by R and Arl is preferably an aromatic group, more preferably a monocyclic aromatic group (preferably phenyl, pyrrolyl, etc.) or a ring assembly aromatic group (preferably biphenylyl, etc.).
Examples of the "substituent" in the "cyclic group which may be substituted" represented by R and Arl include oxo, halogen atoms (e. g. fluorine, chlorine, bromine, iodine, etc.), C1-3 alkylenedioxy (e. g. methylenedioxy, ethylenedioxy, etc.), nitro, cyano, optionally halogenated C1_6 alkyl, hydroxy-C1_6 alkyl, C6_14 aryloxy-C1_6 alkyl (e. g.
phenoxymethyl, etc. ) , C1_6 alkyl-C6-14 aryl-CZ_6 alkenyl (e. g.
methylphenylethenyl, etc.), optionally halogenated C3-6 cycloalkyl, optionally halogenated C1_6 alkoxy, optionally halogenated C1_6 alkylthio, C7_19 aralkyl which may be substituted, hydroxy, C6_14 aryloxy which may be substituted, C,_19 aralkyloxy which may be substituted, C6-14 aryl-carbamoyl which may be substituted, amino, amino-C1_6 alkyl (e. g. aminomethyl, aminoethyl, aminopropyl, aminobutyl, etc.), mono-C1_6 alkylamino (e. g. methylamino, ethylamino, propylamino, isopropylamino, butylamino, etc.), di-C1_6 alkylamino (e. g. dimethylamino, diethylamino, dipropylamino, dibutylamino, ethylmethylamino, etc.), mono-C1_6 alkylamino-C1_6 alkyl (e. g. methylaminomethyl, ethylaminomethyl, propylaminomethyl, isopropylaminoethyl, butylaminoethyl, etc. ) , di-C1_6 alkylamino-C1_6 alkyl (e.g.
dimethylaminomethyl, diethylaminomethyl, dipropylaminomethyl, diisopropylaminoethyl, dibutylaminoethyl, etc.), 5- to 7-membered saturated cyclic amino which may be substituted, 5- to 7-membered non-aromatic heterocyclic groups which may be substituted, acyl, acylamino, acyloxy, etc.
The "cyclic group" represented by R and Arl may have 1 to 5, preferably 1 to 3, of the above-mentioned substituents at a substitutable position on the cyclic group. When the number of substituents is 2 or more, each substituents can be the same or different.
Also, when the "cyclic group" represented by R and Arl is a non-aromatic cyclic hydrocarbon group or a non-aromatic heterocyclic group, the "cyclic group" may have as its substituent(s), C6_19 aryl which may be substituted, 5-to 10-membered aromatic heterocyclic groups which may be substituted, etc.
Here, the groups exemplified as the "substituent" in the "5- to 7-membered saturated cyclic amino which may be substituted" mentioned hereinafter, can be mentioned as "C6-19 aryl which may be substituted" and "5- to 10-membered aromatic heterocyclic groups which may be substituted".
5 The number of substituents is, for example, 1 to 3. When the number of substituents is 2 or more, each substituents can be the same or different.
Specific examples of the above "optionally halogenated C1-6 alkyl" include C1-6 alkyl (e.g. methyl, ethyl, propyl, 10 isopropyl, butyl, isobutyl, sec-butyl, tert-butyl, pentyl, hexyl, etc.) which may have 1 to 5, preferably 1 to 3, halogen atoms (e. g. fluorine, chlorine, bromine, iodine, etc.). Specific examples include methyl, chloromethyl, difluoromethyl, trichloromethyl, trifluoromethyl, ethyl, 2-15 bromoethyl, 2,2,2-trifluoroethyl, pentafluoroethyl, propyl, 3,3,3-trifluoropropyl, isopropyl, butyl, 4,4,4-trifluorobutyl, isobutyl, sec-butyl, tert-butyl, pentyl, isopentyl, neopentyl, 5,5,5-trifluoropentyl, hexyl, 6,6,6-trifluorohexyl, etc.
20 The C1_6 alkyl in the above "optionally halogenated C1_s alkyl" can be mentioned as the C1_6 alkyl in the above "hydroxy-C1_6 alkyl" .
Examples of the above "optionally halogenated C3_6 cycloalkyl" include C3_6 cycloalkyl (e. g. cyclopropyl, 25 cyclobutyl, cyclopentyl, cyclohexyl, etc.) which may have 1 to 5, preferably 1 to 3, halogen atoms (e. g. fluorine, chlorine, bromine, iodine, etc.). Specific examples include cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, 4,4-dichlorocyclohexyl, 2,2,3,3-tetrafluorocyclopentyl, 4 chlorocyclohexyl, etc.
Examples of the above "optionally halogenated C1_6 alkoxy" include C1_6 alkoxy (e. g. methoxy, ethoxy, propoxy, butoxy, pentyloxy, etc.) which may have 1 to 5, preferably 1 to 3, halogen atoms (e. g. fluorine, chlorine, bromine, iodine, etc.). Specific examples include methoxy, difluoromethoxy, trifluoromethoxy, ethoxy, 2,2,2-trifluoroethoxy, propoxy, isopropoxy, butoxy, 4,4,4-trifluorobutoxy, isobutoxy, sec-butoxy, pentyloxy, hexyloxy, etc.
Examples of the above "optionally halogenated C1_6 alkylthio" include C1_6 alkylthio (e. g. methylthio, ethylthio, propylthio, isopropylthio, butylthio, sec-butylthio, tert-butylthio, etc.) which may have 1 to 5, preferably 1 to 3, halogen atoms (e. g. fluorine, chlorine, bromine, iodine, etc.). Specific examples include methylthio, difluoromethylthio, trifluoromethylthio, ethylthio, propylthio, isopropylthio, butylthio, 4,4,4-trifluorobutylthio, pentylthio, hexylthio, etc.
Examples of the "C~_19 aralkyl" in the above "C,_19 aralkyl which may be substituted" include benzyl, phenethyl, diphenylmethyl, triphenylmethyl, 1-naphthylmethyl, 2-naphthylmethyl, 2,2-diphenylethyl, 3-phenylpropyl, 4-phenylbutyl, 5-phenylpentyl, etc. Benzyl is particularly preferred.
Examples of the "substituent" in the above "C,-19 aralkyl which may be substituted" include halogen atom (e. g.
fluorine, chlorine, bromine, iodine, etc.), C1-3 alkylenedioxy (e. g. methylenedioxy, ethylenedioxy, etc.), nitro, cyano, optionally halogenated C1_6 alkyl, optionally halogenated C3_6 cycloalkyl, optionally halogenated C1_s alkoxy, optionally halogenated C1_6 alkylthio, hydroxy, amino, mono-C1_6 alkylamino (e. g. methylamino, ethylamino, propylamino, isopropylamino, butylamino, etc.), di-C1-6 alkylamino (e. g. dimethylamino, diethylamino, dipropylamino, dibutylamino, ethylmethylamino, etc.), amino-C1_6 alkyl (e. g.
aminomethyl, aminoethyl, aminopropyl, aminobutyl, etc.), mono-C1-6 alkylamino-C1-6 alkyl (e. g. methylaminomethyl, ethylaminomethyl, propylaminomethyl, isopropylaminoethyl, butylaminoethyl, etc.), di-C1-6 alkylamino-C1-6 alkyl (e. g.
dimethylaminomethyl, diethylaminomethyl, dipropylaminomethyl, diisopropylaminoethyl, dibutylaminoethyl, etc.), formyl, carboxy, carbamoyl, thiocarbamoyl, optionally halogenated C1_6 alkyl-carbonyl, C1_6 alkoxy-carbonyl (e. g., methoxycarbonyl, ethoxycarbonyl, propoxycarbonyl, tert-butoxycarbonyl, etc.), mono-C1_6 alkyl-carbamoyl (e. g., methylcarbamoyl, ethylcarbamoyl, etc.), di-C1_6 alkyl-carbamoyl (e. g. dimethylcarbamoyl, diethylcarbamoyl, ethylmethylcarbamoyl, etc.), optionally halogenated C1_6 alkylsulfonyl, formylamino, optionally halogenated C1_6 alkyl-carboxamide, C1_6 alkoxy-carboxamide (e. g. methoxycarboxamide, ethoxycarboxamide, prpoxycarboxamide, butoxycarboxamide, etc.), C1-s alkylsulfonylamino (e. g. methylsulfonylamino, ethylsulfonylamino, etc.), C1_6 alkyl-carbonyloxy (e. g.
acetoxy, propanoyloxy, etc.), C1_6 alkoxy-carbonyloxy (e. g.
methoxycarbonyloxy, ethoxycarbonyloxy, propoxycarbonyloxy, butoxycarbonyloxy, etc.), mono-C1_6 alkyl-carbamoyloxy (e. g.
methylcarbamoyloxy, ethylcarbamoyloxy, etc.), di-C1_6 alkyl-carbamoyloxy (e. g. dimethylcarbamoyloxy, diethylcarbamoyloxy, etc.), hydroxy-C1_6 alkyl (e. g., hydroxyethyl, etc.), etc. The number of substituents is, for example, 1 to 5, preferably 1 to 3. When the number of substituents is 2 or more, each substituents can be the same or different.
As the "optionally halogenated C1_6 alkyl" , "optionally halogenated C3_6 cycloalkyl" , ° optionally halogenated C1_6 alkoxy" and "optionally halogenated C1_6 alkylthio", those exemplified as the "substituents" in the above "cyclic group which may be substituted" can be used, respectively.
Examples of the above "optionally halogenated C1_6 alkylcarbonyl" include C1_6 alkyl-carbonyl (e. g. acetyl, propanoyl, butanoyl, pentanoyl, hexanoyl, etc.) which may have 1 to 5, preferably 1 to 3, halogen atoms (e. g., fluorine, chlorine, bromine, iodine, etc.), etc. Specific examples include acetyl, monochloroacetyl, trifluoroacetyl, trichloroacetyl, propanoyl, butanoyl, pentanoyl, hexanoyl, etc.
Examples of the above "optionally halogenated C1_s alkylsulfonyl" include C1_6 alkylsulfonyl (e. g.
methylsulfonyl, ethylsulfonyl, propylsulfonyl, isopropylsulfonyl, butylsulfonyl, sec-butylsulfonyl, tert-butylsulfonyl, etc.) which may have 1 to 5, preferably 1 to 3, halogen atoms (e. g., fluorine, chlorine, bromine, iodine, etc.), etc. Specific examples include methylsulfonyl, difluoromethylsulfonyl, trifluoromethylsulfonyl, ethylsulfonyl, propylsulfonyl, isopropylsulfonyl, butylsulfonyl, 4,4,4-trifluorobutylsulfonyl, pentylsulfonyl, hexylsulfonyl, etc.
Examples of the above "optionally halogenated C1_6 alkyl-carboxamide" include C1_6 alkyl-carboxamide (e. g.
acetamide, propanamide, butanamide, etc.) which may have 1 to 5, preferably 1 to 3, halogen atoms (e. g. fluorine, chlorine, bromine, iodine, etc.), etc. Specific examples include acetamide, trifluoroacetamide, propanamide, butanamide, etc.

Examples of the "C6_14 aryloxy" in the above "Cs-19 aryloxy which may be substituted" include phenyloxy, 1-naphthyloxy, 2-naphthyloxy, etc.
Examples of the "C7_19 aralkyloxy" in the above "C,_19 5 aralkyloxy which may be substituted" include benzyloxy, phenethyloxy, diphenylmethyloxy, triphenylmethyloxy, 1 naphthylmethyloxy, 2-naphthylmethyloxy, 2,2 diphenylethyloxy, 3-phenylpropyloxy, 4-phenylbutyloxy, 5 phenylpentyloxy, etc.
10 Examples of the "C6_19 aryl-carbamoyl" in the above "C6_ 14 aryl-carbamoyl which may be substituted" include phenylcarbamoyl, 1-naphthylcarbamoyl, 2-naphthylcarbamoyl, etc.
As the "substituents" in the "C6_14 aryloxy which may 15 be substituted" , "C,_19 aralkyloxy which may be substituted"
and "C6_14 aryl-carbamoyl which may be substituted", those exemplified for the "substituents" in the above "C~-19 aralkyl which may be substituted" can be used. The number of substituents is, for example, 1 to 5, preferably 1 to 3.
20 When the number of substituents is 2 or more, each substituents can be the same or different.
Examples of the "5- to 7-membered saturated cyclic amino" in the above "5 to 7 membered saturated cyclic amino which may be substituted" include morpholino, 25 thiomorpholino, piperazin-1-yl, piperidino, pirrolidin-1-yl, etc. The "5- to 7-membered saturated cyclic amino" can be condensed with a benzene ring.
Examples of the "substituent" in the "5- to 7-membered saturated cyclic amino which may be substituted" include oxo, optionally halogenated C1_6 alkyl, optionally halogenated C1_6 alkyl-carbonyl, optionally halogenated C1_6 alkylsulfonyl, C6_19 aryl which may be substituted, C,_19 aralkyi which may be substituted, C6_19 aryl-carbonyl which may be substituted, 5- to 10-membered aromatic heterocyclic group which may be substituted, hydroxy, 5- to 8-membered monocyclic non-aromatic heterocyclic group (e. g., piperidinyl, piperazinyl, pyrrolidinyl, etc.), carbamoyl, hydroxy-C1_6 alkyl, C1_6 alkoxy-carbonyl-C1_6 alkyl (e. g.
ethoxycarbonylmethyl, etc.), C8_19 arylalkenyl (e. g., styryl, 3-phenyl-2-prop-2-enyl, etc.), C1_6 alkyl-carboxamide (e. g., methylcarboxamide, etc. ) , (N-C1_6 alkyl) -C1_6 alkyl-carboxamide (e. g., (N-ethyl)methylcarboxamide, etc.), amino, mono-C1_6 alkylamino (e. g., methylamino, ethylamino, propylamino, isopropylamino, butylamino, etc.), di-C1_6 alkylamino (e. g., dimethylamino, diethylamino, dipropylamino, dibutylamino, ethylmethylamino, etc.), 5- to 8-membered monocyclic non-aromatic heterocyclic group-C1_s alkyl (e. g., pyrrolidinylmethyl, etc.), C6_14 aryl-amino-C1_s alkyl (e.g., 2,6-dimethylphenylaminomethyl, etc.) which may be substituted with one to three C1_6 alkyl, etc. The number of substituents is, for example, 1 to 5, preferably 1 to 3. When the number of substituents is 2 or more, each substituents can be the same or different.
Here, as the "optionally halogenated C1_6 alkyl" and "C,_19 aralkyl which may be substituted", those exemplified as the "substituents" in the above "cyclic group which may be substituted" can be used, respectively.
Examples of the "optionally halogenated C1_6 alkyl carbonyl" and "optionally halogenated C1_6 alkylsulfonyl"
include those exemplified as the "substituents" in the above "C,_19 aralkyl which may be substituted".
Examples of the "C6_19 aryl" in the "C6_14 aryl which may be substituted" include phenyl, 1-naphthyl, 2-naphthyl, 2-indenyl, 2-anthryl, etc. Phenyl is especially preferable.
As the "substituents" in the "C6_14 aryl which may be substituted", those exemplified as the "substituents" in the above "C,_19 aralkyl which may be substituted" can be used. The number of substituents is, for example, 1 to 5, preferably 1 to 3. When the number of substituents is 2 or more, each substituents can be the same or different.
Examples of the "C6_14 aryl-carbonyl" in the "C6_14 aryl-carbonyl which may be substituted" include benzoyl, 1-naphthoyl, 2-naphthoyl, etc.
As the "substituents" in the "C6_14 aryl-carbonyl which may be substituted", those exemplified as "substituents" in the above "C~_19 aralkyl which may be substituted" can be used. The number of substituents is, for example, 1 to 5, preferably 1 to 3. When the number of substituents is 2 or more, each substituents can be the same or different.
Examples of the "5- to 10-membered aromatic heterocyclic groups" in the "5- to 10-membered aromatic heterocyclic groups which may be substituted" include 5- to 10-membered (monocyclic or bicyclic) aromatic heterocyclic groups containing 1 or 2 kinds of, preferably 1 to 4 hetero atoms selected from nitrogen, sulfur and oxygen atom in addition to carbon atoms. Specific examples include 2- or 3-thienyl; 2-, 3- or 4-pyridyl; 2- or 3-furyl; 2-, 4- or 5-thiazolyl; 2-, 4- or 5-oxazolyl; 1-, 3- or 4-pyrazolyl; 2-pyrazinyl; 2-, 4- or 5-pyrimidinyl; 1-, 2- or 3-pyrrolyl;
1-, 2- or 4-imidazolyl; 3- or 4-pyridazinyl; 3-isothiazolyl; 3-isoxazolyl; 1,2,4-oxadiazol-5-yl; 1,2,4-oxadiazol-3-yl; 2-, 3-, 4-, 5- or 8-quinolyl; 1-, 3-, 4-, 5-, 6-, 7- or 8-isoquinolyl; 1-, 2-, 3-, 4-, 5-, 6- or 7-indolyl; 1-, 2-, 4- or 5-isoindolyl; 1-, 5- or 6-phthalazinyl; 2-, 3- or 5-quinoxalinyl; 2-, 3-, 4-, 5- or 6-benzofuranyl; 2-, 4-, 5- or 6-benzothiazolyl; 1-, 2-, 4-, 5- or 6-benzimidazolyl, etc.
Examples of the "substituents" in the "5- to 10-membered aromatic heterocyclic groups which may be substituted" include halogen atom (e. g. fluorine, chlorine, bromine and iodine, etc.), C1_3 alkylenedioxy (e. g.
methylenedioxy, ethylenedioxy, etc.), nitro, cyano, optionally halogenated C1_6 alkyl, C6_19 aryloxy-C1_6 alkyl (e. g. phenoxymethyl, etc. ) , C1_6 alkyl-C6_19 aryl-C2_6 alkenyl (e. g. methylphenylethenyl, etc.), optionally halogenated C3_6 cycloalkyl, optionally halogenated C1_6 alkoxy, optionally halogenated C1_6 alkylthio, C,_19 aralkyl which may be substituted, hydroxy, C6_14 aryloxy which may be substituted, C,_19 aralkyloxy which may be substituted, amino, amino-C1_6 alkyl (e. g. aminomethyl, aminoethyl, aminopropyl, aminobutyl, etc.), mono-C1_6 alkylamino (e. g.
methylamino, ethylamino, propylamino, isopropylamino, butylamino, etc.), di-C1_6 alkylamino (e. g. dimethylamino, diethylamino, dipropylamino, dibutylamino, ethylmethylamino, etc.), mono-C1_6 alkylamino-C1_6 alkyl (e.g.
methylaminomethyl, ethylaminomethyl, propylaminomethyl, isopropylaminoethyl, butylaminoethyl, etc.), di-C1_s alkylamino-C1_6 alkyl (e. g. dimethylaminomethyl, diethylaminomethyl, dipropylaminomethyl, diisopropylaminoethyl, dibutylaminoethyl, etc.), 5- to 7-membered saturated cyclic amino, acyl, acylamino, acyloxy, etc. The number of substituents is, for example, 1 to 5, preferably 1 to 3. When the number of substituents is 2 or more, each substituents can be the same or different.
Here, as the "optionally halogenated C1_6 alkyl", "optionally halogenated C3_6 cycloalkyl", "optionally halogenated C1_6 alkoxy", "optionally halogenated C1-6 alkylthio" , "C,-19 aralkyl which may be substituted" , "C6-14 aryloxy which may be substituted", "C,_19 aralkyloxy which 5 may be substituted", those exemplified as the "substituents" in the above "cyclic group which may be substituted" can be used, respectively.
As the "5- to 7-membered saturated cyclic amino", those exemplified as "5-to 7-membered saturated cyclic 10 amino" regarding "5- to 7-membered saturated cyclic amino which may be substituted" which is the "substituent" in the above "cyclic amino which may be substituted" can be used.
Examples of the above "acyl" include acyl of the formulas : -CO-R3, -CO-OR3, -CO-NR3R4, -CS-NR3R', -SOz-R3a, -15 SO-R3a, -PO (-OR3) -OR4 or -P02-R3a wherein R3 is (i) hydrogen atom, (ii) a hydrocarbon group which may be substituted, or (iii) a heterocyclic group which may be substituted; R3a is (i) a hydrocarbon group which may be substituted, or (ii) a heterocyclic group which may be substituted; Rq is hydrogen 20 atom or C1-6 alkyl; R3 and R°, together with the adjacent nitrogen atom, may form a nitrogen-containing heterocyclic ring which may be substituted, and the like.
Examples of the "hydrocarbon group" in "hydrocarbon group which may be substituted" represented by R3 or R3a 25 include straight-chain or cyclic hydrocarbon groups (e. g.

alkyl, alkenyl, alkynyl, cycloalkyl, aryl, aralkyl, arylalkenyl, dihydroindene, etc.), etc. Among these, C1_19 straight-chain or cyclic hydrocarbon groups as shown below are preferred.
a) C1_6 alkyl (e.g. methyl, ethyl, propyl, isopropyl, butyl, isobutyl, sec-butyl, tert-butyl, pentyl, hexyl, etc.);
b) C2_6 alkenyl (e. g., vinyl, allyl, isopropenyl, 2-butenyl, etc.);
c) CZ_6 alkynyl (e. g. ethynyl, propargyl, 2-butynyl, etc.);
d) C3_6 cycloalkyl (e. g. cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, etc.); the C3_6 cycloalkyl may be condensed with one benzene ring;
e) C6_14 aryl (e.g. phenyl, 1-naphthyl, 2-naphthyl, 2-indenyl, 2-anthryl, etc.), preferably phenyl;
f) C~_19 aralkyl (e. g. benzyl, phenethyl, diphenylmethyl, triphenylmethyl, 1-naphthylmethyl, 2-naphthylmethyl, 2,2-diphenylethyl, 3-phenylpropyl, 4-phenylbutyl, 5-phenylpentyl, etc.), preferably benzyl, phenethyl, 3-phenylpropyl;
g) Ce_19 arylalkenyl (e. g., styryl, 3-phenyl-2-prop-2-enyl, etc.);
h) dihydroindene.
The "hydrocarbon groups" are preferably C1_6 alkyl, C6_ 14 aryl, C,_19 aralkyl, etc.
Examples of the "substituent" in the "hydrocarbon groups which may be substituted" include halogen atom (e. g.
fluorine, chlorine, bromine, iodine, etc.), C1-3 alkylenedioxy (e. g. methylenedioxy, ethylenedioxy, etc.), nitro, cyano, optionally halogenated C1_6 alkoxy, optionally halogenated C1_6 alkylthio, hydroxy, amino, mono-C1_s alkylamino (e. g. methylamino, ethylamino, propylamino, isopropylamino, butylamino, etc. ) , di- (C1_6 alkyl optionally substituted with hydroxy)amino (e. g. dimethylamino, diethylamino, dipropylamino, diisopropylamino, dibutylamino, ethylmethylamino, di(hydroxyethyl)amino, etc.), C6_19 aryl-amino which may be substituted with one to three C1-6 alkyl (e. g., phenylamino, 2,6-dimethylphenylamino, etc.), N-C1_s alkyl-N- (C6_14 aryl optionally substituted with C1-s alkyl)amino (e.g., N-methyl-N-phenylamino, N-ethyl-N-(methylphenyl)amino, etc.), 5- or 6-membered monocyclic aromatic heterocyclic ring amino optionally substituted with nitro (e.g., nitropyridylamino, etc.), 5- to 8-membered monocyclic non-aromatic heterocyclic group optionally substituted with oxo or C1_6 alkyl (e. g., tetrahydrofuryl, pyrrolidinyl, oxopyrrolidinyl, piperidinyl, methylpiperidinyl, morpholinyl, methylpiperazinyl, etc.), formyl, carboxy, carbamoyl, thiocarbamoyl, optionally halogenated C1_6 alkyl-carbonyl, C1_6 alkoxy-carbonyl (e. g., methoxycarbonyl, ethoxycarbonyl, propoxycarbonyl, tert-butoxycarbonyl, etc.), 5- to 10-membered aromatic heterocyclic groups which may be substituted, C6_19 aryl-carbonyl which may be substituted, C6_14 aryloxy-carbonyl which may be substituted, C7_19 aralkyloxy-carbonyl which may be substituted, 5- to 6-membered heterocyclic ring-s carbonyl which may be substituted, mono-C1_6 alkyl-carbamoyl (e. g. methylcarbamoyl, ethylcarbamoyl, etc.), di-C1_6 alkyl-carbamoyl (e. g. dimethylcarbamoyl, diethylcarbamoyl, ethylmethylcarbamoyl, etc.), C6_14 aryl-carbamoyl which may be substituted, 5- to 6-membered heterocyclic ring-carbamoyl which may be substituted, optionally halogenated C1_6 alkylsulfonyl, C6_lq arylsulfonyl which may be substituted, formylamino, optionally halogenated C1_6 alkyl-carboxamide, C1_6 alkoxy-carboxamide (e. g., methoxycarboxamide, ethoxycarboxamide, propoxycarboxamide, butoxycarboxamide, etc.), C1_6 alkylsulfonylamino (e. g., methylsulfonylamino, ethylsulfonylamino, etc.), C1_6 alkyl-carbonyloxy (e. g. acetoxy, propanoyloxy, etc.), C6_14 aryl-carbonyloxy which may be substituted, C1_6 alkoxy-carbonyloxy (e. g. methoxycarbonyloxy, ethoxycarbonyloxy, propoxycarbonyloxy, butoxycarbonyloxy, etc.), mono-C1_s alkyl-carbamoyloxy (e. g. methylcarbamoyloxy, ethylcarbamoyloxy, etc.), di-C1_6 alkyl-carbamoyloxy (e. g.
dimethylcarbamoyloxy, diethylcarbamoyloxy, etc.), C6-19 aryl-carbamoyloxy which may be substituted, nicotinoyloxy, etc. The number of substituents is, for example, 1 to 5, preferably 1 to 3. When the number of substituents is 2 or more, each substituents can be the same or different.
Here, as the "optionally halogenated C1_6 alkoxy", "optionally halogenated C1_6 alkylthio" and "C6-19 aryl-s carbamoyl which may be substituted", those exemplified as the "substituent" in the above "cyclic group which may be substituted" can be used, respectively.
As the "optionally halogenated C1_6 alkyl-carbonyl", "optionally halogenated C1-6 alkylsulfonyl" and "optionally halogenated C1-6 alkyl-carboxamide", those exemplified as the "substituent" in the above "C~_19 aralkyl which may be substituted" can be used, respectively.
As the above "5- to 10-membered aromatic heterocyclic groups which may be substituted" and "C6_19 aryl-carbonyl which may be substituted", those exemplified as the "substituent" in the above "5- to 7-membered saturated cyclic amino which may be substituted" can be used, respectively.
Examples of the "C6-14 aryloxy-carbonyl" in the "C6-19 aryloxy-carbonyl which may be substituted" include phenyloxycarbonyl, 1-naphthyloxycarbonyl, 2-naphthyloxycarbonyl, etc.
Examples of the "C,_19 aralkyloxy-carbonyl" in "C~-19 aralkyloxy-carbonyl which may be substituted" include benzyloxycarbonyl, phenethyloxycarbonyl, diphenylmethyloxycarbonyl, triphenylmethyloxycarbonyl, 1-naphthylmethyloxycarbonyl, 2-naphthylmethyloxycarbonyl, 2,2-diphenylethyloxycarbonyl, 3-phenylpropyloxycarbonyl, 4-phenylbutyloxycarbonyl, 5-phenylpentyloxycarbonyl, etc.
5 Examples of the "5- to 6-membered heterocyclic ring carbonyl" in the above "5- to 6-membered heterocyclic ring carbonyl which may be substituted" include nicotinoyl, isonicotinoyl, 2-thenoyl, 3-thenoyl, 2-furoyl, 3-furoyl, morpholinocarbonyl, pepiridinocarbonyl, pyrrolidin-1 10 ylcarbonyl, etc.
Examples of the "5- to 6-membered heterocyclic ring-carbamoyl" in the above "5- to 6-membered heterocyclic ring-carbamoyl which may be substituted" include morpholinocarbamoyl, pepiridinocarbamoyl, 2-15 pyridylcarbamoyl, 3-pyridylcarbamoyl, 4-pyridylcarbamoyl, 2-thienylcarbamoyl, 3-thienylcarbamoyl, etc.
Examples of the "C6_14 arylsulfonyl" in the above "C6_14 arylsulfonyl which may be substituted" include phenylsulfonyl, 1-naphthylsulfonyl, 2-naphthylsulfonyl, etc.
20 Examples of the "C6_14 aryl-carbonyloxy" in the above "Cs-14 aryl-carbonyloxy which may be substituted" include benzoyloxy, 1-naphthoyloxy, 2-naphthoyloxy, etc.
Examples of the "C6_19 aryl-carbamoyloxy" in the above "C6_19 aryl-carbamoyloxy which may be substituted" include 25 phenylcarbamoyloxy, naphthylcarbamoyloxy, etc.

As the "substituents" in the above "C6_14 aryloxy-carbonyl which may be substituted" , "C,_19 aralkyloxy-carbonyl which may be substituted", "5- to 6-membered heterocyclic ring-carbonyl which may be substituted", "5-to 6-membered heterocyclic ring-carbamoyl which may be substituted" , "C6_14 arylsulfonyl which may be substituted" , "C6_19 aryl-carbonyloxy which may be substituted" and "C6_19 aryl-carbamoyloxy which may be substituted", those exemplified as the "substituents" in the above "C~_19 aralkyl which may be substituted" can be mentioned. The number of the substituents is, for example, 1 to 5, preferably 1 to 3. When the number of substituents is 2 or more, each substituents can be the same or different.
Examples of the "heterocyclic groups" in the "heterocyclic groups which may be substituted" represented by R3 or R3a include a 5- to 14-membered (monocyclic, bicyclic or tricyclic) heterocyclic ring containing 1 or 2 kinds of, 1 to 4 hetero atoms selected from nitrogen, sulfur and oxygen atom in addition to carbon atoms.
Preferably, univalent groups formed by removing an optional one hydrogen atom from (i) an aromatic heterocyclic ring, (ii) a 5- to 10-membered non-aromatic heterocyclic ring, or (iii) a 7- to 10-membered heterocyclic-bridge ring, etc., can be mentioned.
Here, examples of the "aromatic heterocyclic ring"

include a 5- to 14-membered, preferably 5- to 10-membered, aromatic heterocyclic ring containing one or more hetero atoms (e.g. 1 to 4) selected from nitrogen, sulfur and oxygen atoms in addition to carbon atoms. Specific examples include aromatic heterocyclic rings such as thiophene, furan, pyrrole, imidazole, pyrazole, thiazole, isothiazole, oxazole, isoxazole, pyridine, pyrazine, pyrimidine, pyridazine, 1,2,4-oxadiazole, 1,3,4-oxadiazole, 1,2,4-thiadiazole, 1,3,4-thiadiazole, furazan, benzothiophene, benzofuran, benzimidazole, benzoxazole, benzothiazole, benzisothiazole, naphtho[2,3-b]thiophene, phenoxathiin, indole, isoindole, 1H-indazole, purine, 4H-quinolidine, isoquinoline, quinoline, phthalazine, naphthyridine, quinoxaline, quinazoline, cinnoline, carbazole, ~-carboline, phenanthridine, acridine, phenazinephenothiadine, phenoxazine, phthalimide, etc.; or a ring formed by condensing these rings (preferably monocyclic rings) with one to multiple (preferably 1 or 2) aromatic rings (e. g. benzene ring, etc.), etc.
Examples of "5- to 10-membered non-aromatic heterocyclic rings" include 2- or 3-pyrroline, pyrrolidine, 2- or 3-imidazoline, 2-oxazoline, oxazolidine, 2- or 3 pyrazoline, pyrazolidine, 2-thiazoline, piperidine, piperazine, hexamethylenimine, morpholine, thiomorpholine, etc.

Examples of "7- to 10-membered heterocyclic-bridge rings" include quinuclidine, 7-azabicyclo[2.2.1]heptane, etc.
The "heterocyclic groups" are preferably 5- to 10-membered (monocyclic or bicyclic) heterocyclic groups containing 1 or 2 kinds of, preferably 1 to 4, hetero atoms selected from nitrogen, sulfur and oxygen atoms in addition to carbon atoms. Specific examples include aromatic heterocyclic groups such as 2- or 3-thienyl; 2-, 3- or 4-pyridyl; 2- or 3-furyl; 2-, 4- or 5-thiazolyl; 2-, 4- or 5-oxazolyl; 1-, 3- or 4-pyrazolyl; 2-pyrazinyl; 2-, 4- or 5-pyrimidinyl; 1-, 2- or 3-pyrrolyl; 1-, 2- or 4-imidazolyl;
3- or 4-pyridazinyl; 3-isothiazolyl; 3-isoxazolyl; 1,2,4-oxadiazol-5-yl; 1,2,4-oxadiazol-3-yl; 2-, 3-, 4-, 5- or 8-quinolyl; 1-, 3-, 4-, 5-, 6-, 7- or 8-isoquinolyl; 1-, 2-, 3-, 4-, 5-, 6- or 7-indolyl; 1-, 2-, 4- or 5-isoindolyl; 1-, 5- or 6-phthalazinyl; 2-, 3- or 5-quinoxalinyl; 2-, 3-, 4-, 5- or 6-benzofuranyl; 2-, 3-, 4-, 5- or 6-benzothienyl; 2-, 4-, 5- or 6-benzothiazolyl; 1-, 2-, 4-, 5- or 6-benzimidazolyl; etc.; and non-aromatic heterocyclic groups such as 1-, 2- or 3-pyrrolidinyl; 1-, 2-, 4- or 5-imidazolidinyl; 2- or 4-imidazolinyl; 2-, 3- or 4-pyrazolidinyl; piperidino; 2-, 3- or 4-piperidyl; 1- or 2-piperazinyl; morpholino; etc.
As the "substituents" in the "heterocyclic groups which may be substituted", those exemplified as the "substituents" in the above "5- to 10-membered aromatic heterocyclic groups which may be substituted" can be used.
The number of substituents is, for example, 1 to 5, preferably 1 to 3. When the number of substituents is 2 or more, each substituents can be the same or different.
Examples of the "C1_6 alkyl" represented by R4 include methyl, ethyl, propyl, isopropyl, butyl, isobutyl, sec-butyl, tert-butyl, pentyl, hexyl, etc.
Examples of the "nitrogen-containing heterocyclic ring" in the "nitrogen-containing heterocyclic ring which may be substituted" formed by R3 and R9 together with the adjacent nitrogen atom include a 5- to 7-membered nitrogen-containing heterocyclic ring which contains at least one nitrogen atom in addition to carbon atoms and may contain 1 to 3 hetero atoms selected from nitrogen, sulfur and oxygen atoms. The "nitrogen-containing heterocyclic rings" are preferably piperidine, morpholine, thiomorpholine, piperazine, pyrrolidine, etc.
As the "substituents" in the "nitrogen-containing heterocyclic ring which may be substituted", those exemplified as the "substituents" in the above "5- to 10-membered aromatic heterocyclic groups which may be substituted" can be used. The number of substituents is, for example, 1 to 5, preferably 1 to 3. When the number of substituents is 2 or more, each substituents can be the same or different.
The "acyl" is preferably formyl, carboxy, carbamoyl, optionally halogenated C1_6 alkyl-carbonyl (e. g. acetyl, 5 etc.), C1_6 alkoxy-carbonyl (e. g. methoxycarbonyl, ethoxycarbonyl, propoxycarbonyl, tert-butoxycarbonyl, etc.), C6_19 aryl-carbonyl which may be substituted (e. g. benzoyl, 1-naphthoyl, 2-naphthoyl, etc.), C6_19 aryloxy-carbonyl which may be substituted (e.g. phenyloxycarbonyl, 1-10 naphthyloxycarbonyl, 2-naphthyloxycarbonyl, etc.), C,_19 aralkyloxy-carbonyl which may be substituted (e. g.
benzyloxycarbonyl, phenethyloxycarbonyl, etc.), a 5- to 6-membered heterocyclic ring-carbonyl which may be substituted (e. g. nicotinoyl, etc.), mono-C1_6 alkyl-15 carbamoyl (e.g. methylcarbamoyl, ethylcarbamoyl, etc.), di-C1_6 alkyl-carbamoyl (e. g. dimethylcarbamoyl, diethylcarbamoyl, ethylmethylcarbamoyl, etc.), C6_14 aryl-carbamoyl which may be substituted (e. g. phenylcarbamoyl, 4-methoxyphenylcarbamoyl, 3,4-dimethoxyphenylcarbamoyl, 20 etc.), aromatic heterocyclic ring-carbamoyl which may be substituted (e.g. 2-pyridinylcarbamoyl, 2 quinolinylcarbamoyl etc.), optionally halogenated C1-s alkylsulfonyl (e.g. methylsulfonyl, etc.), Cs-19 arylsulfonyl which may be substituted (e. g. phenylsulfonyl 25 etc.), etc.

Here, as the "optionally halogenated C1_6 alkyl-carbonyl" and "optionally halogenated C1_6 alkylsulfonyl", those exemplified as the "substituents" in the above "C~_19 aralkyl which may be substituted" can be used, respectively.
As the "C6_14 aryl-carbonyl which may be substituted" , those exemplified as the "substituents" in the above "5- to 7-membered saturated cyclic amino which may be substituted"
can be used.
As the "C6_14 aryloxy-carbonyl which may be substituted", "C7_19 aralkyloxy-carbonyl which may be substituted", "5- to 6-membered heterocyclic ring-carbonyl which may be substituted", "aromatic heterocyclic ring carbamoyl which may be substituted" and "C6_19 arylsulfonyl which may be substituted", those exemplified as the "substituents" in the above "hydrocarbon groups which may be substituted" can be used, respectively.
As the "C6_19 aryl-carbamoyl which may be substituted", those exemplified as the "substituents" in the above "cyclic group which may be substituted" can be used.
Examples of the above "acylamino" include amino which is substituted by 1 or 2 of the above "acyl". Preferably, acylamino of the formulas: -NRS-CORE, -NR5-COOR6a, -NRS-SOZR6a, -NR5-CONR6aRsb, _p0 (-OR5) -OR6, or -PO2-R6 wherein RS is hydrogen atom or C1_6 alkyl; R6 is as defined with respect to the above R3; R6a is as defined with respect to the above R3a; and R6b is as defined with respect to R°] , etc. , can be mentioned.
As the "C1_6 alkyl" represented by R5, the same one as the "C1_6 alkyl" for the above R4 can be mentioned.
The "acylamino" is preferably formylamino, optionally halogenated C1_6 alkyl-carboxamide (e. g. methylcarboxamide, trifluoromethylcarboxamide, etc.), C6-14 aryl-carboxamide which may be substituted (e.g. phenylcarboxamide, 2-methoxyphenylcarboxamide, 4-methoxyphenylcarboxamide, etc.), N- (C6_lq aryl-carbonyl which may be substituted) -N-C1_s alkylamino (e. g. N-4-methoxybenzoyl-N-methylamino, etc.), C~_19 aralkyl-carboxamide which may be substituted (e. g.
benzylcarboxamide, etc.), aromatic heterocyclic ring-carboxamide which may be substituted (e.g. benzothiophen-2-ylcarboxamide, etc.), optionally halogenated C1_6 alkoxy-carboxamide (e. g. methoxycarboxamide, ethoxycarboxamide, propoxycarboxamide, butoxycarboxamide, etc.), Cs_14 arylamino-carbonylamino which may be substituted (e. g.
phenylaminocarbonylamino, etc.), optionally halogenated C1_s alkylsulfonylamino (e. g. methylsulfonylamino, trifluoromethylsulfonylamino, ethylsulfonylamino, etc.), C6_14 arylsulfonylamino which may be substituted (e.g. 4-methoxyphenylsulfonylamino, etc.), etc.
Here, as the "substituents" in the "C6_14 aryl-carboxamide which may be substituted" , "N- (C6_14 aryl-carbonyl which may be substituted) -N-C1_6 arylkylamino" , "C,_ 19 aralkyl-carboxamide which may be substituted", "aromatic heterocyclic ring-carboxamide which may be substituted", "C6_19 arylamino-carbonylamino which may be substituted" and "C6_14 arylsulfonylamino which may be substituted", those exemplified as the "substituents" in the above "C~_ls aralkyl which may be subsituted" can be mentioned. The number of substituents is, for example, 1 to 5, preferably 1 to 3. When the number of substituents is 2 or more, each substituents can be the same or different.
Examples of the above "acyloxy" include oxy substituted by one of the above "acyl". Preferably, acyloxy of the formulas : -0-COR', -0-COOR', -0-CONHR', PO (OH) -OR' or -POZ-R' wherein R' is as defined with respect to the above R3, etc., can be mentioned.
The "acyloxy" is preferably optionally halogenated C1_s alkyl-carbonyloxy (e. g. acetoxy, propanoyloxy, etc.), C6_19 aryl-carbonyloxy which may be substituted (e. g. benzoyloxy, 4-methoxybenzoyloxy, etc.), optionally halogenated C1_6 alkoxy-carbonyloxy (e. g. methoxycarbonyloxy, trifluoromethoxycarbonyloxy, ethoxycarbonyloxy, propoxycarbonyloxy, butoxycarbonyloxy, etc.), mono-C1_6 alkyl-carbamoyloxy (e. g. methylcarbamoyloxy, ethylcarbamoyloxy, etc.), di-C1_6 alkyl-carbamoyloxy (e. g.
dimethylcarbamoyloxy, diethylcarbamoyloxy, etc.), C6-19 aryl-carbamoyloxy which may be substituted (e. g.
phenylcarbamoyloxy, naphthylcarbamoyloxy, etc.), nicotinoyloxy, etc.
As the "substituents" in "C6_14 aryl-carbonyloxy which may be substituted" and "C6_19 aryl-carbamoyloxy which may be substituted", those exemplified as the "substituents" in the above "C~-19 aralkyl which may be substituted" can be mentioned. The number of substituents is, for example, 1 to 5, preferably 1 to 3. When the number of substituents is 2 or more, each substituents can be the same or different.
Examples of the "5- to 7-membered non-aromatic heterocyclic groups" in the "5- to 7-membered non-aromatic heterocyclic groups which may be substituted" which is the "substituents" in "cyclic group which may be substituted"
represented by R and Arl, include 4,5-dihydro-1,3-oxazol-2-yl, 4,5-dihydro-1,3-thiazol-2-yl, 4,5-dihydro-1H-2-imidazolyl, etc. As the "substituents" in the "5- to 7-membered non-aromatic heterocyclic groups which may be substituted", those exemplified as the "substituents" in the above "5- to 7-membered saturated cyclic amino which may be substituted" can be used.
As the "acyl" , "acyloxy" and "acylamino" , which are the "substituents" in the "cyclic group which may be substituted" represented by R and Arl, those exemplified as the "substituents" in the above "5- to 10-membered aromatic heterocyclic groups which may be substituted" can be used.
The "substituents" in the "cyclic group which may be substituted" for R and Arl are preferably a halogen atom 5 (preferably fluorine, chlorine and bromine, etc.); nitro;
C1_3 alkylenedioxy (preferably methylenedioxy, etc.);
optionally halogenated C1_6 alkyl (preferably, methyl, ethyl, propyl, trifluoromethyl, tert-butyl, etc.); hydroxy-C1_6 alkyl (preferably hydroxymethyl, etc.): optionally 10 halogenated C3_6 cycloalkyl (preferably cyclohexyl, etc.);
optionally halogenated C1_6 alkoxy (preferably methoxy, ethoxy, etc.); optionally halogenated C1_6 alkylthio (preferably methylthio, etc.); hydroxy; C,_19 aralkyloxy which may be substituted (preferably benzyloxy, 4-15 methoxybenzyloxy, 3-methoxybenzyloxy, 4-fluorobenzyloxy, 4-methylthiobenzyloxy, 4-ethylbenzyloxy, etc.); Cs-14 aryloxy which may be substituted (preferably phenyloxy, etc.);
amino; mono-C1_6 alkylamino (preferably methylamino, etc.);
di-C1_6 alkylamino (preferably dimethylamino, etc.); 5- to 20 7-membered saturated cyclic amino which may be substituted and may be condensed with a benzene ring (preferably 1,3-dioxo-1,3-dihydro-2H-isoindol-2-yl, etc.); 5- to 7-membered non-aromatic heterocyclic groups which may be substituted (preferably 4,5-dihydro-1,3-oxazol-2-yl, etc.); formyl;
25 carboxy; C6_19 aryl-carbonyl which may be substituted (preferably benzoyl, etc.); C6_14 aryl-carbamoyl which may be substituted (preferably, phenylcarbamoyl, 4-methoxyphenylcarbamoyl, 3,4-dimethoxyphenylcarbamoyl, etc.); aromatic heterocyclic ring-carbamoyl which may be substituted (preferably 2-pyridinylcarbamoyl, 2-quinolinylcarbamoyl, etc.); C1_6 alkoxy-carbonyl (preferably methoxycarbonyl, ethoxycarbonyl, etc.); optionally halogenated C1_6 alkyl-carboxamide (preferably methylcarboxamide, trifluoromethylcarboxamide, etc.); C6_1q aryl-carboxamide which may be substituted (preferably phenylcarboxamide, 2-methoxyphenylcarboxamide, 4-methoxyphenylcarboxamide, etc.); C7-19 aralkyl-carboxamide which may be substituted (preferably benzylcarboxamide, etc.): aromatic heterocyclic ring-carboxamide which may be substituted (preferably benzothiophen-2-ylcarboxamide, etc. ) ; N- (C6_19 aryl-carbonyl which may be substituted) -N-C1_ 6 alkylamino (preferably N-4-methoxybenzoyl-N-methylamino, etc.); C6_lq arylamino-carbonylamino which may be substituted (preferably phenylaminocarbonylamino, etc.);
2O C6_19 arylsulfonylamino which may be substituted (preferably 4-methoxyphenylsulfonylamino, etc.); C6-14 aryl-carbonyloxy which may be substituted (preferably 4-methoxybenzoyloxy, etc.); oxo; etc.
When the "cyclic group" in the "cyclic group which may be substituted" represented by R and Arl is a non-aromatic cyclic hydrocarbon group or a non-aromatic heterocyclic group, C6_14 aryl which may be substituted (preferably phenyl). etc., can be used as a preferred substituent.
More preferably, the "substituent" of the "cyclic group which may be substituted" represented by R and Arl is a halogen atom (preferably chlorine, etc.), C1_6 alkyl (preferably methyl, etc.), C,_19 aralkyloxy which may be substituted with C1_6 alkoxy (preferably methoxybenzyloxy, etc.), etc.
R and Arl are preferably phenyl, biphenylyl (preferably 4-biphenylyl), phenyl-pyridyl (preferably 6-phenyl-3-pyridyl, 5-phenyl-2-pyridyl), phenyl-furyl (preferably 5-phenyl-2-furyl), phenyl-isoxazole (preferably 3-phenyl-isoxazol-5-yl), diphenyl-oxazole (preferably 2,4-diphenyl-1,3-oxazol-5-yl), pyridyl-phenyl (preferably 4-(4-pyridyl)phenyl), phenyl-pyrimidinyl (preferably 2-phenyl-5-pyrimidinyl), benzofuranyl-phenyl (preferably 4-(2-benzofuranyl)phenyl), furyl-phenyl (preferably 4-(2-furyl)phenyl), pyrrolyl (preferably 1-pyrrolyl) or naphthyl; each of which may have 1 or 2 substituents selected from the group consisting of a halogen atom (preferably fluorine, chlorine and bromine, etc.); nitro;
C1_3 alkylenedioxy (preferably methylenedioxy, etc.):
optionally halogenated C1_6 alkyl (preferably, methyl, ethyl, propyl, trifluoromethyl, tert-butyl, etc.); hydroxy-C1_6 alkyl (preferably hydroxymethyl, etc.); optionally halogenated C3_6 cycloalkyl (preferably cyclohexyl, etc.);
optionally halogenated C1-6 alkoxy (preferably methoxy, ethoxy, etc.); optionally halogenated C1-6 alkylthio (preferably methylthio, etc.); hydroxy; C~-19 aralkyloxy which may be substituted (preferably benzyloxy, 4-methoxybenzyloxy, 3-methoxybenzyloxy, 4-fluorobenzyloxy, 4-methylthiobenzyloxy, 4-ethylbenzyloxy, etc.): C6-14 aryloxy which may be substituted (preferably phenyloxy, etc.);
amino; mono-C1-6 alkylamino (preferably methylamino, etc.);
di-C1_6 alkylamino (preferably dimethylamino, etc.); 5- to 7-membered saturated cyclic amino which may be substituted and may be condensed with a benzene ring (preferably 1,3-dioxo-1,3-dihydro-2H-isoindol-2-yl, etc.); 5- to 7-membered non-aromatic heterocyclic groups which may be substituted (preferably 4,5-dihydro-1,3-oxazol-2-yl, etc.); formyl;
carboxy; C6_14 aryl-carbonyl which may be substituted (preferably benzoyl, etc.); C6-19 aryl-carbamoyl which may be substituted (preferably, phenylcarbamoyl, 4-methoxyphenylcarbamoyl, 3,4-dimethoxyphenylcarbamoyl, etc.); aromatic heterocyclic ring-carbamoyl which may be substituted (preferably 2-pyridinylcarbamoyl, 2-quinolinylcarbamoyl, etc.); C1_6 alkoxy-carbonyl (preferably methoxycarbonyl, ethoxycarbonyl, etc.); optionally halogenated C1_6 alkyl-carboxamide (preferably methylcarboxamide, trifluoromethylcarboxamide, etc.): C6-19 aryl-carboxamide which may be substituted (preferably phenylcarboxamide, 2-methoxyphenylcarboxamide, 4-methoxyphenylcarboxamide, etc.); C,_14 aralkyl-carboxamide which may be substituted (preferably benzylcarboxamide, etc.); aromatic heterocyclic ring-carboxamide which may be substituted (preferably benzothiophen-2-ylcarboxamide, etc. ) ; N- (C6_14 aryl-carbonyl which may be substituted) -N-C1_ 6 alkylamino (preferably N-4-methoxybenzoyl-N-methylamino, etc.); C6_lq arylamino-carbonylamino which may be substituted (preferably phenylaminocarbonylamino, etc.);
C6_lq arylsulfonylamino which may be substituted (preferably 4-methoxyphenylsulfonylamino, etc.)~ C6_14 aryl-carbonyloxy which may be substituted (preferably 4-methoxybenzoyloxy, etc. ) ~ oxo~ etc.
Further, preferred examples of R and Arl include piperidino, piperazinyl, pyrrolidinyl, etc.; each of which may have 1 or 2 substituents selected from the group consisting of oxo and C6_1q aryl which may be substituted (preferably phenyl).
Examples of the halogen atom represented by R include fluorine, chlorine, bromine, iodine, etc. Among them, fluorine is preferred.
The "spacer having a main chain of 1 to 10 atoms"
represented by X means a space in which 1 to 10 atoms are linked. Here, the "number of atoms in the main chain" is counted so that the number of atoms in the main chain is minimum. For example, the number of atoms of 1,2 cyclopentylene is counted as 2, and the number of atoms of 5 1,3-cyclopentylene is counted as 3.
Examples of the "spacer having a main chain of 1 to 10 atoms" include a bivalent group consisting of 1 to 5 members selected from -0-, -S-, -CO-, -SO-, -SOZ-, -NRg-(R$ is hydrogen atom, optionally halogenated C1_6 alkyl, 10 optionally halogenated C1_6 alkyl-carbonyl, optionally halogenated Cl_6 alkylsulfonyl), bivalent C1_6 non-cyclic hydrocarbon groups which may be substituted, and bivalent CS_e monocyclic non-aromatic hydrocarbon groups, and the like.
15 Here, as the "optionally halogenated C1_6 alkyl" , those exemplified as the "substituents" in the above "cyclic group which may be substituted" can be used.
As the "optionally halogenated C1_6 alkyl-carbonyl" and "optionally halogenated C1_6 alkylsulfonyl", those 20 exemplified as the "substituents" in the above "C~_19 aralkyl which may be substituted" can be used, respectively.
Examples of the "bivalent C1_6 non-cyclic hydrocarbon groups" in the "bivalent Cl_6 non-cyclic hydrocarbon groups which may be substituted" include 2 5 ( 1 ) C1_6 al kylene ( a . g . -CH2-, - ( CHZ ) 2-, - ( CHZ ) 3-, - ( CHZ
) 4-, -( CHZ ) 5-, - ( CHz ) 6-, -CH ( CH3 ) -, -C ( CH3 ) 2-, -CHZ-CH ( CH3 ) -, -( CH ( CH3 ) ) 2-. - ( CHz ) ZC ( CH3 ) 2-, - ( CH2 ) 3C ( CH3 ) z-, etc . ) ;
(2) CZ_6 alkenylene (e.g. -CH=CH-, -CHZ-CH=CH-, -CH=CH-CHz-, -CH=CH-CHZ-CHZ-, -CHZ-CF=CH-, -C (CH3) ~-CH=CH-, -CHZ-CH=CH
CHZ-, -CHZ-CHZ-CH=CH-, -CH=CH-CH=CH-, -CH=CH-CHZ-CHZ-CHz-, etc.);
( 3 ) C2_6 alkynylene ( a . g . -C = C-, -CHZ-C = C-, -C = C-CH2-, -CHz-C=C-CHz-CH2-, etc. ) ~ etc.
Examples of the "substituent" in the "bivalent C1_s non-cyclic hydrocarbon groups which may be substituted"
include halogen atom (e. g., fluorine, chlorine, bromine, iodine, etc.), hydroxy, nitro, cyano, optionally halogenated C1_6 alkoxy, optionally halogenated C1_6 alkylthio, amino, mono-C1_6 alkylamino (e. g., methylamino, ethylamino, propylamino, isopropylamino, butylamino, etc.), di-C1_6 alkylamino (e. g., dimethylamino, diethylamino, dipropylamino, dibutylamino, ethylmethylamino, etc.), formyl, carboxy, carbamoyl, thiocarbamoyl, optionally halogenated C1_6 alkyl-carbonyl, C1_6 alkoxy-carbonyl (e. g., methoxycarbonyl, ethoxycarbonyl, propoxycarbonyl, tert-butoxycarbonyl, etc.), optionally halogenated C1_6 alkylsulfonyl, etc. The number of substituents is, for example, 1 to 5, preferably 1 to 3.
Here, as the "optionally halogenated C1_6 alkoxy" and "optionally halogenated C1_6 alkylthio", those exemplified as the "substituent" in the above "cyclic group which may be substituted" can be used, respectively.
As the "optionally halogenated C~-6 alkyl-carbonyl" and "optionally halogenated C1_6 alkylsulfonyl", those exemplified as the "substituent" in the above "C,_19 aralkyl which may be substituted" can be used.
Preferably, the "substituent" in the "bivalent C1-s non-aromatic hydrocarbon group which may be substituted" is a halogen atom (e. g., fluorine, chlorine, bromine, iodine, etc.), hydroxy, etc.
As the "bivalent CS-$ monocyclic non-aromatic hydrocarbon groups", for example, bivalent groups formed by removing an optional two hydrogen atoms from CS_$
cycloalkane or CS_e cycloalkene, can be mentioned. Specific examples include 1,2-cyclopentylene; 1,3-cyclopentylene;
1,2-cyclohexylene; 1,3-cyclohexylene; 1,4-cyclohexylene;
1,2-cycloheptylene; 1,3-cycloheptylene; 1,4-cycloheptylene;
3-cyclohexen-1,4-ylene; 3-cyclohexen-1,2-ylene; 2,5-cyclohexadien-1,4-ylene, etc. Especially, CS_8 cycloalkylene is preferable.
As the "spacer having a main chain of 1 to 6 atoms"
represented by Y, among the above "spacer having a main chain of 1 to 10 atoms" represented by X, that whose main chain has 1 to 6 atoms can be mentioned.

The "spacer" represented by X and Y is preferably the "spacer having a main chain of 1 to 6 atoms", more preferably a bivalent group consisting of 1 to 3 members selected from -0-, -S-, -CO-, -SO-, -SOz-, -NR8- (R$ is as defined above) and bivalent C1_6 non-cyclic hydrocarbon group which may be substituted.
Preferred examples of the "spacer having a main chain of 1 to 6 atoms" include ( 1 ) C1_6 al kylene ( a . g . -CHz-, - ( CHz ) z-, - ( CHz ) 3-, -CH ( OH ) -( CHz ) z-, - ( CHz ) 4-, - ( CHz ) 5-, - ( CHz ) 6-, -CHCH3-, -C ( CH3 ) z-, -CHz-CH (CH3) -, -CH (CF3) -, - (CH (CH3) ) z-, - (CFz) z-, - (CHz) zC (CH3) z-, -(CHz) 3C (CH3) z-, etc. ) which may be substituted (preferably with halogen atom, hydroxy, etc.);
( 2 ) Cz_6 al kenylene ( a . g . -CH=CH-, -CHz-CH=CH-, -GH=CH-CHz-, -CH=CH-CHz-CHz-, -CHz-CF=CH-, -C ( CH3 ) z-CH=CH-, -CHz-CH=CH
CHz-, -CHz-CHz-CH=CH-, -CH=CH-CH=CH-, -CH=CH-CHz-CHz-CHz-, etc.) which may be substituted (preferably with halogen atom, hydroxy, etc.);
( 3 ) Cz_6 alkynylene ( a . g . -C = C-, -CHz-C = C-, -C = C-CHz-, CHz-C - C-CHz-CHz-, etc. ) which may be substituted (preferably with halogen atom, hydroxy, etc.);
( 4 ) - ( CHz ) Wi0 ( CHz ) Wz-. - ( CHz ) W1S ( CHz ) wz-.
- ( CHz ) W1C0 ( CHz ) Wz-, - ( CHz ) W1S0 ( CHz ) Wz-, - ( CHz ) WlSOz ( CHz ) Wz-, - ( CHz ) WlNRg ( CHz ) Wz-;
2 5 ( 5 ) - ( CHz ) w3C0-, - ( CHz ) w3CONR8 ( CH ) - ( CH ) NReCO CH
z W4-. z W3 ( z ) W4-.

- ( CHz ) w3SOzNRB ( CHz ) W~-, - ( CHz ) W3NRBSOz ( CHz ) W9-.
- ( CHz ) W3C00 ( CHz ) W~- ;
( 6 ) - ( CHz ) WSNReCO-, - ( CHz ) WsNR$CONReb ( CHz ) Ws-, - ( CHz ) WsCH=CH ( CHz ) WsCO-;
( 7 ) -0 ( CHZ ) w~CO-, -CO ( CHz ) W~CO-, -S ( CHz ) W~CO-, -SO ( CHz ) W~CO-, -SOz ( CHz ) W~CO-, -NR8 ( CHz ) W~CO-, -COCH=CHCO-;
( 8 ) -NR$CO ( CHz ) W8C0-, -CONRa ( CHz ) WeCO-;
wherein R$ is as defined above; Reb is as defined with respect to Re; w1 and w2 is an integer of 0 to 5, and w1 +
w2 is 0 to 5; w3 and w4 is an integer of 0 to 4, and w3 +
w4 is 0 to 4; w5 and w6 is an integer of 0 to 3, and w5 +
w6 is 0 to 3; w7 is an integer of 0 to 4; and w8 is an integer of 0 to 3, etc.
The "spacer having a main chain of 1 to 10 atoms"
represented by X is more preferably - (CHz) W10 (CHz) Wz-. -CONRe-, -NRBCO-, - ( CHz ) W3C0-, - ( CHz ) WaNR8C0-, -CO-, -( CHz ) W1C0 ( CHz ) Wz-, ( the symbol s are as de f fined above ) , Cl_3 al kyl ene ( a . g . , -CHz-, - ( CHz ) z-, - ( CHz ) 3-, -CHz-CH ( CH3 ) -, etc.) which may be substituted (preferably with halogen atom, hydroxy, etc.), Cz_s alkenylene (preferably -CH=CH-CHz-, etc.) which may be substituted (preferably with halogen atom, hydroxy, etc. ) , Cz_s alkynylene (preferably -C
C-CHz-, etc.) which may be substituted (preferably with halogen atom, hydroxy, etc. ) , - (CHz) WlSOz (CHz) Wz- (the symbols are as defined above), etc., in particular, -CO-.
More preferably, the "spacer having a main chain of 1 to 6 atoms" represented by Y is - (CHz) W10 (CHz) Wz- (the symbols are as defined above) (preferably -0(CHz)wz-) (e. g., 5 -0 (CHz) 3-, etc. ) , C1-3 alkylene (e. g. , -CHz-, - (CHz) z-, -(CHz) 3-, -CH (OH) - (CHz) z-, etc. ) which may be substituted (preferably with halogen atom, hydroxy, etc.), Cz_6 alkenylene (e.g., -CH=CH-, -CHI-CH=CH-, -CH=CH-CH~-. -CH=CH-CHz-CHz-, etc.) which may be substituted (preferably 10 with halogen atom, hydroxy, etc. ) , - (CHz) W3CONH (CHz) W4-. -(CHz) W3C00 (CHz) W4- (the symbols are as defined above) , -(CHz) W1C0 (CHz) Wz- (the symbols are as defined above) , (e. g. , -CO ( CHz ) z-, -CO ( CHz ) 3-, - ( CHz ) zC0-, - ( CHz ) 3C0-, etc . ) , -CO (CHz) W~CO- (the symbols are as defined above) (e. g. , -15 CO ( CHz ) zC0-, -CO ( CHz ) 3C0-, etc . ) , -COCH=CHCO-, -0 ( CHz ) W7C0-(the symbols are as defined above) (e.g., -0(CHz)zC0-, etc.), -CONRe(CHz)weCO- (the symbols are as defined above) (e. g., -CONHCHZCO-), etc.
In the formula (I"), as the "spacer having a main 20 chain of 1 to 5 atoms" represented by Ya, among the above "spacer having a main chain of 1 to 10 atoms" represented by X, that whose main chain has 1 to 5 atoms can be mentioned. Ya is preferably - (CHz) W10 (CHz) Wz- (the symbols are as defined above) (preferably -CO(CHz)z-), etc.
25 In the formula (I"'), the "spacer having a main chain of 1 to 6 atoms" is the same as the above Y.
The particularly preferred X is a bond, -(CHZ) W1C0 (CH2) W2- (the symbols are as defined above) , C1-3 alkylene (preferably -CHZ-, - (CHZ) 2-, - (CHZ) 3-, -CHZ-CH (CH3) -, etc. ) , CZ_6 alkenylene (preferably -CH=CH-CHZ-, etc. ) , CZ_6 alkynylene (e. g., -C = C-CHZ-, etc.), etc.
The particularly preferred Y is - (CHz) W10 (CHZ) Wa- (the symbols are as defined above) (preferably -0(CHZ)WZ-, more preferably -0 (CHZ) 3-, etc. ) , Cl_3 alkylene which may be substituted with hydroxy group (preferably -(CHZ)3-, CH (OH) - (CHZ) 2-, etc. ) , CZ_6 alkenylene (preferably -CH=CH
CHz-, -CH=CH-CH2-CHZ-, etc. ) , - (CH2) W1C0 (CHZ) wz- (the symbols are as defined above) (preferably -CO(CHZ)3-, etc.), CO (CHZ) W,CO- (the symbols are as defined above) (preferably -CO ( CHZ ) ZCO-, etc . ) , etc .
The group represented by the formula:
N B ( A
wherein the symbols are as defined above, and the group represented by the formula:
N B' ~ A
wherein the symbols are as defined above, are preferably \ \ ~ \
N~ . ~ , ~
/ N / N / ' 0 \ \ \

/, /N N . N
-N ~ ~ N ~ ~ ~ ~ - ~ \
/ , ~ /, /N / /
and the like. Among them, /N I \ . I \ N I \
/ or /
etc., is preferred. Further, -N ~ ~ N I 1 ~ ~ -N ~ \
/ i / /N / /
or etc., is also preferred.
As the "substituents" in the "benzene ring"
represented by ring A and the "5- to 9-membered nitrogen-containing non-aromatic heterocyclic ring" represented by ring B, those exemplified as the "substituents" in the "cyclic group which may be substituted" represented by the above R and Arl can be used.
The number of substituents is, for example, 1 to 5, preferably 1 to 3. When the number of substituents is 2 or more, each substituents can be the same or different.
The substituents on ring A and ring B are preferably oxo, C6_14 aryl which may be substituted (preferably with C1_s alkoxy), etc.
As the "hydrocarbon groups which may be substituted"
represented by R1 and Rz, those exemplified as the above R3 can be used.
The "hydrocarbon groups which may be substituted" are preferably "C1_6 alkyl which may be substituted" , CZ_E
alkynyl (e. g., ethynyl, etc.), C3_6 cycloalkyl (e. g., cyclopropyl, cyclohexyl, etc.), C6_1q aryl (e. g., phenyl, naphthyl, etc.), dihydroindene, etc. Among them, "C1_6 alkyl which may be substituted" is preferred, in particular, "C1_6 alkyl" is preferred.
Here, examples of the "C1_6 alkyl" in the "C~_6 alkyl which may be substituted" include methyl, ethyl, propyl, isopropyl, butyl, isobutyl, sec-butyl, tert-butyl, pentyl, hexyl, etc. Especially, methyl, ethyl, propyl, etc. are preferred.

Examples of the "substituents" in the "C1_6 alkyl which may be substituted" include halogen atom (e. g. fluorine, chlorine, bromine, iodine, etc.), C1_3 alkylenedioxy (e. g.
methylenedioxy, ethylenedioxy etc.), nitro, cyano, optionally halogenated C3_6 cycloalkyl (e. g., cyclohexyl, etc.), optionally halogenated C1_6 alkoxy (e. g., methoxy, isopropoxy, etc.), optionally halogenated C1_6 alkylthio (e. g., methylthio, etc.), hydroxy, amino, mono-C1_s alkylamino (e. g. methylamino, ethylamino, propylamino, isopropylamino, butylamino, etc.), di-(Cl_6 alkyl which may be substituted with hydroxy)amino (e. g. dimethylamino, diethylamino, dipropylamino, diisopropylamino, dibutylamino, ethylmethylamino, di(hydroxyethyl)amino, etc.), C6_14 aryl-amino which may be substituted with one to three C1_6 alkyl (e. g., phenylamino, 2,6-dimethylphenylamino, etc.), N-C1_s alkyl-N- (C6_lq aryl which may be substituted with C1-6 alkyl)amino (e.g., N-methyl-N-phenylamino, N-ethyl-N-(methylphenyl)amino, etc.), 5- or 6-membered monocyclic aromatic heterocyclic ring amino which may be substituted with nitro (e.g., nitropyridylamino, etc.), 5- to 8-membered monocyclic non-aromatic heterocyclic group (e. g., tetrahydrofuryl, pyrrolidinyl, oxopyrrolidinyl, piperidinyl, methylpiperidinyl, morpholinyl, methylpiperazinyl, etc.), formyl, carboxy, carbamoyl, thiocarbamoyl, optionally halogenated C1_6 alkyl-carbonyl, C1_6 alkoxy-carbonyl (e. g.

methoxycarbonyl, ethoxycarbonyl, propoxycarbonyl, tert-butoxycarbonyl, etc.), mono-C1_6 alkyl-carbamoyl (e. g.
methylcarbamoyl, ethylcarbamoyl, etc.), di-C1_6 alkyl-carbamoyl (e. g. dimethylcarbamoyl, diethylcarbamoyl, 5 ethylmethylcarbamoyl etc.), optionally halogenated C1-6 alkylsulfonyl, formylamino, optionally halogenated C1-6 alkyl-carboxamide, C1_6 alkoxy-carboxamide (e. g.
methoxycarboxamide, ethoxycarboxamide, propoxycarboxamide, butoxycarboxamide, etc.), C1_6 alkylsulfonylamino (e. g.
10 methylsulfonylamino, ethylsulfonylamino, etc.), C1_6 alkyl-carbonyloxy (e. g. acetoxy, propanoyloxy, etc.), C1_6 alkoxy-carbonyloxy (e. g. methoxycarbonyloxy, ethoxycarbonyloxy, propoxycarbonyloxy, butoxycarbonyloxy, etc.), mono-C1_s alkyl-carbamoyloxy (e. g. methylcarbamoyloxy, 15 ethylcarbamoyloxy, etc.), di-C1_6 alkyl-carbamoyloxy (e. g.
dimethylcarbamoyloxy, diethylcarbamoyloxy, etc.), aromatic groups which may be substituted, optionally halogenated C8_ is aryloxy (e. g., phenoxy, chlorophenyloxy, etc.), etc.
The number of substituents is, for example, 1 to 5, 20 preferably 1 to 3. When the number of substituents is 2 or more, each substituents can be the same or different.
Here, as the "optionally halogenated C3_6 cycloalkyl", "optionally halogenated Cl_6 alkoxy" and "optionally halogenated C1_6 alkylthio", those exemplified as the 25 "substituents" in the above "cyclic group which may be substituted" can be used.
As the "optionally halogenated C1_6 alkyl-carbonyl", "optionally halogenated C1_6 alkylsulfonyl" and "optionally halogenated C1_6 alkyl-carboxamide", those exemplified as the "substituents" in the above "C,_19 aralkyl which may be substituted" can be used.
As the "substituents" and "aromatic groups" in the "aromatic groups which may be substituted", those exemplified as the "substituents" and "aromatic groups" in the "cyclic group which may be substituted" represented by the above R can be used. The number of substituents is, for example, 1 to 5, preferably 1 to 3. When the number of substituents is 2 or more, each substituents can be the same or different.
The "aromatic groups" are preferably phenyl, naphthyl, furyl, pyridyl, imidazoly, indolyl, etc. And, the "substituents" are preferably C1_3 alkylenedioxy (e. g., methylenedioxy, etc.), optionally halogenated C1_6 alkyl (e. g., trifluoromethyl, etc.), optionally halogenated C1_6 alkoxy (e. g., methoxy, etc.), a halogen atom (e. g., chlorine, etc.), etc.
As the "heterocyclic group which may be substituted"
represented by R1 and R2, those exemplified as the above R3 can be used.
The "heterocyclic group" in the "heterocyclic group which may be substituted" is preferably a 5- to 10-membered non-aromatic heterocyclic group, more preferably pyrrolidinyl, piperidinyl, etc. Further, the "substituent"
in the "heterocyclic group which may be substituted" is preferably optionally halogenated Cl-6 alkyl (e. g., methyl, etc.), C7_19 aralkyl (e. g., benzyl, etc.), etc. The number of the substituents is, for example, 1 to 5.
Examples of the "nitrogen-containing heterocyclic rings" in the "nitrogen-containing heterocyclic rings which may be substituted" formed by R1 and RZ together with the adjacent nitrogen atom include 3- to 10-membered (preferably 3- to 8-membered) nitrogen-containing heterocyclic rings which contain at least one nitrogen atom in addition to carbon atoms, and which may further contain 1 to 3 hetero atoms selected from nitrogen, sulfur and oxygen atoms. Specific examples include aziridine, azetidine, morpholine, thiomorpholine, piperidine, piperazine, pyrrolidine, hexamethyleneimine, heptamethyleneimine, hexahydropyrimidine, 1,4-diazepam dihydroisoquinoline, and their unsaturated cyclic amines (e. g. 1,2,5,6-tetrahydropyridine, 1,4-diazepin, octahydroisoquinoline, etc.), etc. can be mentioned.
Especially, morpholine, piperidine, piperazine, pyrrolidine, etc., are preferred.
As the "substituents" in the "nitrogen-containing heterocyclic rings which may be substituted", for example, those exemplified as the "substituents" in the above "5- to 7-membered saturated cyclic amino which may be substituted"
can be used. The number of substituents is, for example, 1 to 5, preferably 1 to 3. When the number of substituents is 2 or more, each substituents can be the same or different.
The "substituents" are preferably hydroxy; optionally halogenated C1_6 alkyl (preferably methyl, ethyl, etc. ) ; C6_ 14 aryl (e.g., phenyl, naphthyl, etc.) which may have 1 to 3 substituents selected from halogen atom, optionally halogenated C1_6 alkyl and optionally substituted C~_6 alkoxy; carbamoyl; hydroxy-C1_6 alkyl; C1_6 alkoxy-carbonyl-C1_6 alkyl (e. g. , ethoxycarbonylmethyl, etc. ) ; C7_19 aralkyl (e.g., benzyl, diphenylmethyl, etc.} which may be substituted with C1_3 alkylenedioxy (e. g., methylenedioxy, etc.); 5- to 10-membered aromatic heterocyclic group (preferably pyridyl, pyrimidinyl, etc.); 5- to 8-monocyclic non-aromatic heterocyclic group (e. g., pyrrolidinyl, piperidinyl, etc.); CB_19 aryl-alkenyl (e.g., 3-phenyl-2-prop-2-enyl, etc.); C1_6 alkyl-carboxamide (e. g., methylcarboxamide, etc. ) ; (N-C1_6 alkyl) -C1_6 alkyl-carboxamide (e.g., (N-ethyl)methylcarboxamide, etc.); di-C1_6 alkylamino (e.g., dimethylamino, etc.), 5- to 8-membered monocyclic non-aromatic heterocyclic group-C1_6 alkyl (e. g., pyrrolidinylmethyl, etc.); C6_~4 aryl-amino-C1_s alkyl (e. g., 2,6-dimethylphenylaminomethyl, etc.) substituted with 1 to 3 C1_6 alkyl; etc.
Preferably, R1 and R2, together with the adjacent nitrogen atom, form a nitrogen-containing heterocyclic ring which may be substituted.
In particular, R1 and R2, together with the adjacent nitrogen atom, form piperidino, pyrrolidin-1-yl, etc.
The "nitrogen-containing heterocyclic rings which may be substituted" formed by R1 and R2 together with the adjacent nitrogen atom is preferably - N Z -Rb U
wherein the symbols are as defined above.
Here, as the "hydrocarbon group which may be substituted" represented by Rb, those exemplified as the above R3 can be mentioned. Preferably, Rb is a hydrocarbon group which may be substituted and specific examples thereof include optionally halogenated C1_6 alkyl (preferably methyl, ethyl, etc.); C6_lq aryl (e. g., phenyl, naphthyl, etc.) which may have 1 to 3 substituents selected from halogen atom (e. g., fluorine, chlorine, etc.), optionally halogenated C1_6 alkyl (e.g., methyl, etc.) and optionally substituted C1_6 alkoxy (e. g., methoxy, etc.);

hydroxy-C1_6 al kyl ; C1_6 al koxy-carbonyl-C1_6 al kyl ( a . g . , ethoxycarbonylmethyl, etc.); C~_19 aralkyl (e. g., benzyl, diphenylmethyl, etc.) which may be substituted with C1_3 alkylenedioxy (e. g., methylenedioxy, etc.); CB_l9arylalkenyl 5 (e. g., 3-phenyl-2-prop-2-enyl, etc.); 5- to 8-monocyclic non-aromatic heterocyclic group-C1_6 alkyl (e. g., pyrrolidinylmethyl etc. ) ; C6_14 aryl-amino-C1_6 alkyl (e. g. , 2,6-dimethylphenylaminomethyl, etc.) which may be substituted with 1 to 3 C1_6 alkyl; etc. More preferably, 10 Rb is C6_1g aryl which may be substituted.
Z is preferably CH.
In the formula (I " " '), as the "hydrocarbon group which may be substituted" represented by Rc, those exemplified as the above Rb can be mentioned. Preferably, 15 Rc is C6_19 aryl which may be substituted.
As the "nitrogen-containing heterocyclic ring which may be substituted" formed by R2 together with the adjacent nitrogen atom and Y, those exemplified as the "nitrogen-containing heterocyclic ring which may be substituted"
20 formed by R1 and RZ together with the adjacent nitrogen atom can be mentioned.
Suitable examples of the compounds represented by the formula (I) include those represented by the formulas (I'), (I'.). (I. "). (I... ~). (I.....) ~ etc.
25 Among the compounds represented by the formula (I), those represented by the formulas (I'), (I"), (I " ") or (I " " ') are novel compounds.
Suitable examples of the compounds represented by the formula (I') include the following compounds:
(E)-3-[1-[4-[(4-methoxybenzyl)oxy]benzoyl)-2,3-dihydro-1H-indol-5-yl]-N,N-dimethyl-2-propene-1-amine;
(E)-3-[1-[4-[(4-methylbenzyl)oxy]benzoyl]-2,3-dihydro-1H-indol-5-yl]-N,N-dimethyl-2-propene-1-amine;
(E)-3-[1-[4-[(4-chlorobenzyl)oxy]benzoyl]-2,3-dihydro-1H-indol-5-yl]-N,N-dimethyl-2-propene-1-amine;
1-[[6-(4-chlorophenyl)-3-pyridinyl]carbonyl]-6-[(E)-3-(1-pyrrolidinyl)-1-propenyl]-1,2,3,4-tetrahydroquinoline;
1-[[6-(4-fluorophenyl)-3-pyridinyl]carbonyl]-6-[(E)-3-(1-pyrrolidinyl)-1-propenyl]-1,2,3,4-tetrahydroquinoline;
1-[[6-(4-methylphenyl)-3-pyridinyl]carbonyl]-6-[(E)-3-(1-pyrrolidinyl)-1-propenyl]-1,2,3,4-tetrahydroquinoline;
1-[[6-(4-chlorophenyl)-3-pyridinyl)carbonyl)-6-[(E)-3-dimethylamino-1-propenyl]-1,2,3,4-tetrahydroquinoline;
1-[[6-(4-fluorophenyl)-3~pyridinyl]carbonyl]-6~[(E)-3-dimethylamino-1-propenyl]-1,2,3,4-tetrahydroquinoline;
1-[[6-(4-methylphenyl)-3-pyridinyl]carbonyl]-6-[(E)-3-dimethylamino-1-propenyl]-1,2,3,4-tetrahydroquinoline;
1-[[6-(4-chlorophenyl)-3-pyridinyl]carbonyl]-6-[(E)-4-(1-pyrrolidinyl)-1-butenyl]-1,2,3,4-tetrahydroquinoline;

1-[[6-(4-fluorophenyl)-3-pyridinyl]carbonyl]-6-[(E)-4-(1-pyrrolidinyl)-1-butenyl]-1,2,3,4-tetrahydroquinoline;
1-[[6-(4-methylphenyl)-3-pyridinyl]carbonyl]-6-[(E)-4-(1-pyrrolidinyl)-1-butenyl]-1,2,3,4-tetrahydroquinoline;
1-[[6-(4-chlorophenyl)-3-pyridinyl]carbonyl]-6-[(E)-4-dimethylamino-1-butenyl]-1,2,3,4-tetrahydroquinoline;
1-[[6-(4-fluorophenyl)-3-pyridinyl]carbonyl]-6-[(E)-4-dimethylamino-1-butenyl]-1,2,3,4-tetrahydroquinoline:
1-[[6-(4-methylphenyl)-3-pyridinyl]carbonyl]-6-[(E)-4-dimethylamino-1-butenyl]-1,2,3,4-tetrahydroquinoline;
(E)-N,N-dimethyl-3-[1-[[4-(4-methylphenyl)-1-piperidinyl]carbonyl]-1,2,3,4-tetrhydro-6-quinolinyl]-2-propen-1-amine;
(E)-N,N-dimethyl-3-[1-[[4-(4-fluorophenyl)-1-piperidinyl]carbonyl]-1,2,3,4-tetrhydro-6-quinolinyl]-2-propen-1-amine;
(E)-N,N-dimethyl-3-[1-[[4-(4-chlorophenyl)-1-piperidinyl]carbonyl]-1,2,3,4-tetrhydro-6-quinolinyl]-2-propen-1-amine;
1-[[4-(4-methylphenyl)-1-piperidinyl]carbonyl]-6-[(E)-3-(1-pyrrolidinyl)-1-propenyl]-1,2,3,4-tetrahydroquinoline;
1-[[4-(4-fluorophenyl)-1-piperidinyl]carbonyl]-6-[(E)-3-(1-pyrrolidinyl)-1-propenyl]-1,2,3,4-tetrahydroquinoline;
1-[[4-(4-chlorophenyl)-1-piperidinyl]carbonyl]-6-[(E)-3-(1-pyrrolidinyl)-1-propenyl]-1,2,3,4-tetrahydroquinoline;

(E)-3-[1-[[4-(4-chlorophenyl)-1-piperazinyl]carbonyl]-1,2,3,4-tetrahydro-6-quinolinyl]-N,N-dimethyl-2-propen-1-amine:
(E)-3-[1-[[4-(4-methylphenyl)-1-piperazinyl]carbonyl]-1,2,3,4-tetrahydro-6-quinolinyl]-N,N-dimethyl-2-propen-1-amine;
(E)-3-[1-[[4-(4-fluorophenyl)-1-piperazinyl]carbonyl]-1,2,3,4-tetrahydro-6-quinolinyl]-N,N-dimethyl-2-propen-1-amine;
1-[[5-(4-fluorophenyl)-2-pyridinyl]carbonyl]-6-[(E)-3-(1-pyrrolidinyl)-1-propenyl]-1,2,3,4-tetrahydroquinoline;
1-[[5-(4-methylphenyl)-2-pyridinyl]carbonyl]-6-[(E)-3-(1-pyrrolidinyl)-1-propenyl]-1,2,3,4-tetrahydroquinoline;
1-[[6-(4-chlorophenyl)-3-pyridinyl]carbonyl]-6-[1-methyl-3-piperidinylidene)methyl-1,2,3,4-tetrahydroquinoline;
1-[[5-(4-chlorophenyl)-2-furoyl]-6-[(E)-3-(4-phenyl-1-piperidinyl)-1-propenyl]-1,2,3,4-tetrahydroquinoline.
Suitable examples of the compounds represented by the formula (I") include the following compounds:
4-[4-(4-chlorophenyl)-1-piperidinyl]-4-oxo-1-(1,2,3,4-tetrahydro-7-isoquinolinyl)-1-butanone;
4-[4-(4-chlorophenyl)-1-piperidinyl]-4-oxo-1-(2,3,4,5-tetrahydro-1H-3-benzazepin-7-yl)-1-butanone;
4-[4-(4-chlorophenyl)-1-piperidinyl]-4-oxo-1-(3-methyl 2,3,4,5-tetrahydro-1H-3-benzazepin-7-yl)-1-butanone;

4-[4-(4-chlorophenyl)-1-piperidinyl]-1-(3-ethyl-2,3,4,5-tetrahydro-1H-3-benzazepin-7-yl)-4-oxo-1-butanone;
4-[4-(4-chlorophenyl)-1-piperidinyl]-4-oxo-1-(3-propyl-2,3,4,5-tetrahydro-1H-3-benzazepin-7-yl)-1-butanone;
1-(3-benzyl-2,3,4,5-tetrahydro-1H-3-benzazepin-7-yl)-4-[4-(4-chlorophenyl)-1-piperidinyl]-4-oxo-1-butanone;
1-(3-acetyl-2,3,4,5-tetrahydro-1H-3-benzazepin-7-yl)-4-[4-(4-chlorophenyl)-1-piperidinyl]-4-oxo-1-butanone;
4-[4-(4-chlorophenyl)piperidin-1-yl]-1-(3-isopropyl-2,3,4,5-tetrahydro-1H-3-benzazepin-7-yl)-4-oxobutan-1-one;
4-[4-(4-chlorophenyl)-1-piperidinyl]-4-oxo-1-(2,3,4,5-tetrahydro-1H-2-benzazepin-8-yl)-1-butanone;
4-[4-(4-chlorophenyl)-1-piperidinyl]-1-(2-methyl-2,3,4,5-tetrahydro-1H-2-benzazepin-8-yl)-4-oxo-1-butanone;
4-[4-(4-chlorophenyl)-1-piperidinyl]-1-(2,3-dihydro-1H-isoindol-5-yl)-4-oxo-1-butanone.
In addition to the above compounds represented by the formula (I') or (I"), suitable examples of the compound represented by the formula (I) include the following compounds:
(E)-3-[1-[(4'-chloro[1,1'-biphenyl]-4-yl)carbonyl]-1,2,3,4-tetrahydro-6-quinolinyl]-N,N-dimethyl-2-propen-1-amine;
1-[(4'-chloro[1,1'-biphenyl]-4-yl)carbonyl]-6-[(E)-3-piperidino-1-propenyl]-1,2,3,4-tetrahydroquinoline;
(E)-3-[1-[([l,1'-biphenyl]-4-yl)carbonyl]-2,3-dihydro-1H-indol-5-yl]-N,N-dimethyl-2-propen-1-amine;
(E)-3-[1-[(4'-chloro[1,1'-biphenyl]-4-yl)carbonyl]-2,3-dihydro-1H-indol-5-yl]-N,N-dimethyl-2-propen-1-amine;
(E)-4-[1-[(4'-chloro[1,1'-biphenyl]-4-yl)carbonyl]-1,2,3,4-5 tetrahydro-6-quinolinyl]-N,N-dimethyl-3-buten-1-amine;
1-(3-acetyl-2,3,4,5-tetrahydro-1H-3-benzazepin-7-yl)-4-[4-(4-chlorophenyl)-1-piperidinyl]-1-butanone;
4-[4-(4-chlorophenyl)-1-piperidinyl]-1-(2,3,4,5-tetrahydro-1H-3-benzazepin-7-yl)-1-butanone;
10 4-[4-(4-chlorophenyl)-1-piperidinyl]-1-(3-methyl-2,3,4,5-tetrahydro-1H-3-benzazepin-7-yl)-1-butanone;
4-oxo-N-(2-phenethyl)-4-(2,3,4,5-tetrahydro-1H-3-benzazepin-7-yl)butanamide;
4-oxo-N-(3-phenylpropyl)-4-(2,3,4,5-tetrahydro-1H-3-15 benzazepin-7-yl)butanamide;
N-[2-(1H-indol-3-yl)ethyl]-4-oxo-4-(2,3,4,5-tetrahydro-1H-3-benzazepin-7-yl)butanamide.
Further, suitable examples of the compounds represented by the formula (I) include the following 20 compounds:
7-[3-[4-(4-chlorophenyl)piperidin-1-yl]propoxy]-2,3,4,5-tetrahydro-1H-3-benzazepine;
7-[3-[4-(4-chlorophenyl)-1-piperidinyl]propoxy]-3-methyl-2,3,4,5-tetrahydro-1H-3-benzazepine;
25 7-[3-[4-(4-chlorophenyl)-1-piperidinyl]propoxy]-3-isopropyl-2,3,4,5-tetrahydro-1H-3-benzazepine;
7-[3-[4-(4-chlorophenyl)-1-piperidinyl]propoxy]-3-cyclopentyl-2,3,4,5-tetrahydro-1H-3-benzazepine;
3-benzyl-7-[3-[4-(4-chlorophenyl)-1-piperidinyl]propoxy]-2,3,4,5-tetrahydro-1H-3-benzazepine;
3-acetyl-7-[3-[4-(4-chlorophenyl)-1-piperidinyl]propoxy]-2,3,4,5-tetrahydro-1H-3-benzazepine;
7-[3-[4-(4-chlorophenyl)-1-piperidinyl]propoxy]-3-isobutyryl-2,3,4,5-tetrahydro-1H-3-benzazepine;
3-benzoyl-7-[3-[4-(4-chlorophenyl)-1-piperidinyl]propoxy]-2,3,4,5-tetrahydro-1H-3-benzazepine;
tert-butyl 7-[3-[4-(4-chlorophenyl)-1-piperidinyl]propoxy]-1,2,4,5-tetrahydro-1H-3-benzazepine-3-carboxylate;
7-[3-[4-(4-chlorophenyl)-1-piperidinyl]propoxy]-3-(methylsulfonyl)-2,3,4,5-tetrahydro-1H-3-benzazepine;
7-[3-[4-(4-chlorophenyl)-1-piperidinyl]propoxy]-N-ethyl-1,2,4,5-tetrahydro-3H-3-benzazepine-3-carboxamide;
7-[3-[4-(4-fluorophenyl)-1-piperidinyl]propoxy]-3-isopropyl-2,3,4,5-tetrahydro-1H-3-benzazepine;
7-[3-[4-(2,4-difluorophenyl)-1-piperidinyl]propoxy]-3-isopropyl-2,3,4,5-tetrahydro-1H-3-benzazepine;
7-[3-[4-(4-methylphenyl)-1-piperidinyl]propoxy]-3-isopropyl-2,3,4,5-tetrahydro-1H-3-benzazepine;
3-isopropyl-7-[3-[4-(3-methylphenyl)-1-piperidinyl]propoxy]-2,3,4,5-tetrahydro-1H-3-benzazepine;

3-isopropyl-7-[3-[4-(2-methylphenyl)-1-piperidinyl]propoxy]-2,3,4,5-tetrahydro-1H-3-benzazepine;
3-isopropyl-7-[3-[4-(4-methoxyphenyl)-1-piperidinyl]propoxy]-2,3,4,5-tetrahydro-1H-3-benzazepine;
3-isopropyl-7-[3-[4-(3-trifluoromethylphenyl)-1-piperidinyl]propoxy]-2,3,4,5-tetrahydro-1H-3-benzazepine;
3-acetyl-7-[3-[4-(4-methylphenyl)-1-piperidinyl]propoxy]-2,3,4,5-tetrahydro-1H-3-benzazepine;
3-acetyl-7-[3-[4-(4-methoxyphenyl)-1-piperidinyl]propoxy]-2,3,4,5-tetrahydro-1H-3-benzazepine;
3-isobutyryl-7-[3-[4-(4-methylphenyl)-1-piperidinyl]propoxy]-2,3,4,5-tetrahydro-1H-3-benzazepine;
3-isobutyryl-7-[3-[4-(4-methoxyphenyl)-1-piperidinyl]propoxy]-2,3,4,5-tetrahydro-1H-3-benzazepine;
7-[3-[4-(4-methylphenyl)-1-piperidinyl]propoxy]-3-(methylsulfonyl)-2,3,4,5-tetrahydro-1H-3-benzazepine;
7-[3-[4-(4-methoxyphenyl)-1-piperidinyl]propoxy]-3-(methylsulfonyl)-2,3,4,5-tetrahydro-1H-3-benzazepine;
3-acetyl-7-[3-[4-(4-fluorophenyl)-1-piperidinyl]propoxy]-2,3,4,5-tetrahydro-1H-3-benzazepine;
3-acetyl-7-[3-[4-(3-fluorophenyl)-1-piperidinyl]propoxy]-2,3,4,5-tetrahydro-1H-3-benzazepine;
3-acetyl-7-[3-[4-(2,4-difluorophenyl)-1-piperidinyl]propoxy]-2,3,4,5-tetrahydro-1H-3-benzazepine;
3-acetyl-7-[3-[4-(4-methylphenyl)-1-piperidinyl]propoxy]-2,3,4,5-tetrahydro-1H-3-benzazepine;
3-acetyl-7-[3-[4-(3-methylphenyl)-1-piperidinyl]propoxy]-2,3,4,5-tetrahydro-1H-3-benzazepine;
3-acetyl-7-[3-[4-(2-methylphenyl)-1-piperidinyl]propoxy]-2,3,4,5-tetrahydro-1H-3-benzazepine;
3-acetyl-7-[3-[4-(4-methoxyphenyl)-1-piperidinyl]propoxy]-2,3,4,5-tetrahydro-1H-3-benzazepine;
3-[(3-isopropyl-2,3,4,5-tetrahydro-1H-3-benzazepin-7-yl)oxy]-N-[3-(4-methylphenyl)propyl]propanamide;
N-[3-(4-chlorophenyl)propyl]-3-[(3-isopropyl-2,3,4,5-tetrahydro-1H-3-benzazepin-7-yl)oxy]propanamide;
N-[3-(3-chlorophenyl)propyl]-3-[(3-isopropyl-2,3,4,5-tetrahydro-1H-3-benzazepin-7-yl)oxy]propanamide;
N-[3-(2-chlorophenyl)propyl]-3-[(3-isopropyl-2,3,4,5-tetrahydro-1H-3-benzazepin-7-yl)oxy]propanamide;
3-(4-chlorophenyl)-N-[3-[(3-isopropyl-2,3,4,5-tetrahydro-1H-3-benzazepin-7-yl)oxy]propyl]-1-propanamine;
(E)-4-[4-(4-chlorophenyl)-1-piperidinyl]-4-oxo-1-[3-(trifluoroacetyl)-2,3,4,5-tetrahydro-1H-3-benzazepin-7-yl]-2-buten-1-one;
(E)-4-[4-(4-chlorophenyl)-1-piperidinyl]-4-oxo-1-(2,3,4,5-tetrahydro-1H-3-benzazepin-7-yl)-2-buten-1-one;
(E)-4-[4-(4-chlorophenyl)-1-piperidinyl]-1-(3-isopropyl-2,3,4,5-tetrahydro-1H-3-benzazepin-7-yl)-4-oxo-2-buten-1-one;

8-[3-[4-(4-chlorophenyl)-1-piperidinyl]propoxy]-3-isopropyl-2,3,4,5-tetrahydro-1H-2-benzazepine;
8-[3-[4-(4-chlorophenyl)-1-piperidinyl]propoxy]-3-cyclopentyl-2,3,4,5-tetrahydro-1H-2-benzazepine;
2-benzyl-8-j3-[4-(4-chlorophenyl)-1-piperidinyl]propoxy]-2,3,4,5-tetrahydro-1H-2-benzazepine;
8-[3-[4-(4-chlorophenyl)-1-piperidinyl]propoxy]-2-isobutyryl-2,3,4,5-tetrahydro-1H-2-benzazepine;
2-benzoyl-8-[3-[4-(4-chlorophenyl)-1-piperidinyl]propoxy]-2,3,4,5-tetrahydro-1H-2-benzazepine;
8-[3-[4-(4-chlorophenyl)-1-piperidinyl]propoxy]-2-(methylsulfonyl)-2,3,4,5-tetrahydro-1H-2-benzazepine;
8-[3-[4-(4-chlorophenyl)-1-piperidinyl]propoxy]-N-ethyl-1,3,4,5-tetrahydro-2H-2-benzazepine-2-carboxamide;
8-[3-[4-(4-fluorophenyl)-1-piperidinyl]propoxy]-2-isopropyl-2,3,4,5-tetrahydro-1H-2-benzazepine;
8-[3-[4-(2,4-difluorophenyl)-1-piperidinyl]propoxy]-2-isopropyl-2,3,4,5-tetrahydro-1H-2-benzazepine;
8-[3-[4-(4-methylphenyl)-1-piperidinyl]propoxy]-2-isopropyl-2,3,4,5-tetrahydro-1H-2-benzazepine;
2-isopropyl-8-[3-[4-(3-methylphenyl)-1-piperidinyl]propoxy]-2,3,4,5-tetrahydro-1H-2-benzazepine;
2-isopropyl-8-[3-[4-(2-methylphenyl)-1-piperidinyl]propoxy]-2,3,4,5-tetrahydro-1H-2-benzazepine;
2-isopropyl-8-[3-[4-(4-methoxyphenyl)-1-piperidinyl]propoxy]-2,3,4,5-tetrahydro-1H-2-benzazepine;
2-isopropyl-8-[3-[4-(3-trifluoromethylphenyl)-1-piperidinyl]propoxy]-2,3,4,5-tetrahydro-1H-2-benzazepine;
2-acetyl-8-[3-[4-(4-methylphenyl)-1-piperidinyl]propoxy]-5 2,3,4,5-tetrahydro-1H-2-benzazepine;
2-acetyl-8-[3-[4-(4-methoxyphenyl)-1-piperidinyl]propoxy]-2,3,4,5-tetrahydro-1H-2-benzazepine;
2-isobutyryl-8-[3-[4-(4-methylphenyl)-1-piperidinyl]propoxy]-2,3,4,5-tetrahydro-1H-2-benzazepine;
10 2-isobutyryl-8-[3-[4-(4-methoxyphenyl)-1-piperidinyl]propoxy]-2,3,4,5-tetrahydro-1H-2-benzazepine;
8-[3-[4-(4-methylphenyl)-1-piperidinyl]propoxy]-2-(methylsulfonyl)-2,3,4,5-tetrahydro-1H-2-benzazepine;
8-[3-[4-(4-methoxyphenyl)-1-piperidinyl]propoxy]-2-15 (methylsulfonyl)-2,3,4,5-tetrahydro-1H-2-benzazepine;
2-acetyl-8-[3-[4-(4-fluorophenyl)-1-piperidinyl]propoxy]-2,3,4,5-tetrahydro-1H-2-benzazepine;
2-acetyl-8-[3-[4-(3-fluorophenyl)-1-piperidinyl]propoxy]-2,3,4,5-tetrahydro-1H-2-benzazepine;
20 2-acetyl-8-[3-[4-(2,4-difluorophenyl)-1-piperidinyl]propoxy]-2,3,4,5-tetrahydro-1H-2-benzazepine;
2-acetyl-8-[3-[4-(4-methylphenyl)-1-piperidinyl]propoxy]-2,3,4,5-tetrahydro-1H-2-benzazepine;
2-acetyl-8-[3-[4-(3-methylphenyl)-1-piperidinyl]propoxy]-25 2,3,4,5-tetrahydro-1H-2-benzazepine;

2-acetyl-8-[3-[4-(2-methylphenyl)-1-piperidinyl]propoxy]-2,3,4,5-tetrahydro-1H-2-benzazepine;
2-acetyl-8-[3-[4-(4-methoxyphenyl)-1-piperidinyl]propoxy]-2,3,4,5-tetrahydro-1H-2-benzazepine;
3-[(2-isopropyl-2,3,4,5-tetrahydro-1H-2-benzazepin-8-yl)oxy]-N-[3-(4-methylphenyl)propyl]propanamide;
N-[3-(4-chlorophenyl)propyl]-3-[(2-isopropyl-2,3,4,5-tetrahydro-1H-2-benzazepin-8-yl)oxy]propanamide;
N-[3-(3-chlorophenyl)propyl]-3-[(2-isopropyl-2,3,4,5-tetrahydro-1H-2-benzazepin-8-yl)oxy]propanamide;
N-[3-(2-chlorophenyl)propyl]-3-[(2-isopropyl-2,3,4,5-tetrahydro-1H-2-benzazepin-8-yl)oxy]propanamide;
3-(4-chlorophenyl)-N-[3-[(2-isopropyl-2,3,4,5-tetrahydro-1H-2-benzazepin-8-yl)oxy]-1-propanamine.
Examples of salts of compound (I), (I'), (I"), (I " '), (I " ") or (I " " ') include salts with inorganic bases, ammonium salts, salts with organic bases, salts with inorganic acids, salts with organic acids, salts with basic or acidic amino acids, and the like.
Preferred examples of salts with inorganic bases include alkali metal salts such as sodium salts, potassium salts, etc.; alkaline earth metal salts such as calcium salts, magnesium salts, barium salts, etc.; aluminum salts;
etc.
Preferred examples of salts with organic bases include salts with trimethylamine, triethylamine, pyridine, picoline, ethanolamine, diethanolamine, triethanolamine, dicyclohexylamine, N,N-dibenzylethylenediamine, etc.
Preferred examples of salts with inorganic acids include salts with hydrochloric acid, hydrobromic acid, nitric acid, sulfuric acid, phosphoric acid, etc.
Preferred examples of salts with organic acids include salts with formic acid, acetic acid, trifluoroacetic acid, fumaric acid, oxalic acid, tartaric acid, malefic acid, citric acid, succinic acid, malic acid, methanesulfonic acid, benzenesulfonic acid, p-toluenesulfonic acid, etc.
Preferred examples of salts with basic amino acids include salts with arginine, lysine, ornithine, etc.
Preferred examples of salts with acidic amino acids include salts with aspartic acid, glutamic acid, etc.
Among these salts, pharmaceutically acceptable salts are preferred. For example, when compound (I), (I'), (I"), ( I " ' ) , ( I " " ) or ( I " " ' ) possesses an acidic functional group, it can form an inorganic salt such as an alkali metal salt (e.g., sodium salt, potassium salt, etc.), an alkaline earth metal salt (e. g. calcium salt, magnesium salt, barium salt, etc.), etc., an ammonium salt, etc.
When compound (I), (I'), (I"), (I"'), (I"") or (I""') possesses a basic functional group, it can form an inorganic salt such as hydrochloride, sulfate, phosphate, hydrobromate, etc.; or an organic salt such as acetate, maleate, fumarate, succinate, methanesulfonate, p-toluenesulfonate, citrate, tartrate, etc.
Compounds (I), (I'), (I"), (I " '), (I " ") and (I " " ') (hereinafter also abbreviated as the compound of the present invention) can be either anhydrides or hydrates.
A hydrate may have 0.5 to 3 water molecules.
In addition, the compounds of the invention can be labeled using isotopes (e.g. 3H, 14C, and 355, etc. ) .
When the compound of the present invention contain optical isomers, stereoisomers, regio isomers, rotational isomers, these are also included as the compound of the present invention, and each of them can be obtained as a single substance by per se known synthesis methods and separation methods. For example, when optical isomers exist in the compound of the present invention, the optical isomers resolved from the compound are included in the compound of the present invention.
The optical isomers can be produced using per se known methods. Specifically, the optical isomer can be obtained by using an optically active synthetic intermediate, or subjecting a racemic mixture of the final product to optical resolution in accordance with common method.
Examples of optical resolution methods include per se known methods such as the fractional recrystallization f method, chiral column method, diastereomer method, etc., which are described in detail below.
1) Fractional recrystallization method The method which comprises allowing a racemate to form a salt with an optically active compound (e. g. (+)-mandelic acid, (-)-mandelic acid, (+)-tartaric acid, (-)-tartaric acid, (+)-1-phenethylamine, (-)-1-phenethylamine, cinchonine, (-)-cinchonidine, brucine, etc.), separating the salt using a fractional recrystallization method, followed by, if desired, neutralizing process to obtain a free optical isomer.
2) Chiral column method This method comprises subjecting a racemate or its salt to a column for separating an optical isomer (chiral column) for separation. For example, in the case of liquid chromatography, an optical isomer mixture is added to the chiral column such as ENANTIO-OVM [produced by Toso] or CHIRAL series [produced by Daicel], which is developed using water, various buffer solutions (e. g. phosphate buffer), organic solvents (e. g. ethanol, methanol, isopropanol, acetonitrile, trifluoroacetic acid, diethylamine, etc.) as single or mixed solutions, and the optical isomers are separated. Also, in the case of gas chromatography, for example, separation is conducted using a chiral column such as CP-Chirasil-DeX CB (produced by c i G.L.Science Co.).
3) Diastereomer method In this method, a racemic mixture is subjected to a chemical reaction with an optically active reagent to give 5 a diastereomer mixture, which is separated into a single substance by an ordinary separation means (e. g. fractional recrystallization, chromatography method, etc.). This single substance is subjecting to removal of the optically active reagent part using chemical processing such as a 10 hydrolysis reaction. For example, when a compound of the invention possesses hydroxy or primary or secondary amino in its molecule, this compound is subjected to a condensation reaction with an optically active organic acid (e. g. MTPA [a-methoxy-a-(trifluoromethyl)phenylacetic 15 acid], (-)-menthoxyacetic acid, etc.), to give the diastereomer in an ester form or an amide form, respectively. On the other hand, when a compound of the invention possesses carboxylic acid group, this compound is subjected to a condensation reaction with an optically 20 active amine or alcohol reagent, to give the diastereomer in an amide form or an ester form, respectively. The separated diastereomer can be converted to an optical isomer of the original compound, by applying acidic hydrolysis or basic hydrolysis.
25 A prodrug of compound (I') or (I") is a compound which is converted to compound (I') or (I") by reactions involving enzymes and gastric acid, etc. under physiological conditions in the living body; in other words, a compound that is changed into compound (I') or (I") by enzymatically-caused oxidation, reduction and hydrolysis, and a compound that is changed into compound (I') or (I") by hydrolysis caused by gastric acid. Examples of the prodrugs of compound (I') or (I") include compounds in which amino groups of compound (I') or (I") have been acylated, alkylated, or phosphorylated [e.g. compounds in which amino groups of compound (I') or (I") have been eicosanoylated, aranylated, pentylaminocarbonylated, (5-methyl-2-oxo-1,3-dioxolen-4-yl)methoxycarbonylated, tetrahydrofuranylated, pyrrolidylmethylated, pivaloyloxymethylated, tert-butylated, etc.]; compounds in which hydroxyl groups of compound (I') or (I") have been acylated, alkylated, phosphorylated, borated (e. g.
compounds in which hydroxyl groups of compound (I') or (I") have been acetylated, palmitoylated, propanoylated, pivaloylated, succinylated, fumarilated, alanilated, dimethylaminomethylcarbonylated, etc.); compounds in which carboxyl groups of compound (I') or (I") have been esterified or amidated [e. g. compounds in which carboxyl groups of compound (I') or (I") have been ethylesterified, phenylesterified, carboxylmethylesterified, x dimethylaminomethylesterified, pivaloyloxymethylesterified, ethoxycarbonyloxyethylesterified, phthalidylesterified, (5-methyl-2-oxo-1,3-dioxolen-4-yl)methylesterified, cyclohexyloxycarbonylethylesterified, or methylamidated, etc.]. These compounds can be produced from compound (I') or (I") using per se known methods.
Also, a prodrug of compound (I') or (I") can be a compound which is changed to compound (I') or (I") by physiological conditions, as described in pages 163 to 198 of Molecular Design, Volume 7, "Development of Drugs", published in 1990 by Hirokawa Shoten.
Prodrugs of compounds (I), (I " '), (I " ") and (I " " ') may also be used. As prodrugs of these compounds, those exemplified as prodrugs of the above compound (I') or (I") can be mentioned.
The compound of the present invention can be produced by [Production method 1] to [Production method 10] which are described in detail below, or analogous methods thereto.
Compound (II), compound (III), compound (V), compound (VI), compound (IIa), compound (IIb), compound (IIIa), compound (IIIaa), compound (IIIab), compound (IIIac), compound (IIIb), compound (IIIc), compound (IVa), compound (IVb), compound (IVc), compound (IVd), compound (Va), compound (VIa), compound (VIaa), compound (VIIa), compound (VIId), compound (VIIg), compound (VIIIe), compound (IXa), r..

compound (IXb), compound (IXe), compound (IXg), compound (Xa), compound (Xb), compound (Xf), compound (XIa), compound (XIf) and compound (XIg) used as raw materials can be used in the form of salts, respectively. As such salts, those exemplified as salts of the above compound (I), etc.
can be used.
In the following jProduction method 1] to [Production method 10], when an alkylation reaction, a hydrolysis reaction, an amination reaction, an esterification reaction, an amidation reaction, an esterification reaction, an etherification reaction, an oxidation reaction, a reducing reaction, etc. are carried out, these reactions are carried out in accordance with per se known methods. Examples of such methods include the methods described in Organic Functional Group Preparations, Second Edition, Academic Press, Inc., published in 1989; Comprehensive Organic Transformations, VCH Publishers Inc., published in 1989, etc.
[Production method 1]
Compound (Ia) having -(CHz)W3C0- (w3 is as defined above) for X in the formula (I) is produced, for example, by the following amidation reaction.
(Amidation reaction) ~
.

R-{CHZ}~3-COOti -~ H-N B ( ~ Y - N
\ R2 . , {I I) {I I !) ...
\ f [~- {CH2) w3-CO-N B L ~ Y - N
\ p2 . .
{la} .., wherein the symbols are as defined above.
The "amidation reaction" includes the following "method using a dehydration and condensation agent" and "method using a reactive derivative of carboxylic acid".
i) Method using a dehydration and condensation agent Compound (III), 1 to 5 equivalents of compound (II), and 1 to 2 equivalents of a dehydration and condensation agent are reacted in an inert solvent. If necessary, the reaction can be carried out with the coexistence of 1 to 1.5 equivalents of 1-hydroxybenzotriazole (HOBT) and/or catalytic quantity to 5 equivalents of a base.
Examples of the "dehydrating and condensation agent"
include dicyclohexylcarbodimide (DCC), 1-ethyl-3-(3 dimethylaminopropyl)carbodimide hydrochloride (WSC). WSC
is particularly preferable.
Examples of the "inert solvent" include nitrile solvents (preferably acetonitrile), amide solvents (preferably DMF), halogenated hydrocarbon solvents w (preferably dichloromethane), ether solvents (preferably THF). Two or more kinds of these can be mixed in an appropriate ratio for use.
Examples of the "base" include 1) for example, strong bases such as hydrides of alkali metals or alkaline earth metals (e. g. lithium hydride, sodium hydride, potassium hydride, calcium hydride, etc.), amides of alkali metals or alkaline earth metals (e. g.
lithium amide, sodium amide, lithium diisopropylamide, lithium dicyclohexylamide, lithium hexamethyldisilazide, sodium hexamethyldisilazide, potassium hexamethyldisilazide, etc.), lower alkoxides of alkali metals or alkaline earth metals (e. g. sodium methoxide, sodium ethoxide, potassium tert-butoxide, etc.), etc.;
2) for example, inorganic bases such as hydroxides of alkali metals or alkaline earth metals (e. g. sodium hydroxide, potassium hydroxide, lithium hydroxide, barium hydroxide, etc.), carbonates of alkali metals or alkaline earth metals (e. g. sodium carbonate, potassium carbonate, cesium carbonate, etc.) and hydrogencarbonates of alkali metals or alkaline earth metals (e. g. sodium hydrogencarbonate, potassium hydrogencarbonate, etc.), etc.: and 3) for example, organic bases exemplified by amines such as triethylamine, diisopropylethylamine, N-methylmorpholine, dimethylaminopyridine, DBU (1,8-diazabicyclo[5.4.0]undec-7-en), DBN (1,5-diazabicyclo[4.3.0]non-5-en), etc.; basic heterocyclic compounds such as pyridine, imidazole, 2,6-lutidine, etc.: and the like.
Among the above bases, triethylamine, 4-dimethylaminopyridine, etc., are preferable.
Reaction temperature is usually room temperature (0°C
to 30°C, hereafter the same). Reaction time is, for example, 10 to 24 hours.
ii) Method using a reactive derivative of carboxylic acid A reactive derivative of compound (II) and 1 to 5 equivalents (preferably 1 to 3 equivalents) of compound (III) are reacted in an inert solvent. If necessary, the reaction can be carried out with the coexistence of 1 to 10 equivalents, preferably 1 to 3 equivalents of a base.
Examples of the "reactive derivative" of compound (II) include acid halides (e. g., acid chloride, acid bromide, etc.), mixed acid anhydrides (e. g. acid anhydrides with C1_s alkyl-carboxylic acid, C6-to aryl-carboxylic acid or C1-s alkylcarbonate), active esters (e. g. esters with phenol which may be substituted, 1-hydroxybenzotriazole or N-hydroxysuccinimide, etc.), etc.
Examples of the "substituents" in the "phenol which may be substituted" include halogen atom (e. g. fluorine, chlorine, bromine, iodine, etc.), nitro, optionally halogenated C1_6 alkyl, optionally halogenated C1_6 alkoxy.
The number of substituents is, for example, 1 to 5.
As the "optionally halogenated C1_6 alkyl" and "optionally halogenated C1_6 alkoxy", those exemplified as "substituents" in the above "cyclic group which may be substituted" can be used.
Specific examples of "phenol which may be substituted"
include phenol, pentachlorophenol, pentafluorophenol, p nitrophenol, etc. The reactive derivative is, preferably, an acid halide.
Examples of the "inert solvent" include ether solvents, halogenated hydrocarbon solvents, aromatic solvents, nitrile solvents, amide solvents, ketone solvents, sulfoxide solvents, and water. Two or more kinds of these can be mixed in an appropriate ratio for use. Especially, acetonitrile, THF, dichloromethane, chloroform, etc. are preferable.
As the "base" , the same as above are used. The base is preferably sodium hydride, potassium carbonate, sodium carbonate, sodium hydroxide, potassium hydroxide, sodium hydrogencarbonate, potassium hydrogencarbonate, triethylamine, pyridine, etc.
Reaction temperature is usually -20°C to 50°C, preferably room temperature. Reaction time is usually 5 minutes to 40 hours, preferably 1 to 18 hours.

Further, the compound of the formula (I) wherein X is - (CHZ) WsS02- or - (CHZ) w3S0- (the symbols are as defined above) can be produced by subjecting a sulfonic acid of the formula R- (CHZ) W3-SOaOH (the symbols are as defined above) or a sulfinic acid of the formula R-(CHZ)W3-SOOH (the symbols are as defined above) to the same method as the above "method using a reactive derivative of carboxylic acid".
Compound (II) can be produced by per se known methods or analogous methods thereto.
Compound (III) can be produced by per se known methods, for example, the methods described in Chem. Pharm. Bull., 4377(1988), JP 9-506885 A, JP 10-504315 A, etc. or analogous methods thereto.
For example, compound (III) can be produced by subjecting the compound of the formula:

_ ~R --.~
W N B I j Y N\ 2!~ (Illa) ~ R
wherein W is a protecting group for amino; and the other symbols are as defined above, to a deprotection reaction to remove W.
Examples of the protecting group for amino represented by W include formyl, C1_6 alkyl-carbonyl (e. g. acetyl, propionyl, etc.), C1_6 alkoxy-carbonyl (e. g. methoxycarbonyl, ethoxycarbonyl, tert-butoxycarbonyl, etc.), benzoyl, C,_lo aralkyl-carbonyl (e.g. benzylcarbonyl, etc.), C~_14 aralkyloxy-carbonyl (e.g. benzyloxycarbonyl, 9-fluorenylmethoxycarbonyl, etc.), trityl, phthaloyl, N,N-dimethylaminomethylene, silyl (e. g. trimethylsilyl, triethylsilyl, dimethylphenylsilyl, tert-butyldimethylsilyl, tert-butyldiethylsilyl, etc.), CZ_6 alkenyl (e. g. 1-allyl, etc. ) , etc. These groups may be substituted by 1 to 3 of halogen atom (e. g. fluorine, chlorine, bromine, iodine, etc.), C1_6 alkoxy (e.g. methoxy, ethoxy, propoxy, etc.) or nitro, etc.
The deprotection reaction is carried out, for example, by maintaining compound (IIIa), preferably at 20°C to 140°C, in an aqueous solution of an acid such as a mineral acid (e. g., hydrochloric acid, sulfuric acid, hydrobromic acid, iodic acid, periodic acid, etc.) etc., or a base such as an alkali metal hydroxide (e. g., sodium hydroxide, potassium hydroxide, lithium hydroxide, etc.) etc. The acid or base is usually used in an amount of 1 to 100 equivalents, preferably 1 to 40 equivalents based on compound (IIIa).
Strength of the acid or base is usually 0.1 N to 18 N, preferably 1 N to 12 N. Reaction time is usually 0.5 hour to 48 hours, preferably 1 hour to 24 hours.
Further, when W is t-butoxycarbonyl group, etc., the deprotection reaction can also be carried out by dissolving compound (IIIa) in an organic acid (e. g., trifluoroacetic acid, formic acid, acetic acid, methanesulfonic acid, benzenesulfonic acid, trifluoromethanesulfonic acid, etc.) and maintaining the solution usually at -20°C to 200°C, preferably 0°C to 100°C. The organic acid is used in an amount of 1 to 100 equivalents, preferably 1 to 40 equivalents based on compound (IIIa).
The deprotection reaction can also be carried out by subjecting compound (IIIa) to catalytic reduction in an alcoholic solvent, for example, ethanol, etc., or a solvent such as acetic acid, etc., with a catalyst such as palladium, palladium-carbon, Raney nickel, Raney cobalt, platinum oxide, etc. at normal pressure or, if necessary, under pressure.
Compound (IIIa) can be produced by per se known methods or analogous methods thereto. For example, compound (IIIa) wherein Y is Cz_6 alkenylene [e.g., -CH=CH
(CHZ) W9- (w4 is as defined above) ] , i. e. , compound (IIIaa) , can be produced, for example, according to the following [Reaction scheme 1-1].
[Reaction scheme 1-1]

/R,.. (aa) w -N B I j C--CHz --- (C~,~ - L + H "-N\ .
v Ra , .
(IVa) (Va) o /R' ~ (~) w N B I % C CH2 (C~'fzy~ ~ N\
(Vla) R,.. (ac) w -N B I A C a-~2- (~~w-N~
~ pa . .
(VI la) .' W -N B I i CH-CH - (-N
..
(Illaa) wherein L is a leaving group and the other symbols are as defined above.
In the step (aa), compound (VIa) is produced by a condensation reaction of compound (IVa) and compound (Va).
Examples of the "leaving group" represented by L
include halogen atom (e. g. chlorine, bromine, iodine, etc.), optionally halogenated C1-6 alkylsulfonyloxy (e. g.
methanesulfonyloxy, ethanesulfonyloxy, trifluoromethanesulfonyloxy, etc.), Cs-to arylsulfonyloxy which may be substituted, hydroxy, etc.
Examples of the "substituents" in the "C6_lo arylsulfonyloxy which may be substituted" include halogen atom (e. g. chlorine, bromine, iodine, etc.), optionally halogenated C1_6 alkyl, C1_6 alkoxy, etc. The number of substituents is, for example, 1 to 3. Specific examples of the C6_lo arylsulfonyloxy which may be substituted" include benzenesulfonyloxy, p-toluenesulfonyloxy, 1-naphthalenesulfonyloxy, 2-naphthalenesulfonyloxy, etc.
The "leaving group" is preferably halogen atom (e. g.
chlorine, bromine, iodine, etc.), methanesulfonyloxy, trifluoromethanesulfonyloxy, p-toluenesulfonyloxy, etc.
This reaction is usually carried out in an inert solvent.
Examples of the "inert solvent" include alcohol solvents, ether solvents, halogenated hydrocarbon solvents, aromatic solvents, nitrile solvents, amide solvents, ketone solvents, sulfoxide solvents, water, etc. Two or more kinds of these can be mixed in an appropriate ratio for use.
Especially, acetonitrile, N,N-dimethylformamide (DMF), acetone, ethanol, pyridine, etc., are preferred.
Compound (Va) is used in an amount of 1 equivalent to 100 equivalents based on compound (IVa). Further, compound (Va) can be used in an amount corresponding to a reaction solvent.
Reaction temperature is about -20°C to 200°C, preferably room temperature to 100°C. Reaction time is, for example, 0.5 hour to 1 day.
This condensation reaction may be carried out in the presence of a base. The base is preferably sodium hydride, potassium carbonate, sodium carbonate, sodium hydroxide, potassium hydroxide, sodium hydrogencarbonate, potassium hydrogencarbonate, triethylamine, pyridine, etc. The amount of the base is 0.1 to 100 equivalents, preferably 1 to 10 equivalents based on compound (IVa).
Compound (IVa) can be produced by a per se known method or an analogous method thereto. For example, compound (IVa) can be produced by the method described in JP 6-166676 A, etc. or an analogous method thereto.
Further, compound (Va) can be produced by a per se known method or an analogous method thereto.
In the step (ab), compound (VIIa) is produced by subjecting compound (VIa) to a reducing reaction.
This reducing reaction can be carried out by using a reducing agent such as sodium borohydride, lithium aluminum hydride, triethylsilane, etc.
The reducing reaction can be carried out, for example, according to the methods described in Reduction with Complex Metal Hydrides, Interscience, New York (1956); Chem.
Soc. Rev., ~, 23 (1976); Synthesis, 633 (1974); J. Am. Chem.
Soc., ~1, 2967 (1969); J. Org. Chem., 2.~, 121 (1964); Org.
Reactions, 1, 15 (1942); Angew. Chem., 11, 726 (1956);

Synthesis, 633 (1974); J. Am. Chem. Soc., $Q, 2896 (1958);
Org. Reactions, 4, 378 (1948); J. .Am. Chem. Soc., 19$, 3385 (1986); etc., or analogous methods thereto.
In the step (ac), compound (IIIaa) is produced by subjecting compound (VIIa) to dehydration reaction.
This dehydration reaction can be carried out with heating or at room temperature, if necessary, by using an acid catalyst (e. g., sulfuric acid, phosphoric acid, potassium hydrogen sulfate, p-toluenesulfonic acid, boron trifluoride-ether complex, iodine, etc.). Further, the dehydration reaction can also be carried out by using an activating agent such as thionyl chloride-pyridine, phosphorus oxychloride-pyridine, etc.
The dehydration reaction can be carried out, for example, according to the methods described in Org. Synth., I, 183 (1941); Org. Synth., ~, 430 (1941); Org. Synth., TTT, 204 (1955); Org. Synth., ~, 307 (1988); Synthesis, TTl', 1159 (1980); J. Am. Chem. Soc., ~, 6690 (1984);
Tetrahedron Lett., 599 (1871); etc., or analogous methods thereto.
Further, compound (VIa) used in [Reaction scheme 1-1]
wherein w4 is l, i.e., compound (VIaa), can be produced, for example, by subjecting compound (IXa), compound (Va) and formaldehyde to Mannich reaction according to the following [Reaction scheme 1-2].

[Reaction scheme 1-2]
o /~-:- (ae) ~~o ~R~~.
W'-N B I i C-CHs + H -N~ W !N B I i C-CHa ~-N~
HGHO pa . .
(,~,) Na) (vlaa) wherein the symbols are as defined above.
Mannich reaction in the step (ae) can be carried out, for example, according to the methods described in Org.
Reactions, 1, 303 (1942); Tetrahedron Lett., 1$, 1299 (1977); etc., or analogous methods thereto.
Compound (IXa) can be produced by a per se known method or an analogous method thereto. For example, compound (IXa) can be produced according to the method described in J. Chem. Soc., Perkin Trans. 1, 2993 (1994), etc., or an analogous method thereto.
Compound (VIaa) can also be produced by the following [Reaction scheme 1-3].
W' N B I j C-Chh + (~?~~ -N~ ~ . , W N B I j C-CH CH N~ FP . ~'~
(p) (~) (Xla) (a9~
_~i wherein R9 is C1_6alkyl and the other symbols are as defined above.
As the "C1_6 alkyl" represented by R9, the same as the "C1_6 alkyl" represented by the above R4 can be mentioned.
That is, compound (VIaa) can be produced by carrying out in turn the step (af): the condensation reaction of compound (IXa) and (Xa): and the step (ag): the reducing reaction of compound (XIa).
The step (af) can be carried out by using a per se known condensation reaction. The condensation reaction can be carried out, for example, by the methods described in J.
Heterocyclic Chem., ~Q, 23 (1993); Heterocycles, 22, 195 (1984); etc., or analogous methods thereto:
Compound (Xa) can be produced by a per se known method or an analogous method thereto.
The step (ag) can be carried out by using a per se known reducing reaction (e.g., catalytic reduction using a transition metal catalyst such as Pd/C, etc.; reducing reaction using a metal hydride such as Et3SiH, etc.:
reducing reaction using a metal hydrogen complex such as NaBH(OAc)3, etc.). For example, the reducing reaction can be carried out by the methods described in J. Am. Chem.
Soc., 75., 5014 (1954); Bull. Chem. Soc. Jpn., ~, 3506 (1972); etc., or analogous methods thereto.
Compound (IIIa) wherein Y is -O-(CH2)Wz- (w2 is as defined above), i.e., compound (IIIab), can be produced by subjecting compound (IXb) and compound (Xb) to a dehydration reaction, for example, under the conditions of Mitsunobu reaction according to the following [Reaction scheme 2-1].
[Reaction scheme 2-1]
/ R,... ( ba ) W -N B I j OH + HO- U~),~a N\
R2..
(Xb) (IXb) /R~...
w W-N B ( % O- ICHZwrt N\
(Illab) wherein the symbols are as defined above.
The dehydration reaction in the step (ba) can be carried out, for example, according to the methods described in Synthesis, 1 (1981); Bull. Chem. Soc. Jpn., 510 (1976); etc., or analogous methods thereto.
Compound (IXb) can be produced by a per se known method or an analogous method thereto.
Compound (Xb) can be produced by a per se known method or an analogous method thereto.
Compound (IIIa) wherein Y is -CO- (CHz) w~-CO- (w7 is as defined above), i.e., compound (IIIac) can be synthesized by subjecting compound (IVd) and compound (Va) to the above "amidation reaction" according to the following [Reaction scheme 2-2].

[Reaction scheme 2-2]
R' "
W -.N g I A q'_ iC~m - COZH ~. H -N
(lva) Na) /A, ..

W -N g I ~ C-~CI'~t~w7'_'C' N~
..
(lilac) wherein the symbols are as defined above.
Compound (IVd) can be produced according to a per se known method or an analogous method thereto.
[Production method 2]
Compound ( I ) wherein X is - ( CHZ ) w3-COO ( CH2 ) W4- ( the symbols are as defined above), i.e., compound (Ib), can be produced by the following esterification reaction.
(Esterification reaction) R-(CHt~r3-COOH + HO-(CHi)w4-N B I j ._Y H ~ 2 (II) (IYb) R
R- (~=)w3 -C00 - (CH=) w4-N s I ~ ; Y-N ~
(1b) R ..

wherein the symbols are as defined above.
In this reaction, a reactive derivative of compound (II) and 1 to 5 equivalents (preferably 1 to 3 equivalents) of compound (IVb) is reacted in an inert solvent, usually, in the presence of 1 to 10 equivalents, preferably 1 to 3 equivalents of a base.
As the reactive derivative of compound (II), that exemplified in the above [Production method 1] is used.
Especially, an acid halide is preferable.
Examples of the "inert solvent" include ether solvents, halogenated hydrocarbon solvents, aromatic solvents, nitrile solvents, amide solvents, ketone solvents, sulfoxide solvents. Two or more kinds of these can be mixed in an appropriate ratio for use. Especially, acetonitrile, dichloromethane, chloroform, etc. are preferable.
As the "base", that exemplified in the above [Production method 1] can be used. The base is preferably sodium hydride, potassium carbonate, sodium carbonate, sodium hydroxide, potassium hydroxide, sodium hydrogencarbonate, potassium hydrogencarbonate, triethylamine, pyridine, etc.
Reaction temperature is usually -20°C to 50°C, preferably room temperature. Reaction time is usually 5 minutes to 40 hours, preferably 1 to 18 hours.

[Production method 3]
Compound (I) wherein X is - (CH2) W10 (CHZ) Wz- (the symbols are as defined above), i.e., compound (Ic), can be produced by, for example, the following etherification reaction.
(Etherification reaction) / R~..
R-(CHZ)rr1 "~ -~- HO-(CH=)w2 -N B I ~ .lf-N ~
(v) yYc) R .
/R~_.
R- (CHt~r 1-.'0 -. (CHt) w2 -N s I ~ Y-N ~
U c) R2_ wherein the symbols are as defined above.
In this reaction, compound (IVc) and about 1 to 5 equivalents (preferably 1 to 2 equivalents) of compound (V) are reacted in inert solvent in the presence of base.
As the "base", that exemplified in the above [Production method 1] can be used. The base is preferably potassium carbonate, sodium hydrogencarbonate, triethylamine, N-methylmorpholine, pyridine, etc.
The amount of the base used is usually about 1 to 5 equivalents based on compound (V).
Examples of the "inert solvent" include alcohol solvents, ether solvents, halogenated hydrocarbon solvents, aromatic solvents, nitrile solvents, amide solvents, ketone solvents, sulfoxide solvents, water. Two or more kinds of these can be mixed in an appropriate ratio for use.
Especially, acetonitrile, N,N-dimethylformamide (DMF), acetone, ethanol, pyridine, etc., are preferable.
Reaction temperature is about -20°C to 100°C, preferably room temperature to 80°C. Reaction time is, for example, about 0.5 hour to 1 day.
When the leaving group for L in compound (V) is hydroxy, compound (Ic) can be produced by using Mitsunobu reaction.
The Mitsunobu reaction is carried out by reacting compound (V) and 0.5 to 5 equivalents (preferably 1 to 1.5 equivalents) of compound (IVc) in inert solvent in the coexistence of 0.5 to 5 equivalents (preferably 1 to 1.5 equivalents) of ethyl acetyldicarboxylate.
Examples of the inert solvent include ether solvents, halogenated hydrocarbon solvents, aromatic solvents, nitrile solvents, amide solvents, ketone solvents, sulfoxide solvents. Two or more kinds of these can be mixed in an appropriate ratio for use. Especially, acetonitrile, dichloromethane, chloroform, etc. are preferable.
Reaction temperature is usually -20°C to 50°C, preferably room temperature. Reaction time is usually 5 minutes to 40 hours, preferably 1 to 18 hours.

Compound (IVc) can be produced by a per se known method.
[Production method 4]
Compound ( I ) whe rein X i s - ( CHZ ) W3NR8aC0 ( CH2 ) W4- ( the symbols are as defined above), i.e., compound (Id), can be produced, for example, by the following amidation reaction.
(Amidation reaction) Re a R"
R- NCH ~3 --NH + HOOC - (CHZ)w4 -N s ~ ~ . Y-N ~
~ R2 .
wi) (vi cd) Ra a I \ /R'..
R- (CHZ)w3 -NCO - (CHi)w4-N B ~ , . Y N ~
(I d) RZ_ wherein Rea is hydrogen atom or optionally halogenated C1_s alkyl and the other symbols are as defined above.
As the "optionally halogenated C1_6 alkyl" represented by Rea, that exemplified with respect to the above R8 can be mentioned.
This reaction is carried out in accordance with the above [Production method 1].
Compound (VI) can be produced by a per se known method.
Compound (VIId) can be produced by a per se known method.

[Production method 5]
Compound ( I ) where in X i s - ( CHZ ) WSNHCONRBa ( CHZ ) Ws- ( the symbols are as defined above), i.e., compound (Ie), can be produced, for example, by the following urea reaction.
(Urea reaction) Rs a R.
R- (CH ) -NH ~- H - (CHt)w6 -N ~ ( A Y-iV
t w5 : i \ Z .
(Yllle) ~C~ (IXe) R ' 0 0 ...
Re a /R .
R-(CHt)w5'-NHCON-(CHz)w6-N B ( ~ Y--N
\ Rz.
(1e) wherein the symbols are as defined above.
In this reaction, compound (IXe) and 1 to 5 equivalents (preferably 1 to 1.5 equivalents) of compound (VIIIe) is reacted in an inert solvent in the coexistence of a base.
As the "base", that exemplified in the above Production method 1] can be used. The base is preferably potassium carbonate, sodium carbonate, sodium hydroxide, potassium hydroxide, sodium hydrogencarbonate, potassium hydrogencarbonate, triethylamine, pyridine, etc.
Examples of the "inert solvent" include alcohol solvents, ether solvents, halogenated hydrocarbon solvents, aromatic solvents, nitrile solvents, amide solvents, ketone solvents, sulfoxide solvents, water. Two or more kinds of these can be mixed in an appropriate ratio for use.
Especially, acetonitrile, DMF, acetone, ethanol, pyridine, etc. are preferable.
Reaction temperature is usually -20°C to 100°C, preferably room temperature to 80°C. Reaction time is, for example, 0.5 hour to 1 day.
Compound (VIIIe) can be produced by a per se known method.
Compound (IXe) can be produced by a per se known method.
[Production method 6]
Compound (I) wherein R is a ring assembly aromatic group (Ar2-Ar3) which may be substituted, i.e., compound (If), can be produced by, for example, the following aryl-coupling reaction.
(Aryl-coupling reaction) L' \ R' z ~ ' L Ar3 X -N B ( A Y-1~!
Ar -8-L
(Xf) (Xlf) R .
2 3 \ R1.
Ar Ar-X -N B ~ ~ Y--N
(I f) \R2.
wherein Ar2 and Ar3 are monocyclic aromatic groups or condensed aromatic groups, each of which may be substituted; L1 is hydroxy or C1_6 alkyl; L2 is halogen (preferably chlorine, bromine) or trifluoromethanesulfonyloxy; the other symbols are as defined above.
As "substituents", "monocyclic aromatic groups" and "condensed aromatic groups" in the "monocyclic aromatic groups or condensed aromatic groups, each of which may be substituted" represented by Ar2 and Ar3, those exemplified as the above R and Arl can be used. Especially, it is preferable that both of Ar2 and Ar3 are phenyl groups which may be substituted, and Arz-Ar3 is biphenylyl which may be substituted.
The aryl-coupling reaction can be carried out in accordance with per se known methods such as the method described in Acta. Chemica Scandinavia, pp. 221-230, 1993, or methods analogous thereto.

In this reaction, compound (Xf) and 1 to 3 equivalents (preferably 1 to 1.5 equivalents) of compound (XIf) are reacted in an inert solvent in the presence of a base and a transition metal catalyst.
As the base, that exemplified in the above [Production method 1] can be used. The base is preferably sodium carbonate, sodium hydrogencarbonate, etc.
The amount of the "base" used is, for example, about 1 to 10 equivalents based on compound (XIf).
Examples of the "transition metal catalyst" include palladium catalyst, nickel catalyst. Examples of the "palladium catalyst" include tetrakis(triphenylphosphine)palladium (O), palladium acetate, bis (triphenylphosphine) palladium (II) chloride, palladium-carbon, etc. Examples of the "nickel catalyst"
include tetrakis(triphenylphosphine) nickel (0), etc.
The amount of the "transition metal catalyst" used is about 0.01 to 1 equivalent, preferably about 0.01 to 0.5 equivalent, based on compound (XIf).
Reaction temperature is room temperature to 150°C, preferably about 80°C to 150°C. Reaction time is, for example, about 1 to 48 hours.
Examples of the "inert solvent" include water, alcohol solvents, aromatic solvents. Two or more kinds of these can be mixed in an appropriate ratio for use. Especially, a single solvent such as water, ethanol and toluene; or a mixed solvent of two or more kinds of these is preferred.
Compound (Xf) can be produced by a per se known method.
Compound (XIf) can be produced by a per se known method.
[Production method 7]
Compound (I) wherein Y is Cz-6 alkenylene (e. g., CH=CHCHz), i.e., compound (Ig) can be produced by the following [Reaction scheme 3-1].
That is, compound (Ig) can be produced by carrying out in turn the step (Aa): a condensation reaction of compound (IXg) and compound (Xa); the step (Ab): a reducing reaction of compound (XIg); and the step (Ac): a dehydration reaction of compound (VIIg).
[Reaction scheme 3-1]

O /Rr.
~ -X-N s I % C-~ + ~~O}ZCH-N\ -_-{~X9) (Xa) O Rr...
Ar -X- N B I j C-CH=CH -N\
(X~9) \ ~ / H / Rr .. ( AC I
Ar -X- N B ~ j C-CHz CH2- N
\ ~,..
Nits) t.
/R
Ar -X-- N B I j CH=CH-CI-i~- N
,..
t~9) wherein the symbols are as defined above.
The condensation reaction of the step (Aa) can be carried out, for example, according to the same manner as that in the above step (af).
The reducing reaction of the step (Ab) can be carried out, for example, by a per se known method (e. g., catalytic reduction using a transition metal catalyst such as Pd/C, etc.; reducing reaction using a metal hydride such as Et3SiH, etc.; reducing reaction using a metal hydrogen complex such as NaBH9, etc.).

Further, this reaction can be carried out by a two-stage reaction, for example, by reducing the double bond under the same conditions as those of the above reducing reaction of the step (ag), followed by reducing the carbonyl group with a metal hydrogen complex such as NaBH4, etc.
The dehydration reaction of the step (Ac) can be carried out by the same manner as that in the above step (ac) .
Compound (IXg) can be produced by a per se known method.
Compound (I) can also be produced by subjecting compound (IIa) and compound (III) to a condensation reaction according to the following [Production method 8].
The "condensation reaction" can be carried out according to the same manner as the condensation reaction in the above step (aa) .
[Production method 8]
~Ri-~
R-X-~ + H -N 8 ~ j Y N\ ~I) (1!a) VIII) ...
wherein the symbols are as defined above.
Compound (IIa) can be produced by a per se known method or an analogous method thereto.

Compound (I') can be produced by subjecting compound (IIb) and compound (IIIb) to a condensation reaction, for example, according to the following [Production method 9].
The "condensation reaction" can be carried out according to the same manner as the condensation reaction in the above step (aa).
[Production method 9]
~Ri w Ark X-L + H _.N g' ~ % Y- N\ ( R2 ..
(!1b) ( !1l b) wherein the symbols are as defined above.
Compound (IIb) can be produced by a per se known method or an analogous method thereto.
Compound (IIIb) can be produced according to the same manner as that for the above compound (III).
Compound (I") can be produced by subjecting compound (IIa) and compound (IIIc) to a condensation reaction according to, for example, the following [Production method 10]. The "condensation reaction" can be carried out according to the same manner as the condensation reaction in the above step (aa).
[Production method 10]

R-x-L + H-N s I ~ 1fa-IC-N~Z-Rb ~- ( (11a) (Ilic) wherein the symbols are as defined above.
Compound (IIIc) can be produced according to the same manner as the above compound (III).
Examples of the above "alcohol solvents" include methanol, ethanol, isopropanol, tert-butanol, etc.
Examples of the above "ether solvents" include diethylether, tetrahydrofuran (THF), 1,4-dioxane, 1,2-dimethoxyethane, etc.
Examples of the above "halogenated hydrocarbon solvents" include dichloromethane, chloroform, 1,2-dichloroethane, carbon tetrachloride, etc.
Examples of the above "aromatic solvents" include benzene, toluene, xylene, pyridine, etc.
Examples of the above "hydrocarbon solvents" include hexane, pentane, cyclohexane, etc.
Examples of the above "amide solvents" include N,N-dimethylformamide (DMF), N,N-dimethylacetamide, N-methylpyrrolidone, etc.
Examples of the above "ketone solvent" include acetone, methylethylketone, etc.
Examples of the above "sulfoxide solvents" include dimethylsulfoxide (DMSO), etc.
Examples of the above "nitrile solvents" include acetonitrile, propionitrile, etc.
In a compound of the invention thus obtained, the intramolecular functional group can be converted to a desired functional group by combining per se known chemical reactions. Examples of the chemical reactions include oxidation reaction, reducing reaction, alkylation reaction, hydrolysis reaction, amination reaction, esterification reaction, aryl-coupling reaction, deprotection reaction.
In each of the above reactions, when the starting material compounds possess amino, carboxy, hydroxy, and/or carbonyl as substituents, protecting groups which are generally used in peptide chemicals, etc., can be introduced into these groups, and the desired compound can be obtained by removing the protecting groups after the reaction if necessary.
Examples of the protecting group for amino include those exemplified with respect to the above W.
Examples of the protecting group for carboxy include C1-6 alkyl (e. g. methyl, ethyl, propyl, isopropyl, butyl, tert-butyl, etc.), C,_11 aralkyl (e. g. benzyl, etc.), phenyl, trityl, silyl (e. g. trimethylsilyl, triethylsilyl, dimethylphenylsilyl, tert-butyldimethylsilyl, tert-butyldiethylsilyl, etc.), Cz_6 alkenyl (e. g. 1-allyl, etc.).

These groups may be substituted by 1 to 3 of halogen atom (e.g. fluorine, chlorine, bromine, iodine, etc.), C1-6 alkoxy (e. g. methoxy, ethoxy, propoxy, etc.) or nitro.
Examples of the protective group for hydroxy include C1_6 alkyl (e. g. methyl, ethyl, propyl, isopropyl, butyl, tert-butyl, etc.), phenyl, trityl, C~_lo aralkyl (e. g.
benzyl, etc.), formyl, C1_6 alkyl-carbonyl (e. g. acetyl, propionyl, etc.), benzoyl, C,_lo aralkyl-carbonyl (e. g.
benzylcarbonyl, etc.), 2-tetrahydropyranyl, 2 tetrahydrofuranyl, silyl (e. g. trimethylsilyl, triethylsilyl, dimethylphenylsilyl, tert-butyldimethylsilyl, tert-butyldiethylsilyl, etc.), CZ_6 alkenyl (e. g. 1-allyl, etc.). These groups may be substituted by 1 to 3 of halogen atom (e. g. fluorine, chlorine, bromine, iodine, etc.), C1_6 alkyl (e.g. methyl, ethyl, n-propyl, etc.). C1-s alkoxy (e. g. methoxy, ethoxy, propoxy, etc.) or nitro, etc.
Examples of the protecting group for carbonyl include cyclic acetal (e. g. 1,3-dioxane, etc.), and non-cyclic acetal (e. g. di-C1_6 alkylacetal, etc.).
Removal of the above protecting groups can be carried out in accordance with per se known methods such as those described in Protective Groups in Organic Synthesis, published by John Wiley and Sons (1980). For instance, the methods using acid, base, ultraviolet light, hydrazine, phenylhydrazine, sodium N-methyldithiocarbamate, tetrabutylammonium fluoride, palladium acetate, trialkylsilyl halide (e. g. trimethylsilyl iodide, trimethylsilyl bromide, etc.), and a reduction method, etc.
can be used.
The compound of the present invention can be isolated and purified by per se known methods such as solvent extraction, changing of liquid properties, transdissolution, crystallization, recrystallization, chromatography, etc.
It is also possible to isolate and purify the starting material compounds of the compound of the present invention, or their salts using the same known methods as above, but they can also be used as raw materials in the next process as a reaction mixture without being isolated.
The compound of the present invention possesses an excellent MCH receptor antagonistic action, therefore, it is useful as an agent for preventing or treating diseases caused by MCH. Also, the compound of the present invention is low in toxicity, and is excellent in oral absorbency and intracerebral transitivity.
Therefore, a melanin-concentrating hormone antagonist comprising a compound of the invention can be safely administered to mammals (e. g. rats, mice, guinea pigs, rabbits, sheep, horses, swine, cattle, monkeys, humans, etc.) as an agent for preventing or treating diseases caused by MCH.

Here, examples of the diseases caused by MCH include obesity (e. g. malignant mastocytosis, exogenous obesity, hyperinsulinar obesity, hyperplasmic obesity, hypophyseal adiposity, hypoplasmic obesity, hypothyroid obesity, hypothalamic obesity, symptomatic obesity, infantile obesity, upper body obesity, alimentary obesity, hypogonadal obesity, systemic mastocytosis, simple obesity, central obesity, etc.], hyperphagia, emotional disorders, reproductive function disorders, etc.
The compound of the present invention is also useful as an agent for preventing or treating lifestyle diseases such as diabetes, diabetic complications (e. g. diabetic retinopathy, diabetic neuropathy, diabetic nephropathy, etc.), arteriosclerosis, gonitis, etc.
Further, the compound of the present invention is useful as an anorectic agent.
The MCH antagonist and the pharmaceutical composition of the present invention can be used in combination with an alimentary therapy (e. g., alimentary therapy for diabetes) and exercise.
The MCH antagonist and the pharmaceutical composition of the present invention can be produced by subjecting the compound of the present invention, as it is, or together with a pharmacologically acceptable carrier, to pharmaceutical manufacturing process in accordance with a per se known means.
Here, examples of the pharmacologically acceptable carriers include various organic or inorganic carrier substances which are commonly used as materials for pharmaceutical preparations, such as excipients, lubricants, binders, and disintegrators in solid preparations; solvents, solubilizing agents, suspending agents, isotonizing agents, buffering agents, soothing agents, in liquid preparations:
and the like. Also, in the pharmaceutical manufacturing process, additives such as antiseptics, antioxidants, coloring agents, sweeteners, absorbents, moistening agents, etc., can be used, if necessary.
Examples of the excipients include lactose, sucrose, D-mannitol, starch, cornstarch, crystalline cellulose, light anhydrous silicic acid, etc.
Examples of the lubricants include magnesium stearate, calcium stearate, talc, colloidal silica, etc.
Examples of the binders include crystalline cellulose, sucrose, D-mannitol, dextrin, hydroxypropylcellulose, hydroxypropylmethylcellulose, polyvinylpyrrolidone, starch, saccharose, gelatin, methylcellulose, carboxymethylcellulose sodium, etc.
Examples of the disintegrators include starch, carboxymethylcellulose, carboxymethylcellulose calcium, crosscarmellose sodium, carboxymethylstarch sodium, low substituted hydroxypropylcellulose (L-HPC), etc.
Examples of the solvents include distilled water for injection, alcohol, propylene glycol, macrogol, sesame oil, corn oil, etc.
Examples of the solubilizing agents include polyethylene glycol, propylene glycol, D-mannitol, benzyl benzoate, ethanol, trisaminomethane, cholesterol, triethanolamine, sodium carbonate, sodium citrate, etc.
Examples of the suspending agents include surfactants such as stearyltriethanolamine, sodium lauryl sulfate, lauryl amino propionic acid, lecithin, benzalkonium chloride, benzethonium chloride, glyceryl monostearate; or hydrophilic polymers such as polyvinyl alcohol, polyvinylpyrrolidone, carboxymethylcellulose sodium, methylcellulose, hydroxymethylcellulose, hydroxyethylcellulose, hydroxypropylcellulose, etc.
Examples of the isotonizing agents include glucose, D-sorbitol, sodium chloride, glycerin, D-mannitol, etc.
Examples of the buffering agents include buffer solutions of phosphate, acetate, carbonate, citrate, etc.
Examples of the soothing agents include benzyl alcohol, etc.
Examples of the antiseptics include paraoxybenzoates, chlorobutanol, benzyl alcohol, phenethylalcohol, dehydroacetic acid, sorbic acid, etc.

Examples of the antioxidants include sulfite, ascorbic acid, etc.
The MCH antagonist and the pharmaceutical composition of the present invention can be safely administered orally or parenterally (e. g. by local, rectal and intravenous administration) in various dosage forms, for example, as oral drugs such as tablets (including sugar-coated tablets and film-coated tablets), powders, granules, capsules (including soft capsules), solutions; and parenteral preparations such as injectable preparations (e. g.
preparations for subcutaneous injections, intravenous injections, intramuscular injections, intraperitoneal injections, etc.), external preparations (e. g. nasal preparations, percutaneous preparations, ointments, etc.), suppositories (e. g. rectal suppositories, vaginal suppositories, etc.), sustained-release preparations (e. g.
sustained-release microcapsules, etc.), pellets, drip infusions, etc:
The content of the compound of the present invention in the MCH antagonist of the present invention and the content of the compound of the present invention in the pharmaceutical composition of the present invention are, for example, about 0.1 to 100$ by weight based on the total weight of the MCH antagonist or pharmaceutical composition, respectively.

The dose of the MCH antagonist and the pharmaceutical composition of the present invention can be appropriately selected depending on the subject of administration, route of administration, disease, etc.
For example, the dose per day when the MCH antagonist or the pharmaceutical composition of the present invention is orally administered to an adult obesity patient (body weight: about 60 kg), is about 0.1 to about 500 mg, preferably about 1 to about 100 mg, more preferably about 5 to about 100 mg, in terms of the compound of the present invention which is an active ingredient. This amount can be divided into one to several doses per day for administration.
The MCH antagonist and pharmaceutical composition of the present invention can be used in combination with other concomitant drugs which do not interfere with the MCH
antagonist and pharmaceutical composition of the present invention, for the purpose of "strengthening of therapeutic effect against obesity", "reduction of dose of MCH
antagonist", etc. Examples of the concomitant drugs include a "agents for treating diabetes", "agents for treating diabetic complications", "agents for treating obesity other than MCH antagonists", "agents for treating hypertension", "agents for treating hyperlipidemia", "agents for treating arthritis", "antianxiety agents", "antidepressant", etc. Two or more kinds of these concomitant drugs can be combined in an appropriate ratio for use.
Examples of the above "agents for treating diabetes"
include insulin sensitizers, insulin secretion enhancers, biguanides, insulins, a-glucosidase inhibitors, ~3 adrenaline receptor agonists, etc.
Examples of the insulin sensitizers include pioglitazone or its salt (preferably hydrochloride), troglitazone, rosiglitazone or its salt (preferably maleate), JTT-501, GI-262570, MCC-555, YM-440, DRF-2593, BM-13-1258, KRP-297, R-119702, etc.
Examples of the insulin secretion enhancers include sulfonylureas. Specific examples of the sulfonylureas include tolbutamide, chlorpropamide, tolazamide, acetohexamide, glyclopyramide and its ammonium salt, glibenclamide, gliclazide, glimepiride, etc.
Other than the above, examples of insulin secretion enhancers include repaglinide, nateglinide, mitiglinide (KAD-1229), JTT-608, etc.
Examples of biguanides include metformin, buformin, phenformin, etc.
Examples of insulins include animal insulins extracted from bovine or porcine pancreas; semi-synthetic human insulin which is enzymatically synthesized from insulin extracted from porcine pancreas: human insulin synthesized by genetic engineering, using Escherichia coli and yeast;
etc. As insulin, also employed are insulin-zinc containing 0.45 to 0.9 (w/w)~ of zinc; protamine-insulin-zinc produced from zinc chloride, protamine sulfate and insulin; etc. In addition, insulin can be an insulin fragment or derivative (e. g. INS-l, etc.).
Insulin can also include various types such as ultra immediate action type, immediate action type, two-phase type, intermediate type, prolonged action type, etc., and these can be selected depending on the pathological conditions of patients.
Examples of a-glucosidase inhibitors include acarbose, voglibose, miglitol, emiglitate, etc.
Examples of ~3 adrenaline receptor agonists include AJ-9677, BMS-196085, SB-226552, AZ40140, etc.
Other than the above, examples of the "agents for treating diabetes" include ergoset, pramlintide, leptin, BAY-27-9955, etc.
Examples of the above "agents for treating diabetic complications" include aldose reductase inhibitors, glycation inhibitors, protein kinase C inhibitors, etc.
Examples of aldose reductase inhibitors include torlestat; eparlestat: imirestat: zenarestat; SNK-860;
zopolrestat; ARI-509; AS-3201, etc.

Examples of glycation inhibitors include pimagedine.
Examples of protein kinase C inhibitors include NGF, LY-333531, etc.
Other than the above, examples of "agents for treating diabetic complications" include alprostadil, thiapride hydrochloride, cilostazol, mexiletine hydrochloride, ethyl eicosapentate, memantine, pimagedline (ALT-711), etc.
Examples of the above "agents for treating obesity other than MCH antagonists" include lipase inhibitors and anorectics, etc.
Examples of lipase inhibitors include orlistat, etc.
Examples of anorectics include mazindol, dexfenfluramine, fluoxetine, sibutramine, baiamine, etc.
Other than the above, examples of "agents for treating obesity other than MCH antagonists" include lipstatin, etc.
Examples of the above "agents for treating hypertension" include angiotensin converting enzyme inhibitors, calcium antagonists, potassium channel openers, angiotensin II antagonists, etc.
Examples of angiotensin converting enzyme inhibitors include captopril, enarapril, alacepril, delapril (hydrochloride), lisinopril, imidapril, benazepril, cilazapril, temocapril, trandolapril, manidipine (hydrochloride), etc.
Examples of calcium antagonists include nifedipine, amlodipine, efonidipine, nicardipine, etc.
Examples of potassium channel openers include levcromakalim, L-27152, AL0671, NIP-121, etc.
Examples of angiotensin II antagonists include losartan, candesartan cilexetil, valsartan, irbesartan, CS
866, E4177, etc.
Examples of the above "agents for treating hyperlipidemia (agents for treating arteriosclerosis)"
include HMG-CoA reductase inhibitors, fibrate compounds, etc.
Examples of HMG-CoA reductase inhibitors include pravastatin, simvastatin, lovastatin, atorvastatin, fluvastatin, lipantil, cerivastatin, itavastatin, ZD-4522, or their salts (e. g. sodium salts, etc.), etc.
Examples of fibrate compounds include bezafibrate, clinofibrate, clofibrate, simfibrate, etc.
Examples of the above "agents for treating arthritis"
include ibuprofen, etc.
Examples of the above "antianxiety agents" include chlordiazepoxide, diazepam, oxazolam, medazepam, cloxazolam, bromazepam, lorazepam, alprazolam, fludiazepam, etc.
Examples of the above "antidepressants" include fluoxetine, fluvoxamine, imipramine, paroxetine, sertraline, etc.
The timing of administration of the above concomitant drugs is not limited. The MCH antagonist or pharmaceutical composition and the concomitant drugs can be administrated to the subject simultaneously or at staggered times.
The dosages of the concomitant drugs can be determined in accordance with clinically used dosages, and can be appropriately selected according to the subject of administration, route of administration, diseases and combinations of drugs, etc.
The administration forms for the concomitant drugs are not particularly limited as long as the MCH antagonist or the pharmaceutical composition are used in combination with a concomitant drugs at the time of administration.
Examples of such administration forms includes 1) administration of a single preparation obtained by simultaneous preparation of MCH antagonist or pharmaceutical composition together with concomitant drugs, 2) simultaneous administration of two kinds of preparations obtained by separate preparation of MCH antagonist or pharmaceutical composition, and concomitant drugs, through the same route of administration, 3) staggered administration of two kinds of preparations obtained by separate preparation of MCH antagonist or pharmaceutical composition, and concomitant drugs, through the same route of administration, 4) simultaneous administration of two kinds of preparations obtained by separate preparation of MCH antagonist or pharmaceutical composition, and concomitant drugs, through different routes of administration, 5) staggered administration of two kinds of preparations obtained by separate preparation of MCH
antagonist or pharmaceutical composition, and concomitant drugs, through different routes of administration (for example, administration of MCH antagonist or pharmaceutical composition; and concomitant drugs in this order; or administration in reverse order).
The ratio of combination of MCH antagonist or pharmaceutical composition with concomitant drugs can be appropriately selected in accordance with the subject of administration, route of administration and diseases, etc.
BEST MODE FOR CARRYING OUT THE INVENTION
The present invention will be explained further in detail by the following Reference Examples, Examples, Preparation Examples, and Experimental Examples. However, these do not limit the present invention, and they can be changed within the scope that does not deviate from the scope of the present invention.
In the following Reference Examples and Examples, "room temperature" means 0 to 30°C. Anhydrous magnesium sulfate or anhydrous sodium sulfate was used to dry the organic layer. "~" means percent by weight, unless otherwise specified.

Infrared absorption spectra were determined by the diffuse reflectance method, using fourier transform type infrared spectrophotometer.

FABMS (pos) is mass spectrum determined by the (+) method, in Fast Atom Bombardment Mass Spectrometry.

MS (APCI) and MS (ESI) are mass spectra determine d by Atmospheric Pressure Chemical Inonization (APCI) or Electron Spray Ionization (ESI), respectively.

Other symbols used in the description have the following meanings.

s . singlet d . doublet t . triplet q . quartet m . multiplet br . broad J . coupling constant Hz . Hertz CDC13: heavy chloroform DMSO-d6 . heavy dimethylsulfoxide THF . tetrahydrofuran DMF . N,N-dimethylformamide DMSO . dimethylsulfoxide WSCD . 1-ethyl-3-(3-dimethylaminopropyl) carbodimide ., WSC . 1-ethyl-3-(3-dimethylaminopropyl) carbodimide hydrochloride 1H-NMR . proton nuclear resonance (Free substances were usually measured in CDC13.) IR . infrared absorption spectrum Me . methyl Et . ethyl HOBt . 1-hydroxy-1H-benzotriazole IPE . diisopropyl ether DMAP . 4-dimethylaminopyridine In this specification and drawings, when bases and amino acids are shown by codes, these codes are based on those by the IUPAC-IUB Commission on Biochemical Nomenclature or common codes in the concerned fields.
Examples of these codes are shown below. Also, where some optical isomers of amino acids can exist, the L form is shown unless otherwise specified.
DNA . deoxyribonucleic acid cDNA . complementary deoxyribonucleic acid A . adenine T . thymine G . guanine C . cytosine RNA . ribonucleic acid mRNA : messenger ribonucleic acid dATP . deoxyadenosine triphosphate dTTP . deoxythymidine triphosphate dGTP . deoxyguanosine triphosphate dCTP . deoxycytidine triphosphate ATP . adenosine triphosphate EDTA : ethylenediamine tetraacetic acid SDS . sodium dodecyl sulfate EIA . enzyme immunoassay Gly . glycine Ala . alanine Val . valine Leu . leucine Ile . isoleucine Ser . serine Thr . threonine Cys . cysteine Met . methionine Glu . glutamic acid Asp . aspartic acid Lys . lysine Arg . arginine His . histidine Phe . phenylalanine Tyr . tyrosine Tro . tryptophan Pro . proline Asn . asparagine Gln . glutamine pGl . pyroglutamine Me . methyl group Et . ethyl group Bu . butyl group Ph . phenyl group TC . thiazolidine-4(R)-carboxamide group Substituents, protecting groups and reagents frequently used in this specification, are shown by the following symbols.

Tos . p-toluenesulfonyl CHO . formyl Bzl . benzyl C12Bz1 . 2,6-dichlorobenzyl Bom . benzyloxymethyl Z . benxyloxycarbonyl C1-Z . 2-chlorobenzyloxycarbonyl Br-Z . 2-bromobenzyloxycarbonyl Boc . t-butoxycarbonyl DNP . dinitrophenol Trt . trityl Bum . t-butoxymethyl F~noc . N-9-fluorenylmethoxycarbonyl HOOBt . 3,4-dihydro-3-hydroxy-4-oxo-1,2,3-benzotriazine HONB . 1-hydroxy-5-norbornene-2,3-dicarbodiimide DCC . N,N'-dicyclohexylcarbodiimide SEQ ID NO in the SEQUENCE LISTING in the specification of the present application shows the following sequences.
[SEQ ID N0: 1] shows a synthetic DNA used for screening of cDNA coding rat SLC-1.
[SEQ ID NO: 2] shows a synthetic DNA used for screening of cDNA coding rat SLC-1.
[SEQ ID NO: 3] shows an entire amino acid sequence of rat SLC-1.
[SEQ ID NO: 4] shows an entire base sequence of rat SLC-lcDNA wherein Sal I recognition sequence was added to the 5' side, and Spe I recognition sequence was added to the 3' side.
[SEQ ID N0: 5] shows riboprobe used to determine the quantity of SLC-lmRNA expressed in each clone of rat SLC-1 expression CHO cells.
[SEQ ID NO: 6] shows a synthetic DNA used to obtain cDNA
for coding of human SLC-1.

[SEQ ID N0: 7] shows a primer used to make double-strand cDNA for coding human SLC-1.
[SEQ ID N0: 8] shows an entire base sequence of cDNA for coding human SLC-1.
[SEQ ID N0: 9] shows an entire amino acid sequence of human SLC-1.
[SEQ ID N0: 10] shows a synthetic DNA used for screening of cDNA for coding human SLC-1(S).
[SEQ ID NO: 11] shows a synthetic DNA used for screening of cDNA for coding human SLC-1(S).
[SEQ ID N0: 12] shows a synthetic DNA used for screening of cDNA for coding human SLC-1(L).
[SEQ ID N0: 13] shows a synthetic DNA used for screening of cDNA for coding human SLC-1(L).
[SEQ ID N0: 14] shows an entire base sequence of human SLC-1(S) cDNA wherein Sal I recognition sequence was added to the 5' side, and Spe I recognition sequence was added to the 3' side.
[SEQ ID N0: 15] shows an entire base sequence of human SLC-1(L) cDNA wherein Sal I recognition sequence was added to the 5' side, and Spe I recognition sequence was added to the 3' side.
[SEQ ID NO: 16] shows riboprobe used to determine the quantity of SLC-lmRNA expressed in each clone of human SLC-1(S) expression CHO cells and SLC-1(L) expression CHO cells.

Transformant Fs~:he_r;ch;a c-_n1; DH10B/phSLCIL8 transformed by plasmid containing DNA which codes the base sequence shown by SEQ ID N0: 9, obtained in Reference Example 1 - 6, has been deposited with National Institute of Bioscience and Human-Technology (NIBH), Agency of Industrial Science and Technology, Ministry of International Trade and Industry, under accession of number FERM BP-6632 since February 1, 1999; and with the Institute for Fermentation, Osaka, Japan (IFO), under accession number of IFO 16254 since January 21, 1999.
Examples Reference Example 1 Ethyl 6-(3-chloropropanoyl)-3,4-dihydro-1(2H)-quinoline carboxylate O
'CI
N
EtO~o Aluminum chloride (23.5 g, 176 mmol) was added to a solution of ethyl 3,4-dihydro-1(2H)-quinoline carboxylate (14.5 g, 70.4 mmol) and 3-chloropropionyl chloride (7.39 ml, 77.4 mmol) in dichloromethane under cooling with water-bath, and the mixture was stirred at room temperature for 14 hours. The reaction solution was poured into iced water and extracted with dichloromethane. The extract was washed with a saturated saline solution and dried over anhydrous sodium sulfate, and the solvent was distilled away under reduced pressure. The resulting residues were purified by silica gel column chromatography (developing solvent;
hexane . ethyl acetate - 3 . 1) and crystallized from hexane, whereby the title compound (15.6 g) was obtained as colorless powder with a mp. of 78 to 79 °C.
1H NMR (CDC13) b 1.35 (3H, t, J - 7.0 Hz), 1.93 (2H, m), 2.83 (2H, t, J = 6.2 Hz), 3.42 (2H, t, J = 7.0 Hz), 3.81 (2H, t, J = 6.2 Hz), 3.92 (2H, t, J = 7.0 Hz), 4.28 (2H, q, J = 7.0 Hz), 7.74 (2H, m), 7.92 (1H, d, J = 8.8 Hz).
Elemental analysis for C15H1aC1N03 Calcd.: C, 60.91; H, 6.13; N, 4.74.
Found: C, 61.20; H, 6.05; N, 4.74.
Reference Example 2 Ethyl 6-[3-(dimethylamino)propanoyl]-3,4-dihydro-1(2H)-quinoline carboxylate O
N,Me Me N
Et0'~o 50$ Aqueous dimethylamine (51 mL) was added to a solution of ethyl 6-(3-chloropropanoyl)-3,4-dihydro-1(2H)-quinoline carboxylate (15.0 g, 50.7 mmol) obtained in Reference Example 1 in dichloromethane at room temperature and then stirred for 2 hours. The reaction solution was separated, and the organic layer was washed with a saturated saline solution and dried over anhydrous sodium sulfate, and the solvent was distilled away under reduced pressure. The resultant residues were purified by alumina column chromatography (developing solvent; hexane . ethyl acetate - 1 . 1 ) , whereby the title compound ( 16. 3 g) was obtained as pale yellow matter.
1H NMR (CDC13) b: 1.34 (3H, t, J = 7.0 Hz), 1.96 (2H, m), 2.29 (6H, s), 2.79 (4H, m), 3.11 (2H, m), 3.79 (2H, m), 4.24 (2H, q, J = 7.0 Hz), 7.72-7.78 (2H, m), 7.78 (1H, d, J
- 8.4 Hz).
Reference Example 3 Ethyl 6-[3-(dimethylamino)propyl]-3,4-dihydro-1(2H)-quinoline carboxylate hydrochloride N,Me Me N
2 0 Et0~0 ' HCI
Triethyl silane (64.8 ml, 406 mmol) was added under a nitrogen atmosphere to a solution of ethyl 6-[3-(dimethylamino)propanoyl]-3,4-dihydro-1(2H)-quinoline carboxylate (15.4 g, 50.7 mmol) obtained in Reference Example 2 in trifluoroacetic acid and then stirred at room temperature for 5 days. The solvent was distilled away under reduced pressure, and ether was added to the residues which were then extracted with water. The aqueous layer was made basic with 8 N aqueous sodium hydroxide and then extracted with ethyl acetate. The extract was washed with a saturated saline solution and dried over anhydrous sodium sulfate, and the solvent was distilled away under reduced pressure. The resultant residues were purified by alumina column chromatography (developing solvent; hexane . ethyl acetate = 3 . 1). 4 N hydrogen chloride-ethyl acetate was added to a solution of the resultant oily matter in ether, and the formed solids were washed with diethyl ether, whereby the title compound (14.8 g) was obtained as hygroscopic colorless powder.
1H NMR ( CDC13, free base ) b : 1. 32 ( 3H, t, J = 7 . 0 Hz ) , 1. 78 (2H, m), 1.83 (2H, m), 2.22 (6H, s), 2.29 (2H, m), 2.56 (2H, m) , 2. 75 (2H, t, J = 6. 6 Hz) , 3. 74 (2H, m) , 4.24 (2H, q, J
- 7.0 Hz), 6.98 (2H, m), 7.59 (1H, d, J = 8.4 Hz).
Reference Example 4 N,N-Dimethyl-3-(1,2,3,4-tetrahydro-6-quinolinyl)-1-propan amine dihydrochloride N,Me Me N
~ 2HC1 A solution of ethyl 6-[3-(dimethylamino)propyl]-3,4-dihydro-1(2H)-quinoline carboxylate hydrochloride (14.5 g, 44.4 mmol) obtained in Reference Example 3 in concd.
hydrochloric acid (200 mL) was stirred at 120 °C for 16 hours, and the solvent was distilled away under reduced pressure and dried under reduced pressure, whereby the title compound (12.8 g) was obtained as hygroscopic powder with a mp. of 250 °C (decomp.).
1H NMR (D20) b 1.78 (4H, m), 2.41 (2H, t-like), 2.54 (6H, s), 2.60 (2H, t-like), 2.81 (2H, m), 3.22 (2H, m), 6.93 (3H, m) .
Elemental analysis for C19H22N2 ~ 2HC1 Calcd.: C, 57.73: H, 8.31; N, 9.62.
Found: C, 57.44; H, 8.22; N, 9.47.
Reference Example 5 1-[1-[(4'-Chloro[1,1'-biphenyl]-4-yl)carbonyl]-1,2,3,4-tetrahydro-6-quinolinyl] ethanone O
~Me N
~O
v CI
Oxalyl chloride (0.39 mL) and N,N-dimethylformamide (1 drop) were added in this order to a suspension of 4-(4-chlorophenyl)benzoic acid (1.05 g) in tetrahydrofuran (15 mL). After the mixture was stirred at room temperature for 1 hour, the solvent was distilled away under reduced pressure. The resultant residues were dissolved in tetrahydrofuran (10 mL) and then added to a suspension of 6-acetyl-1,2,3,4-tetrahydroquinoline (0.7 g), sodium hydroxide powder (0.31 g) and tetrabutyl ammonium hydrogensulfate (12 mg) in tetrahydrofuran (15 mL). After the mixture was stirred at room temperature for 3 hours, water was added to the reaction solution which was then extracted with ethyl acetate. The extract was washed with a saturated saline solution and dried over anhydrous magnesium sulfate, and the solvent was distilled away under reduced pressure. The resultant residues were crystallized from diethyl ether, whereby the title compound (1.1g) was obtained as colorless crystals with a mp of 149 to 151 °C.
1H NMR (CDC13) b: 2.03-2.15 (2H, m), 2.53 (3H, s), 2.94 (2H, t, J=6.4 Hz), 3.95 (2H, t, J=6.3 Hz), 6.87 (1H, d, J=8.6 Hz), 7.38-7.61 (9H, m) 7.79 (1H, s).
Elemental analysis for Cz4HZOC1N02 Calcd.: C, 73.94; H, 5.17; N, 3.59.
Found: C, 73.79; H, 5.13; N, 3.57.
Reference Example 6 (E)-1-[1-[(4'-Chloro[1,1'-biphenyl]-4-yl)carbonyl]-1,2,3,4-tetrahydro-6-quinolinyl]-3-(dimethylamino)-2-propen-1-one A mixture of 1-[1-[(4'-chloro[1,1'-biphenyl]-4-yl)carbonyl]-1,2,3,4-tetrahydro-1-quinolinyl] ethanone (0.65 g) obtained in Reference Example 5 and N,N-dimethylformamide dimethylacetal (8 ml) was stirred at 110 °C for 16 hours. The reaction solution was cooled to room temperature, then concentrated under reduced pressure and purified by alumina column chromatography (developing solvent; ethyl acetate). The resultant residues were crystallized from diethyl ether, whereby the title compound (1.1 g) was obtained as colorless crystals with a mp of 168 to 170 °C.
1H NMR (CDC13) ~: 2.00-2.15 (2H, m), 2.75-3.20 (8H, m), 3.95 (2H, t, J=6.4 Hz), 5.64 (1H, d, J=12.3 Hz), 6.76 (1H, d, J=8.4 Hz), 7.37-7.53 (9H, m) 7.75-7.82 (2H, m).
Elemental analysis for CZ~HZSC1Nz02 Calcd.: C, 72.88; H, 5.66; N, 6.30.
Found: C, 72.58; H, 5.84; N, 6.20.
Reference Example 7 1-(1-Acetyl-2,3,4,5-tetrahydro-1H-1-benzazepin-8-yl)-3-chloro-1-propanone / CI
Me~O O
Aluminum chloride (30.8 g, 231 mmol) was added to a solution of 1-acetyl-2,3,4,5-tetrahydro-1H-1-benzazepine (17.5 g, 92.5 mmol) and 3-chloropropionyl chloride (13.2 ml, 139 mmol) in dichloroethane under cooling with water-bath, and then the mixture was stirred at 50 °C for 1 day. The reaction solution was poured into iced water and extracted with dichloromethane. The extract was washed with a saturated saline solution and dried over anhydrous sodium sulfate, and the solvent was distilled away under reduced pressure. The resultant residues were purified by silica gel column chromatography (developing solvent; hexane ethyl acetate - 1 . 1) and crystallized from hexane, whereby the title compound (8.47 g) was obtained as colorless powder with a mp. of 106 to 107 °C.
1H NMR (CDC13) b: 1.41 (1H, m), 1.87 (3H, s), 1.87-2.08 (3H, m), 2.54-2.83 (3H, m), 3.44 (2H, m), 3.93 (2H, m), 4.74 (1H, m) , 7.38 (1H, d, J = 8.0 Hz) , 7.76 (1H, s) , 7.84 (1H, d, J
- 8.0 Hz) .
Reference Example 8 1-(1-Acetyl-2,3,4,5-tetrahydro-1H-1-benzazepin-8-yl)-3-(dimethylamino)-1-propanone Me N~Me Me~~ O
50 ~ aqueous dimethylamine (27 ml) was added to a solution of 1-(1-acetyl-2,3,4,5-tetrahydro-1H-1-benzazepin-8-yl)-3-chloro-1-propanone (7.10 g, 25.4 mmol) obtained in Reference Example 7 in dichloromethane at room temperature, and then stirred for 4 hours. After the reaction solution was separated, the organic layer was washed with a saturated saline solution and dried over anhydrous sodium sulfate, and the solvent was distilled away under reduced pressure. The resultant residues were purified by alumina column chromatography (developing solvent; hexane . ethyl acetate = 1 . 1) and crystallized from hexane, whereby the title compound (5.38 g) was obtained as colorless powder with a mp. of 68 to 70 °C.
1H NMR (CDC13) b: 1.40 (1H, m), 1.86 (3H, s), 1.81-2.07 (3H, m), 2.29 (6H, s), 2.59 (1H, m), 2.77 (4H, m), 3.13 (2H, m), 4.69 (1H, m), 7:36 (1H, d, J = 8.0 Hz), 7.75 (1H, d, J
1.8 Hz), 7.83 (1H, dd, J = 1.8, 8.0 Hz).
Elemental analysis for C1,HZ9Nz02 Calcd.: C, 70.80; H, 8.39; N, 9.71.
Found: C, 70.87; H, 8.16; N, 9.44.
Reference Example 9 (E)-3-(1-Acetyl-2,3,4,5-tetrahydro-1H-1-benzazepin-8-yl)-N,N-dimethyl-2-propen-1-amine Me / N'Me Me~~
Triethyl silane (22.2 ml, 139 mmol) was added under a nitrogen atmosphere to a solution of 1-(1-acetyl-2,3,4,5-tetrahydro-1H-1-benzazepin-8-yl)-3-(dimethylamino)-1-propanone (5.00 g, 17.3 mmol) obtained in Reference Example 8 in trifluoroacetic acid, and then the mixture was stirred at room temperature for 5 days: After the solvent was distilled away under reduced pressure, ether was added to the residues which were then extracted with water. The aqueous layer was made basic with 8 N aqueous sodium hydroxide and then extracted with ethyl acetate. The extract was washed with a saturated saline solution and dried over anhydrous sodium sulfate, and the solvent was distilled away under reduced pressure. The resultant residues were purified by alumina column chromatography (developing solvent; hexane . ethyl acetate - 1 . 1), whereby the title compound (2.74 g) was obtained as oily matter.
1H NMR (CDC13) b: 1.39 (1H, m), 1.73-2.05 (5H, m), 2.28 (6H, s), 2.53-2.75 (4H, m), 3.08 (2H, dd, J = 0.8, 6.6 Hz), 4.69 (1H, m), 6.24 (1H, dt, J = 6.6, 16.0 Hz), 6.48 (1H, d, J =
16.0 Hz), 7.12-7.27 (3H, m).
Reference Example 10 (E)-N,N-Dimethyl-3-(2,3,4,5-tetrahydro-1H-1-benzazepin-8-yl)-2-propen-1-amine Me N~Me H
A solution of (E)-3-(1-acetyl-2,3,4,5-tetrahydro-1H-1-benzazepin-8-yl)-N,N-dimethyl-2-propene-1-amine (2.73 g, 9.95 mmol) obtained in Reference Example 9 in concd.
hydrochloric acid was stirred at 120 °C for 12 hours.
After the solvent was distilled away under reduced pressure, the residues were made basic with 8 N aqueous sodium hydroxide and extracted with ethyl acetate. After the extract was washed with a saturated saline solution and dried over anhydrous sodium sulfate, the solvent was distilled away under reduced pressure, and the residues were crystallized from hexane, whereby the title compound (1.49 g) was obtained as colorless powder with a mp. of 87 to 88 °C.
1H NMR (CDC13) S: 1. 63 (2H, m) , 1. 78 (2H, m) , 2.26 (6H, s) , 2.74 (2H, m), 3.04 (4H, m), 3.78 (1H, br), 6.18 (1H, dt, J
- 6 . 6, 16 . 0 Hz ) , 6 . 42 ( 1H, d, J = 16 . 0 Hz ) , 6 . 75 ( 1H, d, J
- 1.6 Hz), 6.85 (1H, dd, J = 1.6, 7.8 Hz), 7.04 (1H, d, J =
7.8 Hz) .
Elemental analysis for C15Hz2Nz Calcd.: C, 78.21; H, 9.63; N, 12.16.
Found: C, 78.15; H, 9.73; N, 12.23.
Reference Example 11 (E)-1-[1-[(4'-Chloro[1,1'-biphenyl]-4-yl)carbonyl]-1,2,3,4-tetrahydro-6-quinolinyl]-3-piperidino-2-propen-1-one A mixture of (E)-[1-[(4'-chloro[1,1'-biphenyl]-4-yl)carbonyl]-1,2,3,4-tetrahydro-6-quinolinyl]-3-(dimethylamino)-2-propen-1-one (0.29 g) obtained in Reference Example 6 and piperidine (3 ml) was stirred at 110 °C for 2 hours. The reaction solution was cooled to room temperature, concentrated under reduced pressure and purified by alumina column chromatography (developing solvent; ethyl acetate). The resultant residues were crystallized from diethyl ether, whereby the title compound (0.28 g) was obtained as colorless crystals with a mp of 167 to 170 °C.
1H NMR (CDC13) b: 1.57-1.70 (6H, m), 2.03-2.15 (2H, m), 2.92 (2H, t, J=6.6 Hz), 3.25-3.45 (4H, m), 3.95 (2H, t, J=6. 4 Hz) , 5.74 (1H, d, J=12.5 Hz) , 6.74 (1H, d, J=8.4 Hz) , 7.37-7.61 (9H, m) 7.72-7.78 (2H, m).
Reference Example 12 1-(1-Acetyl-2,3-dihydro-1H-indol-5-yl)-3-(dimethylamino)-1-propanone O
N.Me Me Me~O
Using 1-acetyl indoline, the title compound was obtained as viscous oily matter by the same procedures as in Reference Examples 1 and 2.
1H NMR (CDC13) b: 2.21-2.33 (9H, m), 2.74 (2H, t, J=7.2 Hz), 3.11 (2H, t, J=7.2 Hz), 3.23 (2H, t, J=8.6 Hz), 4.12 (2H, t, J=8.6 Hz), 7.78-7.97 (2H, m) 8.24 (1H, d, J=8.4 Hz).
Reference Example 13 (E)-3-[2,3-Dihydro-1H-indol-5-yl]-N,N-dimethyl-2-propene-1-amine N, Me Me H
1) Sodium borohydride (0.75 g) was added to a solution of 1-(1-acetyl-2,3-dihydro-1 H-indol-5-y1)-3-(dimethylamino)-1-propanone (4.3 g) obtained in Reference Example 12 in methanol (40 ml) under cooling with ice-bath, and the mixture was stirred at 0 to 5 °C for 30 minutes.
After iced water was added to the reaction solution, the solvent was distilled away under reduced pressure, and the residues were extracted with ethyl acetate. The extract was washed with a saturated saline solution and dried over anhydrous magnesium sulfate, and the solvent was distilled away under reduced pressure. The resultant residues were purified by alumina column chromatography (developing solvent; ethyl acetate), whereby 3-[1-acetyl-2,3-dihydro-1H-indol-5-yl]-3-hydroxy-N,N-dimethyl-1-propanamine (3.3 g) was obtained as colorless powder.
2) A mixture of 3-[1-acetyl-2,3-dihydro-1H-indol-5-yl]-3-hydroxy-N,N-dimethyl-1-propanamine (3.3 g) obtained in 1) above and concd. hydrochloric acid (20 ml) was heated for 16 hours under reflux. The reaction solution was cooled to room temperature, then concentrated under reduced pressure, diluted with water, made basic with 2 N aqueous sodium hydroxide and extracted with ethyl acetate. The extract was washed with a saturated saline solution and dried over anhydrous magnesium sulfate, and the solvent was distilled away under reduced pressure, whereby the title compound (2.3 g) was obtained as oily matter.
1H NMR (CDC13) b: 2.25 (6H, s), 2.97-3.04 (4H, m), 3.55 (2H, t, J=8.2 Hz), ca. 3.8 (1H, br.s, NH), 5.98-6.09 (1H, m), 6.41 (1H, d, J=16.2 Hz), 6.56 (1H, d, J=8.1 Hz), 7.02 (1H, dd, J=1.5, 8.1 Hz) , 7.19 (1H, s) .
Reference Example 14 1-(1,2,3,4-Tetrahydro-6-quinolinyl)-4-(dimethylamino)-1-butanone o Me N~ Me N
H
Using ethyl 3,4-dihydro-1(2H)-quinoline carboxylate, the title compound was obtained as viscous oily matter by the same procedures as in Reference Examples l, 2 and 4.
1H NMR (CDC13) b: 1.87-2.00 (4H, m), 2.33 (6H, s), 2.48 (2H, t, J = 7. 4 Hz) , 2.78 (2H, t, J = 6. 3 Hz) , 2. 91 (2H, t, J =
7.2 Hz), 3.37 (2H, t, J = 5.6 Hz), 4.4 (1H, br, NH), 6.39 (1H, d, J = 9.2 Hz), 7.60-7.64 (2H, m).
Reference Example 15 4-Oxo-4-[2-(trifluoroacetyl)-1,2,3,4--tetrahydro-7-isoquinolinyl]butanoic acid O O
F~N I ~ C02H
FF
1) Trifluoroacetic anhydride (47.5 ml, 336 mmol) was added dropwise to a solution of 1,2,3,4-tetrahydroisoquinoline (25 g, 188 mmol) in THF (100 ml) at 0°C and stirred for 2 hours at room temperature, and then the solvent was distilled away under reduced pressure.
Water was poured into the residues which were then extracted with ethyl acetate, washed with 1 N hydrochloric acid, and dried over anhydrous magnesium sulfate. The solvent was distilled away under reduced pressure, whereby 43.5 g of 2-(trifluoroacetyl)-1,2,3,4-tetrahydroisoquinoline was obtained as oily matter.
1H-NMR (CDC13) b: 3.00-2.93 (2H, m), 3.92-3.80 (2H, m), 4.77 (2H, m), 7.28-7.13 (4H, m).
2) Aluminum chloride (26 g, 200 mmol) was added little by little to a mixture of 2-(trifluoroacetyl)-1,2,3,4-tetrahydroisoquinoline (10 g, 43.6 mmol) obtained in 1) above and succinic anhydride (4.8 g, 48 mmol) in dichloroethane at room temperature, and the mixture was stirred at 45 °C for 1 hour. The reaction solution was poured into iced water, extracted with ethyl acetate, washed with a saturated saline solution and dried over anhydrous magnesium sulfate. The solvent was distilled away under reduced pressure, and the residues were purified by silica gel column chromatography (developing solvent;
hexane . ethyl acetate = 1 . 1), whereby 7.5 g of the title compound was obtained as colorless powder.
1H-NMR (DMSO-d6) b: 2.58 (2H, m), 3.00 (2H, m), 3.23 (2H, m) , 3. 83 (2H, m) , 4. 84 (2H, m) , 7. 38 (1H, m) , 7. 84 (1H, m) , 7 . 93 ( 1H, m) , 12 . 17 ( 1H, s ) .
Reference Example 16 4-Oxo-4-[3-(trifluoroacetyl)-2,3,4,5-tetrahydro-1H-3-benzazepin-7-yl]butanoic acid O
O ~ C02H
~N~,~
F
F F
Using 2,3,4,5-tetrahydro-1H-3-benzazepine, the title compound was obtained as colorless powder by the same procedure as in Reference Example 15.
1H-NMR (CDC13) b: 2. 81 (2H, t, J=6.4Hz) , 2. 90-3.15 (4H, m) , 3.29 (2H, t, J=6.4Hz), 3.65-3.85 (4H, m), 7.20-7.33 (1H, m), 7.75-7.85 (2H, m), ca. 10 (1H, br).
Reference Example 17 N,N-Dipropyl-(4-ethoxycarbonylmethoxy-3-nitrophenyl) acetamide O
Et0' v 0 I ~ O
O N~'N~Me Me 1) A solution of nitric acid (24.5 ml, 398 mmol) in acetic acid (20 ml) was slowly added dropwise under cooling with ice-bath to a solution of (4-hydroxyphenyl)acetic acid (50.4 g, 330 mmol) in acetic acid (230 ml) such that the temperature of the reaction solution did not exceed 10 °C.
After the reaction solution was stirred for 2 hours, water (1 L) was added dropwise thereto and the precipitated crystals were collected by filtration. The resultant crystals were washed with water and dried, whereby (4 hydroxy-3-nitrophenyl)acetic acid (49 g) was obtained as crystals with a mp of 144 to 146 °C.
1H-NMR (CDC13) b: 3.76 (2H, s), 7.16 (1H, d, J - 8.8 Hz), 7.53 (1H, dd, J = 8.8, 2.2 Hz), 8.04 (1H, d, J = 2.2 Hz).
2) Thionyl chloride (50 ml, 680 mmol) was added dropwise to a solution of (4-hydroxy-3-nitrophenyl)acetic acid (25 g, 127 mmol) obtained in 1) in THF (100 ml) at room temperature, and the mixture was heated under reflux for 2 hours. The reaction solution was concentrated, and the resultant residues were dissolved in chloroform (250 ml) and added dropwise over 1 hour to a solution of dipropylamine (35 ml, 255 mmol) in chloroform (300 ml) under cooling with ice-bath. After this addition, the reaction solution was washed with water and aqueous saturated sodium bicarbonate, and the organic layer was dried over anhydrous sodium sulfate and concentrated. The residues were crystallized from ethyl acetate-hexane, whereby N,N-dipropyl-(4-hydroxy-3-nitrophenyl) acetamide (26.5 g) was obtained as crystals with a mp of 55 to 57 °C.
1H-NMR (CDC13) b : 0 . 8-1. 0 ( 6H, m) , 1. 4-1. 7 ( 4H, m) , 3 . 2-3 . 4 (4H, m) , 3. 67 (2H, s) , 7.12 (1H, d, J = 8. 6 Hz) , 7.53 (1H, dd, J = 8.6, 2.2 Hz), 7.96 (1H, d, J = 2.2 Hz).
3) Potassium carbonate (7.4 g, 53 mmol) was added to a solution of N,N-dipropyl-(4-hydroxy-3-nitrophenyl) acetamide (3.5 g, 17.8 mmol) obtained in 2) above and ethyl bromoacetate (3.0 ml, 26.7 mmol) in DMF (40 ml). After the reaction solution was stirred overnight at room temperature, water was added to the reaction solution which was then extracted with ethyl acetate. The extract was washed with water, dried over anhydrous sodium sulfate and concentrated.
The residues were recrystallized from ethyl acetate-hexane, whereby the title compound (4.9 g, 75 ~) was obtained as crystals with a mp of 79 to 80 °C.
1H-NMR (CDC13) ~: 0.8-1.0 (6H, m), 1.29 (3H, t, J = 7.0 Hz), 1.4-1.7 (4H, m), 3.1-3.4 (4H, m), 3.68 (2H, s), 4.27 (2H, q, J = 7.0 Hz) , 4.76 (2H, s) , 6. 96 (1H, d, J = 8. 6 Hz) , 7.38 (1H, dd, J = 8.6, 2.2 Hz), 7.77 (1H, d, J = 2.2 Hz).
Elemental analysis for C18H26N206 Calcd.: C, 59.00: H, 7.15; N, 7.65.
Found: C, 58.92: H, 7.15; N, 7.85.
Reference Example 18 Methyl 3-(4-ethoxycarbonylmethoxy-3-nitrophenyl)propionate O
EtOI v 0 OMe O
1) Using 3-(4-hydroxyphenyl)propionic acid, 3-(4-hydroxy-3-nitrophenyl)propionic acid was obtained as powder by the same procedure as in 1) in Reference Example 17.
1H-NMR (CDC13) b: 2.70 (2H, t, J = 7.4 Hz) , 2. 95 (2H, t, J
- 7.4 Hz), 7.10 (1H, d, J = 8.8 Hz), 7.46 (1H, dd, J = 8.8, 2.0 Hz), 7.96 (1H, d, J = 2.0 Hz).

Melting point: 80-82 °C (crystallizing solvent: ethyl acetate-hexane) 2) Thionyl chloride (15 ml) was added dropwise to a solution of 3-(4-hydroxy-3-nitrophenyl)propionic acid (49 g, 232 mmol) obtained in 1) above in methanol (500 ml), and the mixture was stirred overnight at room temperature.
After, the reaction solution was concentrated, water (500 ml) was added to the reaction solution which was then extracted with ethyl acetate. The extract was washed with water and aqueous saturated sodium bicarbonate, dried over magnesium sulfate and concentrated, whereby methyl 3-(4-hydroxy-3-nitrophenyl)propionate (47 g) was obtained as powder.
1H-NMR (CDC13) b: 2. 64 (2H, t, J = 7. 4Hz) , 2. 95 (2H, t, J =
7.4Hz), 3.68 (3H, s), 7.10 (1H, d, J = 8.6Hz), 7.46 (1H, dd, J = 8.6, 2.2Hz), 7.95 (1H, d, J = 2.2 Hz).
Melting point: 60-62 °C (crystallizing solvent: ethyl acetate-hexane) 3) Using methyl 3-(4-hydroxy-3-nitrophenyl)propionate obtained in 2) above, the title compound was obtained as powder by the same procedure as in 3) in Reference Example 17.
1H-NMR (CDC13) b: 1.28 (3H, t, J = 7. OHz) , 2. 64 (2H, t, J =
7.4Hz), 2.95 (2H, t, J = 7.4Hz), 3.67 (3H, s), 4.26 (2H, q, J = 7.OHz) , 4.75 (2H, s) , 6. 93 (1H, d, J = 8. 6Hz) , 7.38 (1H, dd, J = 8.6, 2.2Hz), 7.72 (1H, d, J = 2.2Hz).
Melting point: 70-72 °C (crystallizing solvent: ethyl acetate-hexane) Reference Example 19 3,4-Dihydro-6-(3-iodopropyl)-4-(2-naphthalenesulfonyl)-2H-1,4-benzoxazine O
I
v v v ~ OO
/ /
1) Using methyl 3-(4-ethoxycarbonylmethoxy-3-nitrophenyl)propionate obtained in Reference Example 18, methyl 3-(3,4-dihydro-2H-1,4-benzoxazine-3-oxo-6-yl)propionate was obtained as powder by the same procedure as in Example 133.
1H-NMR (CDC13) b: 2. 60 (2H, t, J = 7.4 Hz) , 2. 88 (2H, t, J
- 7.4 Hz), 3.68 (3H, s), 4.59 (2H, s), 6.7-7.0 (3H, m).
Melting point: 131-132 °C (crystallizing solvent: ethyl acetate-hexane) 2) 1 N borane/THF solution (150 ml, 150 mmol) was added to a solution of methyl 3-(3,4-dihydro-2H-1,4-benzoxazine-3-oxo-6-yl)propionate (24 g, 102 mmol) obtained in 1) above in THF (400 ml) under cooling with ice-bath.
The reaction solution was stirred overnight at room temperature, then 6 N hydrochloric acid (50 ml, 300 mmol) was added to the reaction solution which was then stirred for 2 hours, neutralized with 6 N aqueous sodium hydroxide and extracted with ethyl acetate. The extract was washed with water and a saturated saline solution, dried over magnesium sulfate, and concentrated. After triethylamine (25 g, 250 mmol) was added to a solution of the residues in acetonitrile (300 ml), a solution of 2-naphthalene sulfonyl chloride (56 g, 250 mmol) in acetonitrile (100 ml) was added thereto under cooling with ice-bath and stirred at room temperature for 4 hours. The reaction solution was concentrated, and water was added to the residues which were then extracted with ethyl acetate. The extract was washed with water and a saturated saline solution, dried over magnesium sulfate and concentrated. Sodium iodide (37.5 g, 250 mmol) was added to a solution of the residues in acetone (500 ml), and the mixture was stirred overnight at room temperature. The reaction solution was concentrated, and water (500 ml) was added to the concentrate which was then extracted with ethyl acetate.
The extract was washed with water and a saturated saline solution, dried over magnesium sulfate and concentrated, whereby the title compound (22 g) was obtained as powder.
1H-NMR (CDC13) b: 2.0-2.2 (2H, m), 2.71 (2H, t, J = 7.4 Hz), 3.18 (2H, t, J = 7.2 Hz), 3.72 (2H, t, J = 4.6 Hz), 3.93 ( 2H, t, J = 4 . 6 Hz ) , 6 . 70 ( 1H, d, J = 8 . 0 Hz ) , 6 . 90 ( 1H, dd, J - 8.0, 1.8 Hz), 7.5-7.8 (4H, m), 7.8-8.0 (3H, m), 8.30 (1H, s) .
Melting point: 87-88 °C (crystallizing solvent: ethyl acetate-hexane) Reference Example 20 N,N-Dipropyl-[4-(4-methoxyphenyl)carbonylmethoxy-3-nitrophenyl]acetamide O
O
O ~Me Me0 02N N
Me Using N,N-dipropyl-(4-hydroxy-3-nitrophenyl)acetamide obtained in 2) in Reference Example 17, the title compound was obtained as powder by the same procedure as in 3) in Reference Example 17.
1H-NMR (CDC13) b: 0.8-1.0 (6H, m), 1.4-1.7 (4H, m), 3.1-3.4 (4H, m), 3.65 (2H, s), 3.89 (3H, s), 5.34 (2H, s), 6.9-7.1 ( 3H, m) , 7 . 4 0 ( 1H, dd, J = 8 . 6, 2 . 2 Hz ) , 7 . 7 6 ( 1H, d, J =
2.2 Hz) , 8.00 (2H, d, J = 9. 0 Hz) .
Melting point: 95-97 °C (crystallizing solvent: ethyl acetate-hexane) Reference Example 21 3-(4-Chlorophenyl)propylamine 1) After a mixture of 3-(4-chlorophenyl)propionic acid (5.00 g, 27.0 mmol) and thionyl chloride (3 ml) was refluxed for 2 hours, an excess of the thionyl chloride was distilled away under reduced pressure. The resultant residues were dissolved in tetrahydrofuran (200 ml), dropped slowly to a suspension of LiAlH9 in tetrahydrofuran at 0 °C and stirred at room temperature for 1 hour. Water and 1 N aqueous sodium hydroxide were added to the reaction mixture, and after insolubles were filtered off, the filtrate was dried over anhydrous magnesium sulfate. The solvent was distilled away under reduced pressure, whereby 4.6 g 3-(4-chlorophenyl)propyl alcohol was obtained as oily matter.
1H-NMR (CDC13) ~: 1.86 (2H, tt, J = 7. 4, 7.4 Hz) , 2. 68 (2H, t, J = 7. 4 Hz) , 3. 67 (2H, t, J = 7. 4 Hz) , 7. 12 (2H, d, J =
8. 4 Hz) , 7.27 (2H, d, J = 8. 4 Hz) .
2 ) Mesyl chloride ( 2 .10 ml, 27 . 1 mmol ) was added to a solution of 3-(4-chlorophenyl)propyl alcohol (4.6 g, 27 mmol) obtained in 1) above and triethylamine (3.78 ml, 27.1 mmol) in tetrahydrofuran (100 m1) at 0 °C and stirred at room temperature for 30 minutes. Water was added to the reaction mixture which was then extracted with ethyl acetate. The extract was washed with an aqueous saturated NaCl solution and dried over anhydrous magnesium sulfate.
After the solvent was distilled away under reduced pressure, the reaction mixture and potassium phthalimide (5.02 g, 27.1 mmol) were dissolved in dimethylformamide and heated at 80 °C for 10 hours under stirring. 8 N aqueous sodium hydroxide was added to the resultant solution which was then extracted with ethyl acetate. The extract was washed with an aqueous saturated NaCl solution and dried over anhydrous magnesium sulfate. The solvent was distilled away under reduced pressure, whereby 7.47 g 2-[3-(4-chlorophenyl)propyl]-1H-isoindole-1,3(2H)-dione was obtained as solid.
1H-NMR (CDC13) b: 2.00 (2H, tt, J = 7.4, 7.4 Hz) , 2. 69 (2H, t, J = 7.4 Hz), 3.73 (2H, t, J = 7.4 Hz), 7.10-7.82 (4H, m), 7.69-7.89 (4H, m).
3) A solution of 2-[3-(4-chlorophenyl)propyl]-1H
isoindole-1,3(2H)-dione (7.47 g, 24.8 mmol) obtained in 2) above and hydrazine rnonohydrate (2.4 ml, 49.7 mmol) in ethanol was heated for 10 hours under reflux. After the solvent was distilled away, water was added to the residues which were then extracted with ethyl acetate. The extract was washed with an aqueous saturated NaCl solution and dried over anhydrous magnesium sulfate. The solvent was distilled away under reduced pressure, whereby 3.66 g of the title compound was obtained as oily matter.
1H-NMR (CDC13) b: 1.80 (2H, tt, J = 7.4, 7.4 Hz) , 2. 63 (2H, t, J - 7. 4 Hz) , 2. 76 (2H, t, J - 7. 4 Hz) , 3. 08 (2H, s) , 7.08-7.29 (4H, m).
Reference Example 22 2-[4-(4-Chlorophenyl)-1-piperidinyl]-2-oxoethylamine hydrochloride CI
H N NJ
HCI
to 1) Diethyl cyanophosphate (1.29 ml) was added to a solution of 4-(4-chlorophenyl)-1-piperidine hydrochloride (1.80 g), N-(tert-butoxycarbonyl) glycine (1.49 g) and triethylamine (2.38 ml) in DMF (80 ml). The reaction mixture was stirred at room temperature for 4 hours, diluted with water and extracted with ether. The extract was washed with a saturated saline solution and dried over anhydrous magnesium sulfate, and the solvent was distilled away under reduced pressure. The residues were purified by silica gel column chromatography (n-hexane/ethyl acetate -1/1), whereby tert-butyl-2-[4-(4-chlorophenyl)-1-piperidinyl]-2-oxoethyl carbamate (2.48 g) was obtained.
1H-NMR (CDC13) b: 1.46 (9H, s), 1.50-1.70 (2H, m), 1.80 2.00 (2H, m), 2.60-2.90 (2H, m), 3.00-3.20 (1H, m), 3.75 3.90 (1H, m), 3.99 (2H, m), 4.70-4.80 (1H, m), 5.56 (1H, m), 7.11 (2H, d, J=8.4Hz), 7.29 (2H, d, J=8.4Hz).
2) tert-Butyl-2-[4-(4-chlorophenyl)-1-piperidinyl]-2-oxoethyl carbamate (2.48 g) obtained in 1) above was dissolved in 4 N hydrogen chloride in ethyl acetate (50 ml) and stirred at room temperature for 4 hours. The solvent was distilled away under reduced pressure, whereby the title compound (2.16 g) was obtained.
MS(ESI) (M+H): 253.
1H-NMR (CDC13) b: 1.40-2.00 (4H, m), 2.65-3.00 (2H, m), 3.05-3.20 (1H, m), 3.75-4.00 (3H, m), 4.40-4.60 (1H, m), 7.27 (2H, d, J=8.8Hz), 7.37 (2H, d, J=8.5Hz), 8.25 (2H, m).
Reference Example 23 2-[4-(2-Methylphenyl)-1-piperidinyl]-2-oxoethylamine hydrochloride H2N~ /N Me 2 0 ~~ ' HCI
1) Using 4-(2-methylphenyl)-1-piperidine hydrochloride, tert-butyl-2-[4-(2-methylphenyl)-1-piperidinyl]-2-oxoethyl carbamate was obtained by the same procedure as in 1) in Reference Example 22.
1H-NMR (CDC13) b: 1.46 (9H, s), 1.55-1.75 (2H, m), 1.80 1.90 (2H, m), 2.36 (3H, s), 2.60-2.80 (1H, m), 2.90-3.20 (2H, m), 3.75-3.90 (1H, m), 4.01 (2H, m), 4.70-4.85 (1H, m), 5.58 (1H, m), 7.00-7.20 (4H, m).
2) Using tert-butyl-2-[4-(2-methylphenyl)-1 piperidinyl]-2-oxoethyl carbamate obtained in 1) above, the title compound was obtained by the same procedure as in 2) in Reference Example 22.
MS(ESI) (M+H): 233.
1H-NMR (CDC13) S: 1.40-2.00 (4H, m), 2.32 (3H, s),2.70-2.91 (1H, m), 2.95-3.30 (2H, m), 3.75-4.00 (3H, m), 4.40-4.60 (1H, m), 7.10-7.30 (4H, m), 8.25 (2H, m).
Reference Example 24 2-[4-(4-Fluorophenyl)-1-piperazinyl]-2-oxoethylamine dihydrochloride F
~N

2 0 ~ ' 2HC1 1) Using 1-(4-fluorophenyl) piperazine, tert-butyl-2-[4-(4-fluorophenyl)-1-piperazinyl]-2-oxoethyl carbamate was obtained by the same procedure as in 1) in Reference Example 22.
1H-NMR (CDC13) b: 1.46 (9H, s), 3.05-3.15 (4H, m), 3.55 (2H, t, J=5.lHz), 3.79 (2H, t, J=5.lHz), 4.01 (2H, d, J=4.5Hz), 5.52 (1H, m), 6.85-7.05 (4H, m).
2) Using tert-butyl-2-[4-(4-fluorophenvl)-1-piperazinyl]-2-oxoethyl carbamate obtained in 1) above, the title compound was obtained by the same procedure as in 2) in Reference Example 22.
MS (ESI) (M+H) : 238.
1H-NMR (CDC13) b: 3.25-3.60 (4H, m), 3.70-4.00 (6H, m), 7.15-7.30 (3H, m), 7.30-7.50 (1H, m).
Reference Example 25 2-[4-(2-Methoxyphenyl)-1-piperazinyl]-2-oxoethylamine dihydrochloride ~N
H N NJ OMe O ~ 2HC1 1) Using 1-(2-methoxyphenyl) piperazine, tert-butyl-2 [4-(2-methoxyphenyl)-1-piperazinyl]-2-oxoethyl carbamate was obtained by the same procedure as in l) in Reference Example 22.
1H-NMR (CDC13) S: 1.46 (9H, s), 3.00-3.07 (4H, m), 3.56 (2H, t, J=5.4Hz), 3.82 (2H, t, J=5.4Hz), 3.88 (3H, s), 4.01 (2H, d, J=4.5Hz), 5.56 (1H, m), 6.85-7.05 (4H, m).
2) Using tert-butyl-2-[4-(2-methoxyphenyl)-1 piperazinyl]-2-oxoethyl carbamate obtained in 1) above, the title compound was obtained by the same procedure as in 2) in Reference Example 22.
MS(ESI) (M+H): 250.
1H-NMR (CDC13) b: 3.20-3.50 (4H, m), 3.75-4.10 (6H, m), 3.87 (3H, s), 7.01 (1H, t, J=8.OHz), 7.15 (1H, d, J=8.OHz), 7.27 (1H, t, J=8.OHz), 7.49 (1H, d, J=8.OHz).
Reference Example 26 2-(4-Chlorophenoxy)ethylamine HN

1) Sodium hydride (60 a in oil, 640 mg, 16 mmol) was added to a solution of 4-chlorophenol (2 g, 15.6 mmol) in dimethylformamide (20 ml) and stirred at room temperature for 30 minutes, and then N-(2-bromoethyl) phthalimide (4 g, 15.6 mmol) was added thereto and heated at 50 °C for 2 hours under stirring. After the solvent was distilled away under reduced pressure, water was added to the residues which were then extracted with ethyl acetate. The extract was washed with an aqueous saturated NaCl solution and dried over anhydrous magnesium sulfate. The solvent was distilled away under reduced pressure, whereby 1.00 g of 2-[3-(4-chlorophenoxy)ethyl]-1H-isoindole-1,3(2H)-dione was obtained as powder.
1H-NMR (CDC13) b: 4. 10 (2H, t, J = 5. 7 Hz) , 4. 18 (2H, t, J
- 5.7 Hz), 7.10-7.82 (4H, m), 7.69-7.89 (4H, m).
2) Using 2-[3-(4-chlorophenoxy)ethyl]-1H-isoindole-1,3(2H)-dione obtained in 1) above, the title compound was obtained by the same procedure as in 3) in Reference Example 21.
1H-NMR (CDC13) ~: 3.10 (2H, t, J = 5.4 Hz), 3.40 (2H, s), 3.98 (2H, t, J = 5.4 Hz), 6.82 (2H, d, J = 9.2 Hz), 7.24 (2H, d, J = 9.2 Hz) .
Reference Example 27 tert-Butyl 8-hydroxy-1,3,4,5-tetrahydro-2H-2-benzazepine-2-carboxylate OH
2 N sodium hydroxide (40 ml) and t-butyl dicarbonate were added at 0 °C to a solution of 2,3,4,5-tetrahydro-1H-2-benzazepin-8-of hydrobromate (12.0 g, 49.2 mm) in chloroform ( 40 ml ) and water ( 40 ml ) , and the mixture was stirred at room temperature for 16 hours. Ethyl acetate was added to the resulting mixture which was then washed with a saturated saline solution and dried over anhydrous sodium sulfate. The solvent was concentrated under reduced pressure, and the resultant residues were formed into powder with ethyl acetate-isopropyl ether, to give the title compound (7.99 g).
1H NMR (CDC13) b: 1. 40 (9H, s) , 1.73 (2H, m) , 2.86 (2H, m) , 3.67 (2H, m), 4.30-4.36 (2H, m), 6.61-6.70 (2H, m), 6.98 ( 1H, m) .
Reference Example 28 1-[(4-Phenyl-1-piperidinyl)carbonyl]-1,2,3,4-tetrahydroquinoline N /
N" O
1) 1,2,3,4-Tetrahydroquinoline (1 ml, 7.97 mmol) was dissolved in THF (20 ml), and pyridine (1.58 ml, 15.93 mmol) was added thereto and cooled on ice. o-Nitronhenvl chloroformate (1.61 g, 7.97 mmol) was added to the reaction solution and stirred at room temperature for 4 hours, then water and a saturated saline solution were added, and the reaction solution was extracted with ethyl acetate. The extract was dried over magnesium sulfate and concentrated under reduced pressure, whereby 2.57 g 4-nitrophenyl 3,4 dihydroquinoline-1(2H)-carboxylate was obtained as pale yellow solution.
2) 4-Nitrophenyl 3,4-dihydroquinoline-1(2H)-carboxylate obtained in 1) above was dissolved in DMSO (10 ml), and 4-phenylpiperidine hydrochloride (1.58 g, 7.97 mmol) and 4 N aqueous sodium hydroxide (2.09 ml, 8.36 mmol) were added thereto and stirred at room temperature for 22.5 hours. 60 ml ethyl acetate was added to the reaction solution which was then washed with an aqueous potassium carbonate solution and a saturated saline solution. The organic layer was dried over magnesium sulfate and concentrated under reduced pressure, and the resultant residues were purified by silica gel column chromatography (developing solvent; hexane . ethyl acetate - 2 . 1), whereby 2.10 g of the title compound was obtained as pale yellow liquid.
1H-NMR (CDC13) b: 1. 68 (2H, m) , 1. 80 (2H, m) , 1. 98 (2H, m) , 2.65 (1H, m), 2.78 (2H, dd, J=6.6 and 6.9Hz), 2.85 (2H, m), 3.62 (2H, t, J=6.lHz), 3.95 (2H, m), 6.90 (1H, m), 7.04-7.32 (8H, m).
Example 1 3-[1-([1,1'-Biphenyl]-4-ylcarbonyl)-1,2,3,4-tetrahydro-6-quinolinyl]-N,N-dimethyl-1-propanamine Me Biphenylcarbonyl chloride (327 mg, 1.51 mmol) was added to a solution of N,N-dimethyl-3-(1,2,3,4-tetrahydro-6-quinolinyl)-1-propanamine dihydrochloride (400 mg, 1.37 mmol) obtained in Reference Example 4 and triethylamine (669 ml, 4.81 mmol) in dimethylformamide under cooling with ice-bath, and the mixture was stirred at room temperature for 3 days. Ethyl acetate was added to the reaction solution which was then washed with an aqueous saturated sodium bicarbonate solution and a saturated saline solution and dried over anhydrous sodium sulfate, and the solvent was distilled away under reduced pressure. The resultant residues were purified by alumina column chromatography (developing solvent; hexane . ethyl acetate - 3 . 1) and crystallized from hexane, whereby the title compound (113 mg) was obtained as colorless powder with a mp. of 100 to 101 °C.
1H NMR (CDC13) b: 1.73 (2H, m) , 2.06 (2H, m) , 2.20 (6H, s) , 2.26 (2H, m), 2.54 (2H, m), 2.83 (2H, m), 3.92 (2H, t-like), 6.72 (2H, m), 6.99 (1H, s), 7.35-7.60 (9H, m).
Elemental analysis for CZ,H3oN20 Calcd.: C, 81.37; H, 7.59; N, 7.03.
Found: C, 81.26; H, 7.46; N, 7.05.
Example 2 (E)-3-[1-([l,1'-Biphenyl]-4-ylcarbonyl)-2,3,4,5-tetrahydro-1H-1-benzazepin-8-yl]-N,N-dimethyl-2-propen-1-amine hydrochloride Me N~Me HCI
Biphenylcarbonyl chloride (423 mg, 1.95 mmol) was added to a solution of (E)-N,N-dimethyl-3-(2,3,4,5-tetrahydro-1 H-1-benzazepin-8-yl)-2-propene-1-amine (300 mg, 1.30 mmol) obtained in Reference Example 10, sodium hydroxide (130 mg, 3.26 mmol) and tetrabutylammonium hydrogensulfate (4.4 mg, 13.0 mmol) in tetrahydrofuran under cooling with ice-bath, and the mixture was stirred at room temperature for 5 hours. Ethyl acetate was added to the reaction solution which was then washed with a saturated saline solution and dried over anhydrous sodium sulfate, and the solvent was distilled away under reduced pressure. The resultant residues were purified by alumina column chromatography (developing solvent; hexane . ethyl acetate - 3 . 1 ) . 4 N hydrogen chloride in ethyl acetate was added to the resultant oily matter, and the formed crystals were washed with diethyl ether, whereby the title compound (124 mg) was obtained as colorless powder with a mp. of 112 to 113 °C.
1H NMR (CDC13, free base) b: 1.53 (1H, m), 1.96 (2H, m), 2 . 15 ( 6H, s ) , 2 . 77-3 . 07 ( 6H, m) , 5 . 04 ( 1H, m) , 5 . 93 ( 1H, dt, J = 6 . 6, 15 . 8 Hz ) , 6 . 20 ( 1H, d, J = 15 . 8 Hz ) , 6 . 68 ( 1H, s ) , 7.02-7.51 (11H, m).
Elemental analysis for CZ8H3oNz0 ~ HCl ~ 1. 5H20 Calcd.: C, 70.94; H, 7.23; N, 5.91.
Found: C, 71.40; H, 7.31; N, 6.11.
Example 3 3-[1-([1,1'-Biphenyl]-4-ylcarbonyl)-2,3,4,5-tetrahydro-1H-1-benzazepin-8-yl]-N,N-dimethyl-1-propanamine hydrochloride %%~Me N.Me ~ HCI
Palladium-carbon (200 mg) was added to a solution of (E)-3-[1-([1,1'-biphenyl]-4-ylcarbonyl)-2,3,4,5-tetrahydro-1H-1-benzazepin-8-yl]-N,N-dimethyl-2-propen-1-amine (238 mg, 0.580 mmol) obtained in Example 2 in tetrahydrofuran, and the mixture was stirred in a hydrogen atmosphere for 1.5 days. The catalyst was filtered off, and the solvent was distilled away under reduced pressure. The resultant residues were purified by alumina column chromatography (developing solvent; hexane . ethyl acetate = 3 . 1). 4 N
hydrogen chloride in ethyl acetate was added to the resultant oily matter, and the formed crystals were washed with diethyl ether, whereby the title compound (97.9 mg) was obtained as colorless powder with a mp. of 84 to 86 °C.
1H NMR (CDC13, free base) b 1.35-1.52 (3H, m), 1.93-2.00 (10H, m), 2.33 (2H, m), 2.79-3.02 (4H, m), 5.04 (1H, m), 6.49 (1H, s), 6.89 (1H, m), 7.12 (1H, d, J = 7.8 Hz), 7.22-7.52 (9H, m).
Elemental analysis for CzeHs2Nz0 ~ HCl ~ H20 Calcd.: C, 72.01; H, 7.55; N, 6.00.
Found: C, 71.88; H, 7.56; N, 5.99.
Example 4 3-[1-([4'-Chloro[l,l-biphenyl]-4-yl)carbonyl)-1,2,3,4-tetrahydro-6-quinolinyl]-3-hydroxy-N,N-dimethyl-1-propanamine OH
N,Me / Me O
Sodium borohydride (0.6g) was added to a solution of (E)-[1-[(4'-chloro[1,1'-biphenyl]-4-yl)carbonyl]-1,2,3,4-tetrahydro-6-quinolinyl]-3-(dimethylamino)-2-propen-1-one (0.3 g) obtained in Reference Example 6 in methanol (30 ml), and the mixture was heated for 3 hours under reflux. After the solvent was distilled away under reduced pressure, the residues were dissolved in water-ethyl acetate and extracted with ethyl acetate. The extract was washed with water and dried over anhydrous magnesium sulfate, and the solvent was distilled away under reduced pressure. The resultant residues were purified by alumina column chromatography (developing solvent; ethyl acetate), whereby the title compound (0.1 g) was obtained as amorphous powder.
1H NMR (CDC13) b: 1.72-1.80 (2H, m), 2.00-2.12 (2H, m), 2.28 (6H, s), 2.40-2.50 (1H, m), 2.60-2.70 (1H, m), 2.87 (2H, t, J = 6.7 Hz), 3.04 (2H, d, J = 6.6 Hz), 4.83 (1H, t, J = 5.9 Hz), 6.70-6.75 (1H, m), 6.87 (1H, d, J = 8.4 Hz), 7.22 (1H, s), 7.37-7.52 (8H, m).

Example 5 (E)-3-[1-[(4'-Chloro[1,1-biphenyl]-4-yl)carbonyl]-1,2,3,4-tetrahydro-6-quinolinyl]-N,N-dimethyl-2-propen-1-amine Concd. sulfuric acid (4 drops) was added to a solution of 3-[1-[(4'-chloro[l,l-biphenyl]-4-yl)carbonyl]-1,2,3,4-tetrahydro-6-quinolinyl]-3-hydroxy-N,N-dimethyl-1-propanamine (0.1 g} obtained in Example 4 in acetic acid (1 mL), and the mixture was stirred at 50 to 55 °C for 3 hours.
After the solvent was distilled away under reduced pressure, the residues were made basic with 2 N aqueous sodium hydroxide and then extracted with ethyl acetate. The extract was washed with water and dried over anhydrous magnesium sulfate, and the solvent was distilled away under reduced pressure. The resultant residues were purified by alumina column chromatography (developing solvent; ethyl acetate) and crystallized from diethyl ether, whereby the title compound (75 mg) was obtained as colorless powder with a mp of 162 to 164 °C.
1H NMR (CDC13) b: 2.02-2.13 (2H, m), 2.26 (6H, s), 2.85 (2H, t, J = 6 . 6 Hz ) , 3 . 04 ( 2H, d, J = 6. 4 Hz ) , 3 . 93 ( 2H, t, J =

6.4 Hz), 6.16 (1H, dt, J = 6.4, 15.9 Hz), 6.40 (1H, d, J =
15.9 Hz), 6.68 (1H, d, J = 8.5 Hz), 6.91 (1H, d, J = 8.5 Hz), 7.19 (1H, s), 7.37-7.53 (8H, m).
Elemental analysis for CZ~HZ,C1NZ0 Calcd.: C, 75.25; H, 6.31; N, 6.50.
Found: C, 74.90; H, 6.52; N, 6.35.
Example 6 1-[(4'-Chloro[l,l-biphenyl]-4-yl)carbonyl]-6-[(E)-3-piperidino-1-propenyl]-1,2,3,4-tetrahydroquinoline ~ ~ N
/
N
~O
/
CI
Using (E)-1-[1-[(4'-chloro[l,l'-biphenyl]-4-yl) carbonyl]-1,2,3,4-tetrahydro-6-quinolinyl]-3-piperidino-2-propen-1-one obtained in Reference Example 11, the title compound was obtained as colorless crystals with a mp of 141 to 143 °C by the same procedures as in Examples 4 and 5.
1H NMR (CDC13) b: 1.42-1.65 (6H, m), 2.00-2.09 (2H, m), 2.35-2.48 (4H, m), 2.84 (2H, t, J = 6.4 Hz), 3.08 (2H, d, J
- 6.7 Hz) , 3. 92 (2H, t, J = 6.4 Hz) , 6.20 (1H, dt, J = 6.7, 15.6 Hz), 6.38 (1H, d, J = 15.6 Hz), 6.66 (1H, d, J = 8.5 Hz), 6.89 (1H, d, J = 8.5 Hz), 7.18 (1H, s), 7.38-7.52 (8H, m) .
Elemental analysis for C3oH31C1Nz0 Calcd.: C, 76.50; H, 6.63; N, 5.95.
Found: C, 76.40; H, 6.64; N, 5.65.
Example 7 (E)-3-[1-[([l,1'-Biphenyl]-4-yl)carbonyl]-2,3-dihydro-1H-indol-5-yl]-N;N-dimethyl-2-propen-1-amine .Me 1e Using (E)-3-[2,3-dihydro-1H-indol-5-yl]-N,N-dimethyl-2-propen-1-amine obtained in Reference Example 13, the title compound was obtained as colorless crystals with a mp of 174 to 176 °C by the same procedure as in Example 2.
1H NMR (CDC13) b: 2.27 (6H, s), 3.06 (2H, d, J = 6.0 Hz), 3. 13 (2H, t, J = 8. 1 Hz) , 4.15 (2H, br) , 6. 11-6.23 (lH,m) , 6.46 (1H, d, J = 15.9 Hz), 7.06-7.28 (2H, m), 7.36-7.51 (3H, m), 7.61-7.70 (7H, m).
Elemental analysis for Cz6HzsN20 Calcd.: C, 81.64; H, 6.85; N, 7.32.
Found: C, 81.31 H, 6.84; N, 7.29.

Example 8 (E)-3-[1-[(4'-Chloro[1,1'-biphenyl]-4-yl)carbonyl]-2,3-dihydro-1H-indol-5-yl]-N,N-dimethyl-2-propen-1-amine N,Me Me N
~O
CI
Using (E)-3-[2,3-dihydro-1H-indol-5-yl]-N,N-dimethyl-2-propen-1-amine obtained in Reference Example 13, the title compound was obtained as colorless crystals with a mp of 208 to 211 °C by the same procedure as in Example 2.
1H NMR (CDC13) 5: 2.27 (6H, s), 3.06 (2H, d, J = 6.6 Hz), 3.12 (2H, t, J = 8.2 Hz), 4.14 (2H, br), 6.12-6.23 (lH,m), 6. 46 (1H, d, J = 15. 3 Hz) , 7. 06-7.28 (2H, m) , 7. 44 (2H, d, J = 6.6 Hz), 7.56 (2H, d, J = 6.6 Hz), 7.63 (5H, s).
Example 9 (E)-3-[1-[4-[(4-Methoxybenzyl)oxy]benzoyl]-2,3-dihydro-1H-indol-5-yl]-N,N-dimethyl-2-propen-1-amine Using (E)-3-[2,3-dihydro-1H-indol-5-yl]-N,N-dimethyl-2-propen-1-amine obtained in Reference Example 13, the title compound was obtained as colorless crystals with a mp of 164 to 166 °C by the same procedure as in Example 2.
1H NMR (CDC13) b: 2.27 (6H, s), 3.04-3.12 (4H, m), 3.83 (3H, s), 4.12 (2H, t, J - 8.2 Hz), 5.04 (2H, s), 6.10-6.21 (lH,m), 6.45 (1H, d, J = 15.9 Hz), 6.90-7.30 (7H, m), 7.37 (2H, d, J = 8.7 Hz), 7.54 (2H, d, J = 8.4 Hz).
Elemental analysis for CZ8H3oNz03 Calcd.: C, 75.99; H, 6.83; N, 6.33.
Found: C, 75.77; H, 6.86; N, 6.21.
Example 10 1-[1-[(4'-Chloro[1,1'-biphenyl]-4-yl)carbonyl]-1,2,3,4-tetrahydro-6-quinolinyl]-4-(dimethylamino)-1-butanone O I'Ae ~ N~Me N
~O
Using 1-(1,2,3,4-tetrahydro-6-quinolinyl)-4-(dimethylamino)-1-butanone obtained in Reference Example 14, the title compound was obtained as oily matter by the same procedure as in Reference Example 5.
1H NMR (CDC13) b: 1.84-1.96 (2H, m), 2.04-2.13 (2H, m), 2.21 (6H, s) , 2.33 (2H, t, J = 7.1 Hz) , 2. 90-3.20 (4H, m) , 3. 95 (2H, t, J = 6. 4 Hz) , 6. 85 (1H, d, J = 8. 6 Hz) , 7. 38-7 . 62 ( 9H, m) , 7 . 82 ( 1H, s ) .
Example 11 (E)-4-[1-[(4'-Chloro[l,1'-biphenyl]-4-yl)carbonyl]-1,2,3,4 tetrahydro-6-quinolinyl]-N,N-dimethyl-3-buten-1-amine Me Using 1-[1-[(4'-chloro[l,l'-biphenyl]-4-yl)carbonyl]-1,2,3,4-tetrahydro-6-quinolinyl]-4-(dimethylamino)-1-butanone obtained in Example 10, the title compound was obtained as colorless crystals with a mp of 142 to 144 °C
by the same procedures as in Examples 4 and 5.
1H NMR (CDC13) b: 2.01-2.11 (2H, m), 2.25 (6H, s), 2.28 2.43 (4H, m), 2.84 (2H, t, J = 6.6 Hz), 3.92 (2H, t, J =
6. 4 Hz ) , 6 . 06-6 . 18 ( 1H, m) , 6 . 32 ( 1H, d, J = 15 . 6 Hz ) , 6 . 63 (1H, brd, J = 8.1 Hz), 6.86 (1H, d, J = 8.4 Hz), 7.15 (1H, s), 7.37-7.52 (8H, m).
Example 12 4-[4-(4-Chlorophenyl)-1-piperidinyl]-4-oxo-1-[2-(trifluoroacetyl)-1,2,3,4-tetrahydro-7-isoquinolinyl]-1-butanone CI
O O
F
F
F / O
A solution of 4-oxo-4-[2-(trifluoroacetyl)-1,2,3,4-tetrahydro-7-isoquinolinyl]butanoic acid (1.0 g, 3.04 mmol) obtained in Reference Example 15, 4-chlorophenyl piperidine hydrochloride (708 mg, 3.05 mmol) and triethylamine (0.85 ml, 6.1 mmol) in dimethylformamide (8 ml) was stirred at room temperature for 20 minutes and then cooled to 0 °C.
Diethyl cyanophosphate (0.463 ml, 3.05 mmol) was added to the reaction mixture, stirred at 0 °C for 30 minutes, poured into water and extracted with ethyl acetate. The extract was washed with a saturated saline solution and dried over anhydrous magnesium sulfate. The solvent was distilled away under reduced pressure and purified by silica gel column chromatography (developing solvent; ethyl acetate), whereby 1.1 g of the title compound was obtained as colorless crystals.
1H-NMR ( CDC13 ) b : 1. 57 ( 2H, m) , 1. 90 ( 2H, m) , 2 . 68 ( 2H, m) , 2.85 (2H, m), 3.00 (2H, m), 3.13 (1H, m), 3.33 (2H, m), 3.88 (2H, m), 4.13 (1H, m), 4.74 (1H, m), 4.81 (2H, m), 7.31-7.12 (5H, m), 7.93-7.79 (2H, m).
Melting point: 142 °C (dec.) (crystallizing solvent:

ethanol-diisopropyl ether).
Example 13 4-[4-(4-Chlorophenyl)-1-piperidinyl]-4-oxo-1-(1,2,3,4-tetrahydro-7-isoquinolinyl]-1-butanone / CI
v HN ~ N
I I
/ O
A solution of 4-[4-(4-chlorophenyl)-1-piperidinyl]-4-oxo-1-[2-(trifluoroacetyl)-1,2,3,4-tetrahydro-7-isoquinolinyl]-1-butanone (1.1 g, 2.17 mmol) and potassium carbonate (900 mg, 6.5 mmol) in a mixed solvent of water (10 ml) and methanol (40 ml) was stirred at room temperature for 2 hours and then extracted with ethyl acetate. The extract was washed with a saturated saline solution and dried over anhydrous magnesium sulfate. The solvent was distilled away under reduced pressure, whereby 810 mg of the title compound was obtained as colorless powder.

1H-NMR (CDC13) b: 1.60 (2H, m), 1.89 (2H, m), 2.91-2.61 (6H, m) , 3. 19 (2H, m) , 3. 33 (2H, J = 6. 6 Hz) , 3.70 (2H,q, t, J

- 6.9 Hz), 4.10 (2H, s), 4.14 (1H, d, J = 13.2 Hz), 4.75 (1H, d, J = 13.2 Hz), 7.28-7.12 (5H, m), 7.70 (1H, s), 7.80 ( 1H, d, J = 8 . 1 Hz ) .

Melting point: 121-122 °C (crystallizing solvent:
ethanol-diisopropyl ether) Example 14 4-[4-(4-Chlorophenyl)-1-piperidinyl]-4-oxo-1-[3-(trifluoroacetyl)-2,3,4,5-tetrahydro-1H-3-benzazepin-7-yl]-1-butanone / CI
O
O ~N
F~N I / O
F
Using 4-oxo-4-[3-(trifluoroacetyl)-2,3,4,5-tetrahydro-1 H-3-benzazepin-7-yl]butanoic acid obtained in Reference Example 16, the title compound was obtained as colorless powder by the same procedure as in Example 12.
1H-NMR (CDC13) b: 1.45-2.00 (4H, m), 2.55-2.90 (4H, m), 2.97-3.28 (5H, m), 3.34 (2H, t, J=6.4Hz), 3.64-3.84 (4H, m), 4.04-4.21 (1H, m), 4.68-4.84 (1H, m), 7.14 (2H, d, J=8.4Hz), 7.20-7.34 (3H, m), 7.80-7.90 (2H, m).
Elemental analysis for C2,Hz8C1F3N203 Calcd.: C, 62.25; H, 5.42; N, 5.38.
Found: C, 62.23; H, 5.44; N, 5.29.
Melting point: 131-132 °C (crystallizing solvent:
isopropanol-diisopropyl ether) Example 15 4-[4-(4-Chlorophenyl)-1-piperidinyl]-4-oxo-1-(2,3,4,5-tetrahydro-1H-3-benzazepin-7-yl)-1-butanone CI
C
N
HN
Using 4-[4-(4-chlorophenyl)-1-piperidinyl]-4-oxo-1-[3-(trifluoroacetyl)-2,3,4,5-tetrahydro-1H-3-benzazepin-7-yl]-1-butanone obtained in Example 14, the title compound was obtained as colorless powder by the same procedure as in Example 13.
1H-NMR (CDC13) b: 1.47-2.00 (4H, m), 2.57-2.88 (5H, m), 2.98 (8H, br), 3.07-3.27 (1H, m), 3.50 (2H, t, J=6.6Hz), 4.05-4.21 (1H, m), 4.72-4.84 (1H, m), 7.10-7.34 (5H, m), 7.74-7.83 (2H, m).
Elemental analysis for Cz5H29C1N202 Calcd.: C, 70.66; H, 6.88; N, 6.59.
Found: C, 70.22; H, 7.13; N, 6.51.
Melting point: 148-149 °C (crystallizing solvent: ethanol) Example 16 4-[4-(4-Chlorophenyl)-1-piperidinyl]-4-oxo-1-(3-methyl-2,3,4,5-tetrahydro-1H-3-benzazepin-7-yl)-1-butanone r s Me A mixture of 4-[4-(4-chlorophenyl)-1-piperidinyl]-4-oxo-1-(2,3,4,5-tetrahydro-1H-3-benzazepin-7-yl)-1-butanone (0.3 g, 0.70 mmol) obtained in Example 15, formaldehyde (0.086 ml, 1.06 mmol) and formic acid (0.9 ml) was heated at 100 °C for 4 hours, then poured into water, made basic with 8 N aqueous sodium hydroxide and extracted with ethyl acetate. The extract was washed with water and then with a saturated saline solution, and dried over anhydrous magnesium sulfate. After the solvent was distilled away under reduced pressure, the residues were purified by alumina column chromatography (developing solvent; ethyl acetate-methanol - 10 . 1), whereby 0.15 g of the title compound was obtained as colorless powder.
1H-NMR (CDC13) b: 1.47-2.00 (4H, m), 2.38 (3H, s), 2.47-2.88 (8H, m), 2.95-3.06 (4H, m), 3.08-3.28 (1H, m), 3.35 (2H, t, J=6.8Hz), 4.07-4.21 (1H, m), 4.71-4.86 (1H, m), 7.08-7.34 (5H, m), 7.75-7.85 (2H, m).
Elemental analysis for C26H31C1N202 Calcd.: C, 71.14; H, 7.12; N, 6.38.
Found: C, 70.92: H, 7.35; N, 6.41.
Melting point: 143-145 °C (crystallizing solvent: ethyl acetate-diethyl ether) Example 17 4-[4-(4-Chlorophenyl)-1-piperidinyl]-1-(3-ethyl-2,3,4,5-tetrahydro-1H-3-benzazepin-7-yl)-4-oxo-1-butanone CI

N
Et-N~~ 0 A solution of 4-[4-(4-chlorophenyl)-1-piperidinyl]-4-oxo-1-(2,3,4,5-tetrahydro-1H-3-benzazepin-7-yl)-1-butanone (200 mg, 0.47 mmol) obtained in Example 15, iodoethane (0.0376 ml, 0.47 mmol) and potassium carbonate (138 mg, 1.0 mmol) in acetonitrile (5 ml) was stirred at room temperature for 12 hours, then poured into water and extracted with ethyl acetate. The extract was washed with a saturated saline solution and dried over anhydrous magnesium sulfate. The solvent was distilled away under reduced pressure, and the residues were purified by alumina silica gel column chromatography (developing solvent; ethyl acetate), whereby 101 mg of the title compound was obtained as colorless powder.
1H-NMR (CDC13) ~: 1.10 (3H, t, J = 7.0 Hz), 1.62 (2H, m), 1. 94 ( 2H, m) , 2 . 72-2 . 52 ( 8H, m) , 2 . 7 9 ( 2H, t, J = 6 . 4 Hz ) , 2 . 97 ( 4H, m) , 3 . 23 ( 1H, m) , 3 . 35 ( 2H, t, J = 6 . 6 Hz ) , 4 . 13 (1H, d, J = 15.6 Hz), 4.76 (1H, d, J = 12 Hz), 7.35-7.11 (5H, m) , 7.79 (2H, m) .
Melting point: 156-157 °C (crystallizing solvent: ethanol-diisopropyl ether) Example 18 4-[4-(4-Chlorophenyl)-1-piperidinyl]-4-oxo-1-(3-propyl-2,3,4,5-tetrahydro-1H-3-benzazepin-7-yl)-1-butanone CI
Me~
O
Using 4-[4-(4-chlorophenyl)-1-piperidinyl]-4-oxo-1-(2,3,4,5-tetrahydro-1H-3-benzazepin-7-yl)-1-butanone obtained in Example 15, the title compound was obtained as colorless powder by the same procedure as in Example 17.
1H-NMR (CDC13) b: 0.91 (3H, t, J - 7.2 Hz), 1.62 (4H, m), 1. 89 (2H, m) , 2. 45 (2H, t, J = 8. 0 Hz) , 2. 72-2. 66 (6H, m) , 2. 79 (2H, t, J = 6.4 Hz) , 2. 97 (4H, m) , 3.23 (1H, m) , 3. 35 (2H, t, J = 6.6 Hz), 4.13 (1H, d, J = 15.6 Hz), 4.76 (1H, d, J = 12 Hz), 7.35-7.11 (5H, m), 7.79 (2H, m).
Melting point: 151-152 °C (crystallizing solvent: ethanol-diisopropyl ether) Example 19 ..

1-(3-Benzyl-2,3,4,5-tetrahydro-1H-3-benzazepin-7-yl)-4-[4-(4-chlorophenyl)-1-piperidinyl]-4-oxo-1-butanone CI
O
N
N\~ O
Using 4-[4-(4-chlorophenyl)-1-piperidinyl]-4-oxo-1-(2,3,4,5-tetrahydro-1H-3-benzazepin-7-yl)-1-butanone obtained in Example 15, the title compound was obtained as colorless powder by the same procedure as in Example 17.
1H-NMR (CDC13) b: 1.64 (2H, m), 1.89 (2H, m), 2.72-2.65 (6H, m), 2.85 (2H, t, J = 6.4 Hz), 2.97 (4H, m), 3.23 (1H, m), 3.34 (2H, t, J = 6.6 Hz), 3.64 (2H, s), 4.13 (1H, d, J =
15.6 Hz), 4.76 (1H, d, J = 12 Hz), 7.35-7.11 (10H, m), 7.79 ( 2H, m) .
Melting point: 133-134 °C (crystallizing solvent: ethanol-diisopropyl ether) Example 20 1-(3-Benzoyl-2,3,4,5-tetrahydro-1H-3-benzazepin-7-yl)-4-[4-(4-chlorophenyl)-1-piperidinyl]-4-oxo-1-butanone CI
O
N
N\~ O
O

r r Using 4-[4-(4-chlorophenyl)-1-piperidinyl]-4-oxo-1-(2,3,4,5-tetrahydro-1H-3-benzazepin-7-yl)-1-butanone obtained in Example 15, the title compound was obtained as colorless powder by the same procedure as in Example 17.
1H-NMR (CDC13) b: 1.64 (2H, m), 1.89 (2H, m), 3.17-2.59 (9H, m), 3.34 (2H, t, J = 6.6 Hz), 3.53 (2H, m), 3.87 (2H, m), 4 . 13 ( 1H, d, J = 15 . 6 Hz ) , 4 . 7 6 ( 1H, d, J = 12 Hz ) , 7 . 35-7.11 (10H, m), 7.79 (2H, m).
Melting point: 158-160 °C (crystallizing solvent: ethanol-diisopropyl ether) Example 21 4-[4-(4-Chlorophenyl)-1-piperidinyl]-4-oxo-1-[3-(2-oxo-2-phenylethyl)-2,3,4,5-tetrahydro-1H-3-benzazepin-7-yl]-1-butanone CI
O
~ O ~ N
~'_=~-'~N
I I
O
Using 4-[4-(4-chlorophenyl)-1-piperidinyl]-4-oxo-1-(2,3,4,5-tetrahydro-1H-3-benzazepin-7-yl)-1-butanone obtained in Example 15, the title compound was obtained as colorless powder by the same procedure as in Example 17.
1H-NMR (CDC13) b: 1.64 (2H, m), 1.89 (2H, m), 2.86-2.58 (8H, m), 3.03 (4H, m), 3.17 (1H, m), 3.35 (2H, t, J = 6.6 Hz), 3. 96 (2H, s) , 4.13 (1H, d, J = 15. 6 Hz) , 4.76 (1H, d, J =
12 Hz), 7.31-7.11 (5H, m), 7.55-7.43 (3H, m), 7.79 (2H, m), 8.05 (2H, m) .
Melting point: 108-109 °C (crystallizing solvent: ethanol-diisopropyl ether) Example 22 1-(3-Acetyl-2,3,4,5-tetrahydro-1H-3-benzazepin-7-yl)-4-[4-(4-chlorophenyl)-1-piperidinyl]-4-oxo-1-butanone CI
Ac-Using 4-[4-(4-chlorophenyl)-1-piperidinyl]-4-oxo-1-(2,3,4,5-tetrahydro-1H-3-benzazepin-7-yl)-1-butanone obtained in Example 15, the title compound was obtained as colorless powder by the same procedure as in Example 17.
1H-NMR (CDC13) b: 1. 64 (2H, m) , 1.89 (2H, m) , 2. 66 (3H, s) , 2 . 58 ( 4H, m) , 2 . 87 (2H, t, J = 6. 6 Hz ) , 3 . 11 ( 4H, m) , 3 . 17 (1H, m) , 3. 34 (2H, t, J = 6. 6 Hz) , 3.76-3.58 (4H, m) , 4. 13 (1H, d, J - 15.6 Hz), 4.73 (1H, d, J = 12 Hz), 7.31-7.11 (5H, m), 7.81 (2H, m).
Melting point: 110-112 °C (crystallizing solvent: ethanol-diisopropyl ether) Example 23 4-[4-(4-Chlorophenyl)-1-piperidinyl]-4-oxo-1-[3-(2-oxopropyl)-2,3,4,5-tetrahydro-1H-3-benzazepin-7-yl]-1-butanone / CI
O O v Me~ ~ N
'----N
/ O
Using 4-[4-(4-chlorophenyl)-1-piperidinyl]-4-oxo-1-(2,3,4,5-tetrahydro-1H-3-benzazepin-7-yl)-1-butanone obtained in Example 15, the title compound was obtained as colorless powder by the same procedure as in Example 17.
1H-NMR (CDC13) b: 1. 64 (2H, m) , 1. 89 (2H, m) , 2.22 (3H, s) , 2 . 67 ( 4H, m) , 2 . 87 (2H, t, J = 6. 6 Hz ) , 3 . 00 ( 4H, m) , 3 . 17 ( 1H, m) , 3 . 7 8-3 . 32 ( 4H, m) , 4 .13 ( 1H, d, J = 15 . 6 Hz ) , 4 . 73 ( 1H, d, J = 12 Hz ) , 7 . 31-7 . 11 ( 5H, m) , 7 . 81 ( 2H, m) .
Melting point: 119-120 °C (crystallizing solvent: ethanol-diisopropyl ether) Example 24 4-[4-(4-Chlorophenyl)-1-piperidinyl]-4-oxo-1-[3-[2-(1H-pyrrol-1-yl)ethyl]-2,3,4,5-tetrahydro-1H-3-benzazepin-7-yl]-1-butanone CI
O
N ~ N
~N
O
Using 4-[4-(4-chlorophenyl)-1-piperidinyl]-4-oxo-1-(2,3,4,5-tetrahydro-1H-3-benzazepin-7-yl)-1-butanone obtained in Example 15, the title compound was obtained as colorless powder the same procedure as Example 17.
by in 1H-NMR (CDC13) ~: (2H, m), 1.89 (2H, m), 2.95-2.59 1.64 (14H, m), 3.17 (1H, m), 3.34 (2H, t, J = Hz), 4.18-4.00 6.2 (3H, m), 4.75 (1H, m), 6.15 (2H, m), 6.70 (2H, m), 7.31-7.11 (5H, m), 7.81 (2H,m).

Melting point: 96-97 °C (crystallizing solvent: ethanol-diisopropyl ether) Example 25 4-[4-(4-Chlorophenyl)-1-piperidinyl]-1-[3-(2-methylbenzyl)-2,3,4,5-tetrahydro-1H-3-benzazepin-7-yl]-4-oxo-1-butanone CI
O
N
Me N
Using 4-[4-(4-chlorophenyl)-1-piperidinyl]-4-oxo-1-(2,3,4,5-tetrahydro-1H-3-benzazepin-7-yl)-1-butanone obtained in Example 15, the title compound was obtained as colorless powder by the same procedure as in Example 17.
1H-NMR (CDC13) b: 1. 64 (2H, m) , 1. 89 (2H, m) , 2. 40 (3H, s) , 2. 72-2. 65 (6H, m) , 2. 82 (2H, t, J = 6. 4 Hz) , 2. 94 (4H, m) , 3.23 (1H, m) , 3. 35 (2H, t, J = 6. 6 Hz) , 3.54 (2H, s) , 4. 13 (1H, d, J = 15.6 Hz), 4.76 (1H, d, J - 12 Hz), 7.35-7.11 (9H, m) , 7.79 (2H, m) .
Melting point: 108-109 °C (crystallizing solvent: ethanol-diisopropyl ether) Example 26 4-[4-(4-Chlorophenyl)-1-piperidinyl]-1-[3-(3-methylbenzyl)-2,3,4,5-tetrahydro-1H-3-benzazepin-7-yl]-4-oxo-1-butanone CI
Me ~ ~ O
N
N\~ O
Using 4-[4-(4-chlorophenyl)-1-piperidinyl]-4-oxo-1-(2,3,4,5-tetrahydro-1H-3-benzazepin-7-yl)-1-butanone obtained in Example 15, the title compound was obtained as colorless powder by the same procedure Example as in 17.

1H-NMR (CDC13) b: 1.64 ( 2H, m), 1.89 (2H,m), 2.36 (3H, s), 2.72-2. 65 (6H, m) , 2.82 (2H, t, J = 6.4 Hz) 2. (4H, m) , 94 , 3.23 (1H, m), 3.35 (2H, t, J = 6.6 Hz), 3.60 (2H, s), 4.13 (1H, d, J - 15.6 Hz), 4.76 (1H, d, J 12 Hz), 7.35-7.11 -( 9H, m) , 7 . 7 9 ( 2H, m) .
Melting point: 127-128 °C (crystallizing solvent: ethanol-diisopropyl ether) Example 27 4-[4-(4-Chlorophenyl)piperidin-1-yl]-1-[3-(4-methylbenzyl)-2,3,4,5-tetrahydro-1H-3-benzazepin-7-yl]-4-oxobutan-1-one CI
Me O
I I
O
Using 4-[4-(4-chlorophenyl)-1-piperidinyl]-4-oxo-1-(2,3,4,5-tetrahydro-1H-3-benzazepin-7-yl)-1-butanone obtained in Example 15, the title compound was obtained as colorless powder by the same procedure as in Example 17.
1H-NMR (CDC13) b: 1. 63 (2H, m) , 1. 88 (2H, m) , 2. 35 (3H, s) , 2. 64 (6H, m) , 2.78 (2H, t, J = 6. 4 Hz) , 2. 95 (4H, m) , 3.23 (1H, m) , 3. 34 (2H, t, J = 6. 6 Hz) , 3. 60 (2H, s) , 4 . 13 (1H, m), 4.76 (1H, m), 7.35-7.11 (9H, m), 7.79 (2H, m).
Melting point: 137-138 °C (crystallizing solvent: ethanol-diisopropyl ether) Example 28 1-(3-Allyl-2,3,4,5-tetrahydro-1H-3-benzazepin-7-yl)-4-[4-(4-chlorophenyl) piperidin-1-yl]-4-oxobutan-1-one CI
Using 4-[4-(4-chlorophenyl)-1-piperidinyl]-4-oxo-1-(2,3,4,5-tetrahydro-1H-3-benzazepin-7-yl)-1-butanone obtained in Example 15, the title compound was obtained as colorless powder by the same procedure as in Example 17.
1H-NMR (CDC13) b: 1. 63 (2H, m) , 1. 88 (2H, m) , 2. 65 (7H, m) , 2.78 (2H, t, J = 6. 4 Hz) , 2. 97 (4H, m) , 3.23 (2H, m) , 3. 35 ( 2H, t, J = 6 . 6 Hz ) , 4 . 13 ( 1H, m) , 4 . 7 6 ( 1H, m) , 5 . 23-5 . 15 (2H, m), 5.90 (1H, m), 7.31-7.11 (5H, m), 7.79 (2H, m).
Melting point: 136-137 °C (crystallizing solvent: ethanol-diisopropyl ether) Example 29 4-[4-(4-Chlorophenyl)piperidin-1-yl]-4-oxo-1-(2-propynyl-2,3,4,5-tetrahydro-1H-3-benzazepin-7-yl)butan-1-one / CI
O
HC~
O
Using 4-[4-(4-chlorophenyl)-1-piperidinyl]-4-oxo-1-(2,3,4,5-tetrahydro-1H-3-benzazepin-7-yl)-1-butanone obtained in Example 15, the title compound was obtained as colorless powder by the same procedure as in Example 17.
1H-NMR (CDC13) b: 1. 63 (2H, m) , 1. 88 (2H, m) , 2.21 (1H, s) , 3.43-2.58 (15H, m), 4.13 (2H, m), 4.76 (1H, m), 5.07 (1H, m), 5.84 (1H, m), 7.31-7.11 (5H, m), 7.79 (2H, m).
Melting point: 132-134 °C (crystallizing solvent: ethanol-diisopropyl ether) Example 30 4-[4-(4-Chlorophenyl)piperidin-1-yl]-1-(3-isopropyl-2,3,4,5-tetrahydro-1H-3-benzazepin-7-yl)-4-oxobutan-1-one / CI
( O v Me ~ N
~N I / _ O
Me Using 4-[4-(4-chlorophenyl)-1-piperidinyl]-4-oxo-1-(2,3,4;5-tetrahydro-1H-3-benzazepin-7-yl)-1-butanone obtained in Example 15, the title compound was obtained as colorless powder by the same procedure as in Example 17.
1H-NMR (CDC13) b: 1.00 (6H, d, J - 6.6 Hz), 1.62 (4H, m), 1. 89 (2H, m) , 2. 64 (7H, m) , 2. 82 (2H, t, J = 6. 4 Hz) , 2. 95 (4H, m) , 3.23 (1H, m) , 3.35 (2H, t, J = 6. 6 Hz) , 4. 13 (1H, m), 4.76 (1H, m), 7.35-7.11 (5H, m), 7.79 (2H, m).
Melting point: 139-140 °C (crystallizing solvent: ethanol-diisopropyl ether) Example 31 4-Oxo-4-(phenyl-1-piperidinyl)-1-[3-(trifluoroacetyl)-2,3,4,5-tetrahydro-1H-3-benzazepin-7-yl]-1-butanone O
O \ NJ
F~N ~ ~ O
F
Using 4-oxo-4-[3-(trifluoroacetyl)-2,3,4;5-tetrahydro-1H-3-benzazepin-7-yl]butanoic acid obtained in Reference Example 16, the title compound was obtained as colorless powder by the same procedure as in Example 12.
1H-NMR (CDC13) b: 1.48-1.78 (2H, m), 1.82-2.00 (2H, m), 2.60-2.88 (4H, m), 2.98-3.10 (4H, m), 3.13-3.26 (1H, m), 3.34 (2H, t, J=6.5Hz), 3.67-3.83 (4H, m), 4.07-4.18 (1H, m), 4.72-4.82 (1H, m), 7.16-7.37 (6H, m), 7.80-7.90 (2H, m).
Elemental analysis for CZ~Hz9F3N203 Calcd.: C, 66.65; H, 6.01; N, 5.76.
Found: C, 66.45: H, 6.09 N, 5.56.
Melting point: 132-133 °C (crystallizing solvent:
isopropanol).
Example 32 4-Oxo-4-(phenyl-1-piperidinyl)-1-(2,3,4,5-tetrahydro-1H-3-benzazepin-7-yl)-1-butanone Using 4-oxo-4-(phenyl-1-piperidinyl)-1-[3-(trifluoroacetyl)-2,3,4,5-tetrahydro-1H-3-benzazepin-7-yl]-1-butanone obtained in Example 31, the title compound was obtained as colorless powder by the same procedure as in Example 13.
1H-NMR (CDC13) b: 1.54-2.00 (5H, m), 2.60-2.87 (4H, m), 2.97 (8H, br), 3.12-3.24 (1H, m), 3.35 (2H, t, J=6.7Hz), 4.08-4.20 (1H, m), 4.73-4.83 (1H, m), 7.16-7.37 (6H, m), 7.77-7.82 (2H, m).
Elemental analysis for Cz5H3oNz~z Calcd.: C, 76.89; H, 7.74; N, 7.17.
Found: C, 76.44; H, 7.68; N, 7.02.
Melting point: 114 °C (crystallizing solvent:
isopropanol-diisopropyl ether).
Example 33 4-(3-Acetyl-2,3,4,5-tetrahydro-1H-3-benzazepin-7-yl)-4-[4-(chlorophenyl)-1-piperidinyl]-1-butanone CI
C
N
Ac-N
1) Aluminum chloride (2.9 g, 21.7 mmol) was added little by little to a mixture of 3-acetyl-2,3,4,5-tetrahydro-1H-3-benzazepine (2 g, 10.5 mmol) and 4-chlorobutyryl chloride (1.56 g, 11 mmol) in nitromethane (5 ml) at room temperature and stirred for 2 hours at room temperature. The reaction solution was poured into ice water which was then extracted with ethyl acetate, washed with a saturated saline solution and dried over anhydrous magnesium sulfate. The solvent was distilled away under reduced pressure, whereby 1-(3-acetyl-2,3,4,5-tetrahydro-1 H-3-benzazepin-7-yl)-4-chloro-1-butanone (2.9 g) was obtained.
2) A mixture of 1-(3-acetyl-2,3,4,5-tetrahydro-1 H-3 benzazepin-7-yl)-4-chloro-1-butanone (0.75 g, 2.55 mmol) obtained in 1) above, 4-chlorophenyl piperidine (5.1 g, 5.1 mmol) and potassium iodide (0.05 g) in toluene (15 ml) was heated under reflux for 16 hours. The reaction solution was poured into water, made basic with 1 N aqueous sodium hydroxide and extracted with ethyl acetate. The extract was washed with a saturated saline solution and dried over anhydrous magnesium sulfate. The solvent was distilled away under reduced pressure, and the residues were purified by silica gel column chromatography (developing solvent;
ethyl acetate . methanol - 1 . 1), whereby 0.6 g of the title compound was obtained as colorless powder.
1H-NMR (CDC13) b: 1.54-2.25 (11H, m), 2.37-2.56 (3H, m), 2.90-3.12 (8H, m), 3.53-3.64 (2H, m), 3.66-3.79 (2H, m), 7.07-7.31 (5H, m), 7.72-7.82 (2H, m).
Melting point: 131-132 °C (crystallizing solvent:
isopropanol-diisopropyl ether).
Example 34 4-[4-(4-Chlorophenyl)-1-piperidinyl]-1-(2,3,4,5-tetrahydro-1H-3-benzazepin-7-yl)-1-butanone / CI
p N
v v Using 1-(3-acetyl-2,3,4,5-tetrahydro-1 H-3-benzazepin-7-yl)-4-[4-(4-chlorophenyl)-1-piperidinyl]-1-butanone obtained in Example 33, the title compound was obtained as colorless powder by the same procedure as in Reference Example 10.
1H-NMR (CDC13, free base) b: 1.53-2.13 (9H, m), 2.35-2.55 (3H, m), 2.90-3.10 (12H, m), 7.07-7.30 (5H, m), 7.68-7.80 ( 2H, m) .

Elemental analysis for C25H31C1N20 ~ 2HC1 Calcd.: C, 62.05; H, 6.87; N, 5.79.
Found: C, 61.93; H, 6.78; N, 5.48.
Melting point: 243-247 °C (dec.) (crystallizing solvent:
isopropanol-diisopropyl ether).
Example 35 4-[4-(4-Chlorophenyl)-1-piperidinyl]-1-(3-methyl-2,3,4,5-tetrahydro-1H-3-benzazepin-7-yl)-1-butanone CI
Me-Using 4-[4-(4-chlorophenyl)-1-piperidinyl]-1-(2,3,4,5-tetrahydro-1 H-3-benzazepin-7-yl)-1-butanone obtained in Example 34, the title compound was obtained as colorless powder by the same procedure as in Example 16.
1H-NMR (CDC13, free base) b: 1.62-2.20 (8H, m), 2.36-2.67 (10H, m), 2.93-3.15 (8H, m), 7.07-7.30 (5H, m), 7.70-7.80 (2H ,m) .
Elemental analysis for C26H33C1Nz0~ 2HC1 ~ 0. 5H20 Calcd.: C, 61.60; H, 7.16; N, 5.53.
Found: C, 61.73; H, 7.32; N, 5.48.
Melting point: 248-252 °C (dec.) (crystallizing solvent:
isopropanol).

Example 36 N-Butyl-4-oxo-4-(2,3,4,5-tetrahydro-1H-3-benzazepin-7-yl) butanamide trifluoroacetate O
H
N~Me HN ( Io 4-Oxo-4-[3-(trifluoroacetyl)-2,3,4,5-tetrahydro-1H-3-benzazepin-7-yl] butanoic acid (30.2 mg, 0.088 mmol) obtained in Reference Example 16, n-butylamine (5.9 mg, 0.08 mol) and carbodiimide resin (136 mg, 0.12 mmol, 0.88 mmol/g) were stirred in dichloromethane (1 ml) at room temperature for 12 hours. The reaction mixture was filtered, the filtrate was concentrated, and an aqueous solution (0.5 ml) of methanol (500 u1) and potassium carbonate (331 mg, 2.4 mmol) was added to the reaction mixture and then stirred at room temperature for 12 hours.
The solvent was distilled away, and the residues were purified by preparative liquid chromatography (developing solvent: 0.1 ~ aqueous trifluoroacetic acid/0.1 trifluoroacetic acid in acetonitrile - 90/10 to 10/90), whereby 10.2 mg of the title compound was obtained as colorless powder.
MS(ESI)(M+1): 303 Example 37 N-(Cyclohexylmethyl)-4-oxo-4-(2,3,4,5-tetrahydro-1H-3-benzazepin-7-yl)butanamide trifluoroacetate O
H
N
HN ~ Io The title compound was obtained in the same manner as in Example 36.
MS(ESI)(M+1): 343 Example 38 N-Cyclohexyl-4-oxo-4-(2,3,4,5-tetrahydro-1H-3-benzazepin-7-yl)butanamide trifluoroacetate O
H
N
HN O
The title compound was obtained in the same manner as in Example 36.
MS(APCI)(M+1): 287 Example 39 N-Benzyl-4-oxo-4-(2,3,4,5-tetrahydro-1H-3-benzazepin-7-yl)butanamide trifluoroacetate O /
\ N \I
HN I / IOI
The title compound was obtained in the same manner as in Example 36.
MS(ESI)(M+1): 337 Example 40 N-(1,3-Benzodioxol-5-ylmethyl)-4-oxo-4-(2,3,4,5-tetrahydro-1H-3-benzazepin-7-yl)butanamide trifluoroacetate O
\ N \ I O
HN I / O
The title compound was obtained in the same manner as in Example 36.
MS(ESI)(M+1): 381 Example 41 4-Oxo-N-(2-phenetyl)-4-(2,3,4,5-tetrahydro-1H-3-benzazepin-7-yl)butanamide trifluoroacetate O
H
I \ N I \

The title compound was obtained in the same manner as in Example 36.

MS(ESI)(M+1): 351 Example 42 4-Oxo-N-(3-phenylpropyl)-4-(2,3,4,5-tetrahydro-1H-3-benzazepin-7-yl)butanamide trifluoroacetate O /
\ N \) HN
The title compound was obtained in the same manner as in Example 36.
MS(ESI)(M+1): 365 Example 43 N-Benzhydryl-4-oxo-4-(2,3,4,5-tetrahydro-1H-3-benzazepin-7-yl)butanamide trifluoroacetate O /
\ N \
HN
/ /
\
The title compound was obtained in the same manner as in Example 36.
MS (ESI) (M+1) : 413 Example 44 N-(2-Methoxyethyl)-4-oxo-4-(2,3,4,5-tetrahydro-1H-3-benzazepin-7-yl)butanamide trifluoroacetate O
H
N~O~Me HN I / to The title compound was obtained in the same manner as in Example 36.
MS(APCI)(M+1): 305 Example 45 N-(3-(Methylthio)propyl]-4-oxo-4-(2,3,4,5-tetrahydro-1H-3-benzazepin-7-yl)butanamide trifluoroacetate O
H
N~S~~
HN I / IO
The title compound was obtained in the same manner as in Example 36.
MS(ESI)(M+1): 335 Example 46 4-Oxo-4-(2,3,4,5-tetrahydro-1H-3-benzazepin-7-yl)-N-(tetrahydrofuran-2-ylmethyl)butanamide trifluoroacetate H
O
N O
HN I I
/ O
The title compound was obtained in the same manner as in Example 36.
MS(APCI)(M+1): 331 Example 47 N-[2-(1H-Indol-3-yl)ethyl]-4-oxo-4-(2,3,4,5-tetrahydro-1H-3-benzazepin-7-yl)butanamide trifluoroacetate O
H
N ~ \
HN I I
/ O N
H
The title compound was obtained in the same manner as in Example 36.
MS(ESI)(M+1): 390 Example 48 N-(1-Ethylpropyl)-4-oxo-4-(2,3,4,5-tetrahydro-1H-3-benzazepin-7-yl)butanamide trifluoroacetate O
H
N Me / Me The title compound was obtained in the same manner as in Example 36.
MS(ESI)(M+1): 317 Example 49 N-(tert-Butyl)-4-oxo-4-(2,3,4,5-tetrahydro-1H-3-benzazepin-7-yl)butanamide trifluoroacetate O
H
N Me HN I v ~ ~Me / O Me The title compound was obtained in the same manner as in Example 36.
MS(ESI)(M+1): 303 Example 50 N-(Cyclohexyl)-4-oxo-4-(2,3,4,5-tetrahydro-1H-3-benzazepin-7-yl)butanamide trifluoroacetate O
H
N
HN I O
The title compound was obtained in the same manner as in Example 36.
MS (ESI) (M+1) : 329 Example 51 4-Oxo-N-prop-2-ynyl-4-(2,3,4,5-tetrahydro-1H-3-benzazepin-7-yl)butanamide trifluoroacetate O
N C~CH
a HN
/ O
The title compound was obtained in the same manner as in Example 36.
MS (APCI) (M+1) : 285 Example 52 4-Oxo-4-(2,3,4,5-tetrahydro-1H-3-benzazepin-7-yl)-N-[4-(trifluoromethyl)benzyl]butanamide trifluoroacetate O
N
HN
The title compound was obtained in the same manner as in Example 36.
MS(ESI)(M+1): 405 Example 53 N-[2-(3,4-Dimethoxyphenyl)ethyl]-4-oxo-4-(2,3,4,5-tetrahydro-1H-3-benzazepin-7-yl)butanamide trifluoroacetate O
N ~ O'Me HN ~ / ~~ ( / O~ Me The title compound was obtained in the same manner as in Example 36.
MS (ESI) (M+1) : 411 Example 54 N-(3,3-Diphenylpropyl)-4-oxo-4-(2,3,4,5-tetrahydro-1H-3-benzazepin-7-yl)butanamide trifluoroacetate The title compound was obtained in the same manner as in Example 36.
MS (ESI) (M+1) : 441 Example 55 N-(2,3-Dihydro-1H-inden-2-yl)-4-oxo-4-(2,3,4,5-tetrahydro-1H-3-benzazepin-7-yl)butanamide trifluoroacetate O
H
N
HN
The title compound was obtained in the same manner as in Example 36.
MS(ESI)(M+1): 363 Example 56 N-(3-Isopropoxypropyl)-4-oxo-4-(2,3,4,5-tetrahydro-1H-3-benzazepin-7-yl)butanamide trifluoroacetate O
NCO Me HN
/

The title compound was obtained in the same manner as in Example 36.
MS(ESI)(M+1): 347 Example 57 N-(3-Furylmethyl)-4-oxo-4-(2,3,4,5-tetrahydro-1H-3-benzazepin-7-yl)butanamide trifluoroacetate O H O
\ N \
HN I O
The title compound was obtained in the same manner as in Example 36.
MS(ESI)(M+1): 327 Example 58 4-Oxo-N-[3-(2-oxopyrrolidin-1-yl)propyl]-4-(2,3,4,5-tetrahydro-1H-3-benzazepin-7-yl)butanamide trifluoroacetate O
O
NON J
I\ v HN
/ O
The title compound was obtained in the same manner as in Example 36.
MS(APCI)(M+1): 372 Example 59 4-Oxo-N,N-dipropyl-4-(2,3,4,5-tetrahydro-1H-3-benzazepin-7-yl)butanamide trifluoroacetate a O
N~Me HN
The title compound was obtained in the same manner as in Example 36.
MS (ESI) (M+1) : 331 Example 60 N-Methyl-N-(1-naphthylmethyl)-4-oxo-4-(2,3,4,5-tetrahydro-1H-3-benzazepin-7-yl)butanamide trifluoroacetate O 1e / I
N
HN I ~ v ~ ~ I
The title compound was obtained in the same manner as in Example 36.
MS(ESI)(M+1): 401 Example 61 N-[2-(3,4-Dimethoxyphenyl)ethyl]-N-methyl-4-oxo-4-(2,3,4,5-tetrahydro-1H-3-benzazepin-7-yl)butanamide trifluoroacetate O ~e I \ N I \ O~Me HN p /
/ O Me The title compound was obtained in the same manner as in Example 36.
MS (ESI) (M+1) : 425 Example 62 N,N-bis(2-Methoxyethyl)-4-oxo-4-(2,3,4,5-tetrahydro-1H-3-benzazepin-7-yl)butanamide trifluoroacetate Me The title compound was obtained in the same manner as in Example 36.
MS(ESI)(M+1): 363 Example 63 4-Oxo-4-piperidin-1-yl-1-(2,3,4,5-tetrahydro-1H-3-benzazepin-7-yl)butan-1-one trifluoroacetate \ N
J
HN I O~
The title compound was obtained in the same manner as in Example 36.
MS(ESI)(M+1): 315 Example 64 4-(2,6-Dimethylmorpholin-4-yl)-4-oxo-1-(2,3,4,5-tetrahydro-1H-3-benzazepin-7-yl)butan-1-one trifluoroacetate The title compound was obtained in the same manner as in Example 36.
MS(ESI)(M+1): 345 Example 65 4-(3,4-Dihydroisoquinolin-2(1H)-yl)-4-oxo-1-(2,3,4,5-tetrahydro-1H-3-benzazepin-7-yl)butan-1-one trifluoroacetate O
N I /
HN I / O
The title compound was obtained in the same manner as in Example 36.
MS (ESI) (M+1) : 363 Example 66 1-[4-Oxo-4-(2,3,4,5-tetrahydro-1H-3-benzazepin-7-yl)butanoyl]piperidine-4-carboxamide trifluoroacetate O
O ~ 'NH2 N
HN ~ II
/ O
The title compound was obtained in the same manner as in Example 36.
MS (APCI) (M+1) : 358 Example 67 4-[4-(2-Hydroxyethyl)piperidin-1-yl]-4-oxo-1-(2,3,4,5-tetrahydro-1H-3-benzazepin-7-yl)butan-1-one trifluoroacetate OH
O
N
HN I / IO
The title compound was obtained in the same manner as in Example 36.
MS(ESI)(M+1): 359 Example 68 4-Oxo-1-(2,3,4,5-tetrahydro-1H-3-benzazepin-7-yl)-4-thiomorphin-4-ylbutan-1-one trifluoroacetate O ~S
NJ
HN I / O
The title compound was obtained in the same manner as in Example 36.
MS(ESI)(M+1): 333 Example 69 4-(4-Benzylpiperidin-1-yl)-4-oxo-1-(2,3,4,5-tetrahydro-1H-3-benzazepin-7-yl)butan-1-one trifluoroacetate O
N I/
HN I OI
The title compound was obtained in the same manner as in Example 36.
MS(ESI)(M+1): 405 Example 70 N-[1-[4-Oxo-4-(2,3,4,5-tetrahydro-1H-3-benzazepin-7-yl)butanoyl]pyrrolidin-3-yl]acetamide trifluoroacetate The title compound was obtained in the same manner as in Example 36.
MS (APCI) (M+1) : 358 Example 71 N-Cyclohexyl-N-methyl-4-oxo-4-(2,3,4,5-tetrahydro-1H-3-benzazepin-7-yl)butanamide trifluoroacetate O Me 'N
HN ( '~O
The title compound was obtained in the same manner as in Example 36.
MS(ESI)(M+1): 343 Example 72 N-Benzyl-N-methyl-4-oxo-4-(2,3,4,5-tetrahydro-1H-3-benzazepin-7-yl)butanamide trifluoroacetate O Me / ( N
HN I of The title compound was obtained in the same manner as in Example 36.
MS(ESI)(M+1): 351 Example 73 N-Ethyl-N-(2-methoxyethyl)-4-oxo-4-(2,3,4,5-tetrahydro-1H-3-benzazepin-7-yl)butanamide trifluoroacetate 'Me 'r0 N~O~Me HN I O
The title compound was obtained in the same manner as in Example 36.
MS (ESI) (M+1) : 333 Example 74 4-Morpholin-4-yl-4-oxo-1-(2,3,4,5-tetrahydro-1H-3-benzazepin-7-yl)butan-1-one trifluoroacetate O ~O
NJ
HN I /
The title compound was obtained in the same manner as in Example 36.
MS (APCI ) (M+1 ) : 317 Example 75 4-(3,5-Dimethylpiperidin-1-yl)-4-oxo-1-(2,3,4,5-tetrahydro-1H-3-benzazepin-7-yl)butan-1-one trifluoroacetate a O
I ~ N Me The title compound was obtained in the same manner as in Example 36.
MS (ESI) (M+1) : 343 Example 76 4-Octahydroisoquinolin-2(1H)-yl-4-oxo-1-(2,3,4,5-tetrahydro-1H-3-benzazepin-7-yl)butan-1-one trifluoroacetate N
O
HN I / IO
The title compound was obtained in the same manner as in Example 36.
MS(ESI)(M+1): 369 Example 77 4-(4-Hydroxypiperidin-1-yl)-4-oxo-1-(2,3,4,5-tetrahydro-1H-3-benzazepin-7-yl)butan-1-one trifluoroacetate OH
O
N
HN I / IO

The title compound was obtained in the same manner as in Example 36.
MS(APCI)(M+1): 331 Example 78 4-((2S)-2-[[(2,6-Dimethylphenyl)amino]methyl]pyrrolidin-1-yl)-4-oxo-1-(2,3,4,5-tetrahydro-1H-3-benzazepin-7-yl)butan-1-one trifluoroacetate Me i O ~/'~.H ~
N
HN I M l O
The title compound was obtained in the same manner as in Example 36.
MS(ESI)(M+1): 434 Example 79 4-[4-(4-Chlorophenyl)-4-hydroxypiperidin-1-yl]-4-oxo-1-(2,3,4,5-tetrahydro-1H-3-benzazepin-7-yl)butan-1-one trifluoroacetate The title compound was obtained in the same manner as in Example 36.
MS (ESI) (M+1) : 441 Example 80 N-Ethyl-N-[1-[4-oxo-4-(2,3,4,5-tetrahydro-1H-3-benzazepin-7-yl) butanoyl]pyrrolidin-3-yl]acetamide trifluoroacetate The title compound was obtained in the same manner as in Example 36.
MS(ESI)(M+1): 386 Example 81 N-[2-(Dimethylamino)ethyl]-4-oxo-4-(2,3,4,5-tetrahydro-1H-3-benzazepin-7-yl)butanamide trifluoroacetate O
H
N~ ,Me HN I N
/ ~ Me The title compound was obtained in the same manner as in Example 36.
MS (APCI ) (M+1 ) : 318 Example 82 N-[3-(Dimethylamino)propyl]-4-oxo-4-(2,3,4,5-tetrahydro-1H-3-benzazepin-7-yl)butanamide trifluoroacetate 'Me O 'rH
N~N~Me HN ( DI
The title compound was obtained in the same manner as in Example 36.
MS(APCI)(M+1): 360 Example 83 4-Oxo-N-(2-piperidin-1-ylethyl)-4-(2,3,4,5-tetrahydro-1H-3-benzazepin-7-yl)butanamide trifluoroacetate O
H
NON
HN
/ O
The title compound was obtained in the same manner as in Example 36.
MS(APCI)(M+1): 358 Example 84 N-(2-Morpholin-4-ylethyl)-4-oxo-4-(2,3,4,5-tetrahydro-1H-3-benzazepin-7-yl)butanamide trifluoroacetate O
\ a~.
I N
HN
O ~O
The title compound was obtained in the same manner as in Example 36.
MS(APCI)(M+1): 360 Example 85 N-[3-(4-Methylpiperazin-1-yl)propyl]-4-oxo-4-(2,3,4,5-tetrahydro-1H-3-benzazepin-7-yl)butanamide trifluoroacetate O ~N~Me \ N~/~/N
HN I II
/ O
The title compound was obtained in the same manner as in Example 36.
MS (APCI) (M+1) : 387 Example 86 N-[3-[Methyl(phenyl)amino]propyl]-4-oxo-4-(2,3,4,5-tetrahydro-1H-3-benzazepin-7-yl)butanamide trifluoroacetate O H ~e I \ NON I \
HN I I
/ O /
The title compound was obtained in the same manner as in Example 36.

MS(APCI)(M+1): 394 Example 87 N-(1-Benzylpiperidin-4-yl)-4-oxo-4-(2,3,4,5-tetrahydro-1H-3-benzazepin-7-yl)butanamide trifluoroacetate O
HN I / IO N ~
The title compound was obtained in the same manner as in Example 36.
MS(APCI)(M+1): 420 Example 88 4-Oxo-4-(2,3,4,5-tetrahydro-1H-3-benzazepin-7-yl)-N-(2,2,6,6-tetramethylpiperidin-4-yl)butanamide trifluoroacetate Me The title compound was obtained in the same manner as in Example 36.
MS (APCI ) (M+1 ) : 386 Example 89 N-(2-Anilinoethyl)-4-oxo-4-(2,3,4,5-tetrahydro-1H-3-benzazepin-7-yl)butanamide trifluoroacetate /I
\ NON \
HN I I I H
O
The title compound was obtained in the same manner as in Example 36.
MS(APCI)(M+1): 366 Example 90 4-Oxo-N-(pyridin-2-ylmethyl)-4-(2,3,4,5-tetrahydro-1H-3-benzazepin-7-yl)butanamide trifluoroacetate \ N \N
HN I / O
The title compound was obtained in the same manner as in Example 36.
MS (APCI) (M+1) : 338 Example 91 4-Oxo-N-(pyridin-4-ylmethyl)-4-(2,3,4,5-tetrahydro-1H-3-benzazepin-7-yl)butanamide trifluoroacetate O
\ ~ \
HN I II I I
O ~N

The title compound was obtained in the same manner as in Example 36.
MS(APCI)(M+1): 352 Example 92 N-[3-(1H-Imidazol-1-yl)propyl]-4-oxo-4-(2,3,4,5-tetrahydro-1H-3-benzazepin-7-yl)butanamide trifluoroacetate O
\ N~N~%N
HN ( / IO
The title compound was obtained in the same manner as in Example 36.
MS(APCI)(M+1): 355 Example 93 N-[3-(Diisopropylamino)ethyl]-4-oxo-4-(2,3,4,5-tetrahydro-1H-3-benzazepin-7-yl)butanamide trifluoroacetate N
O H
I \ ~N Me Me"Me The title compound was obtained in the same manner as in Example 36.
MS(APCI)(M+1): 374 Example 94 N-[3-(Dimethylamino)-2,2-dimethylpropyl]-4-oxo-4-(2,3,4,5-tetrahydro-1H-3-benzazepin-7-yl)butanamide trifluoroacetate O H Me a ~e N~'~~ fN~
Me HN
/ O
The title compound was obtained in the same manner as in Example 36.
MS(APCI)(M+1): 360 Example 95 N-[3-(2-Methylpiperidin-1-yl)propyl]-4-oxo-4-(2,3,4,5-tetrahydro-1H-3-benzazepin-7-yl)butanamide trifluoroacetate O
H
NON
HN I I I
/ O Me The title compound was obtained in the same manner as in Example 36.
MS (APCI) (M+1) : 386 Example 96 N-(3-Morpholin-4-ylpropyl)-4-oxo-4-(2,3,4,5-tetrahydro-1H-3-benzazepin-7-yl)butanamide trifluoroacetate O H
NON
v HN
/ O

The title compound was obtained in the same manner as in Example 36.
MS(APCI)(M+1): 374 Example 97 4-Oxo-N-(2-pyrrolidin-1-ylethyl)-4-(2,3,4,5-tetrahydro-1H-3-benzazepin-7-yl)butanamide trifluoroacetate O
H
NON
HN
/ O
The title compound was obtained in the same manner as in Example 36.
MS(APCI)(M+1): 344 Example 98 N-[2-[Ethyl(2-methylphenyl)amino]ethyl]-4-oxo-4-(2,3,4,5-tetrahydro-1H-3-benzazepin-7-yl)butanamide trifluoroacetate O
N
~N ~ Me HN I I
/ O ~Me The title compound was obtained in the same manner as in Example 36.
MS(APCI)(M+1): 408 Example 99 N-(1-Benzylpyrrolidin-3-yl)-4-oxo-4-(2,3,4,5-tetrahydro-1H-3-benzazepin-7-yl)butanamide trifluoroacetate The title compound was obtained in the same manner as in Example 36.
MS(APCI)(M+1): 406 Example 100 N-[3-[bis(2-Hydroxyethyl)amino]propyl]-4-oxo-4-(2,3,4,5-tetrahydro-1H-3-benzazepin-7-yl)butanamide trifluoroacetate The title compound was obtained in the same manner as in Example 36.
MS(APCI)(M+1): 392 Example 101 N-[3-[(5-Nitropyridine)amino]ethyl]-4-oxo-4-(2,3,4,5-tetrahydro-1H-3-benzazepin-7-yl)butanamide trifluoroacetate O
N~ W
v~
HN I H N
O
The title compound was obtained in the same manner as in Example 36.
MS (APCI ) (M+1 ) : 412 Example 102 4-Oxo-N-(pyridin-4-ylmethyl)-4-(2,3,4,5-tetrahydro-1H-3-benzazepin-7-yl)butanamide trifluoroacetate O / ~N
~I
v HN
/ O
The title compound was obtained in the same manner as in Example 36.
MS(APCI)(M+1): 338 Example 103 4-Oxo-N-(pyridin-3-ylmethyl)-4-(2,3,4,5-tetrahydro-1H-3-benzazepin-7-yl)butanamide trifluoroacetate O H /~
N ~ N
HN I I
/ O
The title compound was obtained in the same manner as in Example 36.

MS(APCI)(M+1): 338 Example 104 4-Oxo-N-(2-pyridin-3-ylethyl)-4-(2,3,4,5-tetrahydro-1H-3-benzazepin-7-yl)butanamide trifluoroacetate O
\ ~ \
HN I /
N
The title compound was obtained in the same manner as N~Me Me The title compound was obtained in the same manner as in Example 36.
MS(APCI)(M+1): 352 Example 105 N-[2-(Dimethylamino)ethyl]-N-methyl-4-oxo-4-(2,3,4,5-tetrahydro-1H-3-benzazepin-7-yl)butanehydrazide trifluoroacetate O Me I
\ N\/\
N / O
in Example 36.
MS (APCI ) (M+1 ) : 332 Example 106 N-(1-Benzylpyrrolidin-3-yl)-N-methyl-4-oxo-4-(2,3,4,5-tetrahydro-1H-3-benzazepin-7-yl)butanamide trifluoroacetate O Me IN
HN I ' ,N
O
The title compound was obtained in the same manner as in Example 36.
MS(APCI)(M+1): 420 Example 107 N-Ethyl-4-oxo-N-(pyridin-4-ylmethyl)-4-(2,3,4,5-tetrahydro-1H-3-benzazepin-7-yl)butanamide trifluoroacetate O 'Me / N
'N ~ I
v HN
/ O
The title compound was obtained in the same manner as in Example 36.
MS (APCI ) (M+1 ) : 366 Example 108 4-Oxo-N,N-bis(pyridin-3-ylmethyl)-4-(2,3,4,5-tetrahydro-1H-3-benzazepin-7-yl)butanamide trifluoroacetate N
o ~ / I
N ~ N
HN ~ / to The title compound was obtained in the same manner as in Example 36.
MS(APCI)(M+1): 429 Example 109 4-(4-Ethylpiperazin-1-yl)-4-oxo-1-(2,3,4,5-tetrahydro-1H-3-benzazepin-7-yl)butan-1-one trifluoroacetate O ~N~Me NJ
HN I (I
O
The title compound was obtained in the same manner as in Example 36.
MS (APCI) (M+1) : 344 Example 110 Ethyl [4-[4-oxo-4-(2,3,4,5-tetrahydro-1H-3-benzazepin-7-yl)butanoyl]piperazin-1-yl]acetate trifluoroacetate O ~N~OUMe N J I IO
HN I II
/ O
The title compound was obtained in the same manner as in Example 36.
MS (APCI) (M+1) : 401 Example 111 4-(4-Benzylpiperazin-1-yl)-4-oxo-1-(2,3,4,5-tetrahydro-1H-3-benzazepin-7-yl)butan-1-one trifluoroacetate O ~N ~ \
\ NJ /
HN I II
/ O
The title compound was obtained in the same manner as in Example 36.
MS(APCI)(M+1): 406 Example 112 4-Oxo-4-[4-(pyridin-2-yl)piperazin-1-yl]-1-(2,3,4,5-tetrahydro-1H-3-benzazepin-7-yl)butan-1-one trifluoroacetate The title compound was obtained in the same manner as in Example 36.
MS (APCI ) (M+1 ) : 393 Example 113 4-(4-Benzhydrylpiperazin-1-yl)-4-oxo-1-(2,3,4,5-tetrahydro-1H-3-benzazepin-7-yl)butan-1-one trifluoroacetate The title compound was obtained in the same manner as in Example 36.
MS (ESI) (M+1) : 482 Example 114 4-Oxo-4-(4-phenylpiperazin-1-yl)-1-(2,3,4,5-tetrahydro-1H-3-benzazepin-7-yl)butan-1-one trifluoroacetate The title compound was obtained in the same manner as in Example 36.
MS(ESI)(M+1): 392 Example 115 4-[4-(2-Methoxyphenyl)piperazin-1-yl]-4-oxo-1-(2,3,4,5-tetrahydro-1H-3-benzazepin-7-yl)butan-1-one trifluoroacetate ~I
O ~N
NJ Me O
HN I / IO
The title compound was obtained in the same manner as in Example 36.
MS(ESI)(M+1): 432 Example 116 4-(1,4'-Bipiperidin-1'-yl)-4-oxo-1-(2,3,4,5-tetrahydro-1H-3-benzazepin-7-yl)butan-1-one trifluoroacetate The title compound was obtained in the same manner as in Example 36.
MS (APCI) (M+1) : 398 Example 117 4-[3-(Dimethylamino)pyrrolidin-1-yl]-4-oxo-1-(2,3,4,5-tetrahydro-1H-3-benzazepin-7-yl)butan-1-one trifluoroacetate p ~ Me N N
Me HN / Ipl The title compound was obtained in the same manner as in Example 36.
MS(APCI)(M+1): 344 Example 118 N-Benzyl-N-(1-benzylpyrrolidin-3-yl)-4-oxo-4-(2,3,4,5-tetrahydro-1H-3-benzazepin-7-yl)butanamide trifluoroacetate The title compound was obtained in the same manner as in Example 36.
MS (ESI) (M+1) : 496 Example 119 4-Oxo-N,N-bis(pyridin-2-ylmethyl)-4-(2,3,4,5-tetrahydro-1H-3-benzazepin-7-yl)butanamide trifluoroacetate The title compound was obtained in the same manner as in Example 36.
MS(APCI)(M+1): 429 Example 120 4-(4-Methyl-1,4-diazepin-1-yl)-4-oxo-1-(2,3,4,5-tetrahydro-1H-3-benzazepin-7-yl)butan-1-one trifluoroacetate The title compound was obtained in the same manner as in Example 36.
MS(APCI)(M+1): 344 Example 121 4-[4-(2-Hydroxyethyl)pyrazin-1-yl]-4-oxo-1-(2,3,4,5-tetrahydro-1H-3-benzazepin-7-yl)butan-1-one trifluoroacetate OOH
O ~N
\ NJ
HN I II
O
The title compound was obtained in the same manner as in Example 36.
MS(APCI)(M+1): 360 Example 122 4-[4-(1,3-Benzodioxol-5-ylmethyl)pyrazin-1-yl]-4-oxo-1-(2,3,4,5-tetrahydro-1H-3-benzazepin-7-yl)butan-1-one trifluoroacetate O ~N I \
\ NJ / o HN I / IO
The title compound was obtained in the same manner as in Example 36.
MS(APCI)(M+1): 450 Example 123 4-Oxo-4-[4-(pyrimidin-2-yl)piperazin-1-yl]-1-(2,3,4,5-tetrahydro-1H-3-benzazepin-7-yl)butan-1-one trifluoroacetate O ~N N
NJ
HN I /
The title compound was obtained in the same manner as in Example 36.
MS(ESI)(M+1): 394 Example 124 4-Oxo-4-[4-[(2E)-3-phenyl-2-propenyl]piperazin-1-yl]-1-(2,3,4,5-tetrahydro-1H-3-benzazepin-7-yl)butan-1-one trifluoroacetate O ~N /
NJ I /
HN I of The title compound was obtained in the same manner as in Example 36.
MS(ESI)(M+1): 432 Example 125 N-Benzyl-N-[2-(dimethylamino)ethyl]-4-oxo-4-(2,3,4,5-tetrahydro-1H-3-benzazepin-7-yl)butanamide trifluoroacetate The title compound was obtained in the same manner as in Example 36.
MS(APCI)(M+1): 408 Example 126 N-Methyl-N-(1-methylpiperazin-4-yl)-4-oxo-4-(2,3,4,5-tetrahydro-1H-3-benzazepin-7-yl)butanamide trifluoroacetate O lljle ~N
HN I II I
/ O N~~
The title compound was obtained in the same manner as in Example 36.
MS(APCI)(M+1): 358 Example 127 4-Oxo-4-[2-(pyrrolidin-1-ylmethyl)pyrrolidin-1-yl]-1-(2,3,4,5-tetrahydro-1H-3-benzazepin-7-yl)butan-1-one trifluoroacetate O
N
HN I II
/ O N
The title compound was obtained in the same manner as in Example 36.
MS(APCI)(M+1): 384 Example 128 4-Oxo-4-[4-(pyrrolidin-1-yl)piperidin-1-yl]-1-(2,3,4,5-tetrahydro-1H-3-benzazepin-7-yl)butan-1-one trifluoroacetate The title compound was obtained in the same manner as in Example 36.
MS(APCI)(M+1): 384 Example 129 N-Benzyl-N-(2-carboxyethyl)-4-oxo-4-(2,3,4,5-tetrahydro-1H-3-benzazepin-7-yl)butanamide trifluoroacetate O
\ v HN
/ O
The title compound was obtained in the same manner as in Example 36.
MS(ESI)(M+1): 409 Example 130 4-[4-(4-Chlorophenyl)-1-piperidinyl]-4-oxo-1-(2,3,4,5-tetrahydro-1H-2-benzazepin-8-yl)-1-butanone 1) Using 2-(trifluoroacetyl)-2,3,4,5-tetrahydro-1H-2-benzazepine, 4-oxo-4-[2-(trifluoroacetyl}-2,3,4,5-tetrahydro-1H-2-benzazepin-8-yl)butanoic acid was obtained by the same procedure as in Reference Example 15.
1H-NMR (DMSO-d6) b: 1. 82 (2H, m) , 2. 58 (2H, t, J = 6.2 Hz) , 3. 08 (2H, m) , 3.23 (2H, t, J = 6. 0 Hz) , 3. 89 (2H, m) , 4 .73 (2H, m), 7.37-7.41 (1H, m), 7.84-7.88 (2H, m), 12.16 (1H, s) .
2) Using 4-oxo-4-[2-(trifluoroacetyl)-2,3,4,5-tetrahydro-1H-2-benzazepin-8-yl]butanoic acid obtained in 1) above, the title compound was obtained as colorless powder by the same procedures as in Examples 12 and 13.
1H-NMR (CDC13) b: 1.57-1.90 (6H, m), 2.60-2.74 (3H, m), 2.82 (2H, t, J = 6.6 Hz), 2.99 (2H, m), 3.12-3.24 (3H, m), 3.34 (2H, t, J = 6.6 Hz), 4.01 (2H, s), 4.13 (1H, d, J -15. 6 Hz) , 4. 76 (1H, d, J = 12 Hz) , 7. 12-7. 30 (5H, m) , 7. 79 (2H, m) .
Melting point: 122-124 °C (crystallizing solvent:
ethanol-diisopropyl ether).
Example 131 4-[4-(4-Chlorophenyl)-1-piperidinyl]-1-(2-methyl-2,3,4,5-tetrahydro-1H-2-benzazepin-8-yl)-4-oxo-1-butanone CI
\
O v Me ~N \ N
Using 4-[4-(4-chlorophenyl)-1-piperidinyl]-4-oxo-1-(2,3,4,5-tetrahydro-1H-2-benzazepin-8-yl)-1-butanone obtained in Example 130, the title compound was obtained as colorless powder by the same procedure as in Example 16.
1H-NMR (CDC13) b: 1.57-1.94 (6H, m), 2.33 (3H, s), 2.61-2.70 (2H, m) , 2. 84 (2H, t, J = 6. 6 Hz) , 3. 00 (2H, m) , 3. 02 ( 2H, t, J = 5 . 1 Hz ) , 3 . 18 ( 1H, m) , 3 . 36 ( 2H, t, J = 6 . 6 Hz ) , 3.85 (2H, s), 4.14 (1H, d, J = 15.6 Hz), 4.76 (1H, d, J =

12 Hz), 7.12-7.30 (5H, m), 7.83 (2H, m).
Melting point: 133-134 °C (crystallizing solvent:
ethanol-diisopropyl ether).
Example 132 4-[4-(4-Chlorophenyl)-1-piperidinyl]-1-(2,3-dihydro-1H-isoindol-5-yl)-4-oxo-1-butanone CI
1) Using 2-(trifluoroacetyl) isoindole, 4-oxo-4-[2-(trifluoroacetyl)-2,3-dihydro-1H-isoindol-5-yl]butanoic acid was obtained by the same procedure as in Reference Example 15.
1H-NMR (DMSO-d6) b: 2.59 (2H, t, J = 6.2 Hz) , 3.25 (2H, t, J - 6.0 Hz), 4.90 (2H, m), 5.12 (2H, m), 7.55 (1H, m), 7.96-8.05 (2H, m), 12.16 (1H, s).
2) Using 4-oxo-4-[2-(trifluoroacetyl)-2,3-dihydro-1H-isoindol-5-yl]butanoic acid obtained in 1) above, the title compound was obtained as colorless powder by the same procedures as in Examples 12 and 13.
1H-NMR (CDC13) b: 1.56-1.68 (2H, m), 1.82-1.96 (2H, m), 2.58-2.74 (2H, s), 2.84 (2H, t, J = 6.6 Hz), 3.04 (1H, s), 3.17 (1H, m), 3.36 (2H, t, J = 6.6 Hz), 4.15 (1H, d, J -15.6 Hz), 4.31 (4H, s), 4.76 (1H, d, J = 12 Hz), 7.11-7.36 ( 5H, m) , 7 . 92 ( 2H, m) .
Melting point: 133-134 °C (crystallizing solvent:
ethanol-diisopropyl ether).
Example 133 N,N-Dipropyl-(3,4-dihydro-2H-1,4-benzoxazine-3-oxo-6-yl) acetamide O ~ O
"N I ~ N~Me O
i H
Me 10 o palladium-carbon (2.5 g) was added to a solution of N,N-dipropyl-(4-ethoxycarbonylmethoxy-3-nitrophenyl) acetamide (11 g, 30.0 mmol) obtained in Reference Example 17 in ethanol (500 ml) and then subjected to catalytic hydrogenation reaction at normal pressure at room temperature. After the reaction was finished, the catalyst was filtered off, and the resultant filtrate was concentrated. The residues were dissolved in toluene (500 ml) and heated overnight under reflux. The reaction solution was concentrated and then recrystallized from ethyl acetate-hexane, whereby the title compound (8.4 g) was obtained as crystals with a mp of 121 to 122 °C.
1H-NMR (CDC13) b: 0.8-1.0 (6H, m), 1.4-1.7 (4H, m), 3.15-3.4 (4H, m), 3.62 (2H, s), 4.53 (2H, s), 6.7-6.9 (3H, m), 9.1-9.4 (1H, br).
Elemental analysis for Cl6HzzNz03 Calcd.: C, 66.18; H, 7.64; N, 9.65.
Found: C, 66.07; H, 7.37; N, 9.59.
Example 134 3,4-Dihydro-6-[2-(N,N-dipropylamino)ethyl]-2H-1,4-benzoxazine hydrochloride N~ Me H
.
NCI Me 1 N borane/THF solution (140 ml, 140 mmol) was added to a solution of N,N-dipropyl-(3,4-dihydro-2H-1,4-benzoxazine-3-oxo-6-yl)acetamide (10 g, 34.4 mmol) obtained in Example 133 in THF (200 ml), and the mixture was stirred at room temperature for 4 hours, and then 6 N hydrochloric acid (30 ml, 180 mmol) was added dropwise to the reaction solution under cooling with ice-bath. The reaction solution was neutralized with 6 N aqueous sodium hydroxide and extracted with ethyl acetate. The reaction solution was washed with water, dried over anhydrous magnesium sulfate and concentrated. The residues were purified by silica gel column chromatography (developing solvent;

hexane . ethyl acetate = 4 . 1), then 4 N hydrochloric acid in ethyl acetate was added thereto, and the solution was concentrated, whereby the title compound (6.8 q) was obtained as amorphous powder.
1H-NMR ( CDC13, free base ) ~ : 0 . 91 ( 6H, t, J = 7 . 2 Hz ) , 1. 6-1.8 (4H, m), 2.6-2.8 (4H, m), 2.84 (4H, brs), 3.41 (2H, t, J = 4.4 Hz), 3.6-4.0 (1H, br), 4.22 (2H, t, J = 4.4 Hz), 6.4-6.6 (2H, m), 6.65-6.75 (1H, m).
Example 135 3,4-Dihydro-6-[2-(N,N-dipropylamino)ethyl]-4-(1-naphthalenesulfonyl)-2H-1,4-benzoxazine succinate N~ Me S-O
O ~ (CO2H~ Me A solution of 1-naphthalenesulfonyl chloride (388 mg, 1.72 mmol) in acetonitrile (5 ml) was added to a solution of 3,4-dihydro-6-[2-(N,N-propylamino)ethyl]-2H-1,4-benzoxazine hydrochloride (300 mg, 1.14 mmol) obtained in Example 134, 4-dimethylaminopyridine (140 mg, 1.14 mmol) and triethylamine (0.48 ml, 3.43 mmol) in acetonitrile (15 ml) under cooling with ice-bath, and the mixture was stirred at room temperature for 4 hours. Water (50 ml) was added to the reaction solution which was then extracted with ethyl acetate. The extract was washed with 10 0 aqueous potassium carbonate and a saturated saline solution, dried over anhydrous sodium sulfate and concentrated. The residues were purified by silica gel column chromatography (developing solvent; ethyl acetate), and succinic acid (1 equivalent) was added thereto, and the product was recrystallized from ethyl acetate-diisopropyl ether, whereby the title compound (220 mg) was obtained as crystals with a mp of 144 to 145 °C.
1H-NMR (CDC13, free base) ~: 0.89 (6H, t, J = 7.2 Hz), 1.4-1. 6 ( 4H, m) , 2 . 4-2 . 6 ( 4H, m) , 2 . 66 ( 4H, brs ) , 3 . 65 ( 2H, t, J = 4. 6 Hz) , 3. 89 (2H, t, J = 4. 6 Hz) , 6. 64 (1H, d, J = 8. 4 Hz) , 6.89 (1H, dd, J = 8.4, 1.8 Hz) , 7.3-7. 6 (4H, m) , 7. 90 (1H, d, J = 7.8 Hz), 8.08 (1H, d, J = 8.4 Hz), 8.2-8.4 (2H, m).
Example 136 3,4-Dihydro-6-[2-(N,N-dipropylamino)ethyl]-4-(2-naphthalenesulfonyl)-2H-1,4-benzoxazine succinate c° , N~ Me OO .
(CQiH~ Me Using 3,4-dihydro-6-[2-(N,N-dipropylamino)ethyl]-2H-1,4-benzoxazine hydrochloride obtained in Example 134, the title compound was obtained as colorless amorphous powder by the same procedure as in Example 135.
1H-NMR (CDC13, free base) b: 0.90 (6H, t, J = 7.2 Hz), 1.4 1. 6 (4H, m) , 2. 4-2. 6 (4H, m) , 2. 71 (4H, brs) , 3. 68 (2H, t, J - 4.6 Hz), 3.93 (2H, t, J - 4.6 Hz), 6.68 (1H, d, J
8.4 Hz), 6.90 (1H, dd, J = 8.4, 1.8 Hz), 7.5-7.8 (4H, m), 7.8-8.0 (3H, m), 8.29 (1H, brs).
Example 137 4-(4-Chlorobenzenesulfonyl)-3,4-dihydro-6-[2-(N,N-dipropylamino)ethyl]-2H-1,4-benzoxazine succinate CO w N~Me 00 .
(C02H~ Me CI
Using 3,4-dihydro-6-[2-(N,N-dipropylamino)ethyl]-2H-1,4-benzoxazine hydrochloride obtained in Example 134, the title compound was obtained as powder by the same procedure as in Example 135.
1H-NMR (CDC13, free base) b: 0.89 (6H, t, J = 7.2 Hz) , 1. 4-1. 6 ( 4H, m) , 2 . 4-2 . 6 ( 4H, m) , 2 . 69 ( 4H, brs ) , 3 . 72 ( 2H, t, J - 4.6 Hz), 3.88 (2H, t, J - 4.6 Hz), 6.72 (1H, d, J -8.4 Hz), 6.92 (1H, dd, J = 8.6, 2.0 Hz), 7.41 (2H, d, J =
8.8 Hz), 7.56 (2H, d, J = 8.8 Hz), 7.64 (1H, d, J = 2.0 Hz).
Elemental analysis for Cz9H31C1N20,S

Calcd.: C, 54.70; H, 5.93; N, 5.32.
Found: C, 54.46; H, 5.88; N, 5.29.
Melting point: 130-133 °C (crystallizing solvent: acetone) Example 138 3,4-Dihydro-6-[2-(N,N-dipropylamino)ethyl]-4-(2,4,6-trimethylbenzenesulfonyl)-2H-1,4-benzoxazine succinate Me N I ~ N~Me OO
Me I ~ Me (C~H~ Me Using 3,4-dihydro-6-[2-(N,N-dipropylamino)ethyl]-2H-1,4-benzoxazine hydrochloride obtained in Example 134, the title compound was obtained as powder by the same procedure as in Example 135.
1H-NMR (CDC13, free base) b: 0.88 (6H, t, J = 7.4 Hz) , 1. 3-1.6 (4H, m), 2.3-2.6 (4H, m), 2.33 (3H, s), 2.48 (4H, brs), 2.57 (6H, s), 3.83 (2H, t, J = 4.6 Hz), 4.23 (2H, t, J =
4.6 Hz), 6.61 (1H, brs), 6.8-6.85 (2H, m), 7.00 (2H, s).
Melting point: 157-158 °C (crystallizing solvent: ethyl acetate-diisopropyl ether) Example 139 4-(4-t-Butylbenzenesulfonyl)-3,4-dihydro-6-[2-(N,N-dipropylamino)ethyl]-2H-1,4-benzoxazine succinate Me Me Using 3,4-dihydro-6-[2-(N,N-dipropylamino)ethyl]-2H-1,4-benzoxazine hydrochloride obtained in Example 134, the title compound was obtained as amorphous powder by the same procedure as in Example 135.
1H-NMR (CDC13, free base) b: 0.90 (6H, t, J = 7.2 Hz), 1.30 (9H, s), 1.3-1.6 (4H, m), 2.4-2.55 (4H, m), 2.69 (4H, s), 3.71 (2H, t, J = 4.0 Hz), 3.85 (2H, t, J = 4.0 Hz), 6.72 ( 1H, d, J = 8 . 2 Hz ) , 6 . 90 ( 1H, dd, J = 8 . 2, 2 . 0 Hz ) , 7 . 4 4 ( 2H, d, J = 8 . 8 Hz ) , 7 . 57 ( 2H, d, J = 8 . 8 Hz ) , 7 . 68 ( 1H, d, J = 2.0 Hz).
Elemental analysis for Cz8H4oNa0,S
Calcd.: C, 61.29; H, 7.35; N, 5.11.
Found: C, 61.02; H, 7.57; N, 5.00.
Example 140 4-Benzylsulfonyl-3,4-dihydro-6-[2-(N,N-dipropylamino)ethyl]-2H-1,4-benzoxazine succinate CO ~
N I ~ N~Me S=O
,O
(C02H~ Me Using 3,4-dihydro-6-[2-(N,N-dipropylam~no)ethyl]-2H-1,4-benzoxazine hydrochloride obtained in Example 134, the title compound was obtained as powder by the same procedure as in Example 135.
1H-NMR (CDC13, free base} b: 0.89 (6H, t, J = 7.2 Hz) , 1.4-1.6 (4H, m), 2.4-2.55 (4H, m), 2.66 (4H, brs), 3.53 (2H, t, J = 4.2 Hz), 3.73 (2H, t, J = 4.2 Hz), 4.44 (2H, s), 6.7-7.0 (2H, m); 7.1-7.4 (6H, m).
Melting point: 150-151 °C (crystallizing solvent: ethyl acetate-diisopropyl ether) Example 141 3,4-Dihydro-6-[2-(N,N-dipropylamino)ethyl]-4-(2-naphthoyl)-2H-1,4-benzoxazine hydrochloride C
N~ Me p HCI Me Using 3,4-dihydro-6-[2-(N,N-dipropylamino)ethyl]-2H-1,4-benzoxazine hydrochloride obtained in Example 134, the title compound was obtained as powder by the same procedure as in Example 135.
1H-NMR (CDC13, free base) b: 0.75 (6H, t, J = 7.2 Hz) , 1.0-1.4 (4H, m), 1.9-2.2 (6H, m), 2.2-2.4 (2H, m), 4.06 (2H, t, J - 4.2 Hz), 4.39 (2H, t, J - 4.2 Hz), 6.5-6.9 (3H, m), 7.4-7.6 (3H, m), 7.7-7.9 (3H, m), 8.04 (1H, s).
Melting point: 165-166 °C (crystallizing solvent:
methanol-diethyl ether) Example 142 4-(4-Biphenyl-1-carbonyl)-3,4-dihydro-6-[2-(N,N-dipropylamino)ethyl]-2H-1,4-benzoxazine N~~
Me Using 3,4-dihydro-6-[2-(N,N-dipropylamino)ethyl]-2H-1,4-benzoxazine hydrochloride obtained in Example 134, the title compound was obtained as powder by the same procedure as in Example 135.
1H-NMR (CDC13) ~: 0.75 (6H, t, J = 7.2 Hz) , 1. 1-1.4 (4H, m) , 2.1-2. 6 (8H, m) , 4. 04 (2H, t, J = 4. 6 Hz) , 4.38 (2H, t, J
- 4.6 Hz), 6.6-6.9 (3H, m), 7.3-7.5 (3H, m), 7.5-7.7 (6H, m) .
Melting point: 95-96 °C (crystallizing solvent: ethyl acetate-diisopropyl ether) Example 143 3,4-Dihydro-6-[2-(N,N-dipropylamino)ethyl]-4-(1-naphthylmethyl)-2H-1,4-benzoxazine hydrochloride Me Potassium carbonate (316 mg, 2.29 mmol) was added to a solution of 3,4-dihydro-6-[2-(N,N-dipropylamino)ethyl)-2H-1,4-benzoxazine hydrochloride (200 mg, 0.76 mmol) obtained in Example 134 and 1-chloromethyl naphthalene (400 mg, 2.29 mmol) in DMF (15 ml). After the reaction solution was stirred at room temperature for 2 hours, water was added to the reaction solution which was then extracted with ethyl acetate. The extract was washed with water, dried over anhydrous sodium sulfate and concentrated. The residues were purified by silica gel column chromatography (developing solvent; hexane . ethyl acetate - 3 . 1), treated with 4 N hydrochloric acid in ethyl acetate and crystallized from acetone-pentane, whereby the title compound (80 mg) was obtained as crystals with a mp of 177 to 178 °C.
1H-NMR (CDC13, free base) b: 0.82 (6H, t, J = 7.4 Hz) , 1.4 1.7 (4H, m) , 2.3-2.5 (4H, m) , 2.59 (4H, brs) , 3.28 (2H, t, J = 4.4 Hz), 4.21 (2H, t, J = 4.4 Hz), 4.84 (2H, s), 6.4 6.6 (2H, m), 6.7-6.8 (1H, m), 7.3-7.6 (4H, m), 7.7-8.0 (2H, m), 8.0-8.1 (1H, m).

Elemental analysis for C27HssC1N2O~ 0. 5H20 Calcd.: C, 72.38; H, 8.10; N, 6.25.
Found: C, 72.24; H, 7.91; N, 6.12.
Example 144 3,4-Dihydro-6-[2-(N,N-dipropylamino)ethyl]-4-(2-naphthylmethyl)-2H-1,4-benzoxazine hydrochloride ~ Me Ae Using 3,4-dihydro-6-[2-(N,N-dipropylamino) ethyl]-2H-1,4-benzoxazine hydrochloride obtained in Example 134, the title compound was obtained as powder by the same procedure as in Example 143.
1H-NMR (CDC13, free base) b: 0.82 (6H, t, J = 7. 4 Hz) , 1. 4 1.7 (4H, m), 2.4-2.9 (8H, m), 3.3-3.5 (2H, m), 4.2-4.4 (2H, m), 4.59 (2H, brs), 6.4-6.6 (2H, m), 6.7-6.8 (1H, m), 7.3 7.5 (3H, m), 7.7-7.9 (4H, m).
Melting point: 169-170 °C (crystallizing solvent: diethyl ether-hexane) Example 145 3,4-Dihydro-6-[3-(N,N-dipropylamino)propyl]-4-(2-naphthalenesulfonyl)-2H-1,4-benzoxazine succinate Me O
N
N
Me / / ' C H
Qz Potassium carbonate (0.9 g, 6.48 mmol) was added to a solution of 3,4-dihydro-6-(3-iodopropyl)-4-(2-naphthalenesulfonyl)-2H-1,4-benzoxazine (1.0 g, 2.16 mmol) obtained in Reference Example 19 and dipropylamine (263 mg, 2.60 mmol) in DMF (20 ml), and the mixture was stirred overnight at room temperature. Water was added to the reaction solution which was then extracted with ethyl acetate. The extract was washed with water and aqueous saturated sodium bicarbonate, dried over anhydrous sodium sulfate and concentrated. The residues were purified by alumina column chromatography (developing solvent; hexane .
ethyl acetate = 4 . 1) and then dissolved in ethyl acetate.
1 equivalent of succinic acid was added to the resultant solution, and then the solvent was distilled away, whereby the title compound (1.17 g) was obtained as amorphous powder.
1H-NMR (CDC13, free base) b: 0.8-1.0 (6H, m), 1.3-1.6 (4H, m) , 1. 6-1. 9 (2H, m) , 2. 3-2. 6 (8H, m) , 3. 67 (2H, t, J = 4. 6 Hz ) , 3 . 92 ( 2H, t, J = 4 . 6 Hz ) , 6 . 68 ( 1H, d, J = 8 . 4 Hz ) , 6. 91 (1H, dd, J = 8. 4, 2.0 Hz) , 7.52 (1H, dd, J = 8. 4, 2.0 Hz), 7.5-7.5 (2H, m), 7.76 (1H, d, J = 2.0 Hz), 7.8-8.0 (3H, m) , 8.28 (1H, d, J = 1. 8 Hz) .
Example 146 3,4-Dihydro-4-(2-naphthalenesulfonyl)-6-[3-(N-propylamino)propyl]-2H-1,4-benzoxazine succinate CO ~
N
S=O
O Me C H
Using 3,4-dihydro-6-(3-iodopropyl)-4-(2-naphthalene sulfonyl)-2H-1,4-benzoxazine obtained in Reference Example 19, the title compound was obtained as powder by the same procedure as in Example 145.
1H-NMR (CDC13, free base) b: 0. 92 (3H, t, J = 7.4 Hz) , 1.4-1.7 (2H, m), 1.7-2.0 (4H, m), 2.5-2.8 (4H, m), 3.68 (2H, t, J = 4. 6 Hz) , 3. 92 (2H, t, J = 4. 6 Hz) , 6. 68 (1H, d, J = 8.4 Hz) , 6. 89 (1H, dd, J = 8. 4, 2.2 Hz) , 7.4-7.7 (3H, m) , 7.74 ( 1H, d, J = 1. 8 Hz ) , 7 . 8-8 . 0 ( 3H, m) , 8 . 28 ( 1H, d, J = 1. 6 Hz ) .
Melting point: 155-156 °C (crystallizing solvent:
methanol-diethyl ether) Example 147 3,4-Dihydro-4-(2-naphthalenesulfonyl)-6-[3-(4-piperidinopiperidino)propyl]-2H-1,4-benzoxazine dihydrochloride O N
Nr N
i OO

Using 3,4-dihydro-6-(3-iodopropyl)-4-(2-naphthalene sulfonyl)-2H-1,4-benzoxazine obtained in Reference Example 19, the title compound was obtained as powder by the same procedure as in Example 145.
1H-NMR (CDC13, free base) b: 1.3-2.0 (13H, m) , 2.1-2.4 (4H, m), 2.4-2.7 (6H, m), 2.9-3.1 (2H, m), 3.68 (2H, d, J = 4.6 Hz), 3.91 (2H, d, J = 4.6 Hz), 6.68 (1H, d, J = 8.2 Hz), 6.89 (1H, dd, J = 8.2, 2.0 Hz), 7.4-7.7 (3H, m), 7.74 (1H, d, J = 2.0 Hz), 7.8-8.0 (3H, m), 8.28 (1H, d, J = 1.6 Hz).
Melting point: 240-241 °C (crystallizing solvent:
methanol-diethyl ether) Example 148 3,4-Dihydro-4-(2-naphthalenesulfonyl)-6-[3-(4-phenylpiperidino)propyl]-2H-1,4-benzoxazine hydrochloride N I / N
C
i OO
~ HCI
Using 3,4-dihydro-6-(3-iodopropyl)-4-(2-naphthalene sulfonyl)-2H-1,4-benzoxazine obtained in Reference Example 19, the title compound was obtained as powder by the same procedure as in Example 145.
1H-NMR (CDC13, free base) b: 1.6-2.2 (8H, m), 2.3-2.6 (3H, m), 2.64 (2H, t, J = 7.6 Hz), 3.0-3.2 (2H, m), 3.68 (2H, t, J = 4.6 Hz), 3.93 (2H, t, J = 4.6 Hz), 6.69 (1H, d, J = 8.4 Hz) , 6. 91 (1H, dd, J = 8. 4, 2. 0 Hz) , 7.1-7.4 (5H, m) , 7.4-7.7 (3H, m), 7.76 (1H, d, J - 2.0 Hz), 7.8-8.0 (3H, m), 8.30 (1H, brs).
Melting point: 182-183 °C (crystallizing solvent:
methanol-diethyl ether) Example 149 6-[3-[4-(4-Chlorophenyl)-4-hydroxypiperidino]propyl]-3,4-dihydro-4-(2-naphthalenesulfonyl)-2H-1,4-benzoxazine hydrochloride CI
o ~ ~I
N OH
N
i I
HCI
Using 3,4-dihydro-6-(3-iodopropyl)-4-(2-naphthalene sulfonyl)-2H-1,4-benzoxazine obtained in Reference Example 19, the title compound was obtained as powder by the same procedure as in Example 145.
1H-NMR (CDC13) b: 1.7-2.0 (4H, m) , 2.15 (2H, td, J = 13.2, 4.4 Hz), 2.3-2.6 (4H, m), 2.65 (2H, t, J = 7.6 Hz), 2.7-2.9 (2H, m) , 3. 67 (2H, t, J = 4. 6 Hz) , 3. 92 (2H, t, J = 4. 6 Hz) , 6.70 (1H, d, J = 8.4 Hz), 6.91 (1H, dd, J = 8.4, 1.8 Hz), 7.2-7.4 (2H, m), 7.4-7.7 (7H, m), 7.77 (1H, d, J = 2.0 Hz), 7.8-8.0 (3H, m), 8.29 (1H, brs).
Melting point: 125-126 °C (crystallizing solvent:
methanol-diethyl ether) Example 150 3,4-Dihydro-6-[3-[4-(3,4-methylenedioxybenzyl)piperazino]propyl]-4-(2-naphthalenesulfonyl)-2H-1,4-benzoxazine dihydrochloride ~N ~ O
~NJ
N O
i OO

Using 3,4-dihydro-6-(3-iodopropyl)-4-(2-naphthalene sulfonyl)-2H-1,4-benzoxazine obtained in Reference Example 19, the title compound was obtained as powder by the same procedure as in Example 145.
1H-NMR (CDC13, free base) b: 1.7-1. 9 (2H, m) , 2.3-2.7 (12H, m), 3.42 (2H, s), 3.68 (2H, t, J = 4.6 Hz), 3.92 (2H, t, J
- 4.6 Hz), 5.94 (2H, s), 6.68 (1H, d, J = 8.4 Hz), 6.75 (2H, brs), 6.8-7.0 (2H, m), 7.4-7.7 (3H, m), 7.74 (1H, d, J -2.0 Hz), 7.8-8.0 (3H, m), 8.28 (1H, d, J = 1.6 Hz).
Melting point: 212-213 °C (crystallizing solvent:
methanol-diethyl ether) Example 151 3,4-Dihydro-4-[3,4-dihydro-6,7-dimethoxyspiro[naphthalene-2(1H),2'-piperidine]-2'-yl]-4-(2-naphthalenesulfonyl)-2H-1,4-benzoxazine hydrochloride CO ~
N I ~ N ~ OMe S=O
~O ~ OMe HCI
Using 3,4-dihydro-6-(3-iodopropyl)-4-(2-naphthalene sulfonyl)-2H-1,4-benzoxazine obtained in Reference Example 19, the title compound was obtained as amorphous powder by the same procedure as in Example 145.
1H-NMR (CDC13, free base) b: 1.3-2.0 (10H, m), 2.3-2.9 (10H, m) , 3. 66 (2H, t, J = 4. 4 Hz) , 3. 82 ( 6H, s) , 3. 90 (2H, t, J
- 4.4 Hz), 6.56 (2H, brs), 6.68 (1H, d, J = 8.4 Hz), 6.90 (1H, dd, J = 8.4, 2.0 Hz), 7.47 (1H, dd, J = 8.6, 2.0 Hz), 7.5-7.7 (2H, m), 7.7-8.0 (4H, m), 8.27 (1H, brs).
Example 152 3,4-Dihydro-4-(2-naphthalenesulfonyl)-6-[3-(4-pyridylmethylamino)propyl]-2H-1,4-benzoxazine dihydrochloride o1\
C / N,~~
N
i I \ \ o0 / / ~ 2HCi Using 3,4-dihydro-6-(3-iodopropyl)-4-(2-naphthalene sulfonyl)-2H-1,4-benzoxazine obtained in Reference Example 19, the title compound was obtained as amorphous powder by the same procedure as in Example 145.
1H-NMR (CDC13, free base) b: 1.7-2.0 (2H, m) , 2. 67 (4H, t, J = 7.0 Hz), 3.68 (2H, t, J = 4.4 Hz), 3.81 (2H, s), 3.91 ( 2H, t, J = 4 . 4 Hz ) , 6. 68 ( 1H, d, J = 8 . 4 Hz ) , 6 . 88 ( 1H, dd, J = 8.4, 2.2 Hz), 7.1-7.3 (2H, m), 7.4-7.7 (3H, m), 7.7-8.0 (4H, m), 8.28 (1H, brs), 8.53 (2H, d, J = 6.2 Hz).
Example 153 6-~3-[2-(3-Indolylethyl)amino]propyl}-3,4-dihydro-4-(2-naphthalenesulfonyl)-2H-1,4-benzoxazine hydrochloride O
CN I / N
I
I ~ ~ OO H
/ / ' HCI
Using 3,4-dihydro-6-(3-iodopropyl)-4-(2-naphthalene sulfonyl)-2H-1,4-benzoxazine obtained in Reference Example 19, the title compound was obtained as amorphous powder by the same procedure as in Example 145.
1H-NMR (CDC13, free base) S: 1.7-2.0 (2H, m), 2.58 (2H, t, J - 8.0 Hz), 2.69 (2H, t, J - 8.0 Hz), 2.8-3.1 (4H, m), 3.67 (2H, t, J = 4.4 Hz), 3.90 (2H, t, J = 4.4 Hz), 6.64 ( 1H, d, J = 8 . 4 Hz ) , 6 . 82 ( 1H, dd, J = 8 . 2, 2 . 0 Hz ) , 7 . 0-7.3 (3H, m), 7.3-7.4 (1H, m), 7.4-7.8 (5H, m), 7.8-8.0 (3H, m), 8.18 (1H, brs), 8.27 (1H, brs).
Example 154 N,N-Dipropyl-[3,4-dihydro-3-(4-methoxyphenyl)-2H-1,4-benzoxazin-6-yl]acetamide O
I O Me N / N~
/ H
Me0 Me Using N,N-dipropyl-[4-(4-methoxybenzene) carbonylmethoxy-3-nitrophenyl]acetamide obtained in Reference Example 20, the title compound was obtained as oily matter by the same procedure as in Example 133.
1H-NMR (CDC13) b: 0. 8-1. 0 (6H, m) , 1.4-1. 7 (4H, m) , 3. 1-3. 4 (4H, m), 3.56 (2H, s), 3.82 (3H, s), 3.8-4.0 (2H, m), 4.22 (1H, d, J = 10. 6 Hz) , 4.44 (1H, dd, J = 8.8, 3.0 Hz) , 6. 52 ( 1H, dd, J = 8 . 2, 2 . 2 Hz ) , 6 . 60 ( 1H, d, J = 2 . 2 Hz ) , 6 . 74 (1H, d, J = 8.2 Hz), 6.91 (2H, d, J = 8.8 Hz), 7.30 (2H, d, J = 8.8 Hz).
Elemental analysis for C23H3oNzO3 Calcd.: C, 72.22; H, 7.91; N, 7.32.
Found: C, 71.91; H, 8.10; N, 7.35.
Example 155 3,4-Dihydro-6-[2-(N,N-dipropylamino)ethyl]-3-(4-methoxyphenyl)-2H-1,4-benzoxazine hydrochloride O
N I ~ N~Me I~
Me0 / hl HCI Me Using N,N-dipropyl-[3,4-dihydro-3-(4-methoxyphenyl)-2H-1,4-benzoxazin-6-yl]acetamide obtained in Example 154, the title compound in the form of a free base was obtained as powder with a mp of 85 to 90 °C by the same procedure as in Example 133. 4 N hydrochloric acid in ethyl acetate was added to the resultant powder which was then concentrated, whereby the title compound was obtained as amorphous powder.
1H-NMR (CDC13, free base) b: 0. 91 (6H, t, J = 7.4 Hz) , 1. 5-1.8 (4H, m), 1.6-1.8 (4H, m), 2.87 (4H, s), 3.82 (3H, s), 3.8-4.0 (2H, m), 4.23 (1H, dd, J = 10.6, 3.0 Hz), 4.43 (1H, dd, J = 8.8, 3.0 Hz), 6.4-6.6 (2H, m), 6.77 (1H, d, J = 8.8 Hz) , 6. 91 (2H, d, J = 8.8 Hz) , 7.30 (2H, d, J = 8.8 Hz) .
Example 156 4-[4-(4-Chlorophenyl)-1-piperidinyl]-4-oxo-1-[2-(trifluoroacetyl)-2,3,4,5-tetrahydro-1H-2-benzoxazin-8-yl]-1-butanone / CI
// 0 ~
CF3~ v N ~ N
O
Using 4-oxo-4-[2-(trifluoroacetyl)-2,3,4,5-tetrahydro-1H-2-benzazepin-8-yl]butanoic acid obtained in 1) in Example 130, the title compound was obtained as powder by the same procedure as in Example 12.

1H-NMR (CDC13) b: 1.57-1.93 (6H, m), 2.61-2.81 (4H, m), 3.06 (2H, m), 3.22 (1H, m), 3.33 (2H, m), 3.94 (2H, m), 4.13 (1H, m), 4.68-4.79 (3H, m), 7.13 (2H, m), 7.29 (3H, m), 7.88 (1H, m), 8.03 (1H, m).
Melting point: 153-155 °C (crystallizing solvent: ethanol-diisopropyl ether) Example 157 4-[4-(4-Chlorophenyl)piperidin-1-yl]-1-(2-ethyl-2,3,4,5-tetrahydro-1H-2-benzoxazin-8-yl)-4-oxobutan-1-one hydrochloride / CI
Et~ O ~ v N ~ N
~ HCI
O .
Using 4-[4-(4-chlorophenyl)-1-piperidinyl]-4-oxo-1-(2,3,4,5-tetrahydro-1H-2-benzazepin-8-yl)-1-butanone obtained in Example 130, the title compound was obtained as amorphous powder by the same procedure as in Example 17.
1H-NMR ( DMSO-d6) b : 1. 27 ( 3H, t, J = 7 . 4 Hz ) , 1. 42 ( 1H, m) , 1.63 (1H, m), 1.73-1.96 (4H, m), 2.51-2.89 (5H, m), 3.07 (4H, m), 3.22 (2H, m), 3.49 (2H, m), 4.10 (1H, m), 4.45-4.67 (3H, m), 7.27-7.46 (5H, m), 7.85 (2H, m), 10.47 (1H, m) .

Example 158 4-[4-(4-Chlorophenyl)piperidin-1-yl]-1-(2-isopropyl-2,3,4,5-tetrahydro-1H-2-benzoxazin-8-yl)-4-oxobutan-1-one hydrochloride / CI
Me O W
Me~ v N ~ N
J( HCI
O
Using 4-[4-(4-chlorophenyl)-1-piperidinyl]-4-oxo-1-(2,3,4,5-tetrahydro-1H-2-benzazepin-8-yl]-1-butanone obtained in Example 130, the title compound was obtained as amorphous powder by the same procedure as in Example 17.
1H-NMR (DMSO-d6) b: 1.31-1.44 (6H, m), 1.55 (1H, m), 1.81-1.92 (3H, m), 2.07 (1H, m), 2.61 (1H, m), 2.74 (4H, m), 3.04 (1H, m), 3.24-3.30 (4H, m), 3.57 (3H, m), 4.08 (1H, m), 4.47-4.63 (3H, m), 7.24-7.46 (5H, m), 7.96 (2H, m), 9.89 ( 1H, m) .
Example 159 1-(2-Benzyl-2,3,4,5-tetrahydro-1H-2-benzazepin-8-yl)-4-[4-(4-chlorophenyl)piperidin-1-yl]-4-oxobutan-1-one hydrochloride / v Using 4-[4-(4-chlorophenyl)-1-piperidinyl]-4-oxo-1-(2,3,4,5-tetrahydro-1H-2-benzazepin-8-yl)-1-butanone obtained in Example 130, the title compound was obtained as amorphous powder by the same procedure as in Example 17.
1H-NMR (DMSO-d6) b: 1.37 (1H, m), 1.58 (1H, m), 1.74-1.85 (3H, m), 2.07 (1H, m), 2.65-2.89 (5H, m), 3.07-3.21 (6H, m), 4.08 (2H, m), 4.40-4.50 (3H, m), 4.73 (1H, m), 7.28-7.61 (10H, m), 7.96 (2H, m), 10.84 (1H, m).
Example 160 4-[4-(4-Chlorophenyl)piperidin-1-yl]-4-oxo-1-[2-(trifluoroacetyl)-2,3-dihydro-1H-isoindol-5-yl]butan-1-one CI
p ~ _ N
CF~N I ~ O
Using 4-oxo-4-[2-(trifluoroacetyl)-2,3-dihydro-1H-isoindol-5-yl]butanoic acid obtained in 1) in Example 132, the title compound was obtained as powder by the same procedure as in Example 12.
1H-NMR (CDC13) b: 1.58-1.67 (2H, m), 1.84-1.96 (2H, m), 2.62-2.75 (2H, m), 2.86 (2H, t, J = 6.6 Hz), 3.19 (1H, t, J
- 11.7 Hz), 3.33 (2H, t, J = 6.6 Hz), 4.12 (1H, m), 4.75 (1H, m), 4.97 (2H, s), 5.09 (2H, m), 7.13-7.46 (5H, m), 7.96-8.04 (2H, m).
Example 161 4-[4-(4-Chlorophenyl)piperidin-1-yl]-1-(2-methyl-2,3-dihydro-1H-isoindol-5-yl)-4-oxobutan-1-one / CI
C
N
Me N ~ / v O
Using 4-[4-(4-chlorophenyl)piperidin-1-yl]-1-(2,3-dihydro-1H-isoindol-5-yl)-4-oxobutan-1-one obtained in Example 132, the title compound was obtained as powder by the same procedure as in Example 16.

1H-NMR b: 1.56-1.68 (2H, m), 1.82-1.96 (2H, m), (CDC13) 2. 63 (3H, s) 2.74(2H, m) , 2. 84 (2H, t, J = 6. 6 3.
, Hz) , 17 (1H, m), 3.36 (2H,t, J = 6.6 Hz), 4.15 (1H, d, J = 15.6 Hz) , 4.31 (4H, s) 4.76 (1H, d, J = 12 Hz) , 7.11-7.36 (5H, , m) , 7 . 92 ( 2H, m) .
Example 162 4-[4-(4-Chlorophenyl)piperidin-1-yl]-1-(2-ethyl-2,3-dihydro-1H-isoindol-5-yl)-4-oxobutan-1-one / CI
O
N
Et-N' l l I l O
Using 4-[4-(4-chlorophenyl)piperidin-1-yl]-1-(2,3-dihydro-1H-isoindol-5-yl)-4-oxobutan-1-one obtained in Example 132, the title compound was obtained as powder by the same procedure as in Example 17.
1H-NMR (CDC13) b: 1.22 (3H, t, J = 7.2 Hz), 1.26-1.62 (2H, m), 1.83-1.94 (2H, m), 2.61-2.80 (6H, m), 3.17 (1H, m), 3.36 (2H, t, J = 6.6 Hz), 3.96 (4H, s), 4.15 (1H, d, J =
15.6 Hz), 4.76 (1H, d, J = 12 Hz), 7.11-7.36 (5H, m), 7.88 ( 2H, m) .
Example 163 4-[4-(4-Chlorophenyl)piperidin-1-yl]-1-(2-isopropyl-2,3-dihydro-1H-isoindol-5-yl)-4-oxobutan-1-one / CI
O
Me ~ N
~N I / O
Me Using 4-[4-(4-chlorophenyl)piperidin-1-yl]-1-(2,3-dihydro-1H-isoindol-5-yl)-4-oxobutan-1-one obtained in Example 132, the title compound was obtained as powder by the same procedure as in Example 17.

1H-NMR (CDC13) b: 1.21 (6H, d, J = 5.4 Hz), 1.62-1.80 (2H, m), 1.83-1.94 (2H, m), 2.61-2.82 (5H, m), 3.17 (1H, m), 3.36 (2H, t, J = 6.6 Hz), 4.00 (4H, s), 4.15 (1H, d, J =
15. 6 Hz) , 4. 76 (1H, d, J = 12 Hz) , 7. 11-7. 36 (5H, m) , 7. 88 ( 2H, m) .
Example 164 1-(2-Benzyl-2,3-dihydro-1H-isoindol-5-yl)-4-[4-(4-chlorophenyl)piperidin-1-yl]-4-oxobutan-1-one CI
O
N
I I
N~ O
Using 4-[4-(4-chlorophenyl)-1-piperidin-1-yl]-1-(2,3-dihydro-1H-isoindol-5-yl)-4-oxobutan-1-one obtained in Example 132, the title compound was obtained as powder by the same procedure as in Example 17.

1H-NMR (CDC13) b: 1.62-1.80 (2H, m), 1.83-1.94 (2H, m), 2. 59-2. 82 (4H, m) , 3. 17 (1H, m) , 3. 36 (2H, t, 6. Hz) J = 6 , 3.93 (2H, s), 3.97 (4H, s), 4.15 (1H, d, J = 15.6 Hz), 4.76 (1H, d, J = 12 Hz) , 7.18, (2H, m), 7.29-7.42(8H, m), 7.88 (2H, m) .

Example 165 4-(3-Isopropyl-2,3,4,5-tetrahydro-1H-3-benzazepin-7-yl)-4-oxo-N-(3-phenylpropyl)butanamide hydrochloride H
Me ~ _ N
Me~N I ~ C ~ HCI
Using 4-oxo-N-(3-phenylpropyl)-4-(2,3,4,5-tetrahydro-1 H-3-benzazepin-7-yl)butanamide trifluoroacetate obtained in Example 42, the title compound was obtained as amorphous powder by the same procedure as in Example 17.
1H-NMR (DMSO-d6) ~: 1.04 (3H, d, J = 6.3 Hz), 1.27 (6H, d, J - 6.3 Hz), 1.64 (1H, m), 2.91-3.23 (6H, m), 3.60-3.79 (10H, m), 7.17-7.40 (6H, m), 7.85 (2H, m), 11.0 (1H, m).
Example 166 N-(1-Methyl-3-phenylpropyl)-4-oxo-4-(2,3,4,5-tetrahydro-1H-3-benzazepin-7-yl)-butanamide hydrochloride H
N
HN II I p Me .
HCI
The title compound was obtained as amorphous powder in the same manner as in Example 36.
1H-NMR (DMSO-d6) b: 1.05 (3H, d, J = 6. 6 Hz) , 1. 65 (2H, m) , 2.50-2.60 (6H, m), 3.19 (8H, m), 3.75 (1H, m), 4.37 (1H, m), 7.17-7.40 (6H, m), 7.86-7.96 (2H, m), 9.53 (1H, m).
Example 167 4-(3-Isopropyl-2,3,4,5-tetrahydro-1H-3-benzazepin-7-yl)-N-(1-methyl-3-phenylpropyl)-4-oxobutanamide hydrochloride O H
Me~ \ N \
Me N~ O Me . HCI
Using N-(1-methyl-3-phenylpropyl)-4-oxo-4-(2,3,4,5-tetrahydro-1H-3-benzazepin-7-yl)-butanamide hydrochloride obtained in Example 166, the title compound was obtained as amorphous powder by the same procedure as in Example 17.
1H-NMR (DMSO-d6) b: 1.05 (3H, d, J = 6.3Hz), 1.27 (6H, d, J
- 6.3Hz), 1.67 (2H, m), 2.92-3.23 (6H, m), 3.57-3.79 (5H, m), 3.99-4.05 (5H, m), 7.17-7.40 (6H, m), 7.86-7.96 (2H, m), 10 . 97 ( 1H, m) .
Example 168 4-Oxo-N-(2-phenoxyethyl)-4-[3-(trifluoroacetyl)-2,3,4,5-tetrahydro-1H-3-benzazepin-7-yl]butanamide O H
O
\ v ~ O
CF~N I / O
Using 4-oxo-4-[3-(trifluoroacetyl)-2,3,4,5-tetrahydro-1H-3-benzazepin-7-yl]butanoic acid obtained in Reference Example 16, the title compound was obtained as powder by the same procedure as in Example 12.
1H-NMR (CDC13) b: 2.66 (2H, t, J - 6.6 Hz), 3.03 (4H, m), 3. 34 (2H, t, J = 6. 6 Hz) , 3. 67 (4H, m) , 3. 78 (2H, m) , 4. 04 (1H, d, J = 4.8 Hz) , 6.23 (1H, m) , 6. 89, (3H, m) , 7.24 (3H, m) , 7. 78 (2H, m) .
Example 169 4-Oxo-N-(2-phenoxyethyl)-4-(2,3,4,5-tetrahydro-1H-3-benzazepin-7-yl)butanamide C H
NCO
HN
Using 4-oxo-N-(2-phenoxyethyl)-4-[3-(trifluoroacetyl)-2,3,4,5-tetrahydro-1H-3-benzazepin-7-yl]butanamide obtained in Example 168, the title compound was obtained as powder by the same procedure as in Example 13.
1H-NMR (CDC13) b: 2.26 (1H, s) , 2. 65 (2H, t, J = 6. 6 Hz) , 2.98 (8H, m), 3.34 (2H, t, J = 6.6 Hz), 3.67 (2H, q, J
5.1 Hz), 4.04 (2H, t, J = 4.8 Hz), 6.28 (1H, m), 6.89, (3H, m) , 7 . 24 ( 3H, m) , 7 . 71 ( 2H, m) .
Example 170 N-[3-(4-Chlorophenyl)propyl]-4-oxo-4-[3-(trifluoroacetyl)-2,3,4,5-tetrahydro-1H-3-benzazepin-7-yl]butanamide H / CI
C \ N
CF~N I ~ O

Using 4-oxo-4-[3-(trifluoroacetyl)-2,3,4,5-tetrahydro-1H-3-benzazepin-7-yl]butanoic acid obtained in Reference Example 16 and 3-(4-chlorophenyl)propylamine obtained in Reference Example 23, the title compound was obtained as oily matter by the same procedure as in Example 12.
1H-NMR (CDC13) b: 1.73-1.85 (2H, m), 2.60 (4H, m), 3.05 (4H, m), 3.24-3.34 (4H, m), 3.77-3.80 (4H, m), 5.87 (1H, m), 7.09-7.28 (5H, m); 7.77 (2H, m).
Example 171 N-[3-(4-Chlorophenyl)propyl]-4-oxo-4-(2,3,4,5-tetrahydro-1H-3-benzazepin-7-yl)butanamide hydrochloride O H / I CI
N
v HN ~ / O ~ HCI
Using N-[3-(4-chlorophenyl) propyl]-4-oxo-4-[3-(trifluoroacetyl)-2,3,4,5-tetrahydro-1H-3-benzazepin-7-yl]butanamide obtained in Example 170, the title compound was obtained as amorphous powder by the same procedure as in Example 13.
1H-NMR (CDC13) b: 1.73-1.85 (2H, q, J = 7.4 Hz), 2.56-2.72 (6H, m), 2.96 (7H, m), 3.21-3.37 (4H, m), 5.94 (1H, m), 7.07-7.28 (5H, m), 7.75 (2H, m).
Example 172 4-Oxo-N-(4-phenylbutyl)-4-[3-(trifluoroacetyl)-2,3,4,5-tetrahydro-1H-3-benzazepin-7-yl]butanamide O H
O N
\ ~ ~ \
CF~N I / O I /

Using 4-oxo-4-[3-(trifluoroacetyl)-2,3,4,5-tetrahydro-1H-3-benzazepin-7-yl]butanoic acid obtained in Reference Example 16, the title compound was obtained as oily matter by the same procedure as in Example 12.
1H-NMR (CDC13) b: 1.54-1.70 (4H, m), 2.60 (4H, q, J - 6.6 Hz), 3.05 (4H, m), 3.24-3.34 (4H, m), 3.69-3.81 (4H, m), 5.73 (1H, m), 7.15-7.32 (6H, m), 7.78 (2H, m).
Example 173 4-Oxo-N-(4-phenylbutyl)-4-(2,3,4,5-tetrahydro-1H-3-benzazepin-7-yl)butanamide hydrochloride O H
N
HN I / v o I
' HCI
Using 4-oxo-N-(4-phenylbutyl)-4-[3-(trifluoroacetyl)-2,3,4,5-tetrahydro-1H-3-benzazepin-7-yl] obtained in Example 172, the title compound was obtained as amorphous powder by the same procedure as in Example 13.
1H-NMR (CDC13) 5: 1.54-1.65 (4H, m), 2.48-2.61 (5H, m), 3.01 (8H, m), 3.26-3.49 (4H, m), 5.79 (1H, m), 7.11-7.28 (6H, m) , 7.73 (2H, m) .
Example 174 N-[3-(4-Chlorophenyl)propyl]-4-oxo-4-(3-isopropyl-2,3,4,5-tetrahydro-1H-3-benzazepin-7-yl)butanamide O / CI
Me ~
~- I I
M' N ' / O
Using N-[3-(4-chlorophenyl)propyl]-4-oxo-4-(2,3,4,5-tetrahydro-1H-3-benzazepin-7-yl)butanamide hydrochloride obtained in Example 171, the title compound was obtained as powder by the same procedure as in Example 17.
1H-NMR (CDC13) S: 1.03 (6H, d , J = 6.6 Hz), 1.77 (2H, m), 2.57-2.66 (9H, m), 2.96 (4H, m), 3.23-3.34 (4H, m), 5.92 (1H, m), 7.07-7.28 (5H, m), 7.75 (2H, m).
Example 175 4-(3-Isopropyl-2,3,4,5-tetrahydro-1H-3-benzazepin-7-yl)-4-oxo-N-(2-phenoxyethyl)-butanamide O /
Me w v ~ O
Me~N I ~ O
Using 4-oxo-N-(2-phenoxyethyl)-4-(2,3,4,5-tetrahydro-1H-3-benzazepin-7-yl)butanamide obtained in Example 169, the title compound was obtained as powder by the same procedure as in Example 17.
1H-NMR (CDC13) b: 1.02 (6H, d, J - 6.6 Hz), 2.65 (7H, m), 2.95 (4H, m), 3.34 (2H, t, J = 6.6 Hz), 3.67 (2H, q, J =
5.1 Hz), 4.04 (2H, t, J = 4.8 Hz), 6.23 (1H, m), 6.89, (3H, m), 7.24(3H, m), 7.71 (2H, m).
Example 176 N-[2-[4-(4-Chlorophenyl)-1-piperidinyl]-2-oxoethyl]-2,3,4,5-tetrahydro-1H-3-benzazepine-7-carboxamide trifluoroacetate CI
C
N
HN ~ / H
Using 2-[4-(4-chlorophenyl)-1-piperidinyl]-2-oxoethylamine hydrochloride obtained in Reference Example 22, the title compound was obtained in the same manner as in Example 36.
MS(APCI)(M+1):426.
Example 177 N-[2-[4-(2-Methylphenyl)-1-piperidinyl]-2-oxoethyl]-2,3,4,5-tetrahydro-1H-3-benzazepine-7-carboxamide trifluoroacetate O
N~ 'N J Me HN II I H
Using 2-[4-(2-methylphenyl)-1-piperidinyl]-2-oxoethylamine hydrochloride obtained in Reference Example 23, the title compound was obtained in the same manner as in Example 36.
MS (APCI) (M+1) : 406.
Example 178 N-[2-[4-(4-Fluorophenyl)-1-piperazinyl]-2-oxoethyl]-2,3,4,5-tetrahydro-1H-3-benzazepine-7-carboxamide trifluoroacetate / F
O
N
N
HN
H O
Using 2-[4-(4-fluorophenyl)-1-piperazinyl]-2-oxoethylamine dihydrochloride obtained in Reference Example 24, the title compound was obtained in the same manner as in Example 36.
MS(APCI)(M+1):411.
Example 179 N-[2-[4-(2-Methoxyphenyl)-1-piperazinyl]-2-oxoethyl]-2,3,4,5-tetrahydro-1H-3-benzazepine-7-carboxamide trifluoroacetate O ~N
N~ 'N J OMe HN~~ H
Using 2-[4-(2-methoxyphenyl)-1-piperazinyl]-2-oxoethylamine dihydrochloride obtained in Reference Example 25, the title compound was obtained in the same manner as in Example 36.
MS(APCI)(M+1):423.
Example 180 N-[2-[4-(4-Chlorophenyl)-1-piperidinyl]-2-oxoethyl]-2,3,4,5-tetrahydro-1H-2-benzazepine-8-carboxamide trifluoroacetate / CI
O
H N
N W N I) H O
Using 2-[4-(4-chlorophenyl)-1-piperidinyl]-2-oxoethylamine hydrochloride obtained in Reference Example 22, the title compound was obtained in the same manner as in Example 36.

MS (APCI) (M+1) :426.
Example 181 N-[2-[4-(2-Methylphenyl)-1-piperidinyl]-2-oxoethyl]-2,3,4,5-tetrahydro-1H-2-benzazepine-8-carboxamide trifluoroacetate /
O 1' N~ Me N
H O
Using 2-[4-(2-methylphenyl)-1-piperidinyl]-2-oxoethylamine hydrochloride obtained in Reference Example 23, the title compound was obtained in the same manner as in Example 36.
MS(APCI)(M+1):406.
Example 182 N-[2-[4-(4-Fluorophenyl)-1-piperazinyl]-2-oxoethyl]-2,3,4,5-tetrahydro-1H-2-benzazepine-8-carboxamide trifluoroacetate / F
O ~N
H N
N ~ N II
/ H O
Using 2-[4-(4-fluorophenyl)-1-piperazinyl]-2-oxoethylamine dihydrochloride obtained in Reference Example 24, the title compound was obtained in the same manner as in Example 36.
MS(APCI)(M+1):411.
Example 183 N-[2-[4-(2-Methoxyphenyl)-1-piperazinyl]-2-oxoethyl]-2,3,4,5-tetrahydro-1H-2-benzazepine-8-carboxamide trifluoroacetate Using 2-[4-(2-methoxyphenyl)-1-piperazinyl]-2-oxoethylamine dihydrochloride obtained in Reference Example 25, the title compound was obtained by the same procedure as in Example 36.
MS(APCI)(M+1):423.
Example 184 4-[4-(4-Methylphenyl)-1-piperidinyl]-4-oxo-1-(2,3,4,5-tetrahydro-1H-3-benzazepin-7-yl)-1-butanone Me 1) Using 4-oxo-4-[3-(trifluoroacetyl)-2,3,4,5 tetrahydro-1 H-3-benzazepin-7-yl]butanoic acid obtained in Reference Example 16, 4-[4-(4-methylphenyl)-1-piperidinyl]
4-oxo-1-[3-(trifluoroacetyl)-2,3,4,5-tetrahydro-1H-3 benzazepin-7-yl]-1-butanone was obtained as colorless powder by the same procedure as in Example 12.
1H-NMR (CDC13) b: 1.55-2.01 (4H, m), 2.33 (3H, s), 2.57 2.91 (4H, m), 2.97-3.27 (5H, m), 3.34 (2H, t, J=6.4Hz), 3.66-3.84 (4H, m), 4.05-4.19 (1H, m), 4.67-4.83 (1H, m), 7.04-7.30 (5H, m), 7.80-7.91 (2H, m).
Melting point: 132-134 °C (crystallizing solvent: diethyl ether) 2) Using 4-[4-(4-methylphenyl)-1-piperidinyl]-4-oxo-1-[3-(trifluoroacetyl)-2,3,4,5-tetrahydro-1H-3-benzazepin-7-yl]-1-butanone obtained in 1) above, the title compound was obtained as colorless powder by the same procedure as in Example 13.
1H-NMR (CDC13) b: 1.47-2.00 (5H, m), 2.33 (3H, s), 2.55 3.04 (12H, m), 3.06-3.26 (1H, m), 3.35 (2H, t, J=6.8Hz), 4.04-4.20 (1H, m), 4.68-4.85 (1H, m), 7.05-7.24 (5H, m), 7.74-7.84 (2H, m).

Melting point: 115-116 °C (crystallizing solvent: diethyl ether ) Example 185 4-[4-(3-Methylphenyl)-1-piperidinyl]-4-oxo-1-(2,3,4,5-tetrahydro-1H-3-benzazepin-7-yl)-1-butanone O \ Me NJ

1) Using 4-oxo-4-[3-(trifluoroacetyl)-2,3,4,5-tetrahydro-1 H-3-benzazepin-7-yl]butanoic acid obtained in Reference Example 16, 4-[4-(3-methylphenyl)-1-piperidinyl]-4-oxo-1-[3-(trifluoroacetyl)-2,3,4,5-tetrahydro-1H-3-benzazepin-7-yl]-1-butanone was obtained as colorless powder by the same procedure as in Example 12.
1H-NMR (CDC13) b: 1.55-2.01 (4H, m), 2.35 (3H, s), 2.56-2.93 (4H, m), 2.98-3.27 (5H, m), 3.34 (2H, t, J=6.4Hz), 3.67-3.84 (4H, m), 4.05-4.20 (1H, m), 4.68-4.83 (1H, m), 6.96-7.10 (3H, m), 7.14-7.31 (2H, m), 7.80-7.92 (2H, m).
Melting point: 128-129 °C (crystallizing solvent: diethyl ether ) 2) Using 4-[4-(3-methylphenyl)-1-piperidinyl]-4-oxo-1-[3-(trifluoroacetyl)-2,3,4,5-tetrahydro-1H-3-benzazepin-7-yl]-1-butanone obtained in 1) above, the title compound was obtained as colorless powder by the same procedure as in Example 13.
1H-NMR (CDC13) b: 1.45-2.00 (5H, m), 2.34 (3H, s), 2.56 3.03 (12H, m), 3.05-3.26 (1H, m), 3.35 (2H, t, J=6.6Hz), 4.05-4.20 (1H, m), 4.69-4.85 (1H, m), 6.95-7.08 (3H, m), 7.14-7.23 (2H, m), 7.74-7.83 (2H, m).
Melting point: 91-93 °C (crystallizing solvent: diethyl ether) Example 186 4-[4-(2-Methylphenyl)-1-piperidinyl]-4-oxo-1-(2,3,4,5-tetrahydro-1H-3-benzazepin-7-yl)-1-butanone O
N J Me 1) Using 4-oxo-4-[3-(trifluoroacetyl)-2,3,4,5-tetrahydro-1 H-3-benzazepin-7-yl]butanoic acid obtained in Reference Example 16, 4-[4-(2-methylphenyl)-1-piperidinyl]-4-oxo-1-[3-(trifluoroacetyl)-2,3,4,5-tetrahydro-1H-3-benzazepin-7-yl]-1-butanone was obtained as colorless powder by the same procedure as in Example 12.
1H-NMR (CDC13) b: 1.47-1.95 (4H, m), 2.37 (3H, s), 2.58-2.77 (1H, m), 2.80-3.30 (8H, m), 3.35 (2H, t, J=6.6Hz), 3.65-3.85 (4H, m), 4.07-4.23 (1H, m), 4.72-4.87 (1H, m), 7.10-7.32 (5H, m), 7.80-7.92 (2H, m).
Melting point: 145-147 °C (crystallizing solvent: diethyl ether) 2) Using 4-[4-(2-methylphenyl)-1-piperidinyl]-4-oxo-1-[3-(trifluoroacetyl)-2,3,4,5-tetrahydro-1H-3-benzazepin-7-yl]-1-butanone obtained in 1) above, the title compound was obtained as colorless powder by the same procedure as in Example 13.
1H-NMR (CDC13) b: 1.50-1.96 (5H, m), 2.37 (3H, s), 2.57 2.76 (1H, m), 2.79-3.28 (12H, m), 3.36 (2H, t, J=6.6Hz), 4.08-4.24 (1H, m), 4.72-4.87 (1H, m), 7.05-7.23 (5H, m), 7.75-7.84 (2H, m).
Melting point: 93-95 °C (crystallizing solvent: diethyl ether) Example 187 4-[4-(4-Fluorophenyl)-1-piperidinyl]-4-oxo-1-(2,3,4,5-tetrahydro-1H-3-benzazepin-7-yl)-1-butanone F
~N
HN~ '' 1) Using 4-oxo-4-[3-(trifluoroacetyl)-2,3,4,5-tetrahydro-1 H-3-benzazepin-7-yl]butanoic acid obtained in Reference Example 16, 4-[4-(4-fluorophenyl)-1-piperidinyl]-4-oxo-1-[3-(trifluoroacetyl)-2,3,4,5-tetrahydro-1H-3-benzazepin-7-yl]-1-butanone was obtained as colorless powder by the same procedure as in Example 12.
1H-NMR (CDC13) b: 1.53-2.01 (4H, m), 2.57-2.90 (4H, m), 2.97-3.28 (5H, m), 3.34 (2H, t, J=6.6Hz), 3.65-3.84 (4H, m), 4.05-4.20 (1H, m), 4.68-4.84 (1H, m), 6.95-7.07 (2H, m), 7.10-7.32 (3H, m), 7.80-7.90 (2H, m).
Melting point: 105-102 °C (crystallizing solvent: diethyl ether ) 2) Using 4-[4-(4-fluorophenyl)-1-piperidinyl]-4-oxo-1-[3-(trifluoroacetyl)-2,3,4,5-tetrahydro-1H-3-benzazepin-7-yl]-1-butanone obtained in 1) above, the title compound was obtained as colorless powder by the same procedure as in Example 13.
1H-NMR (CDC13) b: 1.47-2.00 (5H, m), 2.57-2.90 (4H, m), 2.98 (8H, br), 3.07-3.27 (1H, m), 3.35 (2H, t, J=6.8Hz), 4.06-4.21 (1H, m), 4.70-4.86 (1H, m), 6.94-7.07 (2H, m), 7.10-7.24 (3H, m), 7.74-7.84 (2H, m).
Melting point: 127-128 °C (crystallizing solvent: diethyl ether) Example 188 4-[4-(4-Methoxyphenyl)-1-piperidinyl]-4-oxo-1-(2,3,4,5-tetrahydro-1H-3-benzazepin-7-yl)-1-butanone r 1) Using 4-oxo-4-[3-(trifluoroacetyl)-2,3,4,5 tetrahydro-1 H-3-benzazepin-7-yl]butanoic acid obtained in Reference Example 16, 4-[4-(2-methylphenyl)-1-piperidinyl]
4-oxo-1-[3-(trifluoroacetyl)-2,3,4,5-tetrahydro-1H-3 benzazepin-7-yl]-1-butanone was obtained as colorless powder by the same procedure as in Example 12.
1H-NMR (CDC13) b: 1.50-1.74 (2H, m), 1.80-1.97 (2H, m), 2.59-2.78 (2H, m), 2.85 (2H, t, J=6.6Hz), 3.00-3.09 (4H, m), 3.12-3.24 (1H, m), 3.34 (2H, t, J=6.6Hz), 3.67-3.83 (7H, m), 4.07-4.16 (1H, m), 4.71-4.80 (1H, m), 6.86 (2H, d, J=8.6Hz), 7.13 (2H, d, J=8.6Hz), 7.23-7.30 (1H, m), 7.80-7.90 (2H, m).
Melting point: 130-131 °C (crystallizing solvent: diethyl ether ) 2) Using 4-[4-(2-methylphenyl)-1-piperidinyl]-4-oxo-1-[3-(trifluoroacetyl)-2,3,4,5-tetrahydro-1H-3-benzazepin-7-yl]-1-butanone obtained in 1) above, the title compound was obtained as colorless powder by the same procedure as in Example 13.
1H-NMR (CDC13) b: 1.51-1.97 (5H, m), 2.58-2.77 (2H, m), 2.83 (2H, t, J=6.7Hz), 2.97 (8H, br), 3.10-3.23 (1H, m), 3.35 (2H, t, J=6.7Hz), 3.80 (3H, s), 4.07-4.18 (1H, m), 4.73-4.83 (1H, m), 6.86 (2H, d, J=8.7Hz), 7.13 (2H, d, J=8.7Hz), 7.19 (1H, d, J=8.3Hz), 7.76-7.83 (2H, m).
Melting point: 99-100 °C (crystallizing solvent: diethyl ether) Example 189 4-[4-(4-Chlorophenyl)-1-piperidinyl]-1-(2-methyl-1,2,3,4-tetrahydro-7-isoquinolinyl)-4-oxo-1-butanone CI
O
Me~N ~ N
I I
O
Using 4-[4-(4-chlorophenyl)piperidin-1-yl]-4-oxo-1-(1,2,3,4-tetrahydroisoquinolin-7-yl)butan-1-one obtained in Example 13, the title compound was obtained as colorless powder by the same procedure as in Example 16.
1H-NMR (CDC13) b: 1. 62 (2H, m) , 1. 89 (2H, m) , 2.48 (3H, s) , 2.67-2.70 (4H, m), 2.82 (2H, t, J = 6.4 Hz), 2.97 (2H, t, J
- 5.4 Hz), 3.23 (1H, m), 3.34 (2H, t, J = 6.6 Hz), 3.62 (2H, s), 4.13 (1H, d, J - 15.6 Hz), 4.76 (1H, d, J - 12 Hz), 7.11-7.31 (5H, m), 7.71-7.81 (2H, m).
Melting point: 139-140 °C (crystallizing solvent:
ethanol-diisopropyl ether) Example 190 4-[4-(4-Chlorophenyl)-1-piperidinyl]-1-(2-ethyl-1,2,3,4-tetrahydro-7-isoquinolinyl)-4-oxo-1-butanone CI
O
Et~N ~ N
I I
I / O
Using 4-[4-(4-chlorophenyl)piperidin-1-yl]-4-oxo-1-(1,2,3,4-tetrahydroisoquinolin-7-yl)butan-1-one obtained in Example 13, the title compound was obtained as colorless powder by the same procedure as in Example 17.
1H-NMR (CDC13) S: 1.21 (3H, t, J = 7.2 Hz), 1.62 (2H, m), 1. 89 (2H, m) , 2. 57-2. 79 (6H, m) , 2. 82 (2H, t, J = 6. 4 Hz) , 2.97 (2H, t, J = 5.4 Hz), 3.23 (1H, m), 3.34 (2H, t, J
6.6 Hz), 3.62 (2H, s), 4.13 (1H, d, J = 15.6 Hz), 4.76 (1H, d, J = 12 Hz), 7.11-7.31 (5H, m), 7.71-7.81 (2H, m).
Melting point: 115-116 °C (crystallizing solvent:
ethanol-diisopropyl ether) Example 191 1-(2-Benzyl-1,2,3,4-tetrahydro-7-isoquinolinyl)-4-[4-(4-chlorophenyl)-1-piperidinyl]-4-oxo-1-butanone CI
~I
O
~ N I ~ N
/ O

Using 4-[4-(4-chlorophenyl)piperidin-1-yl]-4-oxo-1-(1,2,3,4-tetrahydroisoquinolin-7-yl)butan-1-one obtained in Example 13, the title compound was obtained as colorless powder by the same procedure as in Example 17.
1H-NMR (CDC13) b: 1. 62 (2H, m) , 1. 89 (2H, m) , 2.58-2.80 (6H, m) , 2 . 95 ( 2H, t, J = 5 . 4 Hz ) , 3 . 23 ( 1H, m) , 3 . 34 ( 2H, t, J
- 6.6 Hz), 3.67 (2H, s), 3.70 (2H, s), 4.13 (1H, d, J -15.6 Hz), 4.76 (1H, d, J - 12 Hz), 7.11-7.41 (10H, m), 7.62-7.80 (2H, m).
Melting point: 102-103 °C (crystallizing solvent:
ethanol-diisopropyl ether) Example 192 4-[4-(4-Chlorophenyl)-1-piperidinyl]-1-(2-isopropyl-1,2,3,4-tetrahydro-7-isoquinolinyl)-4-oxo-1-butanone CI

N
Me N~\J%
O
Using 4-[4-(4-chlorophenyl)piperidin-1-yl]-4-oxo-1-(1,2,3,4-tetrahydroisoquinolin-7-yl)butan-1-one obtained in Example 13, the title compound was obtained as colorless powder by the same procedure as in Example 17.
1H-NMR (CDC13) b: 1.15 (6H, d, J = 6.6 Hz), 1.62 (2H, m), 1. 8 9 ( 2H, m) , 2 . 59-2 . 95 ( 9H, m) , 3 . 18 ( 1H, m) , 3 . 34 ( 2H, t, J = 6.6 Hz), 3.77 (2H, s), 4.13 (1H, d, J = 15.6 Hz), 4.76 (1H, d, J = 12 Hz), 7.11-7.31 (5H, m), 7.73-7.80 (2H, m).
Melting point: 113-115 °C (crystallizing solvent:
ethanol-diisopropyl ether) Example 193 4-[4-(4-Chlorophenyl)piperidin-1-yl]-1-(3-cyclohexylmethyl-2,3,4,5-tetrahydro-1H-3-benzazepin-7-yl)-4-oxobutan-1-one CI
O
N
I I
N~ O
Using 4-[4-(4-chlorophenyl-1-piperidinyl]-4-oxo-1-(2,3,4,5-tetrahydro-1H-3-benzazepin-7-yl)-1-butanone obtained in Example 15, the title compound was obtained as colorless powder by the same procedure as in Example 17.
1H-NMR (CDC13) b: 0.90 (2H, m), 1.24 (4H, m), 1.47-1.94 (10H, m), 2.23 (2H, d, J = 6.9 Hz), 2.58-2.80 (5H, m), 2.94 (2H, t, J = 6. 4 Hz) , 2. 96 (4H, m) , 3.23 (1H, m) , 3. 35 (2H, t, J = 6 . 6 Hz ) , 4 .13 ( 1H, m) , 4 . 7 6 ( 1H, m) , 7 . 3 5-7 . 11 ( 5H, m) , 7. 79 (2H, m) .
Melting point: 140-141 °C (crystallizing solvent:
ethanol-diisopropyl ether) Example 194 4-[4-(4-Chlorophenyl)-1-piperidinyl]-4-oxo-1-[3-(tetrahydro-2-furanylmethyl)-2,3,4,5-tetrahydro-1H-3-benzazepin-7-yl]-1-butanone CI
O
O ~ N
N~ O
Using 4-[4-(4-chlorophenyl)-1-piperidinyl]-4-oxo-1-(2,3,4,5-tetrahydro-1H-3-benzazepin-7-yl)-1-butanone obtained in Example 15, the title compound was obtained as colorless powder by the same procedure as in Example 17.
MS(ESI) (M+H): 509.
Melting point: 123-125 °C (crystallizing solvent:
ethanol-diisopropyl ether) Example 195 4-[4-(4-Chlorophenyl)-1-piperidinyl]-1-(3-cyclohexyl-2,3,4,5-tetrahydro-1H-3-benzazepin-7-yl)-4-oxo-1-butanone CI
O ~ v N
a ~N , i O
Using 4-[4-(4-chlorophenyl)-1-piperidinyl]-4-oxo-1-(2,3,4,5-tetrahydro-1H-3-benzazepin-7-yl)-1-butanone obtained in Example 15, the title compound was obtained as colorless powder by the same procedure as in Example 17.
MS(ESI) (M+H): 507.
Melting point: 128-130 °C (crystallizing solvent:
ethanol-diisopropyl ether) Example 196 4-[4-(4-Chlorophenyl)-1-piperidinyl]-1-(3-cyclopentyl-2,3,4,5-tetrahydro-1H-3-benzazepin-7-yl)-4-oxo-1-butanone / CI
O
~ N
rN
O
Using 4-[4-(4-chlorophenyl)-1-piperidinyl]-4-oxo-1-(2,3,4,5-tetrahydro-1H-3-benzazepin-7-yl)-1-butanone obtained in Example 15, the title compound was obtained as colorless powder by the same procedure as in Example 17.
1H-NMR (CDC13) b: 1.55-1.69 (5H, m), 1.83 (3H, m), 2.59-3.03 (17H, m), 3.17 (1H, m), 3.35 (2H, t, J = 6.6 Hz), 4.13 (1H, m), 4.76 (1H, m), 7.35-7.11 (5H, m), 7.79 (2H, m).
Melting point: 160-162 °C (crystallizing solvent:
ethanol-diisopropyl ether) Example 197 4-[4-(4-Chlorophenyl)-1-piperidinyl]-1-(3-isobutyl-2,3,4,5-tetrahydro-1H-3-benzazepin-7-yl)-4-oxo-1-butanone CI
Me O
N
Me~N
O
Using 4-[4-(4-chlorophenyl)-1-piperidinyl]-4-oxo-1-(2,3,4,5-tetrahydro-1H-3-benzazepin-7-yl)-1-butanone obtained in Example 15, the title compound was obtained as colorless powder by the same procedure as in Example 17.
1H-NMR (CDC13) b: 0.93 (6H, d, J = 6.2 Hz), 1.62 (4H, m), 1. 89 (3H, m) , 2.21 (2H, d, J = 7. 4 Hz) , 2. 60-2. 74 (6H, m) , 2 . 79 ( 2H, t, J = 6. 4 Hz ) , 2 . 95 ( 4H, m) , 3 . 23 ( 1H, m) , 3 . 35 (2H, t, J = 6. 6 Hz ) , 4 . 13 ( 1H, m) , 4 . 76 ( 1H, m) , 7 . 35-7 . 11 (5H, m), 7.79 (2H, m).
Melting point: 137-138 °C (crystallizing solvent:
ethanol-diisopropyl ether) Example 198 4-[4-(4-Methylphenyl)-1-piperidinyl]-1-(3-methyl-2,3,4,5-tetrahydro-1H-3-benzazepin-7-yl)-4-oxo-1-butanone Me O
N
Me-N
Using 4-[4-(4-methylphenyl)-1-piperidinyl]-4-oxo-1-(2,3,4,5-tetrahydro-1H-3-benzazepin-7-yl)-1-butanone obtained in Example 184, the title compound was obtained as colorless powder the same procedure in Example by as 16.

1H-NMR (CDC13) 66 (2H, m) , 2. (3H, s) b: 1. m) , 33 , 1. 89 (2H, 2 . 38 ( 3H, s ) , 2 ( 6H, 2 . 82 ( J = 6 . Hz ) , . 65 m) , 2H, t, 4 2 . 95 (4H, m), 3.23 (1H, m), 3.35 (2H, t, J 6.6 Hz), 4.13 (1H, =

m), 4.76 (1H, m), .35-7.11 (5H, m), (2H, m).
7 7.79 Melting point: 111-112 C (crystallizing solvent:

ethanol-d iisopropylether) Example 199 1-(3-Isopropyl-2,3,4,5-tetrahydro-1H-3-benzazepin-7-yl)-4-[4-(4-methylphenyl)-1-piperidyl]-4-oxo-1-butanone hydrochloride Me ~I
p Me ICI ~ HCI
Me Using 4-[4-(4-methylphenyl)-1-piperidinyl]-4-oxo-1-(2,3,4,5-tetrahydro-1H-3-benzazepin-7-yl)-1-butanone obtained in Example 184, the title compound was obtained as colorless powder by the same procedure as in Example 17.
1H-NMR (CDC13) S: 1.26 (7H, m) , 1.56 (1H, m) , 1.78 (2H, m) , 2.26 (3H; s), 2.50 (1H, m), 2.73 (2H, m), 2.94-3.64 (7H, m), 4.05 (1H, m) , 4.46 (1H, m) , 7.12 (4H, s) , 7.40 (1H. d, J =
8.4 Hz), 7.83 (2H, m).

Melting point: 180 °C (decomp.) (crystallizing solvent:
ethanol-diisopropyl ether) Example 200 4-[4-(4-Methylphenyl)piperidin-1-yl]-4-oxo-1-(1,2,3,4-tetrahydroisoquinolin-7-yl)butan-1-one Me Using 4-oxo-4-[2-(trifluoroacetyl)-1,2,3,4-tetrahydro-7-isoquinolinyl]butanoic acid obtained in Reference Example 15, the title compound was obtained as colorless powder by the same procedures as in Examples 12 and 13.

1H-NMR ( CDC13 ) S : 1. 63 ( 2H, m) , 1. 95 ( 3H, 2 3 ( 3H, m) , . s ) , 2. 59-2. 72 (3H, m) , 2. 82 (4H, m) , 2. 97 (2H,J = 5. 4 t, Hz) , 3.17 (2H, t, J = 6 .2 Hz), 3.34 (2H, t, J 6.6 Hz), 4.08 =

(2H, s), 4.13 (1H, d, J = 15.6 Hz), 4.76 (1H,d, J = 12 Hz), 7.11-7.20 (5H, m), 7.71-7.81 (2H, m).

Melting point: 119-120 C (crystalliz ing solvent:

ethanol-diisopropyl ether) Example 201 4-[4-(4-Methylphenyl)-1-piperidinyl]-1-(2-methyl-1,2,3,4-tetrahydro-7-isoquinolinyl)-4-oxo-1-butanone Me O
Me~N ~ N
I I
O
Using 4-[4-(4-methylphenyl) piperidin-1-yl]-4-oxo-1-(1,2,3,4-tetrahydroisoquinolin-7-yl)butan-1-one obtained in Example 200, the title compound was obtained as colorless powder by the same procedure as in Example 16.
1H-NMR (CDC13) b: 1. 62 (2H, m) , 1. 89 (2H, m) , 2.34 (3H, s) , 2.48 (3H, s), 2.60-2.73 (4H, m), 2.82 (2H, t, J = 6.4 Hz), 2.97 (2H, t, J = 5.4 Hz), 3.23 (1H, m), 3.34 (2H, t, J =
6.6 Hz), 3.62 (2H, s), 4.13 (1H, d, J = 15.6 Hz), 4.76 (1H, d, J = 12 Hz), 7.11-7.31 (5H, m), 7.71-7.81 (2H, m).
Melting point: 97-99 °C (crystallizing solvent: ethanol-diisopropyl ether) Example 202 1-(2-Isopropyl-1,2,3,4-tetrahydro-7-isoquinolinyl)-4-[4-(4-methylphenyl)-1-piperidinyl]-4-oxo-1-butanone Me N
Me N
O
Using 4-[4-(4-methylphenyl)piperidin-1-yl]-4-oxo-1-(1,2,3,4-tetrahydroisoquinolin-7-yl)butan-1-one obtained in Example 200, the title compound was obtained as colorless powder by the same procedure as in Example 17.
1H-NMR (CDC13) b: 1.15 (6H, d, J = 6.6 Hz), 1.62 (2H, m), 1.89 (2H, m), 2.64 (3H, s), 2.65-2.95 (9H, m), 3.18 (1H, m), 3.34 (2H, t, J = 6.6 Hz), 3.77 (2H, s), 4.13 (1H, d, J =
15.6 Hz), 4.76 (1H, d, J = 12 Hz), 7.11-7.31 (5H, m), 7.73-7.80 (2H, m).
Melting point: 78-80 °C (crystallizing solvent: ethanol-diisopropyl ether) Example 203 1-(2-Benzyl-1,2,3,4-tetrahydro-7-isoquinolinyl)-4-[4-(4-methylphenyl)-1-piperidinyl]-4-oxo-1-butanone hydrochloride Me p ~ v N
N I ~ p ~ HCI
Using 4-[4-(4-methylphenyl)piperidin-1-yl]-4-oxo-1-(1,2,3,4-tetrahydroisoquinolin-7-yl)butan-1-one obtained in Example 200, the title compound was obtained as colorless powder by the same procedure as in Example 17.
1H-NMR (CDC13) b: 1.36 (1H, m) , 1.56 (1H, m) , 1.78 (2H, m) , 2.26 (3H, s), 2.50 (1H, m), 2.73 (2H, m), 3.08-3.43 (8H, m), 3.67 (1H, m), 4.05 (1H, m), 4.46 (4H, m), 7.12 (4H, s), 7. 41 (1H. d, J = 8.4 Hz) , 7.53 (3H, m) , 7. 67 (2H, m) , 7. 86 ( 2H, m) .
Melting point: 72 °C (decomp) (crystallizing solvent:
ethanol-diisopropyl ether) Example 204 5-[4-(4-Chlorophenyl)-1-piperidinyl]-5-oxo-1-[3-(trifluoroacetyl)-2,3,4,5-tetrahydro-1H-3-benzazepin-7-yl]-1-pentanone / CI
O
CF~N
O O
Using 2,3,4,5-tetrahydro-1H-3-benzazepine, the title compound was obtained as colorless amorphous powder by the same procedures as in Reference Example 15 and in Example 12.
1H NMR (CDC13) b: 1. 57 (2H, m) , 1. 89 (2H, m) , 2. 10 (2H, m) , 2.49 (2H, m), 2.58-2.76 (2H, m), 3.01-3.17 (7H, m), 3.75 (4H, m), 4.04 (1H, m), 4.79 (1H, m), 7.11 (2H, m), 7.28 (3H, m), 7.82 (2H, m).
Example 205 5-[4-(4-Chlorophenyl)-1-piperidinyl]-5-oxo-1-(2,3,4,5-tetrahydro-1H-3-benzazepin-7-yl)-1-pentanone CI
HN ~ ~ NJ
O O
Using 5-[4-(4-chlorophenyl)-1-piperidinyl]-5-oxo-1-[3-(trifluoroacetyl)-2,3,4,5-tetrahydro-1H-3-benzazepin-7-yl]-1-pentanone obtained in Example 204, the title compound was obtained as colorless powder by the same procedure as in Example 13.
1H NMR (CDC13) b: 1. 57 (2H, m) , 1. 87 (2H, m) , 2. 10 (2H, m) , 2.48 (2H, m), 2.58-2.75 (2H, m), 2.96 (8H, m), 3.10 (3H, m), 4.04 (1H, m), 4.79 (1H, m), 7.11 (2H, m), 7.18 (1H, m), 7.28 (2H, m), 7.73 (2H, m).
FABMS (pos) 439 [M+H]+.
Melting point: 112-113 °C (crystallizing solvent: ethyl acetate-diisopropyl ether) Example 206 tert-Butyl 8-[3-[4-(4-chlorophenyl)-1-piperidinyl]
propoxy]-1,3,4,5-tetrahydro-2 H-2-benzazepine-2-carboxylate CI
O
Me O v ~N ~ O~N
Me Me A solution of tert-butyl 8-hydroxy-1,3,4,5-tetrahydro-2 H-2-benzazepine-2-carboxylate (1.00 g, 3.80 mmol) obtained in Reference Example 27, 3-bromo-1-chloropropane (0.451 ml, 4.56 mmol) and potassium carbonate (2.62 g, 19.0 mmol) in dimethylformamide (10 ml) was stirred at 80 °C for 3 hours. Ethyl acetate was added to the resultant solution which was then washed with a saturated saline solution and dried over anhydrous sodium sulfate. After the solvent was concentrated under reduced pressure, the resultant residues were purified by alumina column chromatography (developing solvent; ethyl acetate). The resultant oily matter and a solution of 4-(4-chlorophenyl) piperidine (882 mg, 3.80 mmol), potassium carbonate (2.62 g, 19.0 mmol) and sodium iodide (569 mg, 3.80 mmol) in dimethylformamide (10 ml) were stirred at 80 °C for 3 hours. Ethyl acetate was added to the resultant solution which was then washed with a saturated saline solution and dried over anhydrous sodium sulfate. After the solvent was concentrated under reduced pressure, the resultant residues were purified by silica gel column chromatography (developing solvent; hexane ethyl acetate = 3 . 1), whereby the title compound (1.25 g) was obtained.
1H NMR (CDC13) b: 1.41 (9H, s), 1.72-1.82 (6H, m), 1.96-2.05 (4H, m), 2.48-2.58 (3H, m), 2.88 (2H, m), 3.03-3.09 (2H, m), 3.66 (2H, m), 4.01 (2H, m), 4.32-4.39 (2H, m), 6. 66-6. 75 (2H, m) , 7. 0l-7. 05 (1H, m) , 7. 15 (2H, d, J = 8. 6 Hz) , 7.26 (2H, d, J = 8. 6 Hz) .
Example 207 8-[3-[4-(4-Chlorophenyl)-1-piperidinyl]propoxy]-2,3,4,5-tetrahydro-1 H-2-benzazepine / CI
~ O~N
A solution of tert-butyl 8-[3-[4-(4-chlorophenyl)-1-piperidinyl]propoxy]-1,3,4,5-tetrahydro-2H-2-benzazepine-2-carboxylate (1.10 g, 2.20 mmol) obtained in Example 206 in trifluoroacetic acid (10 ml) was stirred for 1 hour and then concentrated under reduced pressure. Ethyl acetate was added to the resultant oily matter which was then washed with an aqueous potassium carbonate solution and a saturated saline solution and dried over anhydrous sodium sulfate. The solvent was concentrated under reduced pressure, and the resultant residues were formed into powder with hexane, to give the title compound (682 mg).
1H NMR (DMSO-d6) ~: 1.57-2.03 (10H, m), 2.43 (3H, m), 2.78 (2H, m), 3.00 (4H, m), 3.72 (2H, m), 3.96 (2H, m), 6.55-6.70 (2H, m), 7.02 (1H, d, J = 8.0 Hz), 7.24-7.36 (4H, m).
Melting point: 97-99 °C (crystallizing solvent:
diisopropyl ether-hexane) Example 208 8-[3-[4-(4-Chlorophenyl)-1-piperidinyl]propoxy]-2-methyl-2,3,4,5-tetrahydro-1H-2-benzazepine hydrochloride CI
Me HCI
Using 8-[3-[4-(4-chlorophenyl)-1-piperidinyl]
propoxy]-2,3,4,5-tetrahydro-1H-2-benzazepine obtained in Example 207, the title compound was obtained as colorless amorphous powder by the same procedure as in Example 16.
1H NMR (CDC13, free base) S: 1.71-1.80 (6H, m), 1.96-2.07 (4H, m), 2.31 (3H, s), 2.45-2.57 (3H, m), 2.81 (2H, m), 2. 98-3. 09 (4H, m) , 3.75 (2H, s) , 3. 99 (2H, t, J = 6. 3 Hz) , 6. 65-6.71 (2H, m) , 7.01 (1H, d, J = 7.2 Hz) , 7. 15 (2H, d, J
- 8.7 Hz), 7.26 (2H, d, J = 8.7 Hz).
Example 209 2-Acetyl-8-[3-[4-(4-chlorophenyl)-1-piperidinyl]propoxy]-2,3,4,5-tetrahydro-1H-2-benzazepine hydrochloride CI
Ac HCI

Using 8-[3-[4-(4-chlorophenyl)-1-piperidinyl]
propoxy]-2,3,4,5-tetrahydro-1H-2-benzazepine obtained in Example 207 and acetic anhydride, the title compound was obtained as colorless amorphous powder by the same procedure as in Example 17.
1H NMR (DMSO-d6) b: 1.84 (2H, m), 2.01 (2H, m), 2.32 (3H, s), 2.47-2.62 (4H, m), 2.75-2.95 (5H, m), 3.24 (2H, m), 3.70-3.82 (4H, m), 4.09 (2H, m), 4.57 (2H, m), 6.72-6.90 (2H, m), 7.09 (1H, m), 7.21-7.30 (4H, m).
Example 210 4-[4-(4-Chlorophenyl)-1-piperidinyl]-1-(3-isopropyl-2,3,4,5-tetrahydro-1H-3-benzazepin-7-yl)-1-butanone dihydrochloride CI
Me N I ~ v v - , 2HCI
Me Using 4-[4-(4-chlorophenyl)-1-piperidinyl]-1-(2,3,4,5-tetrahydro-1 H-3-benzazepin-7-yl)-1-butanone obtained in Example 34, the title compound was obtained as colorless powder by the same procedure as in Example 17.
1H-NMR (CDC13) 6:1.02 (6H, d, J = 6. 6Hz) , 1. 62-1.74 (6H, m) , 1.93-2.05 (4H, m), 2.44 (2H, t like), 2.63-2.67 (2H, m), 2.89-3.05 (10H, m), 7.09-7.27 (5H, m), 7.72-7.75 (2H, m).

Melting point: 236 °C (decomp) (crystallizing solvent:
ethyl acetate-hexane) Example 211 1-(3-Benzyl-2,3,4,5-tetrahydro-1H-3-benzazepin-7-yl)-4-[4-(4-chlorophenyl)-1-piperidinyl]-1-butanone CI
O
N
N II
Using 4-[4-(4-chlorophenyl)-1-piperidinyl]-1-(2,3,4,5-tetrahydro-1 H-3-benzazepin-7-yl)-1-butanone obtained in Example 34, the title compound was obtained as colorless powder by the same procedure as in Example 17.
1H-NMR (CDC13) b: 1.60-1.79 (6H, m), 1.96-2.08 (4H, m), 2.43 (2H, t like), 2.61-2.65 (2H, m), 2.94-3.04 (9H, m), 3.63 (2H, s), 7.09-7.36 (10H, m), 7.71-7.75 (2H, m).
Melting point: 99-100 °C (crystallizing solvent: ethyl acetate-hexane) Example 212 4-[4-(4-Chlorophenyl)-1-piperidinyl]-1-(3-isopropyl-2,3,4,5-tetrahydro-1H-3-benzazepin-7-yl)-4-oxo-1-butanol / CI
~I
OH
Me ~ N
I I
Me~N I / O
Sodium borohydride (81 mg, 2.14 mmol) was added to a suspension of 4-[4-(4-chlorophenyl)-1-piperidinyl]-1-(3-isopropyl-2,3,4,5-tetrahydro-1H-3-benzazepin-7-yl)-4-oxo-1-butanone (0.50 g, 1.07 mmol) obtained in Example 30 in methanol (20 mL), and the mixture was stirred at room temperature for 30 minutes. The reaction solution was concentrated under reduced pressure, and the residues were partitioned into ethyl acetate and water. The ethyl acetate layer was washed with a saturated saline solution and dried over magnesium sulfate. The solvent was distilled away under reduced pressure, whereby the title compound was obtained as amorphous powder.
1H-NMR (CDC13) b: 1.02 (6H, d, J = 6.6Hz), 1.54-1.63 (2H, m), 1.85-1.91 (2H, br m), 2.05-2.17 (2H, m), 2.54 (2H, t like), 2.66-2.78 (6H, m), 2.89-2.93 (5H, m), 3.12 (1H, m), 3.95 (1H, br d), 4.72-4.85 (2H, m), 7.04-7.14 (5H, m), 7.30-7.31 (2H, m).
Example 213 7-[(E)-4-[4-(4-Chlorophenyl)-1-piperidinyl]-4-oxo-1-butenyl]-3-isopropyl-2,3,4,5-tetrahydro-1H-3-benzazepine hydrochloride CI
Me ~ ~ N
~N~~ n .
Me ~ ~ HCI
A solution of 4-[4-(4-chlorophenyl)-1-piperidinyl]-1-(3-isopropyl-2,3,4,5-tetrahydro-1H-3-benzazepin-7-yl)-4-oxo-1-butanol (0.14 g, 0.30 mmol) obtained in Example 212 and p-toluenesulfonic acid monohydrate (0.03 g, 0.16 mmol) in toluene (10 mL) was refluxed for 24 hours under heating.
The reaction solution was concentrated under reduced pressure, and the resultant residues were purified by alumina column chromatography (developing solvent; hexane .
ethyl acetate - 1 . 1), whereby 0.09 g free base of the title compound was obtained as colorless amorphous powder.
The resultant powder was dissolved in ethyl acetate and treated with 4 N hydrochloric acid in ethyl acetate under cooling with ice-bath, whereby 0.04 g of the title compound was obtained as colorless amorphous powder.
1H-NMR (CDC13) b: 1.02 (6H, d, J = 6.6Hz), 1.50-1.71 (2H, m), 1.86-1.92 (2H, m), 2.57-2.72 (6H, m), 2.87-3.00 (5H, m), 2.64 (1H, m), 3.34 (2H, d, J = 6.2Hz), 4.O1-4.07 (1H, br d like), 4.78-4.85 (1H, br d like), 6.26-6.37 (1H, m), 6.46 (1H, d, J = 16.2Hz), 7.05-7.29 (7H, m).

Example 214 1-(3-Acetyl-2,3,4,5-tetrahydro-1H-3-benzazepin-7-yl)-4-[4-(4-chlorophenyl)-1-piperidinyl]-1-butanol Ac Using 1-(3-acetyl-2,3,4,5-tetrahydro-1 H-3-benzazepin-7-yl)-4-[4-(4-chlorophenyl)-1-piperidinyl]-1-butanone obtained in Example 33, the title compound was obtained as colorless powder by the same procedure as in Example 212.
1H-NMR (CDC13) b: 1.50-2.27 (14H, m), 2.42-2.60 (3H, m), 2.85-2.97 (4H, m), 3.01-3.10 (1H, m), 3.23-3.32 (1H, m), 3.47-3.82 (4H, m), 4.64 (1H, brd, J = 5.4Hz), 7.05-7.30 (7H, m) .
Melting point: 113-114 °C (crystallizing solvent: diethyl ether) Example 215 3-Acetyl-7-[(E)-4-[4-(4-chlorophenyl)-1-piperidinyl]-1-butenyl]-2,3,4,5-tetrahydro-1H-3-benzazepine Ac Using 1-(3-acetyl-2,3,4,5-tetrahydro-1 H-3-benzazepin-7-yl)-4-[4-(4-chlorophenyl)-1-piperidinyl]-1-butanol obtained in Example 214, the title compound was obtained as colorless powder by the same procedure as in Example 213.
1H-NMR (CDC13) b: 1.57-1.90 (4H, m), 2.04-2.17 (2H, m), 2.19 (3H, s), 2.39-2.58 (5H, m), 2.84-2.95 (4H, m), 3.05-3.15 (2H, m), 3.52-3.61 (2H, m), 3.68-3.77 (2H, m), 6.13-6.27 (1H, m), 6.39 (1H, d, J = 15.7Hz), 7.03-7.20 (5H, m), 7.23-7.30 (2H, m).
Melting point: 153-155 °C (crystallizing solvent: diethyl ether ) Example 216 N-[2-(4-Chlorophenoxy)ethyl]-4-oxo-4-[3-(trifluoroacetyl)-2,3,4,5-tetrahydro-1H-3-benzazepin-7-yl]butanamide O / CI
O
W v ~ O
CF~N I / O
Using 4-oxo-4-[3-(trifluoroacetyl)-2,3,4,5-tetrahydro-1 H-3-benzazepin-7-yl]butanoic acid obtained in Reference Example 16 and 2-(4-chlorophenoxy)ethylamine obtained in Reference Example 26, the title compound was obtained as oily matter by the same procedure as in Example 12.
1H-NMR (CDC13) b: 2.65 (2H, t, J = 6.6 Hz), 3.02 (4H, m), 3.32 (2H, t, J = 6.6 Hz), 3.62-3.69 (4H, m), 3.78 (2H, m), 3.97 (2H, t, J = 5.4 Hz), 6.24 (1H, m), 6.81 (2H, m), 7.22-7.28 (3H, m), 7.78 (2H, m).
Example 217 N-[2-(4-Chlorophenoxyl)ethyl]-4-oxo-4-(2,3,4,5-tetrahydro-1H-3-benzazepin-7-yl]butanamide hydrochloride O , CI
N~
HN ~ / v ~ O
HCI
Using N-[2-(4-chlorophenoxy)ethyl]-4-oxo-4-[3-(trifluoroacetyl)-2,3,4,5-tetrahydro-1H-3-benzazepin-7-yl]
butanamide obtained in Example 216, the title compound was obtained as amorphous powder by the same procedure as in Example 13.
1H-NMR (CDC13, free base ) b : 2 . 02 ( 1H, m) , 2 . 65 ( 2H, t, J =
6. 6 Hz) , 2. 99 (8H, m) , 3.33 (2H, t, J = 6. 6 Hz) , 3. 66 (2H, m), 3.97 (2H, t, J = 5.4 Hz), 6.31 (1H, m), 6.81 (2H, m), 7.16-7.27 (3H, m), 7.70 (2H, m).
Example 218 N-[3-(4-Chlorophenyl)propyl]-N-methyl-4-oxo-4-[3-(trifluoroacetyl)-2,3,4,5-tetrahydro-1H-3-benzazepin-7-yl]butanamide O Me O
CF~N I ~ v O
3-(4-Chlorophenyl)propylamine (1.69 g, 9.96 mmol) and 37 ~ aqueous formaldehyde (0.811 ml, 10.0 mmol) was stirred at 100 °C for 7 hours in formic acid (10 ml). The resultant mixture was cooled to room temperature, and the formic acid was distilled away, and the reaction solution was made basic with 8 N aqueous sodium hydroxide and extracted with ethyl acetate. The extract was washed with an aqueous saturated NaCl solution and dried over anhydrous magnesium sulfate. The solvent was distilled away under reduced pressure, and the resultant residues, 4-oxo-4-[3-(trifluoroacetyl)-2,3,4,5-tetrahydro-1H-3-benzazepin-8-yl]butanoic acid (3.4 g, 9.96 mmol) obtained in Reference Example 16, and triethylamine (1.39 ml, 9.96 mmol) were stirred in dimethylformamide (5 ml) at room temperature for 30 minutes and then cooled to 0 °C, followed by adding diethyl cyanophosphate (1.51 ml, 9.96 mmol). The resultant mixture was stirred for 1 hour, poured into water and extracted with ethyl acetate. The extract was washed with an aqueous saturated NaCl solution and dried over anhydrous magnesium sulfate. After the solvent was distilled away under reduced pressure, the residues were purified by silica gel column chromatography (developing solvent; ethyl acetate . hexane . 1 . 1), whereby 1.44 g of the title compound was obtained as oily matter.
1H-NMR (CDC13) ~: 1.86 (2H, m), 2.57-2.80 (4H, m), 3.05 (7H, m), 3.30-3.36 (4H, m), 3.77-3.79 (4H, m), 7.10-7.33 (5H, m), 7.76 (2H, m) .
Example 219 N-[3-(4-Chlorophenyl)propyl]-N-methyl-4-oxo-4-(2,3,4,5-tetrahydro-1H-3-benzazepin-7-yl)butanamide hydrochloride O Me / CI
N
HN' I I I p HCI
Using N-[3-(4-chlorophenyl) propyl]-N-methyl-4-oxo-4-[3-(trifluoroacetyl)-2,3,4,5-tetrahydro-1 H-3-benzazepin-7-yl]butanamide obtained in Example 218, the title compound was obtained as amorphous powder by the same procedure as in Example 13.
1H-NMR (CDC13, free base) 8: 1.76-2.05 (3H, m), 2.51-2.68 (6H, m), 3.00 (7H, m), 3.24-3.41 (4H, m), 3.90 (2H, m), 7.07-7.30 (5H, m), 7.76 (2H, m).
Example 220 (E)-3-(Dimethylamino)-1-[1-[[6-(4-methylphenyl)-3-pyridinyl]carbonyl]-1,2,3,4-tetrahydro-6-quinolinyl]-2-propen-1-one Me 1) Using 6-acetyl-1,2,3,4-tetrahydroquinoline and 6-(4-methylphenyl)nicotinic acid, 1-[1-[[6-(4-methylphenyl)-3-pyridinyl]carbonyl]-1;2,3,4-tetrahydro-6-quinolinyl]ethanone was obtained as pale yellow powder by the same procedure as in Reference Example 5.
1H-NMR (DMSO-d6) b: 2.00 (2H, m), 2.36 (3H, s), 2.49 (3H, s), 2.93 (2H, dd, J=6.3 and 6.6Hz), 3.83 (2H, dd, J=6.1 and 6.3Hz), 7.00 (1H, d, J=9.3Hz), 7.30 (2H, d, J=8.lHz), 7.52 (1H, dd, J=1.5 and 8.3Hz), 7.83 (2H, m), 7.95 (1H, d, J=8.3Hz), 8.01 (2H, d, J=8.lHz), 8.59 (1H, m).
2) Using 1-[1-[[6-(4-methylphenyl)-3-pyridinyl]
carbonyl]-1,2,3,4-tetrahydro-6-quinolinyl]ethanone obtained in 1) above, the title compound was obtained as pale yellow powder by the same procedure as in Reference Example 6.
1H-NMR (DMSO-d6) b: 2.00 (2H, tt, J=6.3, 6.3Hz), 2.35 (3H, s), 2.87 (3H, br s), 2.91 (2H, t, J=6.3Hz), 3.11 (3H, br s), 3.83 (2H, t, J=6.3Hz), 5.78 (1H, d, J=12.5Hz), 6.86 (1H, d, J=8.lHz), 7.30 (2H, d, J=8.3Hz), 7.66 (1H, d, J=12.5Hz), 7.80 (3H, m), 7.94 (1H, d, J=8.3Hz), 8.00 (2H, d, J=8.lHz), 8.57 (1H, m).

Example 221 (E)-N,N-Dimethyl-3-[1-[[6-(4-methylphenyl)-3-pyridinyl]carbonyl]-1,2,3,4-tetrahydro-6-quinolinyl]-2-propene-1-amine hydrochloride ,Me ~e Me Using (E)-3-(dimethylamino)-1-[1-[[6-(4-methylphenyl)-3-pyridinyl]carbonyl]-1,2,3,4-tetrahydro-6-quinolinyl]-2-propen-1-one obtained in Example 220, the title compound was obtained as yellow crystals by the same procedures as in Examples 4 and 5.
1H-NMR (DMSO-d6) b: 1.98 (2H, m), 2.36 (3H, s), 2.70 (3H, s), 2.71 (3H, s), 2.86 (2H, t, J=6.3Hz), 3.00 (2H, m), 3.79 (2H, t, J= 6.3Hz), 5.66 (1H, m), 6.98 (2H, s), 7.24 (1H, s), 7.31 (2H, d, J=8.lHz), 7.86 (1H, m), 7.96 (1H, m), 8.00 (2H, d, J=8 . 1Hz ) , 8 . 57 ( 1H, m) , 10 . 42 ( 1H, br s ) .
Example 222 1-[1-[(4-Phenyl-1-piperidinyl)carbonyl]-1,2,3,4-tetrahydro-6-quinolinyl]-3-(1-pyrrolidinyl)-1-propanone Using 1-[(4-phenyl-1-piperidinyl)carbonyl]-1,2,3,4-tetrahydroquinoline obtained in Reference Example 28, the title compound was obtained as colorless solution by the same procedures as in Reference Examples 7 and 8.

1H-NMR (CDC13) b: 1. 70 (2H, m) 1.79 (4H, m) , 1. (2H, m) , 84 , 2.01 (2H, m), 2.56 (4H, m), m), 2.84 (2H, t, 2.69 (1H, J=6.6Hz), 2.89 (2H, dd, J=7.0 and 8.OHz), (2H, m), 2.91 3.14 (2H, dd, J=7.0 and 3.64 (2H, t, J=5.8Hz), 4.05 8.OHz), (2H, m), 7.02 (1H, d, J=8.8Hz), 7.19-7.33 (5H, m), 7.73 (2H, m) .
Example 223 1-[(4-Phenyl-1-piperidinyl)carbonyl]-6-[(E)-3-(1-pyrrolidinyl)-1-propenyl]-1,2,3,4-tetrahydroquinoline hydrochloride N
N
N~O
HCI

Using 1-[1-[(4-phenyl-1-piperidinyl)carbonyl]-1,2,3,4-tetrahydro-6-quinolinyl]-3-(1-pyrrolidinyl)-1-propanone obtained in Example 222, the title compound was obtained as yellow amorphous powder by the same procedures as in Examples 4 and 5.
1H-NMR (DMSO-d6) b: 1.70 (2H, m), 1.83 (2H, m), 1.97 (2H, m), 2.07 (2H, m), 2.23 (2H, m), 2.68 (1H, m), 2.79 (2H, m), 2.88 (4H, m), 3.64 (2H, m), 3.72 (2H, m), 3.78 (2H, m), 4.00 (2H, m), 6.32 (1H, m), 6.82 (1H, d, J=15.8Hz), 7.14 7.33 (8H, m), 12.54 (1H, br s).
Preparation Example 1 (1) Compound obtained in Example 1 50 mg (2) Lactose 34 mg (3) Corn starch 10.6 mg (4) Corn starch (paste) 5 mg (5) Magnesium stearate 0.4 mg 1l i 20 ma l l h l b ce um 120 mg u se ca o c oxymet Total y ~~) Car In accordance with a conventional manner, the above (1) to (6) are admixed and tableted using a tableting machine to give tablets.

Preparation Example 2 (1) Compound obtained in Example 5 50 mg (2) Lactose 34 mg (3) Corn starch 10.6 mg (4) Corn starch (paste) 5 mg (5) Magnesium stearate 0.4 mg ( 6) Carboxymeth~~ ~P1 1 "1 n~P calcium 20 mcr Total 120 mg In accordance with a conventional manner, the above (1) to (6) are admixed and tableted using a tableting machine to give tablets.
Reference Example 1-1 Amplification of rat SLC-1 receptor cDNA by PCR method using rat-brain-originated cDNA
Reverse transcription reaction was carried out using random primer, with rat-brain-originated poly (A)+RNA
(Clone Tech Co.) as a template. The reagent from the TaKaRa RNA PCR ver. 2 kit was used for the reverse transcription reaction. Next, using this reverse transcription product as a template, amplification was carried out by a PCR method using synthetic DNA primers with SEQ ID NOS: 1 and 2. Synthetic DNA primers were constructed to amplify genes in the domain where genes were translated into the receptor protein. At that time, individual restriction enzyme recognition sequences were also added to the 5' side and 3' side of the gene so as to add a nucleotide sequence recognizing the restriction enzyme Sal I to the 5' side of the gene, and to add a nucleotide sequence recognizing the restriction enzyme Spe I to the 3' side of the gene. The reaction mixture was composed of 5 u1 of cDNA template, 0.4 ~M of synthetic DNA
primer, 0.25 mM of dNTPs, 0.5 u1 of Pfu (StrataGene Co.) DNA polymerase, and buffers attached to enzymes, with setting total reaction quantity at 50 u1.
A thermal cycler (Parkin Elmer Co.) was used to produce cycles for amplification. After heating at 94°C
for 60 seconds, the cycle consisting of 94°C for 60 seconds, 60°C for 30 seconds, and 72°C for 150 seconds, was repeated 35 times, and finally reaction was conducted at 72°C for 10 minutes. After 0.8~ agarose gel electrophoresis, the amplified products were confirmed by ethidium bromide dying.
Reference Example 1-2 Subcloning of PCR products into plasmid vector, and confirmation of an amplified cDNA sequence by decoding of a nucleotide sequence in an inserted cDNA portion The reaction product after PCR conducted in Reference Example 1-1 was separated using 0.8% low-melting point agarose gel. After the band section was cut out using a razor, DNA was recovered by conducting fragmentation, phenol extraction, phenol-chloroform extraction and ethanol precipitation. The recovered DNA was subcloned on plasmid vector PCR-Script Amp SK(+) in accordance with prescription of the PCR-Scripts Amp SK(+) cloning kit (Stratagene Co.).

After this was introduced into Fsche_r,'_chia coli XL-1 Blue (Stratagene Co.) by transformation, the clones with fragments of inserted cDNA were selected in LB agar culture medium containing ampicillin and X-gal. Only clones showing white color were separated using a sterilized toothpick, and transformant E. coli XL-1 Blue/rat SLC-1 was obtained.
Each clone was cultured overnight in LB culture medium containing ampicillin, and plasmid DNA was prepared using QIA prep8 mini prep (Qiagen). A portion of the prepared DNA was digested with Sal I and Spe I, and the size of the inserted receptor cDNA fragment was confirmed. Reactions to determine nucleotide sequences were carried out using a DyeDeoxy Terminator Cycle Sequence Kit (Parkin Elmer Co.), and decoded using a fluorescent light automatic sequencer.
The sequences of the 3 clones obtained were analyzed, and it was confirmed that all of them match the reported gene sequence (SEQ ID NO: 4) in which the Sal I recognition sequence was added to the 5' side and the Spe I recognition sequence was added to the 3' side of the cDNA sequence (Lakaye, B., et al., Biochim. Biophys. Acta, Vol. 1401, pp.
216-220 (1998), accession No. AF08650) coding rat SLC-1 protein (SEQ ID NO: 3).
Reference Example 1-3 Preparation of CHO cells for rat SLC-1 expression The full-length amino acid sequence of rat brain originated SLC-1, which was confirmed in Reference Example 1-2, was coded, and plasmid was prepared using a plasmid Midi Kit (Qiagen) from the F. ro1_,'_ transformed by the plasmid, to which the gene with Sal I recognition sequence added to the 5' side and Spe I recognition sequence added to the 3' side, had been introduced. Then, the insert section was cut out by digesting with Sal I and Spe I. The insert DNA was cut out with a razor from the agarose gel after electrophoresis.
Next, fragmentation, phenol extraction, phenol-chloroform extraction, and ethanol precipitation, were conducted and the DNA was recovered. This insert DNA was added to vector plasmid pAKKO-111H (the same vector plasmid as pAKK01.11H described in Hinuma, S., et al., Biochim.
Biophys. Acta, Vol. 1219, pp. 251-259 (1994)) for animal cell expression which was digested with Sal I and Spe I, and ligation was conducted using T4 ligase (TaKaRa Shuzo), to construct pAKKO-SLC-1 plasmid for protein expression.
After E. coli DH5 (TOYOBO) transformed by pAKKO-SLC-1 was cultured, pAKKO-SLC-1 plasmid DNA was prepared using a Plasmid Midi Kit (Qiagen). This was introduced into CHO
dhfr- cells in accordance with the attached protocol, using a CellPhect Transfection Kit (Amersham Pharmacia Biotech Co.). A coprecipitating suspension of 10 ug of DNA and calcium phosphate was prepared, and this suspension was added to 10 cm Petri dishes in which 5 x 105 or 1 X 106 of CHO dhfr- cells had been seeded 24 hours previously. After these cells were cultured for 1 day in MEMa culture medium containing 10% fetal bovine serum, subculture was conducted, and cultivation was conducted in selective culture medium, MEMa culture medium containing no nucleic acid but containing 10% dialyzed fetal bovine serum. 56 Clones of colonies of the transformed CHO cells expressing SLC-1, proliferated in the selective culture medium, were selected.
Reference Example 1-4 Selection of CHO/SLC-1 cell strain expressing a large quantity of full-length rat SLC-1 receptor protein mRNA
The quantity of expressed full-length rat SLC-1 receptor protein mRNA of 56 clones of the CHO/SLC-1 strains established in Reference Example 1-3, was measured using a Cytostar T Plate (Amersham Pharmacia Biotech Co.) as shown below according to the attached protocol. Each well of the Cytostar T Plate was seeded with each clone of the CHO/SLC-1 strain by 2.5 X 104, and cultured for 24 hours, then the cells were fixed using 10% formalin. After 0.25% Triton X-100 was added to each well to increase cell permeability, ASS-labeled riboprobes with SEQ ID N0: 5 were added and hybridized. 20 mg/ml of RNaseA was added to each well to digest tree riboprobes. After the plate was thoroughly washed, the radioactivity of the hybridized riboprobes was determined using a Topcounter. Strains with high radioactivity showed large amounts of mRNA expression. In particular, mainly used was Clone number 44 among 3 clones which showed large amounts of mRNA expression.
Reference Example 1-5 Isolation of plasmid containing human SLC-1 cDNA
After nicks were inserted into the DNA of Human fetal brain originated cDNA library (SUPERSCRIPTTM cDNA Library;
GIBCOBRL Co.) according to the manual of the Genetrapper cDNA positive selection system (GIBCOBRL Co.), using pharge F1 endonuclease, single stranded human fetal brain originated cDNA library was prepared by digesting the above-mentioned library with Escherichia cola exonuclease III.
Biotin-14-dCTP was added to the 3' end of synthetic oligonucleotide (equivalent to 1434-1451 of accession No.
U71092 ) , SEQ ID N0: 6 which was prepared according to the report by Kolakowski Jr., et al. (Kolakowski Jr., et al.
(1996) FEBS Lett. Vol. 398, pp. 253-258) using Terminal Deoxynucleotidyl Transferase, and biotinated oligonucleotide was prepared. The above manual was followed regarding composition of a reaction mixture and reaction time.

After 4 ug of single stranded human fetal brain originated cDNA library was kept at 95°C for 1 minute, the library was rapidly cooled on ice. 20 ng of Biotinated oligonucleotide was added, which was hybridized using the attached hybridization buffer at 37°C for 1 hour.
Streptoavidin beads were added to the mixture, then single stranded human fetal brain originated cDNA hybridized by biotinated oligonucleotide, was isolated using a MAGNA-SEP
Magnetic Particle Separator (GIBCOBRL Co.). The complementary strand was synthesized according to the manual, using as primer 50 ng of synthetic oligonucleotide (equivalent to 1011 - 1028 of accession No. U71092) of SEQ
ID N0: 7, prepared based on the report by Kolakowski Jr. , et al (Kolakowski Jr., et al. (1996) FEBS Lett. Vol. 398, pp. 253-258), to give the double stranded plasmid.
Reference Example 1-6 Determination of nucleotide sequence of plasmid containing isolated human SLC-1 cDNA
After the plasmid obtained in Reference Example 1-5 was introduced into ELECTROMAXTMDH10B~ Cells by the electroporation method, clones with cDNA inserted fragments were selected in LB agar culture medium containing ampicillin and X-gal. Using a sterilized toothpick, only the clones showing white color were separated to give transformant E. coli DH10B/hSLC-1. Individual clones were cultured overnight in LB culture medium containing ampicillin, and the plasmid DNA was refined using QIA prep8 mini prep (Qiagen). The reactions to determine nucleotide sequence were conducted using a DyeDeoxy Terminator Cycle Sequence Kit (Parkin Elmer Co.), and the nucleotide sequence was decoded using a fluorescent light automatic sequencer.
As the results, obtained was the sequence shown in SEQ
ID N0: 8. The amino acid sequence (SEQ ID NO: 9) coded by the nucleotide sequence obtained here, differs from the human SLC-1 amino acid sequence predicted as the sequence analogized from rat SLC-1 based on human chromosome DNA
sequence (accession number: 286090) containing human SLC-1 sequence, in the report by Lakaye, et al. (Lakaye, B., et al. (1998) Biochim. Biophys. Acta. Vol. 1401, pp. 216-220).
This shows the presence of ATG, the initiation codon, on mRNA, in the 69 and 64 amino acids upstream from the estimated sequence. Escherichia coli DHlOB/phSLCIL8, the transformant produced by the plasmid containing DNA coding this sequence was deposited at IFO and NIBH.
Reference Example 1-7 Amplification of human SLC-lcDNA by PCR method using human fetal brain originated cDNA
Amplification by the PCR method was conducted using as the template plasmid containing human SLC-1 DNA sequence cloned by the gene trap method, and using synthetic DNA
primers of SEQ ID NO: 10 and SEQ ID N0: 11, and synthetic DNA primers of SEQ ID N0: 12 and SEQ ID N0: 13, respectively. The former amplified DNA and the latter amplified DNA were named as "human SLC-1(S)" and "human SLC-1(L)", respectively. The synthetic DNA primer was constructed so that the genes in the domain translated to the receptor protein were amplified. At that time, a recognition sequence for each restriction enzyme was added to the 5' side and 3' side, so that the nucleotide sequence recognized by restriction enzyme Sal I would be added to the 5' side of the gene, and the nucleotide sequence recognized by restriction enzyme Spe I would be added to the 3' side. The composition of the reaction mixture for human SLC-1(S) amplification was: 5 u1 of plasmid template containing human SLC-1 DNA sequence, 0.4 uM of respective synthetic DNA primers, 0.2 mM of dNTPs and 0.5 u1 of Pfu DNA polymerase and buffers attached to the enzyme, with setting total quantity for reaction at 50 u1. A thermal cycler (Parkin Elmer Co.) was used for the cycles for amplification. After heating at 94°C for 60 seconds, the cycle consisting of 94°C for 60 seconds, 57°C for 60 seconds, and 72°C for 150 seconds, was repeated 25 times, and finally the temperature of the reactant was maintained at 72°C for 10 minutes. The composition of the reaction mixture for human SLC-1(L) amplification was 5 u1 of plasmid template containing human SLC-1 DNA sequence, 0.4 uM of respective synthetic DNA primers, 0.2 mM of dNTPs, 0.5 u1 of Pfu DNA polymerase and buffers attached to the enzymes, with setting total quantity for reaction at 50 u1.
A thermal cycler (Parkin Elmer Co.) was used for the cycles for amplification. After heating at 94°C for 60 seconds, the cycle consisting of 94°C for 60 seconds, 60°C for 60 seconds, and 72°C for 3 minutes, was repeated 25 times, and finally the temperature of the reactant was maintained at 72°C for ZO minutes. After 0.8~ agarose gel electrophoresis, confirmation of amplified products was conducted by ethidium bromide dying.
Reference Example 1-8 Subcloning of PCR product into plasmid vector and confirmation of amplified cDNA sequence by decoding of nucleotide sequence of inserted cDNA section The reaction product after PCR in Reference Example 1 7 was separated using 0.80 low-melting point agarose gel, and the band section was cut out using a razor. After that, fragmentation, phenol extraction, phenol-chloroform extraction, and ethanol precipitation were conducted, and the DNA was recovered. The recovered DNA was subcloned into pCR-Script Amp SK (+) plasmid vector, as prescribed by the PCR-ScriptTM Amp SK(+) cloning kit (Stratagene Co.).

After this was introduced into Escherichia coli DHSa competent cells (TOYOBO) and transformed, the clones with cDNA inserted fragments were selected in LB agar culture medium containing ampicillin and X-gal. Using a sterilized toothpick, only clones showing white color were separated to give E. coli DHSa/hSLC-1(S), which is a transformant of human SLC-1 (S), and E. coli DHSa/hSLC-1(L), which is a transformant of human SLC-1 (L). Each clone was cultured overnight in LB culture medium containing ampicillin, and plasmid DNA was prepared using QIA prep8 mini prep (Qiagen).
Some of the prepared DNA was digested with Sal I and Spe I
restriction enzymes, and the size of the receptor cDNA
fragments inserted was confirmed. The reactions to determine nucleotide sequence were conducted using a DyeDeoxy Terminator Cycle Sequence Kit (Parkin Elmer Co.) and the nucleotide sequence was decoded using a fluorescent light automatic sequencer. The sequence of the obtained clones respectively matched the DNA sequence (SEQ ID N0:
14) which should be amplified by synthetic DNA primers of SEQ ID N0: 10 and SEQ ID N0: 11 using human SLC-1 gene as a template, and the DNA sequence (SEQ ID N0: 15) which should be amplified by synthetic DNA primers of SEQ ID N0: 12 and SEQ ID N0: 13 using human SLC-1 gene as a template.
Reference Example 1-9 Preparation of CHO cells for expression of human SLC-1(S), and CHO cells for expression of human SLC-1(L) Plasmid was prepared from the E. coli clones transformed by the plasmid wherein inserted were human SLC-1(S) and human SLC-1(L) whose sequences were confirmed in Reference Example 1-8, using a Plasmid Midi Kit (Qiagen), and the insert section was cut out using Sal I and Spe I
restriction enzymes. After electrophoresis was conducted, the insert DNA was cut out from agarose gel using a razor.
Next, fragmentation, phenol extraction, phenol-chloroform extraction, and ethanol precipitation were conducted, and the insert DNA was recovered.
This insert DNA was added to pAKKO-111H vector plasmid for animal cell expression, digested with Sal I and Spe I
(the same vector plasmid as the pAKKO1.11H described in Hinuma, S., et al., Biochim. Biophys. Acta, Vol. 1219, pp.
251-259 (1994)), and ligation was conducted by adding T4 ligase (TaKaRa Shuzo), to construct pAKKO-hSLC-1(S) and pAKKO-hSLC-1(L) plasmids for protein expression.
After E. coli DHSa (TOYOBO) transformed by pAKKO-hSLC
1(S) and pAKKO-hSLC-1(L) was cultured, pAKKO-hSLC-1(S) and pAKKO-hSLC-1(L) plasmid DNAs were prepared using a Plasmid Midi Kit (Qiagen). These were introduced into CHO dhfr cells in accordance with the attached protocol, using a CellPhect Transfection Kit (Amersham Pharmacia Biotech Co.).
A coprecipitative suspension of 10 ug of DNA with calcium phosphate was made, which was added to 10 cm Petri dishes seeded 24 hours in advance with 5 x 105 or 1 x 106 CHO dhfr-cells. After the above was cultured for 1 day in MEMa culture medium containing loo fetal bovine serum, subculture was conducted, and then cultivation was conducted in MEMa culture medium containing no nucleic acid but containing 10~ dialyzed fetal bovine serum, which is a selective culture medium. 56 clones of colonies of transformed cells which are human SLC-1(S) gene introduced CHO cells, and 61 clones of colonies of transformed cells which are human SLC-1(L) gene introduced CHO cells, both of which proliferated in the selective culture medium, were selected.
Reference Example 1-10 Selection of cell colonies into which genes with large quantities of human SLC-1(S) and human SLC-1 (L) mRNA
expression have been introduced The quantities of expressed mRNA of 56 clones of CHO/hSLC-1(S) colonies and 61 clones of CHO/hSLC-1(L) colonies, both of which were established in Reference Example 1-9, were measured in accordance with the attached protocol using a Cytostar T Plate (Amersham Pharmacia Biotech Co.) as shown below.
After each well of the Cytostar T Plate was seeded with each clone of CHO/hSLC-1(S) colonies and CHO/hSLC-1(L) colonies by 2.5 x 104, and cultured for 24 hours, the cells were fixed using 10% formalin.
After 0.25 Triton X-100 was added to each well to increase cell permeability, 35S-labeled riboprobe of SEQ ID
N0: 16 was added and hybridization was conducted.
20 mg/ml of RNaseA was added to each well to digest free riboprobe. After the plate was washed well, the radioactivity of the hybridized riboprobe was determined using a Topcounter. Colonies showing high radioactivity expressed large quantities of mRNA. Of the 7 clones which expressed large quantities of mRNA, mainly used was Clone number 57.
Experimental Example 1 Determination of antagonist activity using GTPyS binding assay of test compound Membrane fraction was prepared by the following method, using the human SLC-1 expressing CHO cell clone 57 obtained in Reference Example 1-10, and the rat SLC-1 expressing CHO
cell clone 44 obtained in Reference Example 1-4.
The human and rat SLC-1 expressing CHO cells (1 x 10s) were scraped in buffer saline phosphate (pH 7.4) to which 5 mM EDTA (ethylenediaminetetraacetic acid) had been added, and centrifuged. 10 ml of homogenized buffer (10 mM NaHC03, 5 mM EDTA, pH 7.5) was added to the cell pellets, and they were homogenized using a Polytron homogenizer. The supernatant obtained by centrifugation at 400 x g for 15 minutes was further centrifuged at 100,000 x g for 1 hour, to obtain the membrane fraction precipitate. This precipitate was suspended in 2 ml of assay buffer [50 mM
Tris-HC1(pH 7.5), 1 mM EDTA, O.lo BSA (bovine serum albumin), 10 mM MgCl2, 100 mM NaCl, 1 uM GDP (guanosine 5'-diphosphate), 0.25 mM PMSF (phenylmethylsulfonyl fluoride), 1 mg/ml pepstatin, 20 mg/ml leupeptin, 10 mg/ml phosphoramidon], which was centrifuged at 100,000 x g for 1 hour. The membrane fraction recovered as precipitate was suspended again in 20 ml of assay buffer, and after the suspension was divided, individual portions were preserved at -80°C and thawed before every use.
Determination of antagonist activity of the test compound was conducted as shown below. After 171 u1 of SLC-1 expressing CHO cell membrane fractions diluted with assay buffer was poured into each well of a 96-well polypropylene plate, 2 u1 of 3x10-1°M MCH diluted with DMSO
solution, 2 u1 of test compound solution diluted to various concentrations, and 25 u1 of [35S]-Guanosine 5'-(y-thio) triphosphate (produced by Daiichi Kagaku Yakuhin) were added respectively. (Final concentration of cell membrane:
20 ug/ml, final concentration of [35S]-Guanosine 5'-(y-thio) triphosphate: 0.33 nM).
After this reaction mixture was allowed to react at 25 °C for 1 hour under stirring, it was filtered under vacuum using a glass filter (GF-C), then the filter was washed 3 times with 300 u1 of washing solution (50 mM Tris-HC1 buffer solution pH 7.5). 50 ml of liquid scintillator was added to the glass filter, and residual radioactivity was determined using a liquid scintillation counter.
The ICSO value of the compound was calculated from the binding inhibition rate (o), based on the definition that the binding inhibition rate (~) - (radioactivity when compound and MCH were added - radioactivity when DMSO
solution was added)/(radioactivity when MCH was added -radioactivity when DMSO solution was added) x 100.
The results were shown below.
Inhibition Activity Compound Number (IC value: uM) Example 1 0.3 Example 5 0.02 Industrial Applicability Compounds (I), (I'), (I"), (I"') and salts thereof possess excellent MCH receptor antagonistic activities, and are useful as an agent for preventing or treating obesity, etc.

SEQUENCE LISTING
<110~ Takeda Chemical Industries, Ltd.
<120~ Melanin Concentrating Hormone Antagonist <130~ 2728W00P
<150~ JP 2001-116219 <151> 2001-04-13 <150~ JP 2000-148647 <151> 2000-05-16 <160~ 16 <210~ 1 <211~ 32 <212~ DNA
<2I3> Artificial Sequence <220~
<223~
<400~ 1 gtcgacatgg atctgcaaac ctcgttgctg tg 32 <210~ 2 <211~ 32 <212> DNA
<213~ Artificial Sequence <220~
<223>
<400~ 2 actagttcag gtgcctttgc tttctgtcct ct 32~
<210> 3 <211~ 353 <212~ PRT
<213~ Rat <400~ 3 Met Asp Leu Gln Thr Ser Leu Leu Ser Thr Gly Pro Asn Ala Ser Asn Ile Ser Asp Gly Gln Asp Asn Leu Thr Leu Pro Gly Ser Pro Pro Arg Thr Gly Ser Val Ser Tyr Ile Asn Ile Ile Met Pro Ser Val Phe Gly Thr Ile Cys Leu Leu Gly Ile Val Gly Asn Ser Thr Val Ile Phe Ala Val Val Lys Lys Ser Lys Leu His Trp Cys Ser Asn Val Pro Asp Ile 65 70 . 75 80' Phe Ile Ile Asn Leu Ser Val Val Asp Leu Leu Phe Leu Leu Gly Met Pro Phe Met Ile His Gln Leu Met Gly Asn Gly Val Trp His Phe Gly Glu Thr Met Cys Thr Leu Ile Thr Ala Met Asp Ala Asn Ser Gln Phe .115 120 125 Thr Sex Thr Tyr Ile Leu Thr Ala Met Thr Ile Asp Arg Tyr Leu Ala Thr Val His Pro Ile Ser Ser Thr Lys Phe Arg Lys Pro Ser Met Ala Thr Leu Val Ile Cys Leu Leu Trp Ala Leu Ser Phe Ile Ser Ile Thr Pro Val Trp Leu Tyr Ala Arg Leu Ile Pro Phe Pro Gly Gly Ala Val Gly Cys Gly Ile Arg Leu Pro Asn Pro Asp Thr Asp Leu Tyr Trp Phe Thr Leu Tyr Gln Phe Phe Leu Ala Phe Ala Leu Pro Phe Val Val Ile Thr Ala Ala Tyr Val Lys Ile Leu Gln Arg Met Thr Ser Ser Val Ala 225 230 235 ~ ' 240 Pro Ala Ser Gln Arg Ser Ile Arg Leu Arg Thr Lys Arg Val Thr Arg Thr Ala Ile Ala Ile Cys Leu Val Phe Phe Val Cys Trp Ala Pro Tyr Tyr Val Leu Gln Leu Thr Gln Leu Ser Ile Ser Arg Pro Thr Leu Thr 275 280' 285 Phe Val Tyr Leu Tyr Asn Ala Ala Ile Ser Leu Gly Tyr Ala Asn Ser Cys Leu Asn Pro Phe Val Tyr Ile Val Leu Cys Glu Thr Phe Arg Lys 305 310 ~ 315 320 Arg Leu Val Leu Ser Val Lys Pro Ala Ala Gln Gly Gln Leu Arg Thr Yal Ser Asn Ala Gln Thr Ala Asp Glu Glu Arg Thr Glu Ser Lys Gly Thr <210~ 4 <211~ 1074 <212j DNA
<213~ Rat <400~ 4 gtcgacatgg atctgcaaac ctcgttgctg tccactggcc ccaatgccag caacatctcc 60 gatggccagg ataatctcac attgccgggg tcacctcctc gcacagggag tgtctcctac 120 atcaacatca ttatgccttc cgtgtttggt accatctgtc tcctgggcat cgtgggaaac 180 tccacggtca tctttgctgt ggtgaagaag tccaagctac actggtgcag caacgtcccc 240 gacatcttca tcatcaacct ctctgtggtg gatctgctct tcctgctggg catgcctttc 300 atgatccacc agctcatggg gaacggcgtc tggcactttg gggaaaccat gtgcaccctc 360 atcacagcca tggacgccaa cagtcagttc actagcacct acatcctgac tgccatgacc 420 attgaccgct acttggccac cgtccacccc atctcctcca ccaagttccg gaagccctcc 480 atggccaccc tggtgatctg cctcctgtgg gcgctctcct tcatcagtat cacccctgtg 540 tggctctacg ccaggctcat tcccttccca gggggtgctg tgggctgtgg catccgcctg 600 ccaaacccgg acactgacct ctactggttc actctgtacc agtttttcct ggcctttgcc 660 cttccgtttg tggtcattac cgccgcatac gtgaaaatac tacagcgcat gacgtcttcg 720 gtggccccag cctcccaacg cagcatccgg cttcggacaa agagggtgac ccgcacggcc 780 attgccatct gtctggtctt ctttgtgtgc tgggcaccct actatgtgct gcagctgacc 840 cagctgtcca tcagccgccc gaccctcacg tttgtctact tgtacaacgc ggccatcagc 900 ttgggctatg ctaacagctg cctgaacccc tttgtgtaca tagtgctctg tgagaccttt 960 cgaaaacgct tggtgttgtc agtgaagcct gcagcccagg ggcagctccg cacggtcagc 1020 aacgctcaga cagctgatga ggagaggaca gaaagcaaag gcacctgaac tagt 1074 <210~ 5 .
<211> 262 <212~ RNA
<213> Rat <400~ 5 gcgaauuggg uaccgggccc ccccucgagg ucgacgguau cgauaagcuu gauaucgaau 60 uccugcagcc cgggggaucc gcccacuagu ucaggugccu uugcuuucug uccucuccuc 120 aucagcuguc ugagcguugc ugaccgugcg gagcugcccc ugggcugcag gcuucacuga 180 caacaccaag cguuuucgaa aggucucaca gagcacuaug uacacaaagg gguucaggca 240 gcuguuagca uagcccaagc ug 262 <210~ 6 <211~ 18 <212~ DNA
<213~ Artificial Sequence <220~ _.
<223~
<400> 6 caacagctgc ctcaaccc I8 <210~7 <211>18 <212~DNA

<213~Artificial Sequence <220>

<223>

<400~7 cctggtgatlc tgcctcct <210~8 <211~1275 <212>DNA

<213~Human <400~8 taggtgatgt cagtgggagc catgaagaag ggagtgggga gggcagttgg gcttggaggc 60 ggcagcggct gccaggctac ggaggaagac ccccttccca actgcggggc ttgcgctccg 120 ggacaaggtg gcaggcgctg gaggctgccg cagcctgcgt gggtggaggg gagctcagct 180 cggttgtggg agcaggcgac cggcactggc tggatggacc tggaagcctc gctgctgccc 240 actggtccca acgccagcaa cacctctgat ggccccgata acctcacttc ggcaggatca 300 cctcctcgca cggggagcat ctcctacatc aacatcatca tgccttcggt gttcggcacc 360 atctgcctcc tgggcatcat cgggaactcc acggtcatct tcgcggtcgt gaagaagtcc 420 aagctgcact ggtgcaacaa cgtccccgac atcttcatca tcaacctctc ggtagtagat 480 ctcctctttc tcctgggcat gcccttcatg atccaccagc tcatgggcaa tggggtgtgg 540 cactttgggg agaccatgtg caccctcatc acggccatgg atgccaatag tcagttcacc 600 agcacctaca tcctgaccgc catggccatt gaccgctacc tggccactgt ccaccccatc 660 tcttccacga agttccggaa gccctctgtg gccaccctgg tgatctgcct cctgtgggcc 720 ctctccttca tcagcatcac ccctgtgtgg ctgtatgcca gactcatccc cttcccagga 780 ggtgcagtgg gctgcggcat acgcctgccc aacccagaca ctgacctcta ctggttcacc 840 ctgtaccagt ttttcctggc ctttgccctg ccttttgtgg tcatcacagc cgcatacgtg 9 aggatcctgc agcgcatgac gtcctcagtg gcccccgcct cccagcgcag catccggctg 960 cggacaaagagggtgacccg gccatctgtctggtcttctt tgtgtgctgg1020 cacagccatc gcaccctactatgtgctaca ttgtccatcagccgcccgac cctcaccttt1080 gctgacccag gtctacttatacaatgcggc ggctatgccaacagctgcct caaccccttt1140 catcagcttg gtgtacatcgtgctctgtga aaacgcttggtcctgtcggt gaagcctgca1200 gacgttccgc gcccaggggcagcttcgcgc gctcagacggctgacgagga gaggacagaa1260 tgtcagcaac agcaaaggcacctga 1275 <210~

<211~

<212~
PRT

<213~
Human <400~.9 MeT Ser Gly MeT Lys Gly Val ArgAla ValGly Leu Val Ala Lys Gly Gly Gly Ser Cys Ala Thr Glu AspPro LeuPro Asn Gly Gly Gln Glu 20 . 25 ' 30 Cys Gly Cys Pro Gln Gly.Gly ArgTrp ArgLeu Pro Ala Ala Gly Arg Gln Pro Trp Glu Ser Ser Ala LeuTrp GluGln Ala Ala Val Gly Arg Thr Gly Gly MeT Leu Glu Ala LeuLeu ProThr Gly Thr Trp Asp Ser 65 ~ 70 75 80 Pro Asn Ser Thr Asp Gly Pro AsnLeu ThrSer Ala Ala Asn Ser Asp Gly Ser Pro Thr Ser Ile Ser IleAsn IleIle MeT
Pro Arg Gly Tyr Pro Ser Phe Thr Cys Leu Leu IleIle GlyAsn Ser Val Gly Ile Gly Thr Val Phe Val Lys Lys Ser LeuHis TrpCys Asn Ile Ala Val Lys Asn Val Pro Asp Ile Phe Ile Ile Asn Leu Ser Val Val Asp Leu Leu 145 . 150 155 160 Phe Leu Leu Gly MeT Pro Phe MeT Ile His Gln Leu MeT Gly Asn Gly ' 165 170 175 Val Trp His Phe Gly GIu Thr MeT Cys Thr Leu Ile Thr Ala MeT Asp Ala Asn Ser Gln Phe Thr Ser Thr Tyr Ile Leu Thr AIa MeT AIa Ile Asp Arg Tyr Leu Ala Thr Val His Pro Ile Ser Ser Thr Lys Phe Arg Lys Pro Ser Val Ala Thr Leu Val Ile Cys Leu Leu Trp Ala Leu Ser Phe Ile Ser Ile Thr Pro Val Trp Leu Tyr Ala Arg Leu Ile Pro Phe Pro Gly Gly Ala Val Gly Cys Gly Ile Arg Leu Pro Asn Pro Asp Thr Asp Leu Tyr Trp Phe Thr Leu Tyr Gln Phe Phe Leu Ala Phe Ala Leu Pro Phe Val Val Ile Thr Ala Ala Tyr Val Arg Ile Leu Gln Arg MeT

Thr Ser Ser Val Ala Pro Ala Ser Gln Arg Ser Ile Arg Leu Arg Thr Lys Arg Val Thr Arg Thr AIa Ile Ala Ile Cys Leu Val Phe Phe Val Cys Trp Ala Pro Tyr Tyr Val Leu Gln Leu Thr Gln Leu Ser Ile Ser Arg Pro Thr Leu Thr Phe Val Tyr Leu Tyr Asn Ala Ala Ile Ser Leu Gly Tyr Ala Asn Ser Cys Leu Asn Pro Phe Val Tyr Ile Val Leu Cys Glu Thr Phe Arg Lys Arg Leu Val Leu Ser Val Lys Pro Ala Ala Gln Gly Gln Leu Arg Ala Val Ser Asn Ala Gln Thr Ala Asp Glu Glu Arg Thr Glu Ser Lys Gly Thr <210> 10 <211~ 31 <212~ DNA
<213~ Artificial Sequence <220>
<223~
<400~ 10 gtcgacatgg acctggaagc ctcgctgctg c 31 <210~ 11 <211> 31 <212~ DNA
<213> Artificial Sequence <220~
<223~
<400> 11 actagttcag gtgcctttgc tttctgtcct c 31 <210~ 12 <211~ 33 <212~ DNA
<213~ Artificial Sequence <220~
<223~
Thr Ser Ser Val Ala Pro Al <400> 12 agtcgacatg tcagtgggag ccatgaagaa ggg 33 <210~ 13 <211~ 33 <212~ DNA
<213~ Artificial Sequence <220~
<223~
<400> 13 aactagttca ggtgcctttg ctttctgtcc tct 33 <210> 14 <211~ 1074 <212~ DNA
<213~ Human <400~ 14 gtcgacatgg acctggaagc ctcgctgctg cccactggtc ccaacgccag caacacctct 60 gatggccccg ataacctcac ttcggcagga tcacctcctc gcacggggag catctcctac 120 atcaacatca tcatgccttc ggtgttcggc accatctgcc tcctgggcat catcgggaac 180 tccacggtca tcttcgcggt cgtgaagaag tccaagctgc actggtgcaa caacgtcccc 240 gacatcttca tcatcaacct ctcggtagta gatctcctct ttctcctggg catgcccttc 300 atgatccacc agctcatggg caatggggtg tggcactttg gggagaccat gtgcaccctc 360 atcacggcca tggatgccaa tagtcagttc accagcacct acatcctgac cgccatggcc 420 attgaccgct acctggecac tgtccacccc atctcttcca cgaagttccg gaagccctct 480 gtggccaccc tggtgatctg cctcctgtgg gccctctcct tcatcagcat cacccctgtg 540 tggctgtatg ccagactcat ccccttccca ggaggtgcag tgggctgcgg catacgcctg 600 cccaacccag acactgacct ctactggttc accctgtacc agtttttcct ggcct~ttgcc 660 ctgccttttg tggtcatcac agccgcatac gtgaggatcc tgcagcgcat gacgtcctca 720 gtggcccccg cctcccagcg cagcatccgg ctgcggacaa agagggtgac ccgcacagcc 780 atcgccatct gtctggtctt ctttgtgtgc tgggcaccct actatgtgct acagctgacc 840 cagttgtcca tcagccgccc gaccctcacc tttgtctact tataeaatgc ggccatcagc 900 ttgggctatg ccaacagctg cctcaacccc tttgtgtaca tcgtgctctg tgagacgttc 960 cgcaaacgct tggtcctgtc ggtgaagcct gcagcccagg ggcagcttcg cgctgtcagc 1020 aacgctcaga cggctgacga ggagaggaca gaaagcaaag gcacctgaac tagt 1074 <210~ 15 <211> 1283 <212> DNA
<213> Human <400~ 15 agtcgacatg tcagtgggag ccatgaagaa gggagtgggg agggcagttg ggcttggagg ,60 cggcagcggc tgccaggcta cggaggaaga cccccttccc aactgcgggg cttgcgctcc 120 gggacaaggt ggcaggcgct ggaggctgcc gcagcctgcg tgggtggagg ggagctcagc 180 tcggttgtgg gagcaggcga ccggcactgg ctggatggac ctggaagcct cgctgctgcc 240 cactggtccc aacgccagca acacctctga tggccccgat aacctcactt cggcaggatc 300 acctcctcgc acggggagca tctcctacat caacatcatc atgccttcgg tgttcggcac 360 catctgcctc ctgggcatca tcgggaactc cacggtcatc ttcgcggtcg tgaagaagtc 420 caagctgcac tggtgcaaca acgtccccga catcttcatc atcaacctct cggtagtaga 480 tctcctcttt ctcctgggca tgcccttcat gatccaccag ctcatgggca atggggtgtg 540 gcactttggg gagaccatgt gcaccctcat cacggccatg gatgccaata gtcagttcac 600 cagcacctac atcctgaccg ccatggccat tgaccgctac ctggccactg tccaccccat 660 ctcttccacg aagttccgga agccctctgt ggccaccctg gtgatctgcc tcctgtgggc 720 cctctccttc atcagcatca cccctgtgtg gctgtatgcc agactcatcc ccttcccagg 780 aggtgcagtg ggctgcggca tacgcctgcc caacccagac actgacctct actggttcac 840 cctgtaccag tttttcctgg cctttgccct gccttttgtg gtcatcacag ccgcatacgt 900 gaggatcctg cagcgcatga cgtcctcagt ggcccccgcc tcccagcgca gcatccggct 960 gcggacaaag agggtgaccc gcacagccat cgccatctgt ctggtcttct ttgtgtgctg 1020 ggcaccctac tatgtgctac agctgaccca gttgtccatc agccgcccga ccctcacctt 1080 tgtctactta tacaatgcgg ccatcagctt gggctatgcc aacagctgcc tcaacccctt 1140 tgtgtacatc gtgctctgtg agacgttccg caaacgcttg gtcctgtcgg tgaagcctgc 1200 agcccagggg cagcttcgcg ctgtcagcaa cgctcagacg gctgacgagg agaggacaga 1260 aagcaaaggc acctgaacta gtt 1283 <210~ 16 <211~ 420 <212~ RNA
<213~ Human <400~ 16 caaaagcugg agcuccaccg cgguggcggc cgcucuagcc cacuaguuca ggugccuuug 60 cuuucugucc ucuccucguc agccgucuga gcguugcuga cagcgcgaag cugccccugg 120 gcugcaggcu,ucaccgacag gaccaagcgu uugcggaacg ucucacagag cacgauguac 180 acaaaggggu ugaggcagcu guuggcauag cccaagcuga uggccgcauu guauaaguag 240 acaaagguga gggucgggcg gcugauggac aacuggguca gcuguagcac auaguagggu 300 gcccagcaca caaagaagac cagacagaug gcgauggcug ugcgggucac ccucuuuguc 360 cgcagccgga ugcugcgcug ggaggcgggg gccacugagg acgucaugcg cugcaggauc 420

Claims (40)

346
1. A melanin-concentrating hormone antagonist which comprises a compound represented by the formula:
wherein R is hydrogen atom, a halogen atom or a cyclic group which may be substituted;
X is a bond or a spacer having a main chain of 1 to 10 atoms;
Y is a spacer having a main chain of 1 to 6 atoms;
ring A is benzene ring which may be further substituted;
ring B is a 5- to 9-membered nitrogen-containing non-aromatic heterocyclic ring which may be further substituted; and R1 and R2 are the same or different and are hydrogen atom, a hydrocarbon group which may be substituted or a heterocyclic group which may be substituted; or R1 and R2, together with the adjacent nitrogen atom, may form a nitrogen-containing heterocyclic ring which may be substituted; or R2, together with the adjacent nitrogen atom and Y, may form a nitrogen-containing heterocyclic ring which may be substituted;
or a salt thereof.
2. The antagonist according to claim 1, wherein R is a cyclic group which may be substituted; X is a spacer having a main chain of 1 to 6 atoms; and R1 and R2 are the same or different and are hydrogen atom or a hydrocarbon group which may be substituted; or R1 and R2, together with the adjacent nitrogen atom, form a nitrogen-containing heterocyclic ring which may be substituted; or R2, together with the adjacent nitrogen atom and Y, form a nitrogen-containing heterocyclic ring which may be substituted.
3. The antagonist according to claim 1 which is an agent for preventing or treating diseases caused by melanin-concentrating hormone.
4. The antagonist according to claim 1 which is an agent for preventing or treating obesity.
5. A compound represented by the formula:
wherein Ar1 is a cyclic group which may be substituted;
X is a bond or a spacer having a main chain of 1 to 10 atoms;
Y is a spacer having a main chain of 1 to 6 atoms;
ring A is benzene ring which may be further substituted;
ring B1 is a 5- to 9-membered nitrogen-containing non-aromatic heterocyclic ring which may be further substituted; and R1 and R2 are the same or different and are hydrogen atom, a hydrocarbon group which may be substituted or a heterocyclic group which may be substituted; or R1 and R2, together with the adjacent nitrogen atom, may form a nitrogen-containing heterocyclic ring which may be substituted; or R2, together with the adjacent nitrogen atom and Y, may form a nitrogen-containing heterocyclic ring (except piperidine) which may be substituted;
provided that, when X is CO, ring B1 is not azepane or 4,5-dihydroazepine each of which may be further substituted, or Ar1 is not biphenylyl which may be substituted, and that Y
is not -CO-(C(Ra)H)na- (Ra is hydrogen atom or a hydrocarbon group which may be substituted, na is an integer of 1 to 10) and does not have a bicyclic nitrogen-containing heterocyclic ring substituted with amino group;
or a salt thereof.
6. The compound according to claim 5, wherein X is a spacer having a main chain of 1 to 6 atoms; and R1 and R2 are the same or different and are hydrogen atom or a hydrocarbon group which may be substituted; or R1 and R2, together with the adjacent nitrogen atom, form a nitrogen-containing heterocyclic ring which may be substituted; or R2, together with the adjacent nitrogen atom and Y, form a nitrogen-containing heterocyclic ring (except piperidine) which may be substituted.
7. The compound according to claim 5, wherein the cyclic group represented by Ar1 is an aromatic group.
8. The compound according to claim 7, wherein the aromatic group is a group formed by removing an optional one hydrogen atom from an aromatic ring assembly formed by 2 or 3 members selected from C6-14 monocyclic or condensed polycyclic aromatic hydrocarbon and 5- to 10-membered aromatic heterocyclic ring.
9. The compound according to claim 5, wherein the spacer represented by X and Y is a bivalent group consisting of 1 to 3 members selected from -O-, -S-, -CO-, -SO-, -SO2-, -NR8- (R8 is hydrogen atom, optionally halogenated C1-6 alkyl, optionally halogenated C1-6 alkyl-carbonyl or optionally halogenated C1-6 alkylsulfonyl), and a divalent C1-6 non-cyclic hydrocarbon group which may be substituted.
10. The compound according to claim 5, wherein X is CO.
11. The compound according to claim 5, wherein Y is C2-6 alkenylene which may be substituted.
12. The compound according to claim 5, wherein the group represented by the formula:

13. The compound according to claim 5, wherein R1 and R2, together with the adjacent nitrogen atom, form a nitrogen-containing heterocyclic ring which may be substituted.
14. The compound according to claim 5, wherein R1 and R5 are C1-6 alkyl.
15. A pharmaceutical composition comprising the compound according to claim 5, or a salt thereof.
16. A prodrug of the compound according to claim 5.
17. A process for producing a compound represented by the formula:
wherein each symbol is as defined in claim 5, or a salt thereof, which comprises reacting a compound represented by the formula:

Ar1 ~ X ~ L (IIb) wherein L is a leaving group and the other symbols are as defined above, or a salt thereof with a compound represented by the formula:
wherein each symbol is as defined above, or a salt thereof.
18. A compound represented by the formula:
wherein R is hydrogen atom, a halogen atom or a cyclic group which may be substituted;
X is a bond or a spacer having a main chain of 1 to 10 atoms;
Ya is a spacer having a main chain of 1 to 5 atoms;
ring A is benzene ring which may be further substituted;
ring B is a 5- to 9-membered nitrogen-containing non-aromatic heterocyclic ring which may be further substituted;
Z is CH or N; and Rb is hydrogen atom or a hydrocarbon group which may be substituted;
provided that Ya does not have a bicyclic nitrogen-containing heterocyclic ring substituted with amino group;
or a salt thereof.
19. The compound according to claim 18, wherein R is hydrogen atom.
20. The compound according to claim 18, wherein Ya is -(CH2)w1CO(CH2)w2- (w1 and w2 are an integer of 0 to 5 and w1 + w2 is 0 to 5) .
21. The compound according to claim 18, wherein Z is CH.
22. The compound according to claim 18, wherein Rb is C6-14 aryl which may be substituted.
23. The compound according to claim 18, wherein the group represented by the formula:
24. A pharmaceutical composition comprising the compound according to claim 18, or a salt thereof.
25. A prodrug of the compound according to claim 18.
26. A process for producing a compound represented by the formula:

wherein each symbol is as defined in claim 18, or a salt thereof, which comprises reacting a compound represented by the formula:
wherein L is a leaving group and the other symbols are as defined above, or a salt thereof, with a compound represented by the formula:
wherein each symbol is as defined above, or a salt thereof.
27. A compound represented by the formula wherein R is hydrogen atom, a halogen atom or a cyclic group which may be substituted;
X is a bond or a spacer having a main chain of 1 to 10 atoms;
ring A is benzene ring which may be further substituted;
ring B is a 5- to 9-membered nitrogen-containing non-aromatic heterocyclic ring which may be further substituted;
w7 is an integer of 0 to 4; and R1 and R2 are the same or different and are hydrogen atom, a hydrocarbon group which may be substituted or a heterocyclic group which may be substituted; or R1 and R2, together with the adjacent nitrogen atom, may form a nitrogen-containing heterocyclic ring which may be substituted; or a salt thereof.
28. A pharmaceutical composition comprising the compound according to claim 27 or a salt thereof.
29. A prodrug of the compound according to claim 27.
30. A compound represented by the formula:
wherein R is hydrogen atom, a halogen atom or a cyclic group which may be substituted;
X is a bond or a spacer having a main chain of 1 to 10 atoms;
ring A is benzene ring which may be further substituted;
ring B is a 5- to 9-membered nitrogen-containing non-aromatic heterocyclic group which may be further substituted;
w2 is an integer of 0 to 5;
Z is CH or N;

Rc is a hydrocarbon group which may be substituted;
or a salt thereof.
31. The compound according to claim 30, wherein Z is CH.
32. The compound according to claim 30, wherein Rc is C6-14 aryl which may be substituted.
33. A pharmaceutical composition comprising the compound according to claim 30 or a salt thereof.
34. A prodrug of the compound according to claim 30.
35. The antagonist according to claim 1 which is an anorectic agent.
36. A pharmaceutical which comprises the melanin-concentrating hormone antagonist according to claim 1 in combination with at least one species selected from the group consisting of an agent for treating diabetes, an agent for treating hypertension and an agent for treating arteriosclerosis.
37. A method for preventing or treating diseases caused by a melanin-concentrating hormone in a mammal in need thereof, which comprises administering to said mammal an effective amount of a compound represented by the formula:
wherein R is hydrogen atom, a halogen atom or a cyclic group which may be substituted;
X is a bond or a spacer having a main chain of 1 to 10 atoms;
Y is a spacer having a main chain of 1 to 6 atoms;
ring A is benzene ring which may be further substituted;
ring B is a 5- to 9-membered nitrogen-containing non-aromatic heterocyclic ring which may be further substituted; and R1 and R2 are the same or different and are hydrogen atom, a hydrocarbon group which may be substituted or a heterocyclic group which may be substituted; or R1 and R2, together with the adjacent nitrogen atom, may form a nitrogen-containing heterocyclic ring which may be substituted; or R2, together with the adjacent nitrogen atom and Y, may form a nitrogen-containing heterocyclic ring which may be substituted;
or a salt thereof.
38. A method for preventing or treating obesity in a mammal in need thereof, which comprises administering to said mammal an effective amount of a compound represented by the formula:
wherein R is hydrogen atom, a halogen atom or a cyclic group which may be substituted X is a bond or a spacer having a main chain of 1 to 10 atoms;
Yb is a spacer having a main chain of 1 to 6 atoms;
ring A is benzene ring which may be further substituted;
ring B is a 5- to 9-membered nitrogen-containing non-aromatic heterocyclic ring which may be further substituted; and R1 and R2 are the same or different and are hydrogen atom, a hydrocarbon group which may be substituted or a heterocyclic group which may be substituted; or R1 and R2, together with the adjacent nitrogen atom, may form a nitrogen-containing heterocyclic ring (except piperidine) which may be substituted; or R2, together with the adjacent nitrogen atom and Y, may form a nitrogen-containing heterocyclic ring which may be substituted;
provided that Yb is not -CO-(C(Ra)H)na- (Ra is hydrogen atom or a hydrocarbon group which may be substituted, na is an integer of 1 to 10);
or a salt thereof.
39. Use of a compound represented by the formula:
wherein R is hydrogen atom, a halogen atom or a cyclic group which may be substituted:
X is a bond or a spacer having a main chain of 1 to 10 atoms:
Y is a spacer having a main chain of 1 to 6 atoms:
ring A is benzene ring which may be further substituted;
ring B is a 5- to 9-membered nitrogen-containing non-aromatic heterocyclic ring which may be further substituted; and R1 and R2 are the same or different and are hydrogen atom, a hydrocarbon group which may be substituted or a heterocyclic group which may be substituted: or R1 and R2, together with the adjacent nitrogen atom, may form a nitrogen-containing heterocyclic ring which may be substituted; or R2, together with the adjacent nitrogen atom and Y, may form a nitrogen-containing heterocyclic ring which may be substituted;
or a salt thereof, for the manufacture of a pharmaceutical preparation for preventing or treating diseases caused by a melanin-concentrating hormone.
40. Use of a compound represented by the formula:
a compound represented by the formula:
wherein R is hydrogen atom, a halogen atom or a cyclic group which may be substituted;
X is a bond or a spacer having a main chain of 1 to 10 atoms:
Yb is a spacer having a main chain of 1 to 6 atoms:
ring A is benzene ring which may be further substituted:
ring B is a 5- to 9-membered nitrogen-containing non-aromatic heterocyclic ring which may be further substituted: and R1 and R2 are the same or different and are hydrogen atom, a hydrocarbon group which may be substituted or a heterocyclic group which may be substituted; or R1 and R2, together with the adjacent nitrogen atom, may form a nitrogen-containing heterocyclic ring (except piperidine) which may be substituted: or R2, together with the adjacent nitrogen atom and Y, may form a nitrogen-containing heterocyclic ring which may be substituted;
provided that Yb is not -CO-(C(Ra)H)na- (Ra is hydrogen atom or a hydrocarbon group which may be substituted, na is an integer of 1 to 10):
or a salt thereof, for the manufacture of a pharmaceutical preparation for preventing or treating obesity.
CA002408913A 2000-05-16 2001-05-15 Melanin-concentrating hormone antagonist Abandoned CA2408913A1 (en)

Applications Claiming Priority (5)

Application Number Priority Date Filing Date Title
JP2000148647 2000-05-16
JP2000-148647 2000-05-16
JP2001-116219 2001-04-13
JP2001116219 2001-04-13
PCT/JP2001/004015 WO2001087834A1 (en) 2000-05-16 2001-05-15 Melanin-concentrating hormone antagonist

Publications (1)

Publication Number Publication Date
CA2408913A1 true CA2408913A1 (en) 2001-11-22

Family

ID=26592253

Family Applications (1)

Application Number Title Priority Date Filing Date
CA002408913A Abandoned CA2408913A1 (en) 2000-05-16 2001-05-15 Melanin-concentrating hormone antagonist

Country Status (5)

Country Link
US (1) US7229986B2 (en)
EP (1) EP1283199A4 (en)
AU (1) AU2001256733A1 (en)
CA (1) CA2408913A1 (en)
WO (1) WO2001087834A1 (en)

Families Citing this family (152)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP1310490A4 (en) * 2000-07-04 2004-03-17 Takeda Chemical Industries Ltd Gpr14 antagonist
WO2002004433A2 (en) 2000-07-06 2002-01-17 Neurogen Corporation Melanin concentrating hormone receptor ligands
US6706751B2 (en) * 2000-12-21 2004-03-16 Hoffman-La Roche Inc. Dihydroindole and tetrahydroquinoline derivatives
ES2319619T3 (en) 2001-05-04 2009-05-11 Amgen Inc. CONDENSED HETEROCICLIC COMPOUNDS.
US6809104B2 (en) 2001-05-04 2004-10-26 Tularik Inc. Fused heterocyclic compounds
KR20040012851A (en) 2001-05-22 2004-02-11 뉴로젠 코포레이션 Melanin concentrating hormone receptor ligands: substituted 1-benzyl-4-aryl piperazine analogues
ATE446286T1 (en) 2001-11-26 2009-11-15 Schering Corp PIPERIDINE MCH ANTAGONISTS AND THEIR USE IN THE TREATMENT OF OBESITY AND CENTRAL NERVOUS SYSTEM DISORDERS
CA2468015A1 (en) 2001-11-27 2003-06-05 Merck & Co., Inc. 2-aminoquinoline compounds
JP2005532991A (en) 2002-01-10 2005-11-04 ニューロジェン・コーポレーション Melanin-concentrating hormone receptor ligand: substituted 2- (4-benzyl-piperazin-1-ylmethyl)-and 2- (4-benzyl-diazepan-1-ylmethyl) -1H-benzimidazole analogs
JP2005526709A (en) 2002-01-10 2005-09-08 ニューロジェン・コーポレーション Melanin-concentrating hormone receptor ligand: substituted benzimidazole analogs
US7314937B2 (en) 2002-03-21 2008-01-01 Eli Lilly And Company Non-imidazole aryl alkylamines compounds as histamine H3 receptor antagonists, preparation and therapeutic uses
US7105526B2 (en) 2002-06-28 2006-09-12 Banyu Pharmaceuticals Co., Ltd. Benzimidazole derivatives
DE10238865A1 (en) * 2002-08-24 2004-03-11 Boehringer Ingelheim International Gmbh New carboxamides are melanin-concentrating hormone receptor antagonists, useful for treating e.g. metabolic diseases, diabetes, eating disorders, cardiovascular disease, emotional disorders, reproductive and memory disorders
US7351719B2 (en) 2002-10-31 2008-04-01 Boehringer Ingelheim Pharma Gmbh & Co. Kg Amide compounds having MCH-antagonistic activity and medicaments comprising these compounds
US7452911B2 (en) 2002-10-31 2008-11-18 Boehringer Ingelheim Pharma Gmbh & Co. Kg Alkyne compounds with MCH antagonistic activity and medicaments comprising these compounds
PL376659A1 (en) 2002-11-06 2006-01-09 Tularik Inc. Fused heterocyclic compounds
WO2004041266A1 (en) 2002-11-08 2004-05-21 Takeda Pharmaceutical Company Limited Receptor function controlling agent
GB0229820D0 (en) * 2002-12-20 2003-01-29 Glaxo Group Ltd Novel compounds
CA2509413C (en) * 2002-12-20 2012-05-01 Glaxo Group Limited Benzazepine derivatives for the treatment of neurological disorders
US7772188B2 (en) 2003-01-28 2010-08-10 Ironwood Pharmaceuticals, Inc. Methods and compositions for the treatment of gastrointestinal disorders
JPWO2004069798A1 (en) * 2003-02-10 2006-05-25 萬有製薬株式会社 Melanin-concentrating hormone receptor antagonist containing piperidine derivative as active ingredient
WO2004080411A2 (en) 2003-03-07 2004-09-23 Neurocrine Biosciences, Inc. Melanin-concentrating hormone receptor antagonists and compositions and methods related thereto
ATE547404T1 (en) 2003-09-22 2012-03-15 Msd Kk PIPERIDINE DERIVATIVES
BRPI0415051A (en) 2003-10-01 2006-11-28 Procter & Gamble melanin-concentrating hormone antagonist compounds and their pharmaceutical compositions
WO2005040824A2 (en) * 2003-10-24 2005-05-06 Bayer Healthcare Ag Diagnostics and therapeutics for diseases associated with g protein-coupled receptor 24 (gpr24)
ES2556244T3 (en) 2003-10-31 2016-01-14 Takeda Pharmaceutical Company Limited Solid preparation comprising pioglitazone, glimepiride and a polyoxyethylene sorbitan fatty acid ester
US7592373B2 (en) 2003-12-23 2009-09-22 Boehringer Ingelheim International Gmbh Amide compounds with MCH antagonistic activity and medicaments comprising these compounds
CN1930126A (en) 2004-03-05 2007-03-14 万有制药株式会社 Pyridone derivative
US7605176B2 (en) 2004-03-06 2009-10-20 Boehringer Ingelheim International Gmbh β-ketoamide compounds with MCH antagonistic activity
US7517910B2 (en) 2004-03-30 2009-04-14 Takeda Pharmaceutical Company Limited Alkoxyphenylpropanoic acid derivatives
WO2005097127A2 (en) 2004-04-02 2005-10-20 Merck & Co., Inc. Method of treating men with metabolic and anthropometric disorders
US7524862B2 (en) 2004-04-14 2009-04-28 Boehringer Ingelheim International Gmbh Alkyne compounds with MCH antagonistic activity and medicaments comprising these compounds
DE102004017934A1 (en) 2004-04-14 2005-11-03 Boehringer Ingelheim Pharma Gmbh & Co. Kg New alkyne compounds having MCH antagonist activity and medicaments containing these compounds
CA2568640C (en) 2004-06-04 2011-08-09 Teva Pharmaceutical Industries Ltd. Pharmaceutical composition containing irbesartan
WO2005123723A1 (en) * 2004-06-18 2005-12-29 Glaxo Group Limited 3-cycloalkylbenzazepines as histamine h3 antagonists
US20090156474A1 (en) 2004-11-01 2009-06-18 Amylin Pharmaceuticals, Inc. Methods for treating obesity and obesity related diseases and disorders
US8394765B2 (en) * 2004-11-01 2013-03-12 Amylin Pharmaceuticals Llc Methods of treating obesity with two different anti-obesity agents
EP1828207B1 (en) 2004-12-17 2009-10-28 Eli Lilly And Company Thiazolopyridinone derivates as mch receptor antagonists
SI1828177T1 (en) * 2004-12-17 2009-02-28 Lilly Co Eli Novel mch receptor antagonists
EP2332909B1 (en) 2005-04-13 2014-10-15 Astex Therapeutics Limited Hydroxybenzamide derivatives and their use as inhibitors of hsp90
CA2605778A1 (en) 2005-04-20 2006-10-26 Takeda Pharmaceutical Company Limited Fused heterocyclic compound
WO2006118320A1 (en) 2005-04-28 2006-11-09 Takeda Pharmaceutical Company Limited Thienopyrimidone compound
US7737155B2 (en) 2005-05-17 2010-06-15 Schering Corporation Nitrogen-containing heterocyclic compounds and methods of use thereof
NZ562766A (en) 2005-05-30 2011-03-31 Banyu Pharma Co Ltd Piperidine derivatives as histamine-H3 receptor antagonists
EP1897558B1 (en) 2005-06-09 2013-09-04 Norgine BV Solid preparation of 2-hexadecyloxy-6-methyl-4h-3,1-benzoxazin-4-one
CA2618112A1 (en) 2005-08-10 2007-02-15 Banyu Pharmaceutical Co., Ltd. Pyridone compound
EP2330125A3 (en) 2005-08-11 2012-12-12 Amylin Pharmaceuticals, Inc. Hybrid polypeptides with selectable properties
EP1922336B1 (en) 2005-08-11 2012-11-21 Amylin Pharmaceuticals, LLC Hybrid polypeptides with selectable properties
AU2006282260A1 (en) 2005-08-24 2007-03-01 Msd K.K. Phenylpyridone derivative
JP2007063225A (en) 2005-09-01 2007-03-15 Takeda Chem Ind Ltd Imidazopyridine compound
US20090264426A1 (en) 2005-09-07 2009-10-22 Shunji Sakuraba Bicyclic aromatic substituted pyridone derivative
BRPI0616463A2 (en) 2005-09-29 2011-06-21 Merck & Co Inc compound, pharmaceutical composition, and use of a compound
JP2009512715A (en) 2005-10-21 2009-03-26 ノバルティス アクチエンゲゼルシャフト Combination of renin inhibitor and anti-dyslipidemic agent and / or anti-obesity agent
AU2006307046A1 (en) 2005-10-27 2007-05-03 Msd K.K. Novel benzoxathiin derivative
BRPI0618354B8 (en) 2005-11-10 2021-05-25 Banyu Pharma Co Ltd compound and its use, pharmaceutical composition, preventive or medicine
GEP20105033B (en) 2005-12-28 2010-06-25 Takeda Pharmaceuticals Co Therapeutic agent for diabetes
US7754725B2 (en) 2006-03-01 2010-07-13 Astex Therapeutics Ltd. Dihydroxyphenyl isoindolymethanones
US20090281097A1 (en) 2006-04-14 2009-11-12 Takeda Pharmaceutical Company Limited Nitrogen-containing heterocyclic compound
PE20080344A1 (en) 2006-06-27 2008-06-09 Sanofi Aventis 8-AZABICYCLE COMPOUNDS [3.2.1] OCT-8-IL-1,2,3,4-TETRAHYDROQUINOLINE SUBSTITUTED AS INHIBITORS 11B-HSD1
EP2034018A4 (en) 2006-06-27 2010-02-10 Takeda Pharmaceutical Genetically modified animal and use thereof
FR2902790A1 (en) * 2006-06-27 2007-12-28 Sanofi Aventis Sa New N-(pyrrolidino- or piperidino-carbonyl)-tetrahydro-benzazines, are 11 beta-hydroxysteroid dehydrogenase type 1 modulators useful e.g. for treating obesity, diabetes or hypertension
PE20080212A1 (en) * 2006-06-27 2008-04-25 Sanofi Aventis UREAS DERIVATIVES OF PIPERIDINE OR PYRROLIDINE AS MODULATORS OF 11B-HYDROXIESTEROID DEHYDROGENASE TYPE 1 (11BHSD1)
ZA200900154B (en) 2006-06-27 2010-03-31 Takeda Pharmaceutical Fused cyclic compounds
US20100029619A1 (en) 2006-08-04 2010-02-04 Takeda Pharmaceutical Company Limted Fused heterocyclic compound
SG176477A1 (en) 2006-08-07 2011-12-29 Ironwood Pharmaceuticals Inc Indole compounds
WO2008039327A2 (en) 2006-09-22 2008-04-03 Merck & Co., Inc. Method of treatment using fatty acid synthesis inhibitors
JPWO2008038692A1 (en) 2006-09-28 2010-01-28 萬有製薬株式会社 Diaryl ketimine derivatives
EP2081891A2 (en) 2006-10-12 2009-07-29 Astex Therapeutics Limited Pharmaceutical compounds having hsp90 inhibitory or modulating activity
US8916552B2 (en) 2006-10-12 2014-12-23 Astex Therapeutics Limited Pharmaceutical combinations
US8883790B2 (en) * 2006-10-12 2014-11-11 Astex Therapeutics Limited Pharmaceutical combinations
GB0620259D0 (en) 2006-10-12 2006-11-22 Astex Therapeutics Ltd Pharmaceutical compounds
WO2008044054A2 (en) 2006-10-12 2008-04-17 Astex Therapeutics Limited Hydroxy-substituted benzoic acid amide compounds for use in therapy
WO2008044029A1 (en) 2006-10-12 2008-04-17 Astex Therapeutics Limited Pharmaceutical combinations
EP2298772A1 (en) 2006-10-18 2011-03-23 Takeda Pharmaceutical Company Limited Fused heterocyclic compounds
AU2007310064B2 (en) 2006-10-19 2013-03-28 Takeda Pharmaceutical Company Limited Indole compound
WO2008062905A2 (en) 2006-11-24 2008-05-29 Takeda Pharmaceutical Company Limited Heteromonocyclic compound and use thereof
JPWO2008090944A1 (en) 2007-01-25 2010-05-20 武田薬品工業株式会社 Spiro ring compound
JPWO2008093639A1 (en) 2007-01-29 2010-05-20 武田薬品工業株式会社 Pyrazole compounds
US20080186971A1 (en) * 2007-02-02 2008-08-07 Tarari, Inc. Systems and methods for processing access control lists (acls) in network switches using regular expression matching logic
EP2123652A1 (en) 2007-02-20 2009-11-25 Takeda Pharmaceutical Company Limited Heterocyclic compound
EP2145884B1 (en) 2007-04-02 2014-08-06 Msd K.K. Indoledione derivative
WO2008136428A1 (en) 2007-04-27 2008-11-13 Takeda Pharmaceutical Company Limited Nitrogen-containing five-membered heterocyclic compound
US8501750B2 (en) 2007-05-21 2013-08-06 Takeda Pharmaceutical Company Limited Heterocyclic compound and use thereof
CA3089569C (en) 2007-06-04 2023-12-05 Synergy Pharmaceuticals Inc. Agonists of guanylate cyclase useful for the treatment of gastrointestinal disorders, inflammation, cancer and other disorders
US8969514B2 (en) 2007-06-04 2015-03-03 Synergy Pharmaceuticals, Inc. Agonists of guanylate cyclase useful for the treatment of hypercholesterolemia, atherosclerosis, coronary heart disease, gallstone, obesity and other cardiovascular diseases
TW200914006A (en) 2007-07-12 2009-04-01 Takeda Pharmaceutical Coated preparation
WO2009011451A1 (en) 2007-07-19 2009-01-22 Takeda Pharmaceutical Company Limited Solid preparation comprising alogliptin and metformin hydrochloride
WO2009051244A1 (en) 2007-10-18 2009-04-23 Takeda Pharmaceutical Company Limited Heterocyclic compound
EP2210876B1 (en) 2007-11-01 2015-05-20 Takeda Pharmaceutical Company Limited Heterocyclic compound as glucagon antagonist
AU2007360979B2 (en) * 2007-11-14 2014-04-10 Amylin Pharmaceuticals, Llc Methods for treating obesity and obesity related diseases and disorders
EA201070835A1 (en) 2008-01-10 2011-02-28 Такеда Фармасьютикал Компани Лимитед COMPOSITION CAPSULES
GEP20135844B (en) 2008-03-05 2013-06-10 Takeda Pharmaceutical Heterocyclic compound
AU2009220605A1 (en) 2008-03-06 2009-09-11 Msd K.K. Alkylaminopyridine derivative
AU2009229860A1 (en) 2008-03-28 2009-10-01 Msd K.K. Diarylmethylamide derivative having antagonistic activity on melanin-concentrating hormone receptor
JPWO2009123194A1 (en) 2008-04-01 2011-07-28 武田薬品工業株式会社 Heterocyclic compounds
EP2264017A4 (en) 2008-04-04 2011-07-27 Takeda Pharmaceutical Heterocyclic derivative and use thereof
GB0806527D0 (en) 2008-04-11 2008-05-14 Astex Therapeutics Ltd Pharmaceutical compounds
EP2266983B1 (en) 2008-04-16 2013-06-05 Takeda Pharmaceutical Company Limited Nitrogenated 5-membered heterocyclic compound
WO2009145286A1 (en) 2008-05-30 2009-12-03 武田薬品工業株式会社 Heterocyclic compound
JP2011522828A (en) 2008-06-04 2011-08-04 シナジー ファーマシューティカルズ インコーポレイテッド Guanylate cyclase agonists useful for the treatment of gastrointestinal disorders, inflammation, cancer, and other disorders
US20110071129A1 (en) 2008-06-19 2011-03-24 Makoto Ando Spirodiamine-diaryl ketoxime derivative
EP2321341B1 (en) 2008-07-16 2017-02-22 Synergy Pharmaceuticals Inc. Agonists of guanylate cyclase useful for the treatment of gastrointestinal, inflammation, cancer and other disorders
EP2326625A1 (en) * 2008-07-18 2011-06-01 Takeda Pharmaceutical Company Limited Benzazepine derivatives and their use as hstamine h3 antagonists
EP2319841A1 (en) 2008-07-30 2011-05-11 Msd K.K. (5-membered)-(5-membered) or (5-membered)-(6-membered) fused ring cycloalkylamine derivative
US20110136788A1 (en) 2008-08-07 2011-06-09 Minoru Maruyama Therapeutic agent for irritable bowel syndrome
MX2011004258A (en) 2008-10-22 2011-06-01 Merck Sharp & Dohme Novel cyclic benzimidazole derivatives useful anti-diabetic agents.
EP2351743A4 (en) * 2008-10-27 2012-05-09 Takeda Pharmaceutical Bicyclic compound
KR101320245B1 (en) 2008-10-30 2013-10-30 머크 샤프 앤드 돔 코포레이션 Isonicotinamide orexin receptor antagonists
JP5557845B2 (en) 2008-10-31 2014-07-23 メルク・シャープ・アンド・ドーム・コーポレーション Novel cyclic benzimidazole derivatives useful as antidiabetic agents
EP2379547A1 (en) 2008-12-16 2011-10-26 Schering Corporation Pyridopyrimidine derivatives and methods of use thereof
WO2010075069A1 (en) 2008-12-16 2010-07-01 Schering Corporation Bicyclic pyranone derivatives as nicotinic acid receptor agonists
US8383647B2 (en) 2009-01-30 2013-02-26 Takeda Pharmaceutical Company Limited Quinoline derivative
ES2350077B1 (en) * 2009-06-04 2011-11-04 Laboratorios Salvat, S.A. INHIBITING COMPOUNDS OF 11BETA-HYDROXIESTEROID DEHYDROGENASE TYPE 1.
WO2011083316A1 (en) 2010-01-08 2011-07-14 Takeda Pharmaceutical Company Limited Benzazepine derivatives for the treatment of central nervous system disorders
UY33172A (en) 2010-01-08 2011-07-29 Takeda Pharmaceutical DERIVATIVES OF BENZAZEPINE AND ITS USE AS HISTAMINE ANTAGONISTS H3
WO2011083315A1 (en) 2010-01-08 2011-07-14 Takeda Pharmaceutical Company Limited Compounds and their use
EP2538784B1 (en) 2010-02-25 2015-09-09 Merck Sharp & Dohme Corp. Benzimidazole derivatives useful anti-diabetic agents
UY33354A (en) 2010-04-27 2011-12-01 Takeda Pharmaceutical BICYCLE COMPOUND AS ACC INHIBITOR
US9616097B2 (en) 2010-09-15 2017-04-11 Synergy Pharmaceuticals, Inc. Formulations of guanylate cyclase C agonists and methods of use
PE20140161A1 (en) 2010-11-30 2014-02-19 Takeda Pharmaceutical BICYCLE COMPOUND
AR084433A1 (en) 2010-12-22 2013-05-15 Ironwood Pharmaceuticals Inc FAAH INHIBITORS AND PHARMACEUTICAL COMPOSITIONS CONTAINING THEM
KR20150075120A (en) 2011-02-25 2015-07-02 머크 샤프 앤드 돔 코포레이션 Novel cyclic azabenzimidazole derivatives useful as anti-diabetic agents
TW201311679A (en) 2011-08-04 2013-03-16 Takeda Pharmaceutical Nitrogen-containing heterocyclic compound
TWI582084B (en) 2011-10-07 2017-05-11 武田藥品工業股份有限公司 Heterocyclic compounds
AR088352A1 (en) 2011-10-19 2014-05-28 Merck Sharp & Dohme ANTAGONISTS OF THE RECEIVER OF 2-PIRIDILOXI-4-NITRILE OREXINE
CN103998432A (en) 2011-10-24 2014-08-20 武田药品工业株式会社 Bicyclic compound
CA2864990C (en) 2012-02-24 2021-03-02 Nobuyuki Takakura Benzofuran and benzothiophene compounds for the inhibition of ghrelin o-acyltranferase (goat)
US9073864B2 (en) 2012-03-29 2015-07-07 Takeda Pharmaceutical Company Limted Aromatic ring compound
JP6299591B2 (en) 2012-07-03 2018-03-28 小野薬品工業株式会社 Compound having somatostatin receptor agonist activity and pharmaceutical use thereof
RU2015106909A (en) 2012-08-02 2016-09-27 Мерк Шарп И Доум Корп. ANTI-DIABETIC TRICYCLIC COMPOUNDS
US9296746B2 (en) 2012-10-16 2016-03-29 Takeda Pharmaceutical Company Limited Heterocyclic compound
ES2695350T3 (en) 2012-12-11 2019-01-03 Takeda Pharmaceuticals Co Heterocyclic compound
KR20150118158A (en) 2013-02-22 2015-10-21 머크 샤프 앤드 돔 코포레이션 Antidiabetic bicyclic compounds
US9605000B2 (en) 2013-03-14 2017-03-28 Takeda Pharmaceutical Company Limited Spiro azetidine isoxazole derivatives and their use as SSTR antagonists
EP2970119B1 (en) 2013-03-14 2021-11-03 Merck Sharp & Dohme Corp. Novel indole derivatives useful as anti-diabetic agents
EP2970384A1 (en) 2013-03-15 2016-01-20 Synergy Pharmaceuticals Inc. Agonists of guanylate cyclase and their uses
US9486494B2 (en) 2013-03-15 2016-11-08 Synergy Pharmaceuticals, Inc. Compositions useful for the treatment of gastrointestinal disorders
WO2014163162A1 (en) 2013-04-04 2014-10-09 武田薬品工業株式会社 Heterocyclic compound
JP6272832B2 (en) 2013-04-04 2018-01-31 武田薬品工業株式会社 Heterocyclic compounds
JP6606491B2 (en) 2013-06-05 2019-11-13 シナジー ファーマシューティカルズ インコーポレイテッド Ultra high purity agonist of guanylate cyclase C, method for producing and using the same
WO2015046482A1 (en) 2013-09-30 2015-04-02 小野薬品工業株式会社 Compound having agonistic activity to somatostatin receptor and medicinal use thereof
WO2015051496A1 (en) 2013-10-08 2015-04-16 Merck Sharp & Dohme Corp. Antidiabetic tricyclic compounds
WO2015190613A1 (en) 2014-06-09 2015-12-17 Takeda Pharmaceutical Company Limited Radiolabeled compounds
CA2959208C (en) 2014-08-29 2023-09-19 Tes Pharma S.R.L. Pyrimidine derivatives and their use as inhibitors of alpha-amino-beta-carboxymuconate-epsilon-semialdehyde decarboxylase
CN109952292A (en) 2016-10-14 2019-06-28 Tes制药有限责任公司 Pantonine-carboxyl muconic acid semialdehyde removes the inhibitor of carboxylic acid
EP3551176A4 (en) 2016-12-06 2020-06-24 Merck Sharp & Dohme Corp. Antidiabetic heterocyclic compounds
US10968232B2 (en) 2016-12-20 2021-04-06 Merck Sharp & Dohme Corp. Antidiabetic spirochroman compounds
EP3581569A4 (en) 2017-02-08 2020-02-19 ONO Pharmaceutical Co., Ltd. Compound having somatostatin receptor agonistic activity and pharmaceutical use thereof
JP2022507805A (en) 2018-11-20 2022-01-18 ティエエッセ ファルマ ソチエタ レスポンサビリタ リミタータ α-Amino-β-carboxymuconic acid semialdehyde decarboxylase inhibitor
WO2020167706A1 (en) 2019-02-13 2020-08-20 Merck Sharp & Dohme Corp. 5-alkyl pyrrolidine orexin receptor agonists
EP4010314B1 (en) 2019-08-08 2024-02-28 Merck Sharp & Dohme LLC Heteroaryl pyrrolidine and piperidine orexin receptor agonists
CA3189908A1 (en) 2020-08-18 2022-02-24 Stephane L. Bogen Bicycloheptane pyrrolidine orexin receptor agonists

Family Cites Families (111)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
DE1921737A1 (en) 1969-04-29 1970-11-12 Bayer Ag Sulfonylureas and sulfonylsemicarbazides containing heterocyclic acyl radicals with antidiabetic activity
FI49828C (en) * 1969-07-01 1975-10-10 Thomae Gmbh Dr K Process for the preparation of new sulphonylureas for lowering blood glucose.
DE1933388A1 (en) * 1969-07-01 1971-01-21 Thomae Gmbh Dr K New sulfonylureas and processes for their preparation
CH593263A5 (en) * 1974-02-22 1977-11-30 Hoffmann La Roche
US4170654A (en) 1976-02-13 1979-10-09 Merck & Co., Inc. Antihypertensive compositions containing N-heterocyclicalanines and α-
US4156734A (en) * 1976-02-13 1979-05-29 Merck & Co., Inc. Antihypertensive compositions containing an aryl-substituted alanine azo and an arylhydrazino-propionic acid
US4160835A (en) 1976-11-19 1979-07-10 Merck & Co., Inc. Antihypertensive compositions containing an arylsubstituted alanine and a phenyl hydrazinopropionic acid
JPS5465184A (en) 1977-11-02 1979-05-25 Sony Corp Production of oxidizing agent
EP0002792A1 (en) * 1978-01-03 1979-07-11 Sandoz Ag 3-Aminopropoxyaryl derivatives, their preparation and pharmaceutical compositions containing them
DE2934609A1 (en) 1979-08-28 1981-03-12 Cassella Ag, 6000 Frankfurt TETRAHYDROCHINOLIN DERIVATIVES, METHOD FOR THE PRODUCTION THEREOF, THEIR USE AND PHARMACEUTICAL PREPARATIONS CONTAINING THE SAME.
DE3034237A1 (en) 1979-09-18 1981-04-16 Otsuka Pharmaceutical Co. Ltd., Tokyo CARBOSTYRIL DERIVATIVES, METHOD FOR THE PRODUCTION THEREOF AND ANTIHISTAMINICALLY ACTIVE AGENTS CONTAINING THESE COMPOUNDS
US4242346A (en) * 1979-12-19 1980-12-30 Smithkline Corporation Bis-2N-alkylene tetrahydroisoquinoline compounds
US4315935A (en) 1980-04-14 1982-02-16 Smithkline Corporation N,N'-Bis[substituted-1,2,3,4-tetrahydroisoquinolinolyl]disulfonylimides and antiallergic compositions and method of use
JPS5846515B2 (en) * 1980-04-19 1983-10-17 帝国化学産業株式会社 Method for producing indole derivatives
GB2083392A (en) 1980-09-08 1982-03-24 Graham Douglas Ian Wrench with rapid rotation facility
FR2591595B1 (en) * 1985-12-13 1988-09-09 Roussel Uclaf NOVEL 4-MORPHOLINYL 1H-INDOLE DERIVATIVES, SALTS THEREOF, PROCESS FOR THEIR PREPARATION, APPLICATION AS MEDICAMENTS, COMPOSITIONS CONTAINING THEM, AND INTERMEDIATES
DE3600390A1 (en) 1986-01-09 1987-07-16 Hoechst Ag DIARYLALKYL-SUBSTITUTED ALKYLAMINE, METHOD FOR THE PRODUCTION THEREOF, THEIR USE AND MEDICINAL PRODUCTS CONTAINING THE SAME
DE3633977A1 (en) 1986-10-06 1988-04-07 Cassella Ag TETRAHYDROQUINOL DERIVATIVES, A METHOD FOR THE PRODUCTION THEREOF, THEIR USE AND PHARMACEUTICAL PREPARATIONS CONTAINING THE SAME
JPS63290821A (en) 1987-05-25 1988-11-28 Otsuka Pharmaceut Co Ltd Antiarrhythmic
GB8717374D0 (en) 1987-07-22 1987-08-26 Smith Kline French Lab Pharmaceutically active compounds
JPH0262875A (en) 1988-05-23 1990-03-02 Wakunaga Pharmaceut Co Ltd Novel isoindoline derivative
US5280032A (en) 1989-02-14 1994-01-18 Toyama Chemical Co., Ltd. 1,2-ethanediol derivative and salt thereof, process for producing the same, and cerebral function-improving agent comprising the same
NZ232493A (en) 1989-02-14 1992-06-25 Toyama Chemical Co Ltd Aryl- or heterocyclyl-substituted 1,2-ethanediol derivatives and pharmaceutical compositions
JPH04506967A (en) * 1989-07-27 1992-12-03 ジー．ディー．サール　アンド　カンパニー Renal selective products for the treatment of hypertension
US4963563A (en) 1989-10-13 1990-10-16 Abbott Laboratories 6-substituted-1,2,3,4-tetrahydroisoquinolines
JPH03181478A (en) * 1989-12-08 1991-08-07 Banyu Pharmaceut Co Ltd Pyridinecarboxylic acid derivative
GR1001322B (en) 1990-04-06 1993-08-31 Panagiotis Anagnostopoulos Mechanism for wire bending machines
KR900016822A (en) * 1990-04-20 1990-11-14 하라 레이노스께 Slide projector
US5173497A (en) 1990-05-17 1992-12-22 Hoechst-Roussel Pharmaceuticals Incorporated Alpha-oxopyrrolo[2,3-B]indole acetic acids, esters, amides and related analogs
AU634380B2 (en) * 1990-05-17 1993-02-18 Hoechst-Roussel Pharmaceuticals Incorporated Alpha-oxopyrrolo(2,3-b)indole acetic acids, esters, amides and related analogs, a process for their preparation and their use as medicaments
US5264587A (en) 1990-05-17 1993-11-23 Hoechst-Roussel Pharmaceuticals Incorporated Method of preparing α-oxopyrrolo[2,3-b]indole acetic acids and derivatives
JP3044055B2 (en) 1990-08-09 2000-05-22 富山化学工業株式会社 1,2-ethanediol derivatives and salts thereof
ATE187455T1 (en) 1990-08-14 1999-12-15 Chugai Pharmaceutical Co Ltd METHOTREXATE DERIVATIVES WITH ANTIRHEUMATIC ACTIVITY
GB9020338D0 (en) 1990-09-18 1990-10-31 Lilly Industries Ltd Pharmaceutical compounds
US5151435A (en) * 1991-04-08 1992-09-29 Merck & Co., Inc. Angiotensin ii antagonists incorporating an indole or dihydroindole
US5175164A (en) 1991-06-05 1992-12-29 Merck & Co., Inc. Angiotensin ii antagonists incorporating a substituted indole or dihydroindole
JPH0717612B2 (en) * 1991-06-28 1995-03-01 ファイザー製薬株式会社 Novel tetrahydrobenzazepine derivative
DE4127404A1 (en) 1991-08-19 1993-02-25 Thomae Gmbh Dr K CYCLIC IMINODERIVATES, MEDICAMENTS CONTAINING SUCH COMPOUNDS AND METHOD FOR THE PRODUCTION THEREOF
US5288749A (en) 1991-12-20 1994-02-22 Abbott Laboratories Tertiary and secondary amines as alpha-2 antagonists and serotonin uptake inhibitors
CA2128205C (en) * 1992-01-27 2004-03-30 Hiroharu Matsuoka Methotrexate derivatives
PH31294A (en) * 1992-02-13 1998-07-06 Thomae Gmbh Dr K Benzimidazolyl derivatives, pharmaceutical compositions containing these compounds and process for preparing them.
JP3281099B2 (en) * 1992-02-13 2002-05-13 中外製薬株式会社 Anti-rheumatic drug
TW218875B (en) * 1992-03-09 1994-01-11 Takeda Pharm Industry Co Ltd
US5462934A (en) 1992-03-09 1995-10-31 Takeda Chemical Industries Condensed heterocyclic ketone derivatives and their use
US5538973A (en) 1992-03-27 1996-07-23 Kyoto Pharmaceutical Industries, Ltd. Imidazole derivative, pharmaceutical use thereof, and intermediate therefor
WO1993020065A1 (en) * 1992-03-27 1993-10-14 Kyoto Pharmaceutical Industries, Ltd. Novel imidazole derivative, pharmaceutical use thereof, and intermediate therefor
US5541218A (en) 1992-07-23 1996-07-30 Pfizer Inc. Indolinyl N-hydroxyurea and N-hydroxamic acid derivatives as lipoxygenase inhibitors
JP2661841B2 (en) * 1992-07-23 1997-10-08 ファイザー製薬株式会社 Indoline derivatives
US5374643A (en) 1992-09-11 1994-12-20 E. R. Squibb & Sons, Inc. Aryl urea (thiourea) and cyanoguanidine derivatives
TW270927B (en) 1992-10-16 1996-02-21 Otsuka Pharma Co Ltd
JP2913082B2 (en) 1992-10-16 1999-06-28 大塚製薬株式会社 Vasopressin antagonist and oxytocin antagonist
DE69319551T2 (en) 1992-12-02 1998-10-29 Kissei Pharmaceutical Indoline compounds used to treat dysurias
DE4326465A1 (en) 1993-01-20 1995-02-09 Thomae Gmbh Dr K Amino acid derivatives, pharmaceutical compositions containing these compounds and process for their preparation
TW242557B (en) * 1993-02-18 1995-03-11 Ciba Geigy
JP3213426B2 (en) * 1993-02-19 2001-10-02 エーザイ株式会社 6,7-dihydro-5H-cyclopenta [d] pyrimidine derivative
US5387685A (en) 1993-07-16 1995-02-07 American Cyanamid Co MDR reversal agents
US5547966A (en) 1993-10-07 1996-08-20 Bristol-Myers Squibb Company Aryl urea and related compounds
GB9322976D0 (en) 1993-11-08 1994-01-05 Pfizer Ltd Therapeutic agents
DE69411589T2 (en) * 1993-12-21 1999-01-07 Smithkline Beecham Plc INDOL, INDOLIN AND CHINOLIN DERIVATIVES WITH A 5HT1D ANTAGONISTIC EFFECT
WO1995020950A1 (en) * 1994-02-03 1995-08-10 Cambridge Neuroscience, Inc. Therapeutic guanidines
US6143791A (en) 1994-02-03 2000-11-07 Cambridge Neuroscience, Inc. Therapeutic guanidines
MX9605366A (en) 1994-05-07 1997-12-31 Astra Ab Bicyclic amidine derivatives as inhibitors of nitric oxide synthetase.
JP3331047B2 (en) * 1994-06-01 2002-10-07 キッセイ薬品工業株式会社 Indoline derivatives
JP3331048B2 (en) * 1994-06-01 2002-10-07 キッセイ薬品工業株式会社 Indole derivatives
GB9416972D0 (en) 1994-08-23 1994-10-12 Smithkline Beecham Plc Carbon side chain/indole/indolene
CA2199855A1 (en) * 1994-09-16 1996-03-21 Ryosuke Ushijima Novel carbapenem derivative
GB9424708D0 (en) * 1994-12-07 1995-02-01 Bristol Myers Squibb Co Use of inflammatory modulators in the treatment of chronic or recalcitrant skin damage
US5631280A (en) 1995-03-29 1997-05-20 Merck & Co., Inc. Inhibitors of farnesyl-protein transferase
WO1996035713A1 (en) * 1995-05-08 1996-11-14 Pfizer, Inc. Dipeptides which promote release of growth hormone
WO1996038471A1 (en) 1995-05-29 1996-12-05 Pfizer Inc. Dipeptides which promote release of growth hormone
GB9511355D0 (en) * 1995-06-06 1995-08-02 Fujisawa Pharmaceutical Co Urea derivatives
SK281442B6 (en) * 1995-08-10 2001-03-12 Astra Aktiebolag Bicyclic amidine derivatives, method of preparing thereof, pharmaceutical compositions containing theses derivatives and their use
US5767129A (en) 1995-08-24 1998-06-16 Warner-Lambert Company Substituted quinolines and isoquinolines as calcium channel blockers, their preparation and the use thereof
GB9519077D0 (en) 1995-09-18 1995-11-15 Fujisawa Pharmaceutical Co New heterocyclic compounds
EP0801060A1 (en) 1996-04-09 1997-10-15 Pfizer Inc. Heterocyclic Beta-3 Adrenergenic Agonists
KR19990087814A (en) * 1996-04-24 1999-12-27 다케다 야쿠힌 고교 가부시키가이샤 And a fused imidazopyridine derivative as an anti-lipoprotein
WO1997043305A1 (en) * 1996-05-14 1997-11-20 Agouron Pharmaceuticals, Inc. Inhibitors of picornavirus 3c proteases and methods for their use and preparation
US5856530A (en) 1996-05-14 1999-01-05 Agouron Pharmaceuticals, Inc. Antipicornaviral compounds and methods for their use and preparation
JP2000512646A (en) * 1996-06-25 2000-09-26 スミスクライン・ビーチャム・パブリック・リミテッド・カンパニー Sulfonamide derivatives as 5HT7 receptor antagonists
JP2000517301A (en) * 1996-08-14 2000-12-26 スミスクライン・ビーチャム・パブリック・リミテッド・カンパニー Tetrahydroisoquinoline derivatives and their pharmacological uses
JP3226100B2 (en) 1996-08-22 2001-11-05 同和薬品工業株式會社 Arylsulfonylimidazolone derivatives as antitumor agents
SK71299A3 (en) * 1996-12-13 2000-12-11 Rhone Poulenc Rorer Pharma Sulfonic acid or sulfonylamino n-(heteroaralkyl)-azaheterocyclylamide compounds
US6602864B1 (en) * 1996-12-13 2003-08-05 Aventis Pharma Deutschland Gmbh Sulfonic acid or sulfonylamino N-(heteroaralkyl)-azaheterocyclylamide compounds
US6004977A (en) 1996-12-27 1999-12-21 Hoechst Marion Roussel, Inc. N-(pyridinylamino) isoindolines and related compounds
BR9714189A (en) * 1996-12-27 2000-02-29 Hoechst Marion Roussel Inc N- (pyridinylamino) isoindolines and related compounds
AU6852898A (en) * 1997-04-17 1998-11-11 Takeda Chemical Industries Ltd. Thermogenic composition and benzazepine thermogenics
WO1998050346A2 (en) * 1997-04-18 1998-11-12 Smithkline Beecham Plc Acetamide and urea derivatives, process for their preparation and their use in the treatment of cns disorders
IL123986A (en) 1997-04-24 2011-10-31 Organon Nv Serine protease inhibiting antithrombotic agents and pharmaceutical compositions comprising them
DE19727117A1 (en) * 1997-06-26 1999-01-07 Boehringer Ingelheim Pharma Phenylalkyl derivatives, pharmaceutical compositions containing them and processes for their preparation
WO1999033798A1 (en) * 1997-12-25 1999-07-08 Yamanouchi Pharmaceutical Co., Ltd. Nitrogenous heterocyclic derivatives
PL342477A1 (en) * 1998-02-27 2001-06-04 Kissei Pharmaceutical Derivatives of indole and pharmacological compositions containing them
GB9804734D0 (en) 1998-03-05 1998-04-29 Pfizer Ltd Compounds
JP4327915B2 (en) * 1998-03-30 2009-09-09 株式会社デ・ウエスタン・セラピテクス研究所 Sulfonamide derivatives
CN1323295A (en) * 1998-08-26 2001-11-21 阿文蒂斯药物有限公司 AZA-bicycles which modulate the inhibition of cell adhesion
WO2000012074A2 (en) * 1998-08-28 2000-03-09 Scios Inc. Use of piperidines and/or piperazines as inhibitors of p38-alpha kinase
FR2783519B1 (en) * 1998-09-23 2003-01-24 Sod Conseils Rech Applic NOVEL AMIDINE DERIVATIVES, THEIR PREPARATION, THEIR USE AS MEDICAMENTS AND THE PHARMACEUTICAL COMPOSITIONS CONTAINING THEM
ATE316969T1 (en) * 1998-10-08 2006-02-15 Smithkline Beecham Plc TETRAHYDROBENZAZEPINE DERIVATIVES USABLE AS DOPAMINE D3 RECEPTOR MODULATORS (ANTIPSYCHOTIC AGENTS)
AU6123699A (en) * 1998-10-16 2000-05-08 Takeda Chemical Industries Ltd. Nitrogenous fused heterocycle compounds, process for the preparation thereof andagents containing the same
TWI274750B (en) * 1999-01-12 2007-03-01 Abbott Gmbh & Co Kg Triazole compounds showing high affinity to dopamine D3 receptor and pharmaceutical composition comprising the same
GB9909409D0 (en) * 1999-04-24 1999-06-23 Zeneca Ltd Chemical compounds
JP2000321732A (en) * 1999-05-07 2000-11-24 Fuji Photo Film Co Ltd Silver halide color photographic sensitive material and image forming method
JP2000321736A (en) 1999-05-07 2000-11-24 Fuji Photo Film Co Ltd Silver halide color photographic sensitive material and image forming method
GB9929552D0 (en) * 1999-12-14 2000-02-09 Proteus Molecular Design Compounds
CA2383008A1 (en) * 1999-06-14 2000-12-21 Amanda Jane Lyons Compounds
DE19927415A1 (en) * 1999-06-16 2000-12-21 Bayer Ag Indolinyl urea derivatives
CN1454211A (en) * 1999-07-16 2003-11-05 布里斯托尔-迈尔斯斯奎布药品公司 Nitrogen containing heterobicycles as factor xa inhibitors
DE19934272A1 (en) * 1999-07-21 2001-01-25 Bayer Ag New N-phenyl-tetrahydroisoquinoline-sulfonamide derivatives are antiviral agents especially useful for treating cytomegalovirus infections
AU6762400A (en) * 1999-08-12 2001-03-13 Cor Therapeutics, Inc. Inhibitors of factor xa
CA2383147A1 (en) * 1999-09-20 2001-03-29 Takeda Chemical Industries, Ltd. Mch antagonists
EP1218358B1 (en) * 1999-09-23 2006-09-13 AstraZeneca AB Therapeutic quinazoline compounds
ES2234683T3 (en) * 1999-11-05 2005-07-01 Smithkline Beecham Plc ISOQUINOLINE AND QUINAZOLINE DERIVATIVES WITH COMBINED ACTIVITY ON THE 5HT1A, 5HT1B AND 5HT1D RECEPTORS.

Also Published As

Publication number Publication date
US7229986B2 (en) 2007-06-12
EP1283199A4 (en) 2003-12-17
WO2001087834A1 (en) 2001-11-22
US20030158177A1 (en) 2003-08-21
AU2001256733A1 (en) 2001-11-26
EP1283199A1 (en) 2003-02-12

Similar Documents

Publication Publication Date Title
US7229986B2 (en) Melanin-concentrating hormone antagonist
CA2407149C (en) Melanin-concentrating hormone antagonist
US7115750B1 (en) Melanin concentrating hormone antagonist
US7183415B2 (en) Quinoline compound
CA2383147A1 (en) Mch antagonists
JP2002003370A (en) Melanin coagulating hormone antagonistic agent
WO2001025228A1 (en) Amine derivatives
US20050245571A1 (en) Amine derivative
JP2004523530A (en) Piperazine and piperidine derivatives as melanocortin receptor agonists
JP2002526477A (en) 4-carboxyamino-2-methyl-1,2,3,4-tetrahydroquinolines as CETP inhibitors
JP2008546711A (en) Hexahydro-pyrrolo-isoquinoline compounds for the treatment of CNS disorders
JP2002371059A (en) Melanin-agglutinating hormone antagonist
CA2506735A1 (en) Indole derivatives as somatostatin agonists or antagonists
JP2002241274A (en) Melamine-aggregating hormone antagonist
JP4408618B2 (en) Quinoline compounds
WO1997011054A1 (en) Benzoic acid compounds and medicinal use thereof
ES2349624T3 (en) ANTAGONISTS OF THE HORMONE THAT CONCENTRATES THE MELANINE.
JP4630555B2 (en) Amine derivatives
JP2004300133A (en) Amine derivative
JP2002097138A (en) Mch(melanin-concentrating hormone) antagonist
JP2002348287A (en) Amine derivative
JP2003192682A (en) Amine derivative
JP2002088079A (en) Amine derivative
WO2002016350A1 (en) Amine derivatives
JP2006104208A (en) Agent for prevention and treatment of urinary disturbance

Legal Events

Date Code Title Description
EEER Examination request
FZDE Dead