WO2014114771A1

WO2014114771A1 - Method for obtaining stable transformants of microalgae of the genus chlorella

Info

Publication number: WO2014114771A1
Application number: PCT/EP2014/051448
Authority: WO
Inventors: Aude Carlier; Remy Michel
Original assignee: Algenics's
Priority date: 2013-01-24
Filing date: 2014-01-24
Publication date: 2014-07-31
Also published as: FR3001228A1; EP2956546A1

Abstract

The invention relates to a method for obtaining a stable transformant of microalgae of the genus Chlorella, as well as expression vectors and microalgae of the genus Chlorella comprising said expression vectors.

Description

PROCESS FOR OBTAINING STABLE TRANSFORMANTS

OF MICROALGUES OF THE GENUS CHLORELLA

The industrial potential of microalgae in terms of applications related to energy, health, cosmetics, food and the environment are particularly important.

Due in particular to the controversies related to first-generation biofuels, the technical and economic limits that hinder second-generation biofuels, the production of biofuels from microalgae has undergone significant global development over the last five years.

Biogas is also another form of energy that can be derived from microalgae.

The field of cosmetics aims to integrate more and more natural ingredients, including oils, pigments from microalgae.

The food industry, also incorporates molecules from microalgae, mainly dyes. Microalgae also offer interesting opportunities in the field of food supplements and nutraceuticals.

Microalgae are widely used in animal feed, especially for fish fry food but also for fattening food.

Companies such as biotechnology or pharmaceuticals also need systems of production of molecules of interest that meet their requirements in terms of quality, quantity of molecules produced and profitability. This sector is booming. Since the late 1990s, more than 280 therapeutic recombinant proteins have been commercialized.

For several years, microalgae have been proposed as a production system of interest molecules as an alternative to bacterial expression systems, in yeasts, insect cells or in plant cells. However, there are many technical constraints to such use of which one of the major points is the obtaining of stable transformants.

Among the various microalgae existing, those of the genus Chiorella are particularly interesting for the different industrial applications. Indeed, microalgae of the genus Chiorella can be cultivated on a large scale at low cost under different cultivation methods: autotrophy, mixotrophy or heterotrophy. Their culture can be carried out in conventional fermenters already present on industrial sites. Advantageously, in heterotrophic culture, the carbon source may be a co-product of an industrial sector. It should be noted that microalgae of the genus Chiorella are among the microalgae with the best productivities. In addition, the composition of different microalgae algae of the genus Chiorella is particularly interesting for certain industrial applications: for example their high oil content makes it possible to use them advantageously to produce biofuels, and high protein content allows their use in animal feed. In addition, microalgae of the genus Chlorella are of interest for producing recombinant proteins because of their eukaryotic characteristics, including their ability to perform post-translational modifications such as N-glycosylation.

However, data from the literature (Chow et al., 1999, Rakkhumkaew et al.

2012) show instability of transgenes in microalgae of the genus Chlorella, thus preventing their use on an industrial scale as a system for expressing molecules of interest.

The objective of the present invention is therefore to have available a process for obtaining stable transformants of microalgae of the Chlorella genus, thus allowing their use as a production system of substances of interest at the industrial level.

The inventors have surprisingly demonstrated that the presence of at least one endogenous nucleic acid sequence of the nuclear genome of a microalgae of the Chlorella genus in a transformation vector (in particular an expression vector), in particular two fragments of the gene sequence encoding the 18S rRNA, makes it possible to obtain particularly stable transformants of Chlorella microalgae, at least up to seventeen successive subcultures, after cryopreservation, in the presence or in the absence of selection agent.

Thus, according to a first aspect, the subject of the invention is a process for obtaining a stable microalgae transformant of the Chlorella genus comprising the following steps:

(i) transforming the nuclear genome of a Chlorella microalgae by an expression vector comprising:

an expression cassette, in particular heterologous; and

an endogenous nucleic acid sequence of the nuclear genome of said microalgae of the genus Chlorella and / or a nucleic acid stabilizer sequence having at least 80% identity, in particular at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, with said endogenous stabilizing nucleic acid sequence throughout the length of said sequence; said endogenous stabilizing nucleic acid sequence being from 10bp to 300kbp in length; and

(ii) selection of a stable transformant.

The process according to the invention has the following advantages:

It allows the production of molecules of interest in a system particularly adapted to industrial scale: high productivity, low costs, uses of industrial fermenters, possibility of different modes of culture (in autotrophy, mixotrophy or heterotrophy), possibility of 'the use of industrial co-product as a carbon source in heterotrophic culture;

It allows the production of substances of interest, in particular by modifying the metabolic pathways by genetic engineering. In particular, the method according to the invention thus allows the production of enzymes involved in the metabolism of lipids leading to the production and accumulation of specific lipids;

It allows the production of recombinant molecules in a system with eukaryotic properties; Indeed, microalgae of the genus Chlorella have the capacity to perform post-translational modifications such as N-glycosylation. In particular, the process according to the invention thus makes it possible to produce glycosylated proteins, in particular of therapeutic interest, such as monoclonal antibodies, viral envelope proteins and lysosomal enzymes.

In order to allow a better understanding of the present invention, certain definitions are provided. Unless otherwise indicated, the other technical terms used in this application must be interpreted in their usual meaning.

For the purpose of the present invention, the term "transformant" means any organism, in particular a microalgae of the genus Chlorella, resulting from a genetic transformation.

The term "stable microalgae transformant of the genus Chlorella" within the meaning of the present invention is understood to mean a microalgae transformant of the genus Chlorella in which the presence of the transformation vector (in particular the expression vector according to the invention by which said microalgae of the genus Chlorella in the process for obtaining a stable transformant according to the invention) and / or transgene optionally included in the transformation vector and / or the expression cassette possibly included in the transformation vector is detected after at least 4 successive transplants, in particular at least 10 successive transplants, more particularly at least 1 5 successive transplants and especially at least 17 successive transplants, in particular after culture of the transformant after cryopreservation and / or without selection agent, in particular in autotrophy, mixotrophy or heterotrophy. The detection of the transformation vector and / or the transgene can be carried out according to all techniques well known to those skilled in the art, such as PCR (Polymerase Chain Reaction) using primers specific to the transformation vector and / or the transgene and / or expression cassette.

The term "transformation vector" in the sense of the present invention, any vector by which is transformed an organism, including a microalgae of the genus Chlorella. In particular, the transformation vector is the expression vector according to the invention by which said microalga of the genus Chlorella is transformed in the process for obtaining a stable transformant according to the invention.

For the purposes of the present invention, the term "transgene" means any molecule of nucleic acid, in particular any gene, intended to be introduced into an organism, in particular a microalgae of the genus Chlorella. In particular, the transgene is a DNA sequence encoding a substance of interest and included in the heterologous expression cassette according to the invention. The term "successive subculture" in the sense of the present invention, the removal of at least one microalgae of the Chlorella genus from an initial culture medium and culturing thereof in a culture medium identical to or different from the initial medium. In particular, successive subcultures can be carried out by subculturing the culture in a fresh medium every 2 to 3 weeks, at the same cell concentration or at a different cell concentration, in the same medium or in a culture medium different from the medium. initial.

The term "microalgae of the genus Chlorella" within the meaning of the present invention means any microalgae belonging to the genus Chlorella. For example, microalgae of the genus Chlorella may be selected from the group consisting of Chlorella alternans (Tetrachlorella), Chlorella angustoellipsoidea, Chlorella anitrata, Chlorella anitrata var. minor, Chlorella antarctica, Chlorella autotrophica, Chlorella autotrophica var. atypica, Chlorella beijerinckii (Parachlorella), Chlorella capsulata, Chlorella conductrix (Brandt) Beijerinck, Chlorella desiccata, Chlorella ellipsoidea, Chlorella emersonii, Chlorella emersonii var. globosa, Chlorella fusca var. vacuolata, Chlorella hainangensis (Heveochlorella), Chlorella kessleri (Parachlorella), Chlorella lobophora, Chlorella luteoviridis (Heterochlorella), Chlorella marina, Chlorella miniata, Chlorella minutissima, Chlorella mirabilis, Chlorella ovalis, Chlorella parasitica (Brandt) Beijerinck, Chlorella parva, Chlorella pringsheimii (Pseudochlorella), Chlorella protothecoids (auxenochlorella), Chlorella protothecoids var. communis (auxenochlorella), Chlorella pyrenoidosa, Chlorella pyrenoidosa (Pseudochlorella), Chlorella regularis var. minima, Chlorella reisiglii, Chlorella saccharophila, Chlorella saccharophila var. saccharophila, Chlorella saccharophila var. ellipoida, Chlorella salina, Chlorella sorokiniana, Chlorella spaerckii, Chlorella species, Chlorella sphaerica, Chlorella stigmatophora, Chlorella variabilis, Chlorella variegata Beijerinck, Chlorella viscosa, Chlorella vulgaris, Chlorella vulgaris fo. Tertia, Chlorella vulgaris fo. Viridis, Chlorella vulgaris Beijerinck, Chlorella xanthella Beijernick, Chlorella zofingiensis, especially Chlorella protothecoids and Chlorella sorokiniana, especially Chlorella protothecoids.

For the purpose of the present invention, the term "nuclear genome transformation" is understood to mean any technique making it possible to introduce nucleic acid molecules into the nucleus of a receptor organism, in particular a microalgae of the genus Chlorella. Examples of techniques for transforming the nuclear genome of a microalgae of the genus Chlorella include electroporation (Maruyama et al., 1994), techniques using PEG (polyethylene glycol) (Jarvis and Brown, 1991). ), techniques using Agrobacterium (Cha et al., 2012), biolistics. Some of these techniques are illustrated in the examples of this application.

In particular, the step (i) of transforming the nuclear genome of a microalga of the Chlorella genus is implemented by biolistics.

During step (i) of transformation of the nuclear genome of a microalga of the Chlorella genus, the expression vector may be in circular or linear form.

Prior to step (i) of transforming the nuclear genome of a microalgae of the genus Chlorella, the method according to the invention may comprise a step of preparing protoplasts of said microalgae of the genus Chlorella. So step (i) of nuclear genome transformation of a microalgae of the genus Chlorella can be carried out on intact cells or on protoplasts of a microalgae of the genus Chlorella. The stage of preparation of protoplasts of a microalgae of the Chlorella genus may be carried out according to any technique well known to those skilled in the art such as that described in the article by Lu et al. , 201 1.

The step (ii) of selecting a stable transformant can be implemented, in particular by detecting the presence of the expression vector and / or the expression cassette in the transformant, after at least 4 successive subcultures. , in particular at least 10 successive transplants, more particularly at least 1 5 successive transplants and especially at least 17 successive subcultures, especially after culture of the transformant after cryopreservation and / or without selection agent, especially in autotrophy, mixotrophy or heterotrophy. The detection of the presence of the expression vector and / or the expression cassette in the transformant making it possible to validate the stability of the transformant can be done according to any technique well known to a person skilled in the art, such as by PCR (" Polymerase Chain Reaction ") using primers specific for the expression vector and / or the expression cassette. This detection of the expression vector and / or the expression cassette in the transformant is advantageously carried out after each subculture.

By way of example, the step (ii) of selecting a stable microalgae transformant of the Chlorella genus may be carried out as follows: after 1 to 21 days of culture, the potentially transformed clones of the microalgae of the Chlorella species that develop on selection agar plates are transplanted a first time on a fresh medium supplemented with selection agent. The clones are then regularly transplanted onto selection agar plates and, as soon as the third subculture is taken, they are also placed in a liquid medium in the presence of a selection agent. After 4 successive subcultures, the clones are both subcultured on media with and without a selection agent. After 5 rounds of subculture, the clones are placed in culture, in particular in heterotrophic conditions, with and without a selection agent. The monitoring of the detection of the transformation vectors (expression vectors according to the invention) and / or transgenes (nucleic acid sequences of interest according to the invention) is carried out after each transplanting and this in order to define the stability detection of the transformation vectors (expression vectors according to the invention) and / or transgenes (nucleic acid sequences of interest according to the invention) in the genome of the transformed microalgae. The integration of the transformation vectors (expression vectors according to the invention) and / or transgenes (nucleic acid sequences of interest according to the invention) into the genome of microalgae of the genus Chlorella and the stability of the integration are verified by PCR amplification on the transformed clones obtained for the microalgae, subcultured in culture media with and without a selection agent, grown under standard culture conditions and in particular under heterotrophic conditions. According to a particular embodiment, the detection of the integration of the transformation vectors (expression vectors according to the invention) and / or transgenes (nucleic acid sequences of interest according to the invention) into the genome of the Microalgae of the Chlorella genus and the stability of the integration can be checked after cryopreservation: Thus, the transformed clones of microalgae of the Chlorella genus can be cryopreserved at -80 ° C .; in order to validate the stability of the integration of the transgenes (nucleic acid sequences of interest according to the invention) into the genome of the microalgae, PCR analyzes are performed on cultures from cryopreserved clones for at least 2 months.

For the purposes of the present invention, the term "expression vector" is intended to mean any vector that makes it possible to express a molecule of nucleic acids in an organism, in particular a microalgae of the genus Chlorella. The expression vector may be viral such as bacteriophages or non-viral such as plasmids.

For the purposes of the present invention, the term "expression cassette" is understood to mean a fragment of nucleic acids, in particular DNA which can be inserted into a vector at specific restriction sites, said fragment comprising the sequences necessary for the expression of expression (enhancer (s), promoter (s), terminator (s), polyadenylation sequence ...) of a sequence of interest. The fragment and the restriction sites are designed to insure insertion of said fragment into a vector in a reading frame suitable for transcription and / or translation. In particular, said promoter of the expression cassette is not an endogenous promoter of said microalgae of the Chlorella genus transformed by the expression vector according to the invention. As examples of promoters that can be used in the expression vector according to the invention, mention may be made of the CaMV35S promoter, the ubiquitin promoter, the RBCS2 promoter, the nopaline synthase promoter and the chlorella virus promoters. , in particular the CaMV35S promoter and very particularly the CaMV35S promoter of sequence SEQ ID NO: 1.

For the purposes of the present invention, the term "heterologous expression cassette" means an expression cassette comprising a sequence of nucleic acids of interest coding a substance of interest, in particular of therapeutic interest. The substance of interest may be an RNA or a polypeptide of interest depending on the intended application.

One of the applications of the present invention is the production of microalgae of the genus Chlorella expressing enzymes by the method of obtaining a stable transformant according to the invention, said microalgae of the genus Chlorella being able to be used in biopulping operations, biobleaching or bioremediation. The enzymes used can be of heterologous origin, e.çj. fungal or bacterial, or endogenous, leading in this case to their over-expression in the microalgae of the genus Chlorella transformed. These enzymes include oxidoreductases such as laccases (EC 1 .1 0.3.2) or peroxidases (EC 1 .1 .1 .7) with a broad spectrum of action against aromatic compounds and their degradation in compounds of lower toxicity. In the present application, the microalgae of the genus Chlorella can be transformed by an expression vector according to the invention in which the heterologous expression cassette comprises a gene (nucleic acid sequence of interest) encoding an enzyme or at least 2 genes encoding substances of interest having a synergistic action, for example a laccase and a lignin peroxidase (LiP) or a laccase and a manganese peroxidase (MnP). The microalgae of the genus Chlorella thus obtained can be used advantageously in several industrial applications. A first application is the depollution of industrial effluents containing toxic aromatic compounds such as certain dyes used in the production of paper, textiles and plastics, or polycyclic aromatic hydrocarbons ("Polycyclic aromatic hydrocarbons"). (PAHs)). The depollution of wastewater, in particular the degradation of the estogenetic hormones such as estrone (E1), 17b-estradiol (E2), estriol (E3) and the synthetic hormone 17a-ethinylestradiol (EE2) can also be carried out by microalgae of the Chlorella genus expressing laccase and / or peroxidase. A second application of said microalgae of the genus Chlorella is the depolymerization of lignin fibers to facilitate bleaching by chemical agents ("enhance bleaching by chlorine-like") and to reduce the energy required to obtain pulp (" paper mill "). These methods are known by the respective names of biobleaching and biopulping.

Another application of the present invention is the production of microalgae of the Chlorella type expressing as substances of interest, metal chelating proteins by the process for obtaining a stable transformant according to the invention, said microalgae of the Chlorella genus. may be used in industrial effluent clearance operations. The chelating proteins can be of heterologous origin, e.çj. fungal, bacterial, yeast, or endogenous, leading in this case to their overexpression in the microalgae of the genus Chlorella transformed. These proteins include cysteine-rich proteins such as metallothioneins and phytochelatines. The microalgae of the genus Chlorella thus obtained can be used advantageously in the depollution of industrial effluents containing heavy metals such as cadmium, copper, lead, mercury, arsenic, zinc, or nickel.

Another of the applications of the present invention is the production of microalgae of the Chlorella genus expressing enzymes by the process for obtaining a stable transformant according to the invention, said microalgae of the Chlorella genus being able to be used in green chemistry applications. as the production of elemental chemical bricks used in the composition of polymers. The enzymes used can be of heterologous origin, e.çj. fungal or bacterial, or endogenous, leading in this case to their over-expression in the microalgae of the genus Chlorella transformed. In the present application, the microalgae of the genus Chlorella can be transformed by an expression vector according to the invention in which the heterologous expression cassette comprises a gene (nucleic acid sequence of interest) encoding an enzyme using as substrate an endogenous metabolite or at least 2 genes encoding substances of interest having a sequential action on this metabolite. The microalgae of the genus Chlorella thus obtained can be used advantageously in several industrial applications. A first application is the biotechnological production of biodegradable polyesters of the polyhydroxyalkanoate (PHA) type. Poly (3-hydroxybutyrate) (PHB) is a first example of PHA that can be obtained by microalgae of the Chlorella genus of the present invention expressing the heterologous acetyl-CoA C-acetyltransferase enzymes [EC 2.3.1.9], NADPH-dependent acetoacetyl-CoA reductase [EC 1 .1 .1 .36] and Polyhydroxyalkanoate synthase [EC 2.3.1. -]. Poly (4-hydroxybutyrate) is a second example of PHA that can be obtained by microalgae of the genus Chlorella of the present invention expressing the heterologous enzymes succinate semialdehyde dehydrogenase [EC 1 .2.1 .76], 4-hydroxybutyrate dehydrogenase [EC 1 .1 .1 .61], 4-hydroxybutyryl-CoA transferase [EC 2.8.3. a] and Polyhydroxyalkanoate synthase [EC 2.3.1. -]. A second application concerning the production of elemental bricks used in the polymer composition is the synthesis of 2-hydroxyisobutyrate (2-HI BA). 2-HIBA can be advantageously obtained in the microalgae culture medium of the Chlorella genus of the present invention expressing the heterologous enzymes acetyl-CoA C-acetyltransferase [EC 2.3.1.9], NADPH-dependent acetoacetyl-CoA reductase [EC1.1.336] and 2-hydroxyisobutyryl-CoA mutase [EC 5.4.99. -]. A third application concerning the production of elementary bricks used in the polymer composition is the synthesis of Isoprene. Isoprene can be advantageously obtained by means of microalgae of the Chlorella genus of the present invention expressing the heterologous enzyme Isoprene synthase [EC 4.2.3.27]. Isoprene production can be enhanced by overexpression of endogenous enzymes of methyl-erythritol phosphate (MEP) metabolism, eg the enzyme 1-deoxy-D-xylulose-5-phosphate synthase [EC 2.2.1.7]. and the enzyme 1-deoxy-D-xylulose-5-phosphate reductoisomerase [EC 1 .1 .1 .267]. A fourth application relating to the production of elemental bricks used in the polymer composition is the synthesis of 1,3-propanediol (PDO). PDO can be advantageously obtained by microalgae of the genus Chlorella of the present invention expressing the heterologous glycerol dehydratase enzymes [EC 4.2.1.30] and 1,3-propanediol dehydrogenase [EC 1 .1 .1 .202].

Another of the applications of the present invention is the production of microalgae of the Chlorella genus enriched in lipids by the method of obtaining a stable transformant according to the invention, said microalgae of the Chlorella genus being able to be used in the production of biodiesel. In the present application, the microalgae of the genus Chlorella can be transformed by an expression vector according to the invention in which the heterologous expression cassette comprises one or more genes (sequence (s) of nucleic acids of interest) encoding enzymes involved in the lipid pathway and more particularly in the synthesis of triglycerides. Enzymes of endogenous or exogenous origin for carrying out the application may be selected from the following list: pyruvate dehydrogenase [EC 1 .2.4.1], acetyl-CoA carboxylase [EC 6.4.1.2], malonyl-CoA ACP transacylase [EC 2.3.1 .39], Fatty acid synthases [EC 2.3.1. -], glycerol-3-phosphate dehydrogenase [EC 1 .1 .1 .8], glycerol-3-phosphate acyl transferase [EC 2.3.1 .1 5], phosphatidic acid phosphatase [EC 3. 1.3.4], diacylglycerol O-acyltransferase [EC 2.3.1.20], phospholipid: diacylglycerol acyltransferase [EC 2.3.1.1 58].

Another of the applications of the present invention is the production of microalgae of the Chlorella genus, the production of hydrogen of which is optimized by the process for obtaining a stable transformant according to the invention, said microalgae of the genus Chlorella being able to be used in the production of biohydrogen as a source of energy. The production of dihydrogen by microalgae of the genus Chlorella can be increased by overexpression as substances of interest for exogenous or endogenous enzymes such as ferredoxin hydrogenase [EC 1 .12.7.2] and pyruvate: ferredoxin oxidoreductase [ EC 1 .2.7.1].

Another of the applications of the present invention is the modification of microalgae of the genus Chlorella having an increased capacity for the assimilation of carbon dioxide by the process for obtaining a stable transformant according to the invention, said microalgae of the Chlorella genus being able to be used in the capture of industrial carbon dioxide. Carbon monoxide uptake by microalgae of the genus Chlorella can be increased by overexpression as a substance of interest for the carbonic anhydrase enzyme [EC 4.2.1 .1] alone or accompanied by overexpression of a bicarbonate. Another of the applications of the present invention is the production of lipid-enriched Chlorella microalgae having beneficial properties for human or animal health by the process for obtaining a stable transformant according to the invention, said microalgae of the genus Chlorella can be obtained by the expression as substances of interest of endogenous or exogenous enzymes involved in the synthesis of these lipids. A first example of lipid of biological interest is eicosapentaenoic acid (EPA), the accumulation of which can be promoted in microalgae of the Chlorella genus of the present invention by the expression alone or in combination of lipid metabolism enzymes as delta 6 desaturase [EC 1 .14.19.3], fatty acid elongase 6 [EC 6.2.1.3] and delta 5 desaturase [EC 1 .14.19. -]. A second example of lipid of biological interest is docosahexaenoic acid (DHA) from eicosapentaenoic acid. Accumulation of DHA may be promoted in microalgae of the genus Chlorella of the present invention by the expression alone or in combination as substances of interest for lipid metabolism enzymes as fatty acid elongase [EC 2.3.1.199]. ] and delta 4 desaturase [EC 1 .14. -. -].

Another of the applications of the present invention is the production of microalgae of the Chlorella genus producing sulphated exopolysaccharides having cosmetic applications by the process for obtaining a stable transformant according to the invention, said microalgae of the Chlorella genus being obtainable by the expression as substances of interest of endogenous or exogenous enzymes involved in the sulfation of polysaccharides such as sulfotransferases (EC 2.8.2. -].

Another application of the present invention is the production of microalgae of the Chlorella genus expressing as substances of interest for recombinant allergens by the process for obtaining a stable transformant according to the invention, said allergens being able to be used after purification for diagnosis or desensitization of allergy. Examples of allergens that can be expressed natively or modified in microalgae of the genus Chlorella are mite allergens such as Der p 1 and Der p 2, animal allergens such as Fel d 1 of the cat or Can f 1 of dog, hymenopteran venom allergens such as Api m 1 and Ves v 1, plant pollen allergens such as Bet v 2 from birch or Dac g 1 from dactyl grass, food allergens such as Ara h 1 from peanut. The recombinant allergens produced by the microalgae of the genus Chlorella genetically transformed by the process according to the invention can be accumulated in the cell or secreted in the culture medium when they present a signal peptide at their amino-terminal end. The recombinant allergens thus produced can be used as diagnostic tools for demonstrating the presence of antibodies directed against said allergens. These allergens can also be used for the desensitization of allergy by treatments performed by injectable subcutaneous or sublingual route.

Another of the applications of the present invention is the production of microalgae of the Chlorella genus expressing as substances of interest for recombinant proteins by the method of obtaining a stable transformant according to the invention, said proteins being able to be used therapeutically. or prophylactic in humans or animals. Thus, the polypeptide of interest may be an antibody, a viral envelope protein, a lysosomal enzyme, etc. Examples of recombinant proteins for use therapeutic are insulin for the treatment of diabetes, growth hormone for the treatment of small children or antibodies or antibody fragments as certolizumab used in the treatment of rheumatoid arthritis or ranibizumab used in the treatment of age-related macular degeneration. Examples of recombinant proteins for prophylactic use are the HBsAg antigen used in the hepatitis B vaccine or capsid proteins of the papillomavirus used in the cancer vaccine of the cervix.

The term "nucleic acid sequence stabilizer" in the sense of the present invention, any sequence for obtaining a stable transformant of a microalgae of the genus Chlorella.

The stabilizing nucleic acid sequences may in particular be identified by the method for identifying stabilizing nucleic acid sequences according to the invention comprising the following steps:

(i) obtaining a transformant by transforming the nuclear genome of a Chlorella microalgae by an expression vector comprising:

an expression cassette, in particular heterologous; and

an endogenous nucleic acid sequence of the nuclear genome of said microalgae of the genus Chlorella; said endogenous nucleic acid sequence being from 10 pb to 300 kbp in length; and

(ii) determining the stability of said transformant (for example by detecting the presence of said expression vector and / or said expression cassette according to the invention in the transformant after successive subcultures, in particular after at least 4, in particularly at least 10, more particularly after at least 1 5 successive subcultures and especially after at least 17 successive subcultures); and especially

(iii) selecting said endogenous nucleic acid sequence to obtain a stable transformant.

The term "endogenous sequence of the nuclear genome of a microalgae of the genus Chlorella" within the meaning of the present invention, a native sequence of the nuclear genome of a microalga of the genus Chlorella as opposed to the exogenous sequences of the nuclear genome of a microalgae of the like Chlorella.

The endogenous nucleic acid sequence of the nuclear genome of a microalgae of the genus Chlorella can be from 10 bp (base pairs) to 300 kbp (kilobase pairs) in length, in particular from 10 bp. at 150 kbp, more particularly ranging from 10 bp 100 kbp, more particularly ranging from 10 bp to 50 kbp, more particularly ranging from 10 bp to 20 kbp, more particularly ranging from 20 bp to 10 kbp, more particularly ranging from 50 bp. at 2 kbp and even more particularly ranging from 100 bp to 1 kbp, more particularly from 300 bp to 800 bp and even more particularly from 400 bp to 750 bp. Said endogenous stabilizing sequence may be a coding sequence. For the purposes of the present invention, the term "coding sequence" means any sequence which is transcribed into RNA and translated into protein.

According to a preferred embodiment, said endogenous stabilizing sequence may be a gene or a gene fragment.

In particular, said endogenous stabilizing sequence is a sequence coding for a gene or gene fragment chosen from the group consisting of:

the sequence of the gene encoding the degreening protein (dee8);

the sequence of the gene coding for glutamine synthetase;

the sequence of the gene coding for an ammonium transporter; and

their fragments having a length of at least 10 bp, in particular of a length ranging from 10 bp to 10 kbp, in particular ranging from 20 bp to 2 kbp, more particularly ranging from 50 bp to 1000 bp, and even more especially ranging from 400bp to 750bp.

According to a preferred embodiment, said endogenous stabilizing sequence is a sequence coding for ribosomal RNA.

In particular, said endogenous stabilizing sequence is a coding sequence of ribosomal RNA selected from the group consisting of:

the sequence of the gene coding for the 18S rRNA;

the sequence of the gene encoding the 28S rRNA;

the sequence of the gene encoding 5.8S rRNA; and

their fragments having a length of at least 10 bp, in particular of a length ranging from 10 bp to 10 kbp, in particular ranging from 20 bp to 2 kbp, more particularly ranging from 50 bp to 1000 bp and even more particularly ranging from 400 bp to 750 bp;

particularly the sequence of the 18S rRNA encoding gene and its fragments having a length of at least 10 bp, in particular of a length ranging from 10 bp to 10 kbp, in particular ranging from 20 bp to 2 kbp, more particularly ranging from 50 bp to 1000 bp and even more particularly from 400 bp to 750 bp.

In particular, said endogenous stabilizing sequence is the only endogenous sequence of said microalgae of the Chlorella genus included in said expression vector.

Said expression vector may comprise one or more stabilizing nucleic acid sequences.

According to a preferred embodiment, said expression vector may comprise at least one stabilizing nucleic acid sequence, in particular only one, chosen from the group consisting of: an endogenous nucleic acid sequence endogenous to the nuclear genome of said microalgae of the genus Chlorella, said endogenous stabilizing nucleic acid sequence being from 10 bp to 300 kbp in length; and

a stabilizing nucleic acid sequence having at least 80% identity with said endogenous stabilizing nucleic acid sequence throughout the length of said sequence;

in particular said stabilizing nucleic acid sequence being an endogenous sequence of the nuclear genome of said microalgae of the genus Chlorella and more particularly being the only endogenous sequence of said microalgae of the genus Chlorella included in said expression vector.

According to a preferred embodiment, said expression vector may comprise at least two, especially only two, stabilizing nucleic acid sequences selected from the group consisting of:

an endogenous nucleic acid sequence endogenous to the nuclear genome of said microalgae of the genus Chlorella, said endogenous stabilizing nucleic acid sequence being from 10 bp to 300 kbp in length; and

a stabilizing nucleic acid sequence having at least 80% identity with said endogenous stabilizing nucleic acid sequence throughout the length of said sequence; in particular the two stabilizing nucleic acid sequences being endogenous sequences of the nuclear genome of said microalgae of the Chlorella genus and more particularly being the only endogenous sequences of said microalgae of the Chlorella genus included in said expression vector.

When said expression vector comprises at least two stabilizing nucleic acid sequences, said sequences may be identical or different, in particular different.

When said expression vector comprises at least two endogenous stabilizing nucleic acid sequences, said sequences may be of the same chromosome, in particular of the same locus and very particularly of the same gene, and even more particularly may be successive fragments of the sequence of the same gene.

In particular, when said expression vector comprises at least one or at least two endogenous stabilizing nucleic acid sequences, said sequence (s) may be ribosomal RNA coding sequences selected from the group consisting of:

the sequence of the gene coding for the 18S rRNA;

the sequence of the gene encoding the 28S rRNA;

the sequence of the gene encoding 5.8S rRNA; and their fragments having a length of at least 10 bp, in particular of a length ranging from 10 bp to 10 kbp, in particular ranging from 20 bp to 2 kbp, more particularly ranging from 50 bp to 1000 bp and even more especially ranging from 400 bp to 750 bp;

particularly the sequence of the gene coding for the 18S rRNA and its fragments of a length of at least 10 bp, in particular of a length ranging from 10 bp to 10 kbp, in particular ranging from 20 bp to 2 kbp, more particularly ranging from 50 bp to 1000 bp and even more particularly from 400 bp to 750 bp.

In particular, said endogenous stabilizing sequences coding for ribosomal RNA are fragments of the sequence of the gene coding for 18S rRNA, in particular said fragments being from 10 bp to 10 kbp in length, in particular ranging from 20 bp to 2 kbp, more particularly ranging from 50 bp to 1000 bp and even more particularly ranging from 400 bp to 750 bp; in particular, said fragments being different and even more particularly the fragments corresponding to two successive fragments of the 18S rRNA gene sequence, preferably said fragments being the only two endogenous sequences of said Chlorella microalga included in said vector. expression.

In particular, said endogenous stabilizing sequences coding for ribosomal RNA are fragments of the sequence of the gene coding for 28S rRNA, in particular said fragments being of length ranging from 10 bp to 10 kbp, in particular ranging from 20 bp to 2 kbp, more particularly ranging from 50 bp to 1000 bp and even more particularly ranging from 400 bp to 750 bp; in particular, said fragments being different and even more particularly the fragments corresponding to two successive fragments of the sequence of the gene encoding the 28S rRNA, preferentially said fragments being the only two endogenous sequences of said microalgae of the genus Chlorella included in said vector of expression.

According to another preferred embodiment, when said expression vector comprises at least one or at least two endogenous stabilizing nucleic acid sequences, said sequence (s) may be sequences encoding a gene or gene fragment selected from the group consisting of in :

the sequence of the gene encoding the degreening protein (dee8);

the sequence of the gene coding for glutamine synthetase;

the sequence of the gene coding for an ammonium transporter; and

their fragments having a length of at least 10 bp, in particular of a length ranging from 10 bp to 10 kbp, in particular ranging from 20 bp to 2 kbp, more particularly ranging from 50 bp to 1000 bp and even more especially ranging from 400bp to 750bp.

According to another preferred embodiment, when said expression vector comprises at least one or at least two endogenous stabilizing nucleic acid sequences, the one or more sequences may be chosen from the group consisting of:

the sequence of the gene coding for the 18S rRNA;

the sequence of the gene encoding the 28S rRNA; the sequence of the gene encoding 5.8S rRNA;

the sequence of the gene encoding the degreening protein (dee8);

the sequence of the gene coding for glutamine synthetase;

the sequence of the gene coding for an ammonium transporter; and

In particular, when said microalgae of the Chlorella genus is Chlorella protothecoids, said endogenous stabilizing sequence may be the sequence of the gene coding for the 18S rRNA, in particular of sequence SEQ ID NO: 12 or of sequence SEQ NO: 132, or a fragment of the sequence of the gene coding for 18S rRNA, in particular of sequence SEQ ID NO: 12 or of sequence SEQ ID NO: 132, in particular said fragment is chosen from the group consisting of: the fragment of sequence SEQ ID NO: 13, the fragment of sequence SEQ ID NO: 14, the fragment of sequence SEQ ID NO: 133, the fragment of sequence SEQ ID NO: 134.

In particular, when said microalgae of the Chlorella genus is Chlorella protothecoids, said endogenous stabilizing sequence may be the sequence of the gene coding for the 28S rRNA, in particular of sequence SEQ ID NO: 42 or a fragment of the sequence of the gene coding for rRNA. 28S, in particular of sequence SEQ ID NO: 42, in particular said fragment is chosen from the group consisting of: the fragment of sequence SEQ ID NO: 43, the fragment of sequence SEQ ID NO: 44.

In particular, when said microalgae of the Chlorella genus is Chlorella protothecoids, said endogenous stabilizing sequence may be the sequence of the gene coding for the 5.SS rRNA, in particular of the sequence SEQ ID NO: 45 or a fragment of the sequence of the gene encoding the 5.8S rRNA, in particular of sequence SEQ ID NO: 45.

In particular, when said microalgae of the Chlorella genus is Chlorella protothecoids, said endogenous stabilizing sequence may be chosen from the group consisting of: the sequence SEQ ID NO: 13, the sequence SEQ ID NO: 14, the sequence SEQ ID NO: 133, the sequence SEQ ID NO: 134, the sequence SEQ ID NO: 43, the sequence SEQ ID NO: 44, the sequence SEQ ID NO: 45, in particular in the group consisting of the sequence SEQ ID NO: 13, the sequence SEQ ID NO: 14, the sequence SEQ ID NO: 133 and the sequence SEQ ID NO: 134.

In particular, when said microalgae of the Chlorella genus is Chlorella protothecoids, the expression vector may comprise at least one or at least two endogenous stabilizing sequences, the endogenous stabilizing sequence (s) being chosen from the group consisting of: the sequence SEQ ID NO : 13, the sequence SEQ ID NO: 14, the sequence SEQ ID NO: 133, the sequence SEQ ID NO: 1 34, the sequence SEQ ID NO: 43, the sequence SEQ ID NO: 44, the sequence SEQ ID NO: 45, more particularly, the endogenous stabilizing sequence (s) being the only endogenous sequence (s) of said Chlorella protothecoid microalga included in said expression vector. In particular, when said microalgae of the genus Chlorella is Chlorella sorokiniana, said endogenous stabilizing sequence may be the sequence of the gene coding for the 18S rRNA, in particular of sequence SEQ ID NO: 15 or of sequence SEQ ID NO: 18 or a fragment of the sequence of the gene coding for 18S rRNA, in particular of sequence SEQ ID NO: 15 or of sequence SEQ ID NO: 18, in particular said fragment is chosen from the group consisting of: the fragment of sequence SEQ ID NO: 16, the fragment of sequence SEQ ID NO: 17, the fragment of sequence SEQ ID NO: 19, the fragment of sequence SEQ ID NO: 20.

In particular, when said microalgae of the Chlorella genus is Chlorella sorokiniana, the expression vector may comprise at least one or at least two endogenous stabilizing sequences, the endogenous stabilizing sequence or sequences being chosen from the group consisting of: the sequence SEQ ID NO : 16, the sequence SEQ ID NO: 17, the sequence SEQ ID NO: 19, the sequence SEQ ID NO: 20, more particularly, the endogenous stabilizing sequence or sequences being the only endogenous sequence (s) of the said microalga Chlorella sorokiniana included in said expression vector.

In particular, when said microalgae of the genus Chlorella is Chlorella minutissima, said endogenous stabilizing sequence may be the sequence of the gene coding for 18S rRNA, in particular of sequence SEQ ID NO: 21 or a fragment of the sequence of the gene coding for rRNA. 18S, in particular of sequence SEQ ID NO: 21, in particular said fragment is chosen from the group consisting of: the fragment of sequence SEQ ID NO: 22, the fragment of sequence SEQ ID NO: 23.

In particular, when said microalgae of the genus Chlorella is Chlorella minutissima, the expression vector may comprise at least one or at least two endogenous stabilizing sequences, the endogenous stabilizing sequence or sequences being chosen from the group consisting of: the sequence SEQ ID NO : 22, the sequence SEQ ID NO: 23, in particular, said endogenous stabilizing sequence (s) being the only endogenous sequence (s) of said microalga Chlorella minutissima included in said expression vector.

In particular, when said microalgae of the genus Chlorella is Chlorella zofingiensis, said endogenous stabilizing sequence may be the sequence of the gene coding for the 18S rRNA, in particular of sequence SEQ ID NO: 24 or a fragment of the sequence of the gene coding for rRNA. 18S, in particular of sequence SEQ ID NO: 24, in particular said fragment is chosen from the group consisting of: the fragment of sequence SEQ ID NO: 25, the fragment of sequence SEQ ID NO: 26.

In particular, when said microalgae of the Chlorella genus is Chlorella zofingiensis, the expression vector may comprise at least one or at least two endogenous stabilizing sequences, the endogenous stabilizing sequence or sequences being chosen from the group consisting of: the sequence SEQ ID NO : 25, the sequence SEQ ID NO: 26, more particularly, the endogenous stabilizing sequence (s) being the only endogenous sequence (s) of said microalga Chlorella zofingiensis included in said expression vector. In particular, when said microalgae of the Chlorella genus is Chlorella autotrophica, said endogenous stabilizing sequence may be the sequence of the gene coding for the 18S rRNA, in particular of sequence SEQ ID NO: 27 or a fragment of the sequence of the gene coding for rRNA. 18S, in particular of sequence SEQ ID NO: 27, in particular said fragment is chosen from the group consisting of: the fragment of sequence SEQ ID NO: 28, the fragment of sequence SEQ ID NO: 29.

In particular, when said microalgae of the genus Chlorella is Chlorella autotrophica, the expression vector may comprise at least one or at least two endogenous stabilizing sequences, the endogenous stabilizing sequence or sequences being chosen from the group consisting of: the sequence SEQ ID NO : 28, the sequence SEQ ID NO: 29, in particular, said endogenous stabilizing sequence (s) being the only endogenous sequence (s) of said Chlorella autotrophica microalga included in said expression vector.

In particular, when said microalgae of the Chlorella genus is Chlorella vulgaris, said endogenous stabilizing sequence may be the sequence of the gene coding for the 18S rRNA, in particular of sequence SEQ ID NO: 30 or a fragment of the sequence of the gene coding for rRNA. 18S, in particular of sequence SEQ ID NO: 30, in particular said fragment is chosen from the group consisting of: the fragment of sequence SEQ ID NO: 31, the fragment of sequence SEQ ID NO: 32.

In particular, when said microalgae of the Chlorella genus is Chlorella vulgaris, the expression vector may comprise at least one or at least two endogenous stabilizing sequences, the endogenous stabilizing sequence or sequences being chosen from the group consisting of the sequence SEQ ID NO : 31, the sequence SEQ ID NO: 32, more particularly, the endogenous stabilizing sequence (s) being the only endogenous sequence (s) of said microalga Chlorella vulgaris included in said expression vector.

In particular, when said microalgae of the Chlorella genus is Chlorella beijerinckii, said endogenous stabilizing sequence may be the sequence of the gene encoding the 18S rRNA, in particular of sequence SEQ ID NO: 135 or a fragment of the sequence of the gene coding for rRNA. 18S, in particular of sequence SEQ ID NO: 135, in particular said fragment is chosen from the group consisting of: the fragment of sequence SEQ ID NO: 136, the fragment of sequence SEQ ID NO: 137.

In particular, when said microalgae of the Chlorella genus is Chlorella beijerinckii, the expression vector may comprise at least one or at least two endogenous stabilizing sequences, the endogenous stabilizing sequence or sequences being chosen from the group consisting of: the sequence SEQ ID NO : 136, the sequence SEQ ID NO: 137, more particularly, the endogenous stabilizing sequence (s) being the only endogenous sequence (s) of said Chlorella beijerinckii microalga included in said expression vector.

In particular, when said microalgae of the genus Chlorella is Chlorella protothecoids, said endogenous stabilizing sequence may be the sequence of the gene encoding the protein dee8 (degreening protein), in particular of sequence SEQ ID NO: 33 or a fragment of the gene sequence encoding the protein dee8, in particular sequence SEQ ID NO: 33, in particular said fragment is chosen from the group consisting of: the fragment of sequence SEQ ID NO: 34, the fragment of sequence SEQ ID NO: 35.

In particular, when said microalgae of the Chlorella genus is Chlorella protothecoids, said endogenous stabilizing sequence may be the sequence of the gene coding for glutamine synthetase, in particular of sequence SEQ ID NO: 36 or a fragment of the sequence of the gene coding for glutamine synthetase, in particular of sequence SEQ ID NO: 36, in particular said fragment is chosen from the group consisting of: the fragment of sequence SEQ ID NO: 37, the fragment of sequence SEQ ID NO: 38.

In particular, when said microalgae of the Chlorella genus is Chlorella protothecoids, said endogenous stabilizing sequence may be the sequence of the gene coding for an ammonium transporter, in particular of sequence SEQ ID NO: 39 or a fragment of the sequence of the gene encoding a transporter. ammonium, in particular of sequence SEQ ID NO: 39, in particular said fragment is chosen from the group consisting of: the fragment of sequence SEQ ID NO: 40, the fragment of sequence SEQ ID NO: 41.

In particular, when said microalgae of the Chlorella genus is Chlorella protothecoids, said endogenous stabilizing sequence may be chosen from the group consisting of: the sequence SEQ ID NO: 34, the sequence SEQ ID NO: 35, the sequence SEQ ID NO: 37, the sequence SEQ ID NO: 38, the sequence SEQ ID NO: 40, the sequence SEQ ID NO: 41.

In particular, when said microalgae of the Chlorella genus is Chlorella protothecoids, the expression vector may comprise at least one or at least two endogenous stabilizing sequences, the endogenous stabilizing sequence (s) being chosen from the group consisting of: the sequence SEQ ID NO : 34, the sequence SEQ ID NO: 35, the sequence SEQ ID NO: 37, the sequence SEQ ID NO: 38, the sequence SEQ ID NO: 40, the sequence SEQ ID NO: 41, very particularly, the sequence or sequences endogenous stabilizers being the one or only endogenous sequences of said microalgae Chlorella protothecoids included in said expression vector.

In particular, when said microalgae of the Chlorella genus is Chlorella protothecoids, said endogenous stabilizing sequence may be chosen from the group consisting of: the sequence SEQ ID NO: 13, the sequence SEQ ID NO: 14, the sequence SEQ ID NO: 133, the sequence SEQ ID NO: 134, the sequence SEQ ID NO: 43, the sequence SEQ ID NO: 44, the sequence SEQ ID NO: 45, the sequence SEQ ID NO: 34, the sequence SEQ ID NO: 35, the sequence SEQ ID NO: 37, the sequence SEQ ID NO: 38, the sequence SEQ ID NO: 40, the sequence SEQ ID NO: 41.

In particular, when said microalgae of the Chlorella genus is Chlorella protothecoids, the expression vector may comprise at least one or at least two endogenous stabilizing sequences, the endogenous stabilizing sequence (s) being chosen from the group consisting of: the sequence SEQ ID NO : 13, the sequence SEQ ID NO: 14, the sequence SEQ ID NO: 133, the sequence SEQ ID NO: 134, the sequence SEQ ID NO: 43, the sequence SEQ ID NO: 44, the sequence SEQ ID NO: 45 , the sequence SEQ ID NO: 34, the sequence SEQ ID NO: 35, the sequence SEQ ID NO: 37, the sequence SEQ ID NO: 38, the sequence SEQ ID NO: 40, the sequence SEQ ID NO: 41, all especially, the said endogenous stabilizing sequences being the single endogenous sequence (s) of said microalga Chlorella protothecoids included in said expression vector.

In the expression vector, said stabilizing sequence may be located upstream or downstream of the expression cassette, in particular upstream or downstream of said nucleic acid sequence of interest.

In particular, when said expression vector comprises at least two stabilizing nucleic acid sequences, said sequences can be located on either side of the expression cassette, in particular on either side of said sequence of expression. nucleic acids of interest.

The percentages of identity to which reference is made in the context of the disclosure of the present invention are determined on the basis of an overall alignment of the sequences to be compared, that is to say on an alignment of the sequences taken in their completeness over their entire length using for example the algorithm of Needleman and Wunsch (1970). This sequence comparison can be performed for example using the needle software using the "open Gap" parameter equal to 10.0, the "Gap Extend" parameter equal to 0.5 and a "Blosum 62" matrix. For example, needle is available on the ebi.ac.uk world wide website under the name "Align".

Said process for obtaining a stable transformant according to the invention may further comprise the following steps:

(iii) isolating said stable transformant; and

(iv) culturing said stable transformant.

The step (iii) of isolating said stable transformant can be implemented according to any technique well known to those skilled in the art such as by clonal selection on agar.

The step (iv) of culturing said transformant can be carried out according to any technique well known to those skilled in the art and adapted to said microalgae, in autotrophy, in heterotrophy or in mixotrophy. Some of these culture techniques are illustrated in the examples of this application.

According to a particular embodiment of the method for obtaining a stable transformant according to the invention, said expression vector is the vector deposited on December 20, 2012 at the CCAP ("Culture Collection of Algae and Protozoa"; algae and protozoa culture ") under registration number CCAP 21 1/122. This vector corresponds to the plasmid named pAlg-CHAst-aphW // in the examples. This vector is in particular composed of an expression cassette comprising the aphVIII sequence coding for a selection agent placed under the control of the promoter sequence CaMV35S (SEQ ID NO: 1) and the terminator nos (SEQ ID NO: 4), as well as the nucleic acid sequences stabilizing SEQ ID N: 13 and SEQ ID N: 14 of the nuclear genome of the microalgae of the genus Chlorella protothecoids. It also has a bacterial origin of replication as well as the kanamycin resistance gene for the selection of recombinant bacterial clones. The present application also relates to a process for producing a substance of interest comprising the implementation of the method for obtaining a stable transformant according to the invention, wherein said expression cassette is a heterologous expression cassette. comprising a DNA sequence encoding said substance of interest. The particular embodiments are as described above. In particular, said method for producing a substance of interest according to the invention comprises culturing said stable transformant under conditions allowing the expression of the substance of interest. Said method may further comprise a step of recovering said substance of interest, for example by purification.

The present application also relates to a vector of expression deposited on December 20, 2012 at the CCAP under the registration number CCAP 21 1/122.

The present application also relates to an expression vector comprising: an expression cassette, in particular a heterologous cassette; and

an endogenous nucleic acid sequence of the nuclear genome of a microalgae of the genus Chlorella and / or a stabilizing nucleic acid sequence having at least 80% identity with said endogenous stabilizing nucleic acid sequence over the entire length of the genome. said sequence; said endogenous stabilizing nucleic acid sequence being of a length ranging from 10 bp to 10 kbp, in particular ranging from 20 bp to 2 kbp, more particularly ranging from 50 bp to 1000 bp and even more particularly ranging from 400 bp to 750 bp. pb; said endogenous stabilizing nucleic acid sequence being a coding sequence for ribosomal RNA, in particular the sequence of the gene encoding 18S rRNA or a fragment thereof. The particular embodiments are as described above.

In particular, said expression vector according to the invention may comprise: an expression cassette, in particular a heterologous cassette; and

an endogenous nucleic acid sequence of the nuclear genome of a microalgae of the genus Chlorella and / or a stabilizing nucleic acid sequence having at least 80% identity with said endogenous stabilizing nucleic acid sequence over the entire length of the genome. said sequence; said endogenous stabilizing nucleic acid sequence being SEQ ID NO: 13; and

an endogenous nucleic acid sequence of the nuclear genome of a microalgae of the genus Chlorella and / or a stabilizing nucleic acid sequence having at least 80% identity with said endogenous stabilizing nucleic acid sequence over the entire length of the genome. said sequence; said endogenous stabilizing nucleic acid sequence being SEQ ID NO: 14. The particular embodiments are as described above.

an endogenous nucleic acid sequence of the nuclear genome of a microalgae of the genus Chlorella and / or a sequence of nucleic acids stabilizer having at least 80% identity with said endogenous stabilizing nucleic acid sequence throughout the length of said sequence; said endogenous stabilizing nucleic acid sequence being of a length ranging from 10 bp to 10 kbp, in particular ranging from 20 bp to 2 kbp, more particularly ranging from 50 bp to 1000 bp and even more particularly ranging from 400 bp to 750 pb; said endogenous stabilizing nucleic acid sequence being a coding sequence, in particular a gene or a gene fragment. The particular embodiments are as described above.

Said expression vectors according to the invention can be used in the processes according to the invention as described above.

This application also relates to a microalgae, in particular of the genus

Chlorella, comprising at least one expression vector according to the invention, in particular the vector deposited on December 20, 2012 at the CCAP under the registration number CCAP 21 1/122. In particular, the present application concerns the microalgae Chlorella protothecoids deposited on December 20, 2012 at the CCAP under the registration number CCAP 21 1/122.

Other advantages and features of the invention will become apparent from the following examples.

These examples are given for illustrative and not limiting.

Figure 1 represents transformation vectors of microalgae of the genus Chlorella. The selection gene is placed under the control of the CaMV35S promoter and the terminator of nopaline synthase. Sequences 1 and 2 of the nuclear genome of a microalgae of the genus Chlorella were cloned into the pAlg-CHAst vector.

Figure 2 represents the detection of nucleic acid sequences of interest (transgenes) nptII (Figure 2A), aphVII (Figure 2B) and aphVIII (Figure 2C) in microalgae Chlorella sorokiniana and Chlorella protothecoids transformed. PCR amplifications were performed on liquid cultures of microalgae transformed with each of the nucleic acid sequences of interest (transgenes) using primer pairs AG013 / AG084, AN362 / 363 and AN322 / AN323. M: size marker; T-: water control; T +: vector control; wt: wild type line.

Figure 3 shows the detection of the nucleic acid sequence of interest

(transgene) aphVIII in microalgae Chlorella protothecoids transformed. The PCR amplifications were performed on liquid Chlorella cultures transformed after 3, 7, 9 and 14 successive subcultures under standard culture conditions, in heterotrophy, and with and without selection pressure. M: size marker; T-: water control; T +: vector control; wt: wild type line; R3, R7, R9, R14: number of successive subcultures; (+/-): with and without selection pressure.

FIG. 4 represents the results of PCR amplifications of the nucleic acid sequence of interest (transgene) aphVIII carried out on 3 transformed clones of the microalga Chlorella protothecoids. The transformed clones were cryopreserved over a period of 2 months. The PCR amplifications were carried out on cultures having undergone 4 successive subcultures carried out in standard medium supplemented with selection after cryopreservation output. M: size marker; T-: water control; T +: vector control; wt: wild type line.

Figure 5 shows a schematic of the vector pAlg-CHAst-aphW // in linear form for the stable genetic transformation of the microalga Chlorella protothecoids. The bars symbolize the PCR amplifications performed on the transformed microalgae in order to show the integration of the entire vector and integrate into the genome of the microalgae.

FIG. 6 represents the results of PCR amplifications carried out on 3 transformed microalgae clones belonging to the genus Chlorella protothecoids (after 14 successive subcultures in standard medium supplemented with selection agent). M: size marker; T-: water control; T-: buffer control; T +: vector control; wt: wild type line; Amplification 1: primers AN322 / AN323; Amplification 2; primers 367/368; amplification 3: primers 369/370; Amplification 4a: primers 433/434; Amplification 4b: primers 371/372.

FIG. 7 represents the PCR amplifications carried out on 3 clones of the microalgae Chlorella protothecoids transformed with the vectors pAlgCHAst-F1 -aphVIII (lanes 1 to 3) and pAlgCHAst-F1 -aph V7 // - F1 (lanes 4 to 6 ). M: size marker; T-: buffer control; T +: vector control; wt: wild type line; Amplification 1: primers AN322 / AN323; Amplification 2; primers 367/368; amplification 3: primers 369/370; Amplification 4a: primers 433/434; Amplification 4b: primers 371/372.

Figure 8 shows the PCR amplifications of the aphVIII sequence performed on the transformed Chlorella clones. M: size marker; T-: water control; T +: vector control; wt1: Chlorella protothecoids CCAP21 1 / 7A unprocessed; wt2: Unconverted Chlorella beijerinckii: wt3: Chlorella protothecoids CCAP21 1 / 8D untransformed; lanes 1 and 2: transformed clones of Chlorella protothecoids CCAP21 1 / 7A; lanes 3 and 4: transformed clones of Chlorella beijerinckii; lanes 5 to 10: Chlorella prototypes CCAP21 1 / 8D transformed with the F1 and F2 stabilizing sequences of 28S rRNA (5-6), glutamine synthetase (7-8) and ammonium transporter (9-10) .

Figure 9 shows the profiles of total glycosylated proteins in microalgae of the genus Chlorella. Protein extracts of microalgae were separated on SDS-PAGE gel and transferred to nitrocellulose membrane. Glycoproteins were detected by affinodetection using concanavalin A lectin coupled with peroxidase. M: size marker; Cp: Chlorella protothecoids; Cv: Chlorella vulgaris; Cs: Chlorella sorokiniana; T +: sample of glycoproteins.

Figure 10 depicts Western blot detection of eGFP protein in total protein extracts of transformed Chlorella protothecoid microalgae clones. Protein extracts of microalgae were separated on SDS-PAGE gel and transferred to nitrocellulose membrane. Detection is performed using an anti-GFP antibody coupled to peroxidase (SC9996-HRP). T +: protein extract containing eGFP protein; wt: protein extract of the microalgae Chlorella protothecoids unprocessed; 1-6: Protein extracts of microalgae Chlorella protothecoids transformed. EXAMPLES

I. Materials and Methods

1.1. Method of cultivating microalgae of the genus Chlorella autotrophy

Strains of microalgae of the genus Chlorella were obtained from the banks

UTEX, CCMP, SAG and CCAP. Chlorella sorokiniana microalgae (UTEX1663; UTEX1230), protothecoids (CCAP21 1 / 7A; CCAP21 1 / 8D), autotrophica (CCMP243), vulgaris (CCAP21 1/1 1 B; SAG280), zofin§iensis (CCAP21 1/14; UTEX32 ), minutissima (UTEX2219), beijerinckii (SAG20.46) were made axenic and clonal.

Microalgae of the Chlorella genus were cultured at 22 ° C. under continuous illumination (280-350 pmol photons.m ^-2 .s- ¹ ), in a culture medium composed of sterile filtered tap water at 0.22 μm. and enriched with Conway 1 X nutrient medium (supplemented with 0.5 g / L tryptone or KNO ₃ at 1.5 g / L depending on the species) and in the BG1 1 commercial medium (C3061, Sigma). For volumes greater than 50 ml, specifically from 1 to 300 liters, the cultures were aerated with an air / CO 2 2% mixture.

The microalgae were also cultured on agar media composed of sterile filtered tap water at 0.22 μιη and enriched with Conway 1 X nutrient medium, and in commercial medium BG1 1 (C3061, Sigma), supplemented with 1% agarose.

The culture concentration was calculated on Mallassez counting cells (using the Algenics Algae Finder software) after fixing the microalgae with a Lugol solution.

1.2. Method for cultivating microalgae of the Chlorella genus in heterotrophy

Microalgae of the genus Chlorella capable of growing on a medium supplemented with carbon source and in the absence of light were placed in the standard culture medium enriched with 10 g / l of glucose. The cultures were placed at 22 ° C and in the dark. The culture on agar medium was carried out in Petri dishes by adding 1% agarose.

1.3. Cropopreservation of microalgae of the genus Chlorella

The microalgae were cultured in the standard culture medium until the stationary phase of growth. They were pelleted by centrifugation at 2000 g for 5 min and taken up in the culture medium at the rate of 100 million cells per milliliter with the addition of cryoprotectants at a rate of: 5% MeOH, 5% DMSO, 9% DMSO, 10% DMSO , according to the strains. The cryopreserved microalgae were stored at -80 ° C.

1.4. Preparation of vectors for the genetic transformation of Chlorella

The vector pAlg-CHA (FIG. 1) for the genetic transformation of microalgae of the Chlorella genus is composed of an expression cassette comprising the sequence coding for a selection agent placed under the control of the promoter sequence CaMV35S of the mosaic virus of the cauliflower, and the nos terminator of the nopaline gene synthase. It was carried out by cloning the promoter sequence CaMV35S (SEQ ID NO: 1) in the vector pCR2.1 (Invitrogen). The terminator sequence nos (SEQ ID NO: 4) was cloned downstream of the promoter sequence. The genes nptII (SEQ ID NO: 6), aphVIII (SEQ ID NO: 5) and aphVII (SEQ ID NO: 7), coding respectively the antibiotic resistance conferring enzymes G418, paromomycin and hygromycin, were inserted into the cassette. expression. The scheme of transformation vectors is shown in Figure 1. The pAlg-CHA vector also has an origin of bacterial replication as well as the ampicillin resistance gene for the selection of recombinant bacterial clones.

The vector pAlg-CHAst (FIG. 1) allowing the stabilization of the genetic transformation of microalgae of the Chlorella genus is composed of an expression cassette comprising the sequence coding for a selection agent placed under the control of the CaMV35S promoter sequence and the terminator nos, as well as two DNA sequences of the nuclear genome of the microalgae of the genus Chlorella.

The DNA fragments of the nuclear genome 1 and 2 of the microalga of the genus

Chlorella were amplified using specific primers defined following a bioinformatic analysis performed on different microalgae. They were then successively cloned into the transformation vector. The final step was to clone the selection cassette containing the selection genes nptII, aphVII and aphVIII, which respectively encode G418, hygromycin and paromomycin resistance conferring enzymes. The pAlg-CHAst vector also has an origin of bacterial replication as well as the kanamycin resistance gene for the selection of recombinant bacterial clones.

I.5. Transformation of microalgae

Microalgae of the genus Chlorella have been transformed by different methods whose main steps are described below.

1.5.1. Transformation of microalgae of the genus Chlorella by particle bombardment

The genetic transformation of Chlorella was carried out by particle bombardment using the modified BIORAD PDS-1000 / He apparatus (Thomas et al., 2001).

Chlorella cultures in exponential growth phase were concentrated by centrifugation (10 minutes, 2150g, 20 ° C), diluted in sterile water, and spread on agar at 10 ⁸ cells per agar. Microcarriers are gold particles (diameter 0.6 μιη). They were prepared according to the supplier's protocol (BIORAD).

Precipitation of the DNA was carried out by a solution containing 1.25M CaCl ₂ and 20 mM spermidine, with a ratio of 1.25 μg of DNA per 0.75 mg of gold particles per shot. The rupture discs used range from 900 to 1350 psi. The vacuum is achieved at 30 Hg.

The microalgae were incubated for 24 hours before transplanting onto agars supplemented with selection agent. They were then kept at 22 ° C. under constant lighting. After 1 to 2 weeks of culture, the potentially transformed clones that developed were transplanted onto agar plates and then into liquid medium supplemented with selection agent. 1.5.2. Transformation of microalgae of the genus Chlorella by the technique of electroporation

Electroporation transformation involves subjecting microalgae to an electric field. It causes the formation of transient pores in the plasma membrane by altering its polarity, permitting the penetration of DNA into the cell in order to fit into the nuclear genome.

Two devices were used. The MicroPulser (Biorad) is an electroporator allowing to obtain a range of intensity of the electric fields from 200V to 3000V (0,5 to 30kVolts / cm). The GenePulser MXcell (Biorad) is a 96 well plate electroporator that allows to vary many parameters such as the type of pulses (exponential waves or square waves), the voltage, the capacitance and the time and number of pulses for the waves. square.

The cells in the exponential growth phase were pelleted by centrifugation at 2000 g for 5 minutes, washed in 5 ml of electroporation buffer (0.08 M KCl buffer, 0.01 M CaCl ₂ , 0.2 M Hepes, 0.2 M Mannitol; 0.2 M Sorbitol) and then resuspended at 10 ⁸ cells per ml in the buffer cooled to 4 ° C. The plasmid DNA and the carrier DNA (calf thymus DNA, Sigma) were respectively added to the final concentration of g / mL and 25 μg / mL. The solution was gently mixed by pipetting and incubated for 5 to 10 minutes on ice. Two hundred microliters of solution containing the cells and the DNA were transferred to each electroporation vessel and subjected to an electroporation (0.5 to 30 kVolts / cm) for 1 ms (1 to 3 pulses). The vats were then incubated on ice for 5 to 10 minutes then the cells were resuspended in 3 ml of culture medium without antibiotic and incubated for 24 hours under standard culture conditions. After 24 hours, the cells are centrifuged, washed with 100 μl of culture medium, and plated on selective agar medium or cultured flask (5 ml) in the presence of selection agent.

1.5.3. Transformation of microalgae of the genus Chlorella by the PEG technique

The permeabilization of the cells was carried out by stirring in the presence of PEG (PEG 4000 (20 μM, 4000 M, Sigma) and PEG 6000 (15 μM, 6000 M, Sigma)) at different final concentrations (3.5%, 10%, 15%). % and 20%), with or without glass beads (0.45-0.52 mm diameter, Sigma). The size of the beads, the stirring time, the molecular weight of the PEG and its concentration were parameters to optimize for an efficient transformation of each microalgae.

The cells, in the exponential growth phase, were pelleted by centrifugation at 2000 g for 5 minutes. The pellet was washed with culture medium and the cells resuspended in medium at 1 × 10 ⁶ cells per ml. A solution containing 300 mg of autoclaved glass beads, 1 μg of vector DNA (μ / μί) and PEG 4000 or PEG 6000 at different concentrations was added to the cell suspension for a final volume of 1 ml in a tube. conical centrifugation of 1.5mL. The solution was mixed briefly by inversion of the tube, stirred at 2400rpm on a 'Signature Pulsing Vortex Mixer' (VWR) shaker at variable times (from 30 seconds to 2 minutes). After decantation of the glass beads, the supernatant was transferred to 10mL culture tubes and the cells grown in 4mL medium. culture during a night in low light. After 24 hours, the cells were pelleted by centrifugation, taken up in 100 μl of culture medium and completely spread on agaric selection medium.

1.5. . Protoplast transformation of microalgae of the genus Chlorella by the PEG technique

One hundred million cells were previously treated to make protoplasts. These cells are centrifuged at 2000g for 5 min and washed in a medium solution containing 0.6M Sorbitol / Mannitol to remove the digestion solution and wall components.

The cells were taken up in 0.2 ml of a 0.6 M Sorbitol / Mannitol solution containing 50 mM CaCl ₂ and transferred to a 1.5 ml centrifuge tube. 10 .mu.l of plasmid DNA at .mu.l and 10 .mu. of calf thymus DNA at 2.5 .mu.m / .mu.l (Sigma) were added. After incubation for 15 minutes at room temperature, 400 μl of PNC solution (20% PEG, 0.4 ml NaCl and 25 mM CaCl ₂ ) was added to the cell suspension and the mixture was stirred gently for 30 minutes at room temperature. .

300mg of glass beads were added after the PNC solution. The cell suspension was then stirred at 2400 rpm on a Signature Pulsing Vortex Mixer (VWR) for 15 seconds, the supernatant was then transferred to a new 1.5 ml tube, gently stirred for 30 minutes, then 0.6 ml. Recovery medium (culture medium supplemented with 0.6M Mannitol / Sorbitol, 1% glucose, 1% yeast extract and 1% tryptone) was added. The cells were incubated in the dark for 12 h at 22 ° C to regenerate their cell wall. All of the cells were then screened on agar medium or liquid supplemented with the appropriate selection agent.

1.5.5. Transformation of microalgae of the genus Chlorella by Aqrobacterium tumefaciens

The bacterial strain used is the strain LBA4404 from Agrobacterium tumefaciens (Invitrogen). The vectors used are the plasmid pBi121 (GenBank: AF485783.1) and the plasmid pCambia2300 (GenBank: AF234315.1).

Agrobacterium tumefaciens is a bacterium that naturally has the ability to transmit and integrate part of its DNA into the genome of plants. This particular biological feature has been diverted to allow the genetic transformation of plants.

Plasmid vectors have been developed by insertion of specific sequences recognized by the biological machinery of the bacterium on either side of the sequence to be integrated into the genome. The bacteria will be able to integrate the DNA of interest into the genome of the host cell.

The microalgae transformation protocol includes the following steps:

-Transformation of agrobacteria with vectors of interest and preparation of recombinant bacterial cultures

-Preparation of Chlorella cells in exponential growth phase -Culture of agrobacteria with microalgae on agar medium and in liquid medium

-Lavages of the Chlorella cells and put in culture on medium of selection.

1.6. Extraction of genomic DNA of microalgae of the genus Chlorella

The cells were pelleted by centrifugation (21 50g, 15 minutes, 4 ° C). The microalgae were incubated overnight at 4 ° C. in 4 ml of 1 X TE-NaCl buffer (0.1 M Tris-HCl, 0.05 M EDTA, 0.1 M NaCl, pH 8). 1% SDS, 1% Sarkosyl and 0.4 mg / ml proteinase K were then added to the sample followed by incubation at 40 ° C for 90 minutes. A first phenol-chloroform-isoamyl alcohol extraction was carried out to extract an aqueous phase comprising the nucleic acids. The RNAs contained in the sample were removed by one hour of incubation at 60 ° C. in the presence of RNase (1 μg / ml). A second phenol-chloroform extraction was performed, followed by ethanol precipitation. The resulting pellet was air dried and solubilized in 200μί of ultrapure water. Quantitation of the DNA was performed spectrophotometrically (260 nm) and analyzed by agarose gel electrophoresis.

1.7. PCR amplification analyzes (polymerase chain reaction)

The screenings of recombinant bacterial clones as well as the PCR amplifications carried out on purified DNAs were carried out using the following conditions.

The PCR reaction was carried out in a final volume of 50 μί composed of 1 X PCR buffer, 0.2 mM of each dNTP, 5 μl of each primer, 20 ng of template DNA and 1.25 μl of Taq DNA polymerase (Taq DNA polymerase, Rock). Thirty PCR cycles were performed for the amplification of the template DNA. The initial denaturation was carried out at 94 ° C for 5 min. Each subsequent cycle consists of a denaturation step at 94 ° C (1 min), a primer hybridization step at 55 ° C (1 min), and an elongation step at 72 ° C (1 min). The samples obtained after the PCR reaction were checked on agarose gel (1%) stained with ethidium bromide.

Colony PCR amplification screenings of the transformed Chlorella microalgae are carried out using the "REDExtract-N-Amp ™ Plant PCR Kit" (Sigma) kit.

1.8. Southern blot

The genomic DNA of the microalgae of the wild-type and transformed Chlorella genus are digested overnight at 37 ° C. using the restriction enzyme EcoRI. The samples are then deposited on 0.8% agarose gel and the lambda HindIII size marker (D9780, Sigma). The migration is carried out for 3 to 4 hours at 1 30 volts and at 4 ° C. in a 1 X TAE solution. The digested DNAs are monitored under UV at 254 nm after labeling with ethidium bromide.

The gel is then incubated twice for 5 minutes in a depurination solution (0.25M HCl) with stirring and then rinsed with UP water. The gel is then incubated in a denaturation solution (0.5M NaOH, 1.5M NaCl) for 15 minutes, rinsed with UP water, and finally incubated in the neutralization solution (1M Tris-HCl, 1mg). 5M NaCl, pH 7.4), twice 15 minutes. The nucleic acids are transferred by capillarity for 4 hours onto a nylon membrane (RPN303B, GE Healthcare) using a solution of SSC20X. The DNA is then covalently attached by treating the membrane with UV (254 nm) for 2 minutes.

The membrane is incubated in the prehybridization solution (SSC6X, 0.1% SDS, Denhart's 5X solution, 100μg / mL carrier DNA) at 65 ° C. for 1 hour, then it is placed overnight in contact with the solution. hybridization mixture containing 100ng of the previously denatured labeled probe for 10 minutes at 100 ° C. The labeling of the nucleic acid probe is carried out with the BrightStar Psoralen-Biotin kit (AM180, Ambion).

The membrane is then washed for 30 minutes at 65 ° C. in a bath of the SSC6X solution, twice for 30 minutes in the SSC2X solution, 0.1% SDS, and for 15 minutes in the SSC0.2X solution, 0.1%. SDS. Rinsing was performed in 1 X TBS for 5 minutes and the membrane was saturated in TBS, 3% BSA for 2 hours. Hybridization is carried out using a solution of 1 X TBS, 0.05% Tween 20 containing streptavidin coupled to peroxidase (S2438, Sigma) diluted 1/10000 ^th. After washing for 5 minutes in a solution of 1 X TBS, 0.05% Tween 20, and rinsing in 1 X TBS, the revelation is carried out using an ECL revealing kit (RPN2109, GE Healthcare). ).

1.9. Detection of the activity of the gene qus

The cells of the microalgae of the genus Chlorella in the exponential phase of growth are recovered by centrifugation (10 minutes, 50 g, 20 ° C.) and then washed with a PBS buffer. The enzymatic reaction solution is composed of Na ₂ HPO ₄ 93mM, 68mM NaH ₂ PO ₄ , 10mM EDTA pH8, 0.1% Triton X100, and 1mM X-Gluc. A volume of 50 μί of the reaction solution is added to the cell pellet. The cells are resumed and the tubes are incubated overnight at 37 ° C. The cells are then observed by light microscopy to visualize the blue color in the cells.

1.10. Detection of eGFP Fluorescent Protein

The study of the cellular localization of the eGFP protein by epi-fluorescence microscopy is carried out on wild-type and transformed Chlorella cells. Fluorescence of the eGFP protein and chlorophyll are visualized using 488nm excitation filters, and emission filters of 500-520 and 625-720nm, respectively.

1.1 1. Extraction of the total proteins of microalgae of the genus Chlorella

The cells of the microalgae of the genus Chlorella at the end of the exponential phase of growth were recovered by centrifugation (10 minutes, 50 g, 20 ° C.). The cell pellets were resuspended in cell lysis buffer (0.1M Tris-HCl pH8, 15% sucrose, 0.5% SDS, 1mM PMSF, 1% protease inhibitor cocktail (SIGMA) ). Cell lysis was performed by sonication (amplitude 30%, draws 2 seconds) for 30 minutes at 4 ° C. using the Vibracell 750watt apparatus. The cell lysates obtained were centrifuged (60 minutes, 5000 g, 4 ° C) to remove cell debris and the supernatants corresponding to soluble total protein extracts were recovered. 1.12. Detection of eGFP fluorescent protein by immunoblotting

The protein samples of the wild-type and transformed strains of the Chlorella microalgae are separated on a 12% SDS-PAGE gel. The proteins are transferred to nitrocellulose membrane (RPN303D, GE Healthcare) and stained with Rouge Ponceau to control the transfer efficiency. The nitrocellulose membrane is saturated for 2 hours in a solution of TBS containing 5% milk. Immunodetection was performed using horseradish peroxidase-conjugated anti-GFP antibody (Santa Cruz, sc-9996-HRP) diluted 1: 2000 in TBS, 0.05% Tween 20, containing 1 % milk for 2 hours at room temperature. The membrane is then washed with 0.05% TBS-Tween (6 times 5 minutes at room temperature) followed by a final wash with TBS (5 minutes at room temperature). Detection is performed by the chemiluminescence method (RPN2109, GE Healthcare).

1.1 3. Detection of monoclonal antibodies by immunoblotting

The culture supernatants of the wild-type and transformed strains of the microalgae of the Chlorella genus are deposited on a 12% SDS-PAGE gel. The proteins are transferred to nitrocellulose membrane (RPN303D, GE Healthcare) and stained with Rouge Ponceau to control the transfer efficiency. The nitrocellulose membrane is saturated for 2 hours in a solution of TBS containing 5% milk. The immunodetection is carried out using horseradish peroxidase-conjugated anti-human IgG antibody (Sigma, A6029-HRP) diluted 1: 2000 in TBS, 0.05% Tween 20, containing 1% of milk for 2 hours at room temperature. The membrane is then washed with 0.05% TBS-Tween (6 times 5 minutes at room temperature) followed by a final wash with TBS (5 minutes at room temperature). Detection is performed by the chemiluminescence method (RPN2109, GE Healthcare).

1.14. Detection of glvcoproteins using the Concanavalin A lectin

Protein samples of microalgae of the genus Chlorella were separated on a 12% SDS-PAGE gel. The separated proteins were transferred to nitrocellulose membrane (RPN303D, GE Healthcare) and stained with Ponceau Rouge to control the transfer efficiency. The nitrocellulose membrane was saturated for 5 minutes in 2% TBS Tween20 solution. The affinodetection was carried out using horseradish peroxidase-conjugated Concanavalin A lectin (Sigma, L6397) diluted 1: 2000 in TBS, 0.05% Tween 20, 1 mM CaCl ₂ , 1 mM MgCl 2. _2, 1 mM MnCl ₂ for 2 hours at room temperature. The membrane was washed with 0.05% TBS-Tween (6 times 5 minutes at room temperature), followed by a final wash with TBS (5 minutes at room temperature). Detection was performed by the chemiluminescent method (RPN2109, GE Healthcare). 1.1 5. Listing the specific primers of fragments 1 and 2 of genomic DNAs of microalgae Chlorella - Table 1

5 II. Results

11.1. Example 1 Transformation of microalgae of the genus Chlorella

11.1 .1. Culture of microalgae

Microalgae Chlorella sorokiniana (UTEX1663) and Chlorella protothecoids (CCAP21 1 / 8D) were cultured in a medium composed of tap water supplemented with a nutrient solution of Conway 1 X and tryptone at 0.5 g / L, or KN0 ₃ to 1, 5g / L according to the microalgae. Cell count was performed by Malassez cell counting using the Algenics Algae Finder software.

11.1 .2. Realization of pAlg-CHA expression vectors

The pAlg-CHA vector of genetic transformation of microalgae of the genus

Chlorella is composed of an expression cassette comprising the sequence coding for a selection agent placed under the control of the cauliflower mosaic virus CaMV35S promoter sequence and the nos terminator of the nopaline synthase gene (FIG. ).

The promoter sequence CaMV35 (SEQ ID NO: 1) and the sequence Tnos (SEQ ID NO:

4), were amplified from a synthetic vector respectively with the aid of the pairs of primers.

AV35 (5 '- AAGAATTCCATGGAGTCAAAGATTC-3') / AV36 (5'-

TTG AATTCGTCCCCCGTGTTCTCTC-3 ') and AV38 (5'-AAG AGCTCG AATTTCCCCG ATCGTTC-3') / AV39 (5'-TTTCATGACCGATCTAGTAACATAG-3 '). These primers also made it possible to insert the EcoRI site 5 'and 3' of the promoter, and the SacI and BspHI sites, 5 'and 3' of the terminator. Each of the sequences was then cloned into the vector pCR2.1 (Invitrogen).

The coding sequence npt11 (SEQ ID NO: 6) of the G418 resistance gene was amplified from the vector pCR2.1 (Invitrogen) using primers AV43 (5'-AAGGATCCATGATTGAACAAGATGG-3 ') and AV44 ( 5 '-TTG AGCTCTCAG AAG AACTCGTCAAG-3') for inserting BamHI restriction sites at 5 'and Sacl at 3'. The sequence was then cloned into the Chlorella pAlg-CHA-npt // transformation vector between the CaMV35S regulatory sequences and the nos terminator.

The aphVII coding sequence (SEQ ID NO: 7) was amplified from the pChlamy vector (Invitrogen) using the specific primers AV45 (5'-AAGGATCCATGACACAAGAATCCCTG-3 ') and AV46 (5'-TTGGATCCTTATCAGGCGCCGGGGG-3' ) which made it possible to insert the cleavage site for the BamHI restriction enzyme 5 'and 3' of the sequence. It was then cloned into the Chlorella pAlg-CHA-aphW / transformation vector between the CaMV35S regulatory sequences and the nos terminator.

The coding sequence aphVIII (SEQ ID NO: 5) was amplified from a synthetic vector using the specific primers AV41 (5'-AAGGATCCATGGACGATGCGTTGCG-3 ') and AV42 (5'-TTG AG CTCTCAG AAG AACTCGTCCAAC - 3) 'which allowed the cleavage sites to be inserted for the 5' BamHI and 3 'SacI enzymes of the sequence. This sequence has then cloned into the Chlorella pAlg-CHA-aphW // transformation vector between the CaMV35S regulatory sequences and the nos terminator.

11.1 .3. Genetic transformation of Chlorella microalgae

Chlorella microalgae were transformed by the particle bombardment technique and the electroporation technique, by PEG, by Agrobacterium tumefaciens, on intact cells and protoplasts (Lu et al., 201 1).

The genetic transformation of Chlorella microalgae was carried out by particle bombardment using the modified BIORAD PDS-1000 / He (Thomas et al., 2001).

Chlorella cultures in exponential growth phase were concentrated by centrifugation (10 minutes, 2150g, 20 ° C), diluted in sterile water, and spread on agar (at 10 ⁸ cells per agar). Precipitation of the DNA was carried out by a solution containing 1.25M CaCl ₂ and 20mM spermidine, with a ratio of 1.25μg of DNA per 0.75mg of microcarriers. The transformation was carried out with firing pressures ranging from 900 to 1350psi.

The genetic transformation of Chlorella microalgae was also performed by electroporation using two devices, MicroPulser (Biorad) and GenePulser MXcell (Biorad).

The microalgae in the exponential growth phase were pelleted by centrifugation at 2000 g for 5 minutes, washed in 5 ml of electroporation buffer (0.08 M KCl buffer, 0.01 M CaCl _2, 0.2 M Hepes, 0.2 M Mannitol, Sorbitol 0.2M) and then resuspended at 10 ⁸ cells per ml in buffer cooled to 4 ° C. They were then placed in cuvettes with gaps of 1 to 4 mm, and in a 96-well plate.

The pAlg-CHA-npt //, pAlg-CHA-aphW /, pAlg-CHA-aphW // and carrier DNA vectors were added respectively to ^ g / mL and 25 μg / mL final. The microalgae in solution were then subjected to electric pulses of 1 ms, up to 18kVolts / cm.

The microalgae Chlorella sorokiniana was transformed using the pAlg-C A-nptll vector, and Chlorella protothecoids using the pAlg-CHA-aphW / and pAlg-CHA-aphVIII vectors.

The microalgae which underwent transformation by particle bombardment and by electroporation were incubated for 24 hours under constant illumination and at 22 ° C. The cells were then centrifuged, washed with the culture medium, and plated at a rate of 15 × 10 ⁶ cells. by agar, on agar media containing 50mg / L of G418, 50mg / L of paromomycin or 400mg / L of hygromycin.

11.1 .4. Selection of transformed microalgae

After 15 to 21 days of culture, the potentially transformed clones of microalgae Chlorella sorokiniana and protothecoids that developed on the selection agar plates were transplanted a first time on a fresh medium supplemented with selection agent (50mg / L of G418, 50mg / L of paromomycin or 400mg / L hygromycin). The clones were then subcultured every 15 days on agars supplemented with selection agent.

11.1 .5. Detection of transgenes in Chlorella microalgae

The transformants obtained on the selection agar plates were subcultured in culture media with selection agent and cultured under standard culture conditions. The analyzes were carried out on the Chlorella clones which developed after 1, 2, 3 and 4 successive subcultures.

The insertion of the heterologous nptll, aphVII, and aphVIII resistance sequences to selection agents, G418, hygromycin, and paromomycin in the Chlorella microalgae genome was verified by PCR assays.

Figure 2 shows the results of PCR amplification screening of specific sequences of the nptII, aphVII, and aphVIII genes obtained for transformed Chlorella clones. The amplifications carried out on the control tubes as well as on the unprocessed strains are negative. The PCR amplifications carried out on the pAlg-CHA-nptll, pAlg-CH A-aphVII and pAlg-CHA-aphW // vectors gave respectively bands at the expected sizes of 31 1 bp, 480 bp and 405 bp.

The presence of the nptII transgene in the transformed Chlorella sorokiniana microalgae was verified using primers AG013 (5'-TAGCCGGATCAAGCGTATGCAG-3 ') and AG084 (5'-ACAG ACAATCG G CTG CTCTG ATG-3'). The clones obtained have an amplification at the expected size of 31 1 bp (FIG. 2A). This result, confirmed on the clones after 2 to 3 subcultures on fresh media supplemented with selection agent, validated the insertion of the transgene into the genome of Chlorella sorokiniana.

The presence of the aphVII and aphVIII transgenes in the transformed Chlorella protothecoid microalgae was verified using primer pairs AN362 / AN363 (5'-ATTGATTCGGATGATTCC-3 '/ 5'-ATCCGGCTCATCACCAG-3') and AN322 / AN323, respectively. (5'-TTGTGAGTGGGTTGTTGTGG-3 '/ 5'-AAGTCGACGCTCCCTTCAGC-3'). The clones obtained have an amplification at the expected size of 480bp for aphVII and 405bp for aphVIII (FIGS. 2B and 2C). Detection of transgenes in microalgae was carried out after 2 to 3 successive subcultures on fresh media supplemented with selection agents, which validated the insertion of the transgenes into the microalgae genome.

The transformants were monitored by detection of the nptll, aphVII and aphVIII transgenes by PCR amplifications carried out on the transformed clones after successive subcultures of the cultures. Detection of transgenes was negative for all clones transformed after 3 to 4 successive subcultures.

The analyzes were repeated on a larger number of clones obtained after transformation of the Chlorella microalgae using the nptll, aphVII and aphVIII genes. The PCR amplifications carried out on cultures derived from transformed clones give negative results, regardless of the transgene, after 3 to 4 successive subcultures. Detection of transgenes has not been possible for the few microalgae that have retained the ability to grow in the presence of the selection agent. 11.1 .6. Conclusion

The genetic transformation of the Chlorella sorokiniana and Chlorella protothecoid microalgae by the nptll, aphVII and aphVIII resistance genes made it possible to obtain transformed clones in which we could demonstrate the presence of the transgene.

The detection of transgenes in the genome of microalgae has been confirmed on 2 to 3 successive subcultures on selection media. In contrast to some clones that retained the ability to grow on selection agent during subcultures, we noted a loss of growth on the selection media of the majority of transformed Chlorella clones.

The PCR analyzes carried out over successive generations on the transformed clones, have demonstrated the loss of the detection of transgenes in the cultures of all the microalgae, whatever the selection agent used.

The genetic transformation of Chlorella was carried out using the following transformation technologies: particle bombardment, electroporation, PEG, Agrobacterium tumefaciens, intact cells and protoplasts. The detection of transformants has been validated for each of the transformation techniques. On the other hand, the detection of the transgenes was lost in all cases after 3 to 4 successive transplants of the transformants on selection medium.

The detection of transgenes in microalgae transformed on several successive transplants has demonstrated an integration of the transgene into the genome of Chlorella sorokiniana and Chlorella protothecoids. The work carried out also made it possible to highlight a problem of stability of the transgene integration in microalgae of the genus Chlorella.

11.2. Example 2: Stable transformation of microalgae of the genus Chlorella

11.2.1. Culture of microalgae

The microalgae Chlorella protothecoids (CCAP21 1 / 8D) was cultured in a medium composed of tap water supplemented with a Conway 1 X nutrient solution and tryptone at 0.5 g / L. The cultures were placed at 22 ° C under constant light. The culture in heterotrophy was carried out in the standard medium to which 10 g / l of glucose was added. The cultures were placed in the dark and at 22 ° C.

Cell count was performed by Malassez cell counting using the Algenics Algae Finder software.

11.2.2. Realization of the expression vector pAlg-CHAst-aphV7 //

The vector pAlg-CHAst-aphW // of genetic transformation of microalgae of the genus Chlorella is composed of an expression cassette comprising the aphVIII sequence coding for the selection agent paromomycin, placed under the control of the promoter sequence CaMV35S of the virus. cauliflower mosaic and the nos terminator of the nopaline synthase gene (Figure 1). Two genomic DNA sequences of Chlorella protothecoids were cloned into the vector. The genomic DNA sequences 1 and 2 correspond to two different fragments of 750 bp of the 18S rRNA. The AN58 (5'-ACCTGGTTGATCCTGCCAGT-3 ') and AN59 (5'-G ATCCTTCTG CAG GTTCACCTAC-3') primers for amplifying the 18S rRNA sequence of Chlorella protothecoids were defined after a bioinformatic analysis of the sequences available in the libraries. of data. Once sequenced, we were able to define the primers to amplify the two fragments of interest.

Both sequences were amplified on the genomic DNA of the microalgae Chlorella protothecoids using primers AN336 / AN337 (5'-AAGAATTCAACCTGGTTGATCCTGCC-3 '/ 5' -TTG G ATCCCTCG AG AC AG CAAG AG AG AG AG 3 ') and AN338 / AN339 (5'-AACTCG AGTTC ATTCAATG ACACC ACC-3' / 5'-TTG G ATCCTTG ATCCTTCTG C AG GTTC-3 ').

Fragment 1 was cloned using the EcoRI and BamHI sites inserted by PCR into the pAlg-CHAst vector. This vector is derived from the commercial vector pCambia2300 in which the selection cassette transformants p35S-npt // - T35S was removed by digestion with the enzyme Asel. The XhoI site was also inserted 3 'of the sequence, upstream of the BamHI site, in order to carry out the cloning sequence. The genomic DNA fragment 2 was also cloned into the pAlg-CHAst vector using the XhoI and BamHI sites inserted during the PCR.

The CaMV35S-aphV7 // - Tnos selection cassette was amplified by PCR from the pAlg-CHA-aphW // vector and finally cloned into the vector pAlg-CHAst in XhoI after insertion of the 5 'and 3' sites. using primers AV37 (5'-AACTCGAGCATGGAGTCAAAGATTC-3 ') and AV40 (5'-TTCTCGAGCCGATCTAGTAACATAG-3'). Figure 1 shows the map of the vector pAlg-CHAst-aphW //.

II.2.3 Genetic transformation of Chlorella microalgae

Genetic transformation of the Chlorella protothecoid microalgae was performed by particle bombardment using the modified BIORAD PDS-1000 / He (Thomas et al., 2001).

Chlorella cultures in exponential growth phase were concentrated by centrifugation (10 minutes, 2150g, 20 ° C), diluted in sterile water, and spread on agar (at 10 ⁸ cells per agar). Precipitation of the DNA was carried out by a solution containing 1.25M CaCl ₂ and 20mM spermidine, with a ratio of 1.25μg of DNA per 0.75mg of microcarriers. The transformation was carried out with firing pressures ranging from 900 to 1350psi. The microalgae Chlorella protothecoids was transformed using the pAlg-CHAst-aphW // vector in circular form and in linear form (NheI digestion).

The microalgae which underwent transformation by particle bombardment were incubated for 24 hours under constant illumination and at 22 ° C. The cells were then centrifuged, washed with the culture medium, and plated at a rate of 15 × 10 ⁶ cells per agar. on agar media containing 50mg / L of paromomycin. 11.2.4. Selection of transformed microalgae

After 15 to 21 days of culture, the potentially transformed clones of microalgae Chlorella protothecoids that have developed on the selection agar plates were transplanted a first time on a fresh medium supplemented with selection agent (50 mg / l of paromomycin). The clones were then transplanted every 10 to 15 days on selection agar plates and from the third subculture, they were also placed in liquid medium in the presence of selection agent. After 4 successive subcultures, the clones were both subcultured on media with and without a selection agent. After 5 rounds of subculture, the clones were placed in culture under heterotrophic conditions with and without selection agent. The monitoring of transgene detection was carried out after each transplanting and this in order to define the stability of the detection of transgenes in the genome of transformed microalgae.

11.2.5. Stability of transgene detection in Chlorella microalgae

The integration of the transgene into the genome of the Chlorella microalgae and the stability of the integration were verified by PCR amplification on the transformed microalgae clones, transplanted into culture media with and without a selection agent, grown under the conditions standard culture and in heterotrophic condition.

11.2.6. Stable insertion of the transgene into the Chlorella genome

Chlorella microalgae were subcultured 17 times in standard culture medium in the presence or absence of the paromomycin selection antibiotic. The maintenance of the transformed clones analyzed here represents 8 months of culture.

Chlorella microalgae transformed were also placed in culture in heterotrophic condition by adding glucose in the culture medium at a rate of 10 g / L, over a period of 3 months, in the presence and absence of selection agent.

The stability of the detection of the transgene in the genome of transformed chlorella was verified by PCR amplification using primers AN322 (5'-TTGTGAGTGGGTTGTTGTGG-3 ') and AN323 (5'-AAGTCGACGCTCCCTTCAGC-3') specific to the sequence coding aphVIII (Figure 3).

The PCR amplifications carried out on the clones transformed after 3, 9 and 14 successive subcultures, with and without a selection agent, show a constant detection at 405bp corresponding to the transgene. The detection of transgenes has been validated on the cultures after 26 successive transplants which represents 1 year and 8 months of culture (data not shown). These results demonstrate the stability of transgene integration in the genome of the microalga of industrial interest Chlorella protothecoids. II.2.7. Stability of transgene detection after crvopreservation of transformed microalgae

The transformed clones of the microalgae Chlorella protothecoids were cryopreserved at -80 ° C. In order to validate the stability of the integration of the transgenes into the genome of the microalgae, PCR analyzes were carried out on cultures after 4 successive subcultures. cryopreserved clones for 2 months. Figure 4 shows the detection of the transgene in all the analyzed clones thus demonstrating the stability of the integration of the transgenes after a passage in cryopreservation.

11.2.8. Stable insertion of the entire vector randomly into the Chlorella genome

The stable insertion of the pAlg-CHAst-aphW // vector has been verified in microalgae

Chlorella transformed and regularly transplanted into the standard culture medium in the presence of the paromomycin selection antibiotic. Detection of the selection gene and the rest of the vector in the genome of the transformed chlorella was carried out by PCR amplification using different pairs of primers specific for the sequence of the vector. Figure 5 shows schematically the PCR amplifications carried out on the whole pAlg-CHAst-aphW // transformation vector.

Amplification 1 corresponds to the demonstration of the presence of the transgene aphVIII in transformed microalgae Chlorella.

The PCR amplifications carried out using primers AN322 (5 '- TTGTGAGTGGGTTGTTGTGG-3') and AN323 (5'-AAGTCGACGCTCCCTTCAGC-3 ') specific for the transgene aphVIII are shown in FIG. 6. The amplifications obtained for the 3 clones of Chlorella microalgae transformed with the pAlg-CHAst-aphW // vector made it possible to obtain a band at the expected size of 405 bp, also visible for the amplification carried out on the control vector. No amplification was obtained for the untransformed microalgae. This result shows that the microalgae have incorporated the aphVIII transgene which confers resistance to paromomycin.

Amplifications 2 and 3 correspond to the demonstration of the presence of the sequences of two genes present in the pAlg-CHAst-aphW // vector in the transformed Chlorella microalgae.

The PCR amplifications carried out using the primer pairs AN367 (5 '-

AACGCATGAAGGTTATCG-3 ') / AN368 (5'-AAGAATGGGCAGCTCGTACC-3') and AN369 (5'-AC AAAG ATGTTG CTGTCTCC-3 ') / AN370 (5'-AGTATGAAGATGAACAAAGC-3') respectively specific for genes 1 and 2 present on the pAlg-CHAst-aphW // vector and on both sides of the aphVIII transgene, are shown in FIG. 6. The amplifications carried out on the non-transformed microalgae did not give any result. For the 3 clones of the transformed microalgae Chlorella, amplifications to the expected sizes, respectively 292 and 497bp, were obtained, also visible for the amplifications carried out on the pAlg-CHAst-aphW // vector. This result shows that the microalgae have stably incorporated the entire transformation vector.

Amplifications 4a and 4b correspond to the demonstration of the presence of the selection cassette between fragments 1 and 2 in the transformation vector in transformed Chlorella microalgae.

PCR amplifications using primer pairs AN433 (5 '- TTTAATGTACTG AATTAACG - 3') / AN434 (5 '- TAATAATTAACATGTAATG C - 3') and AN371 (5 '- TCACAACCGGGATACCGACC - 3') / AN372 ( 5'-ATCGGTGCGGGCCTCTTCG-3 ') respectively amplify the 5' and 3 'portions of the aphVIII expression cassette of the pAlg-CHAst-aphV7 // vectors, encompassing sequences 1 and 2 of the Chlorella genome (Figure 5). The results obtained, shown in FIG. 6, show that no amplification has been obtained for the non-transformed microalgae. On the other hand, for the 3 clones of the microalgae Chlorella transformed, amplifications to the expected sizes, respectively 1 103 and 1519bp, were obtained, also visible for the amplifications carried out on the control vector. This result shows that the aphVIII expression cassette was randomly inserted into the microalgae genome.

Moreover, this result, coupled with those obtained previously, show that the microalgae have stably and randomly incorporated the entire vector pAlg-CHAst-aphW // integrally. These results, validated on the clones transformed with plasmid DNA in circular and linear form, confirm that the integration into the genome was performed randomly.

11.2.9. Conclusion

Genetic transformation of the Chlorella protothecoid microalgae using the pAlg-CHAst-aphW // vector has yielded transformed microalgae lines. The detection of the transgene carried out on cultures after successive transplants, cultures with and without a selection agent, cultures placed in autotrophic and heterotrophic conditions, and in cultures which have undergone cryopreservation, validates that the integration of the transgene is stable. Detection by PCR amplification of the different parts of the vector pAlg-CHAst-aphW // in the genome of transformed microalgae showed that insertion into the genome had occurred by random insertion.

In contrast to the transformation results obtained in Example 1 which showed instability of the integration of the transgenes, the use of the 18S rRNA genomic sequences in the transformation vector made it possible to stabilize the random integration of the transgenes into the genome of the transgenes. microalgae of the genus Chlorella.

Thus, we have developed a method which has made it possible to remove the biology lock identified in Example 1, and which makes it possible to stably transform microalgae of the genus Chlorella by random insertion of the transgene.

II.3. Example 3: stable genetic transformation of microalgae of the genus Chlorella

11.3.1. Strains of Chlorella

The microalgae are Chlorella sorokianiana (UTEX1663, UTEX1230), Chlorella vulgaris (CCAP21 1/1 1 B, SAG280), Chlorella autotrophica CCMP243, Chlorella protothecoids (CCAP21 1 / 7A, CCAP21 1 / 8D), Chlorella zofin§iensis (CCAP21 1 / 14; UTEX32), Chlorella minutissima (UTEX2219) and Chlorella beijerinckii (SAG20.46).

11.3.2. Culture of microalgae

Chlorella microalgae are cultivated in a medium composed of tap water supplemented with a nutrient solution of Conway 1 X, tryptone at 0.5 g / L or KN0 ₃ at 1.5 g / L according to the microalgae, and in the medium commercial BG1 1 (C3061, Sigma). The cultures are placed at 22 ° C. under constant light. The heterotrophic culture is performed in the standard medium to which are added 10 g / l of glucose. The cultures are placed at 22 ° C in the dark.

The cell count is performed by counting on a Malassez cell using the Algenics Algae Finder software.

I I.3.3. Realization of expression vectors

The vector base used for the genetic transformation of Chlorella microalgae is the pAlg-CHAst-aphW // vector used in Example 2.

The 18S rRNA sequences of each of the microalgae were amplified using primers AN58 (ACCTGGTTGATCCTGCCAGT) and AN59 (G ATCCTTCTG CAG GTTCACCTAC). Once sequenced, the primers for amplifying two specific fragments for each microalgae were defined (Table 1).

The genomic DNA sequences 1 and 2 corresponding to the two fragments of the 18S rRNA of each of the microalgae of the genus Chlorella, were amplified using the primers described in Table 1. Sites for the restriction enzymes EcoRI and XhoI / BamHI were respectively inserted 5 'and 3' of fragment 1. The XhoI and BamHI sites were respectively inserted 5 'and 3' of fragment 2. Each of the fragments as well as the CaMV35S-aphV7 // - Tnos selection cassette were cloned into the transformation vector pAlg-CHAst-aphVIII. of Chlorella as described in Example 2.

I I.3. . Genetic transformation of Chlorella microalgae

Chlorella cultures in the exponential growth phase were concentrated by centrifugation (10 minutes, 50 g, 20 ° C), diluted in sterile water, and spread on agar (at 10 ⁸ cells per agar). Precipitation of the DNA was carried out by a solution containing 1.25M CaCl ₂ and 20mM spermidine, with a ratio of 1.25μg of DNA per 0.75mg of microcarriers. The transformation was carried out with firing pressures ranging from 900 to 1350psi. The Chlorella microalgae were transformed using the vector pAlg-CHAst-aphW // possessing the homologous genomic DNA fragments, in circular form and in linear form.

The microalgae which underwent transformation by particle bombardment were incubated for 24 hours under constant illumination and at 22 ° C. The cells were then centrifuged, washed with the culture medium, and plated at 1 × 10 ⁶ cells per agar. on agar media containing 50 mg / l of paromomycin.

I I.3.5. Selection of transformed microalgae

After 15 to 21 days of culture, the potentially transformed clones of the Chlorella microalgae that developed on the selection agar plates were transplanted a first time on a fresh medium supplemented with a selection agent (50 mg / l of paromomycin). The clones were then regularly transplanted onto selection agar plates and after the third transplant, they were also placed in a liquid medium. presence of selection agent. After 4 successive subcultures, the clones were both subcultured on media with and without a selection agent. After 5 rounds of subculture, the clones were placed in culture under heterotrophic conditions with and without selection agent. The monitoring of transgene detection was carried out after each transplanting and this in order to define the stability of the detection of transgenes in the genome of transformed microalgae.

11.3.6. Stability of transgene detection in Chlorella microalgae

The integration of the transgene into the genome of microalgae of the genus Chlorella and the stability of the integration were verified by PCR amplification on the transformed clones obtained for the microalgae, subcultured in culture media with and without a selection agent, grown in the standard conditions of culture and in heterotrophic condition.

11.3.7. Stable insertion of the transgene into the Chlorella genome

Chlorella microalgae were subcultured successively in the standard culture medium in the presence or absence of the paromomycin selection antibiotic.

The transformed Chlorella microalgae were also placed in culture under heterotrophic conditions by adding glucose to the culture medium at the rate of 10 g / L, in the presence and in the absence of a selection agent.

The stability of the detection of the transgene in the genome of the transformed chlorella was verified by PCR amplification using primers AN322 (5 '- TTGTGAGTGGGTTGTTGTGG-3') and AN323 (5 '-AAGTCGACGCTCCCTTCAGC-3') specific for the sequence. coding aphVIII.

Figure 8 shows the detection of the transgene in Chlorella protothecoid microalgae (CCAP21 1 / 7A) and Chlorella beijerinckii (SAG20.46) after 1 5 subcultures. The presence of a band at the expected size of 405 bp in the transformants demonstrates the presence of the transgene.

These results validate the methodology developed for the stable insertion of transgene into the genome of Chlorella microalgae.

11.3.8. Stability of transgene detection after crvopreservation of transformed microalgae

The transformed clones of microalgae of the Chlorella genus were cryopreserved at -80 ° C. In order to validate the stability of the integration of transgenes into the genome of the microalgae, PCR analyzes were performed on cultures derived from cryopreserved clones during 2 month.

I I.3.9. Stable insertion of the entire vector randomly into the Chlorella microalgae genome

The stable insertion of the pAlg-CHAst-aphW // vector was verified in the Chlorella microalgae transformed and regularly subcultured in the standard culture medium in the presence of the paromomycin selection antibiotic. The detection of the selection gene and of the remainder of the vector in the genome of transformed chlorella was carried out by PCR amplification using different pairs of primers specific for the sequence of the vector. Figure 5 shows schematically the PCR amplifications carried out on the whole pAlg-CHAst-aphW // transformation vector.

Amplification 1 corresponds to the demonstration of the presence of the transgene aphVIII in transformed microalgae Chlorella. The PCR amplifications were carried out using primers AN322 (5'-TTGTGAGTGGGTTGTTGTGG-3 ') and AN323 (5'-AAGTCGACGCTCCCTTCAGC-3') specific for the transgene aphVIII. Figure 8 shows the detection of the transgene in the genome of Chlorella protothecoid microalgae (CCAP21 1 / 7A) and Chlorella beijerinckii (SAG20.46).

Amplifications 2 and 3 correspond to the demonstration of the presence of the sequences of 2 genes present in the pAlg-CHAst-aphW // vector in the transformed Chlorella microalgae. PCR amplifications were performed using primer pairs AN367 (5'-AACGCATGAAGGTTATCG-3 ') / AN368 (5'-AAG AATG GG CAG CTCGTACC-3') and AN369 (5 '- ACAAAG ATGTTG CTGTCTCC - 3 ') / AN370 (5'-AGTATGAAGATGAACAAAGC-3') respectively specific for genes 1 and 2 present on the pAlg-CHAst-aphW // vector and on both sides of the aphVIII transgene (FIG. 5). The detection of a band at the expected sizes, respectively 497 bp and 292 bp (data not shown), validates the presence of the entire transformation vector pAlg- CHAst, stably integrated into the genome of each of the microalgae of the genus Chlorella transformed.

Amplifications 4a and 4b correspond to the demonstration of the presence of the selection cassette between fragments 1 and 2 in the transformation vector in transformed Chlorella microalgae. PCR amplifications were performed using primer pairs AN433 (5'-TTTAATGTACTG AATTAACG-3 ') / AN434 (5'-TAATAATTAACATGTAATG C-3') and AN371 (5'-TCACAACCGGGATACCGACC-3 ') / AN372 (5'-ATCGGTGCGGGCCTCTTCG-3 ') respectively allowing the 5' and 3 'portions of the aphVIII expression cassette of the pAlg-CHAst-aphW // vectors to be amplified, including sequences 1 and 2 of the Chlorella genome (Figure 5). Detection of bands at the expected sizes for each of the transformants (data not shown), validates the fact that the aphVIII expression cassette has randomly inserted into the microalgae genome.

These results show that microalgae of the Chlorella genus have stably and randomly integrated the entire vector pAlg-CHAst-aphW // integrally.

These results, obtained on the microalgae of the Chlorella genus, confirm those obtained in Example 2, and confirm that the use of the 18S rRNA genomic sequences in the transformation vector has made it possible to stabilize the random integration of the transgenes into the genome of the microalgae of the genus Chlorella. Thus, the methodology developed here allows the microalgae of the genus Chlorella to be stably transformed by random insertion of the transgene. 11.4. Example 4: Stable genetic transformation of Chlorella protothecoids using vectors having different sequences homologous to the genomic DNA of the microalgae

11.4.1. Culture of microalgae

11.4.2. Use of the selection genes nptll and aphVII for the stable transformation of microalgae Chlorella protothecoids.

Realization of the vectors pAlg-CHAst-npf // and pAlg-CHAst-aphW /

The CaMV35S-npt // -Nos and pCaMV35S-aphV7 / -Tnos selection cassettes were amplified from the pAlg-CHA vectors using primers AV37 (5'-AACTCGAGCATGGAGTCAAAGATTC-3 ') and AV40 (5'- TTCTCGAGCCGATCTAGTAACATAG-3 '). They were then cloned in place of the CaMV35S-aphV7 // Tnos cassette in the pAlg-CHAst-aphW // vector using the XhoI sites inserted at 5 'and 3' sequences during amplification. PCR.

Genetic transformation of the Chlorella microalgae using the pAlg-C Ast-aphVII vector provided stable transformants (data not shown).

11.4.3. Using 18S rRNA Genomic DNA fragment 1 for the stable transformation of Chlorella protothecoid microalgae.

The objective is to demonstrate that the presence of a single fragment, or 2 identical fragments, homologous to endogenous sequences allows the stabilization of the random integration of transgenes into the Chlorella protothecoid genome.

Realization of the Fragmentl -aphVIII construct and Fragment 1 -aphVIII- Fragment 1

Chlorella 18S rRNA fragment 1 protothecoids was amplified from genomic DNA of the microalgae using primers AN336 (5'-AAGAATTCAACCTGGTTGATCCTGCC-3 ') and AN337 (5'-

TTG G ATCCCTCG AG AG AG CAAG AG AG AG C - 3 '). It was then cloned using the EcoRI and BamHI sites inserted by PCR into the pAlgCHAst-F1 vector from the pCambia2300 commercial vector in which the p35S-npt // - T35S transformants selection cassette was removed by digestion with the Asel restriction enzyme.

The pAlgCHAst-F1 -aphVIII vector was produced by cloning the CaMV35S-aphV7 // - Tnos selection cassette into the vector pAlgCHAst-F1 into XhoI after insertion of the 5 'and 3' sites by PCR using primers AV37 (5'-AACTCGAGCATGGAGTCAAAGATTC-3 ') and AV40 (5'-TTCTCG AG CCG ATCTAGTAACATAG-3'). The vector pAlgCHAst-F1 -aphVH1-? was performed by cloning a second fragment 1 of Chlorella protothecoid 18S rRNA into the pAlgCHAst-F1-aphVIII vector downstream of the selection cassette. Fragment 1 was recovered by digestion of the donor vector with HindIII-EcoRV enzymes, and cloned into the vector pALgCHAst-F1 -aphVIII digested with HindIII and Pvull enzymes.

II.4.4. Use of different genomic DNA fragments for stable transformation of microalgae Chlorella protothecoids

The objective is to demonstrate that the origin and size of the genomic sequences present in the vector pAlg-CHAst-aphW // are not directly responsible for the stabilization of the genetic transformation of Chlorella protothecoids, but that the stabilization of the Integration of transgenes is due to the implemented strategy of including DNA sequences homologous to the genomic DNA of the microalgae in the vector. This strategy makes it possible to stabilize the random insertion of transgenes into the genome of Chlorella microalgae.

Analyzes carried out in databases coupled with bioinformatics analyzes made it possible to characterize genome sequences of the microalgae Chlorella protothecoids. The PCR amplifications carried out on the genomic DNA and the sequencing of the amplicons obtained made it possible, in particular, to identify the sequences of the genes coding for the 28S rRNAs, the glutamine synthetase, the ammonium transporter and a protein involved in the degreening process.

The constructs for the stable genetic transformation of Chlorella protothecoids were made using specific sequences of these 4 genes, amplified from the genomic DNA of the microalgae using the pairs of primers defined after the sequencing of the genes and described in Table 1.

The vector base used for the genetic transformation of microalgae

Chlorella is the vector pAlg-CHAst-aphW // used in Example 2. The sequence of fragments 1 and 2 of the 18S rRNA were replaced by the specific fragments of the genes mentioned above.

Two 750 pb fragments were amplified for 28S rRNA (SEQ ID N: 43 and SEQ ID NO: 44) and cloned into the transformation vector using the inserted EcoRI, BamHI, and XhoI sites. 5 'and 3' of the sequence during the PCR.

Two 450 bp fragments were amplified for the gene encoding a degreening protein (SEQ ID NO: 34 and SEQ ID NO: 35) and were cloned into the transformation vector using the EcoRI, BamHI sites, and XhoI inserted 5 'and 3' of the sequence during PCR.

Two 550 bp fragments were amplified for the gene coding for glutamine synthetase (SEQ ID N: 37 and SEQ ID N: 38) and were cloned into the transformation vector using the EcoRI, SalI, and XhoI sites. inserted 5 'and 3' of the sequence during the PCR.

Two 750 bp fragments were amplified for the gene encoding an ammonium transporter (SEQ ID N: 40 and SEQ ID N: 41) and cloned into the vector of transformation using the EcoRI, BamHI, and XhoI sites inserted at 5 'and 3' of the sequence during the PCR.

The last vector made consists of associating DNA fragments remote from the genome of the microalgae Chlorella protothecoids. It is carried out by cloning fragment 1 of the glutamine synthetase gene and fragment 2 of the ammonium transporter gene whose loci are located on different scaffolds.

11. .5. Genetic transformation of Chlorella microalgae

Chlorella cultures in exponential growth phase were concentrated by centrifugation (10 minutes, 2150g, 20 ° C), diluted in sterile water, and spread on agar (at 10 ⁸ cells per agar). Precipitation of the DNA was carried out by a solution containing 1.25M CaCl ₂ and 20mM spermidine, with a ratio of 1.25μg of DNA per 0.75mg of microcarriers. The transformation was carried out with firing pressures ranging from 900 to 1350psi. The Chlorella microalgae were transformed using the vector pAlg-CHAst-aphW // possessing the homologous genomic DNA fragments, in circular form and in linear form.

The microalgae which undergo transformation by particle bombardment were incubated for 24 hours under constant illumination and at 22 ° C. The cells were then centrifuged, washed with the culture medium, and plated at a rate of 15 × 10 ⁶ cells per agar, on agar media containing 50 mg / L of paromomycin.

11.4.6. Selection of transformed microalgae

After 15 to 21 days of culture, the potentially transformed clones of Chlorella microalgae that developed on the selection agar plates were transplanted a first time on a fresh medium supplemented with selection agent (50 mg / l of paromomycin). The clones were then regularly transplanted on selection agar plates and from the third subculture, they were also placed in liquid medium in the presence of selection agent. After 4 successive subcultures, the clones were both subcultured on media with and without a selection agent. After 5 rounds of subculture, the clones were placed in culture under heterotrophic conditions with and without selection agent. The monitoring of transgene detection was carried out after each transplanting and this in order to define the stability of the detection of transgenes in the genome of transformed microalgae.

II.4.7. Stability of transgene detection in Chlorella microalgae

The integration of the transgene into the genome of microalgae of the genus Chlorella and the stability of the integration were verified by PCR amplification on the transformed clones obtained for the microalgae, subcultured in culture media with and without a selection agent, grown in the standard conditions of culture and in heterotrophic condition. 11.4.8. Stable insertion of the transgene into the Chlorella genome

Chlorella microalgae were subcultured 15 times successively in the standard culture medium in the presence or absence of the paromomycin selection antibiotic.

Chlorella microalgae transformed were also placed in culture under heterotrophic conditions by adding glucose to the culture medium at a rate of 10 g / L, in the presence and absence of selection agent.

The stability of the detection of the transgene in the genome of transformed chlorella was verified by PCR amplification using primers AN322 (5'-TTGTGAGTGGGTTGTTGTGG-3 ') and AN323 (5'-AAGTCGACGCTCCCTTCAGC-3') specific for the sequence coding aphVIII.

11.4.9. Detection of transgenes in Chlorella microalgae

Genetic transformation of the microalgae Chlorella protothecoids was carried out using the constructs pAlgCHAst-F1 -aphVIII, pAlgCHAst-F1 -aphV7 // - F1, and with the vector pAlg-CHAst-aphW // in which the fragments 1 and 2 corresponding to fragments of the 28S RNA, or a degreening protein, or glutamine synthetase, or an ammonium transporter.

Detection of the presence of the transgene aphVIII in the transformed Chlorella microalgae was carried out by PCR amplifications using the primers AN322 (5'-TTGTGAGTGGGTTGTTGTGG-3 ') and AN323 (5'-AAGTCGACGCTCCCTTCAGC-3') specific for the transgene aphVIII . The results obtained are described in Figures 7 and 8.

The detection of a band at the expected size of 405 bp corresponding to the aphVIII sequence validates the presence of the transgene in the genome of microalgae of the genus Chlorella transformed with the constructs pAlgCHAst-F1 -aphVIII and pAlgCHAst-F1-aphVIII ^ (FIG. ). This result also shows that the presence of a single fragment or twice the same fragment in the vector makes it possible to obtain stable transformants of the microalgae of the genus Chlorella.

The PCR amplifications carried out on the clones obtained after transformation with the pAlg-CHAst vector in which the F1 and F2 fragments of the 18S RNA were replaced by fragments corresponding to either the 28S sequence, the glutamine synthetase sequence or the sequence ammonium transporter, revealed a band at the expected size of 405 bp corresponding to the sequence aphVIII (Figure 8). This result validates the presence of the transgene in the genome of Chlorella microalgae transformed with these vectors. This result also shows that the presence of DNA fragment other than 18S RNAs in the transformation vector makes it possible to obtain stable transformants of the chlorella microalgae.

11.4.10. Stability of transgene detection after crvopreservation of transformed microalgae

The transformed clones of microalgae of the genus Chlorella were cryopreserved at -80 ° C. In order to validate the stability of the integration of the transgenes in the genome of the microalgae, PCR analyzes were performed on cultures from cryopreserved clones for 2 months.

11.4.1 1. Stable insertion of the entire vector randomly into the Chlorella microalgae genome

The stable insertion of the pAlg-CHAst-F1 -aphVIII and pAlg-CHAst-F1 -aphVIII vectors was verified in the Chlorella microalgae transformed and regularly subcultured in the standard culture medium in the presence of the paromomycin selection antibiotic. Detection of the selection gene and the rest of the vector in the genome of the transformed chlorella was carried out by PCR amplification using different pairs of primers specific for the sequence of the vector. FIG. 5 schematizes the PCR amplifications carried out on the entire pAlg-CHAst-aphVIII transformation vector.

Amplification 1 corresponds to the demonstration of the presence of the transgene aphVIII in transformed microalgae Chlorella. The PCR amplifications carried out using primers AN322 (5'-TTGTGAGTGGGTTGTTGTGG-3 ') and AN323 (5'-AAGTCGACGCTCCCTTCAGC-3') specific for the transgene aphVIII are shown in FIG. 7.

The PCR amplifications carried out on 3 clones of the Chlorella microalgae transformed with the pAlg-CHAst-F1 -aphVIII and pAlg-CHAst-F1 -aphV7 //-F1 vectors gave a band at the expected size of 405 bp. This band, visible for the amplification carried out on the control vector, is absent for the untransformed microalgae. This result shows that the microalgae have incorporated the aphVIII transgene which confers resistance to paromomycin.

Amplifications 2 and 3 correspond to the demonstration of the presence of the sequences of two genes present in the vector pAlg-CHAst-F1 -aphVIII and pAlg-CHAst-F1 -aphV7 // - F1 in the transformed Chlorella microalgae. PCR amplifications using primer pairs AN367 (5'-AACGCATGAAGGTTATCG-3 ') / AN368 (5'-AAG AATG GG CAG CTCGTACC-3') and AN369 (5 '- AC AAAG ATGTTG CTGTCTCC - 3 )) / AN370 (5'-AGTATGAAGATGAACAAAGC-3 ') respectively specific for the genes 1 and 2 present on the vectors and on either side of the aphVIII transgene are shown in FIG. 7.

The amplifications carried out on the unprocessed microalgae did not give any result. For the transformed Chlorella clones, amplifications to the expected sizes, respectively 292 and 497 bp, were obtained as well as for the vectors pAlg-CHAst-F1 -aphV7 // and pAlg-CHAst-F1 -aphV7 //-F1. This result shows that microalgae have stably integrated the entire transformation vector.

The amplifications 4a and 4b correspond to the demonstration of the presence of the selection cassette, either downstream of the F1 fragment in the pAlg-CHAst-F1-aphVIII vector, or between the two F1 fragments in the pAlg-CHAst-vector. F1 -aphV7 // - F1, in transformed Chlorella microalgae. The PCR amplifications carried out using the primer pairs AN433 (5'-TTTAATGTACTG AATTAACG-3 ') / AN434 (5'-TAATAATTAACATGTAATG C-3') and AN371 (5'-TCACAACCGGGATACCGACC-3 ') / AN372 ( 5'- ATCGGTGCGGGCCTCTTCG-3 ') respectively make it possible to amplify the 5' and 3 'portions of the aphVIII expression cassette of the pAlg-CHAst-aphW // vectors, including sequences 1 and 2 of the Chlorella genome (FIG. 5).

The results obtained, presented in FIG. 7, show that no amplification has been obtained for the non-transformed microalgae. Amplifications to the expected sizes, respectively 103, 768 and 1522 bp, were obtained for the 6 transformed Chlorella clones, as well as for the control vectors. This result shows that the aphVIII expression cassette was randomly inserted into the microalgae genome.

This result, coupled with those obtained previously, show that the microalgae have integrated stably and randomly all of the vectors pAlg-CHAst-F1-aphVIII and pAlg-CHAst-F1 -aph V7 //-F1 integrally. These results, validated on the clones transformed with plasmid DNA in circular and linear form, confirm that the integration into the genome was performed randomly.

11.4.12. Conclusion

Genetic transformation of the microalgae Chlorella protothecoids using the vectors pAlg-CHAst-F1 -aphVIII and pAlg-CHAst-F1 -aphV7 // - F1 provided stable transformed lines of the Chlorella microalgae. Detection by PCR amplification of the different parts of the vectors in the genome of the transformed microalgae showed that the insertion into the genome had taken place by random insertion and that the vectors were present in an intact form.

The present results, together with the results of Examples 2 and 3, demonstrate that the use of a single fragment, 2 identical fragments, or 2 different fragments, homologous to endogenous Chlorella sequences, such as sequences of gene (eg coding for the degreening protein, an ammonium transporter, or glutamine synthetase) or ribosomal RNA coding sequences (18S, 28S, 5.8S), makes it possible to transform stably (ie after more of 15 subcultures) microalgae of the genus Chlorella, this by random insertion of the transgene.

II.5. Example 5 Production of Molecules of Industrial Interest in Chlorella

11.5.1. Strains of Chlorella

The microalgae are Chlorella sorokianiana UTEX1663, Chlorella vulgaris SAG280 and SAG21 1 .1 1b, Chlorella autotrophica CCMP243, Chlorella NC64A SAG21 1 .6, Chlorella protothecoids CCAP21 1 / 8D and SAG21 1 .7C, Chlorella Kessleri SAG27.87, Chlorella ellipsoida SAG2141 .

II.5.2. Culture of microalgae

The microalgae Chlorella were grown in a medium composed of tap water supplemented with a nutrient solution of Conway 1 X, tryptone at 0.5 g / L or KN0 ₃ at 1.5 g / L according to the microalgae, and in the commercial medium BG1 1 (C3061, Sigma). The cultures were placed at 22 ° C under constant light. The culture in heterotrophy has was performed in the standard medium to which were added 10g / L of glucose. The cultures were placed in the dark and at 22 ° C.

II.5.3. Detection of glvcoproteins of microalgae of the genus Chlorella

Chlorella microalgae protein samples were separated on 12% SDS-PAGE gel and transferred to nitrocellulose membrane (RPN303D, GE Healthcare). After saturation of the nitrocellulose membrane for 5 minutes in 2% TBS Tween20 solution, glvcoproteins were detected by affinodetection using horseradish peroxidase conjugated Concanavalin A lectin (Sigma, L6397). Figure 9 shows the results obtained for different microalgae of the genus Chlorella.

Chlorella microalgae have profiles in which glvcoproteins have been detected. These microalgae thus have the ability to produce mature glycosylated proteins. Because of their high industrial potential and their ability to perform post-translational modifications such as N-glycosylation, Chlorella microalgae are very good candidates as expression systems for the production of glycosylated proteins of therapeutic interest. such as monoclonal antibodies, viral envelope proteins, or lysosomal enzymes.

11.5.4. Production of marker proteins in the microalgae Chlorella protothecoids The regulatory sequences of viral origin A3R (SEQ ID No.) and A208R (SEQ ID No.), were synthesized with the addition of the EcoRI site 5 'and 3' of each of the sequences. These promoters were then cloned into the pAlg-CHA vector in place of the CaMV35S promoter.

The genes coding for the reporter proteins eGFP (SEQ ID NO: 8) and GUS (SEQ ID NO: 9) were respectively amplified from the pPT-eGFP vectors (Zaslavskaia et al., 2000) and pBi ^' 121 (GenBank: AF485783 ) using primer pairs AV49 (5'-AAGGATCCATGGTGAGCAAGGGCGAG-3 ') / AV50 (5'-TTG AG CTCTTACTTGTACAG CTCGTC-3') and AV51 (5'-AAGGATCCATGTTACGTCCTGTAGAAAC-3 ') / AV52 (5' TTGAGCTCTCATTGTTTGCCTCCCTG-3 '). The coding sequences were then cloned into the pAlg-CHA vector under the control of the A3R promoter for the gus gene, and A208R for the egfp gene.

The expression cassettes pA3R-çjus-Tnos and pA208R-ej / p-Tnos were amplified using the primers AV47 (5'-G CTCCTG GTCG AACATG G-3 ') or AV48 (5'-G AGTCAACATATG GGGGG - 3 ') and AV40 (5'-TTCTCG AGCCG ATCTAGTAACATAG - 3') before being cloned into free ends in the vector pAlg-CHAst-aphW //. The cloning site of the expression cassettes is downstream of fragment 2 of the 18S rRNA. 11.5.5. Production of glvcoproteins of therapeutic interest in the microalga Chlorella protothecoids

The heavy and light chain sequences of the monoclonal antibody of therapeutic interest Rituximab (SEQ ID NO: 10, SEQ ID NO: 1 1) were synthesized. The BamHI and SacI sites were respectively inserted at 5 'and 3' of each of the sequences.

The heavy chain was cloned into the vector pAlg-CHA-çjus instead of the sequence gus downstream of the viral promoter A3R. The light chain was cloned into the pAlg-CHA-ej / p vector in place of the egfp sequence downstream of the A208R viral promoter.

The expression cassettes pA3R-CM.rtx-Tnos and pA208R-Ch / rtx-Tnos were amplified using primers AV47 (5'-G CTCCTG GTCG AACATG G-3 ') or AV48 (5'-G). AGTCAACATATG GGGGG-3 ') and AV40 (5'-TTCTCG AGCCG ATCTAGTAACATAG-3') before being cloned into free ends in the vector pAlg-CHAst-aphW //. The cloning sites of the expression cassettes are upstream of the fragment 1 and downstream of the fragment 2 of the 18S rRNA.

11.5.6. Genetic transformation of Chlorella microalgae

Chlorella cultures in exponential growth phase were concentrated by centrifugation (10 minutes, 2150g, 20 ° C), diluted in sterile water, and spread on agar (at 10 ⁸ cells per agar). Precipitation of the DNA was carried out by a solution containing 1.25M CaCl ₂ and 20mM spermidine, with a ratio of 1.25μg of DNA per 0.75mg of microcarriers. The transformation was carried out with firing pressures ranging from 900 to 1350psi. The microalgae Chlorella protothecoids was transformed using the pAlg-CHAst-aphW // vector in circular form and in linear form.

The microalgae which underwent transformation by particle bombardment were incubated for 24 hours under constant illumination and at 22 ° C. The cells were then centrifuged, washed with the culture medium, and plated at a rate of 15 × 10 ⁶ cells per agar. on agar media containing 50mg / L of paromomycin.

II.5.7. Selection of transformed microalgae

After 15 to 21 days of culture, the potentially transformed clones of Chlorella microalgae that developed on the selection agar plates were transplanted a first time on a fresh medium supplemented with selection agent (50 mg / l of paromomycin). The clones were then regularly transplanted on selection agar plates and from the third subculture, they were also placed in liquid medium in the presence of selection agent. After 4 successive subcultures, the clones were both subcultured on media with and without a selection agent. After 5 rounds of subculture, the clones were placed in culture under heterotrophic conditions with and without selection agent. The monitoring of transgene detection was carried out after each transplanting and this in order to define the stability of the detection of transgenes in the genome of transformed microalgae. 11.5.8. Detection of reporter proteins in Chlorella protothecoids transformants

Chlorella protothecoid microalgae clones transformed with the GUS protein coding sequence are cultured under standard culture conditions. The cells in the exponential growth phase are recovered by centrifugation (10 minutes, 2150 g, 20 ° C.) and then incubated in the GUS reaction buffer. The observation of the specific blue staining of the expression of the gus gene is carried out after 24 hours using a photonic microscope.

Chlorella protothecoid microalgae clones transformed with the coding sequence for the eGFP fluorescent protein were cultured under standard culture conditions. The cells in exponential growth phase were recovered by centrifugation (10 minutes, 2150 g, 20 ° C.) and then observed using an epichlorofusion microscope.

Wild-type cells and cells expressing the eGFP protein of the microalgae Chlorella protothecoids were lysed. Protein extracts were analyzed by immunoblotting using an anti-eGFP antibody (Santa Cruz, sc-9996-HRP). The results obtained are described in Figure 10.

The detection of the eGFP protein revealed for the positive control (T +) a band at the expected size (about 27 kDa) whereas no signal is detected for the untransformed strain of the Chlorella microalgae (wt). Detection of a band at the expected size for all transformed Chlorella clones demonstrates expression of the reporter gene. This result demonstrates that microalgae transformed with the pAlg-CHAst-sGFP vector are able to produce the protein of interest.

The expression of the eGFP protein in the transformants was monitored as successive subcultures were observed by observation in microscopy and western blot. The detection of the protein was validated after 20 successive transplants testifying to the stability of the integration and the expression of the transgenes in the transformed Chlorella microalgae.

11.5.9. Detection of Rituximab Antibody in Chlorella Protothecoids Transformants

The culture supernatants of the wild-type strains transformed with the coding sequences for the heavy and light chains of the commercial Rituximab antibody are recovered by centrifugation (10 minutes, 2150 g, 20 ° C.) of exponential phase culture. growth. The detection of the recombinant antibody secreted in the culture medium of the transformed microalgae is carried out using the anti-human IgG antibody (Sigma, A6029-HRP). BIBLIOGRAPHIC REFERENCES

Cha T., Yee W. and Aziz A. (2012). "Assessment of factors affecting Agrobacterium-mediated genetic transformation of the unicellular green alga, Chlorella vulgaris." World Journal of Microbiology and Biotechnology 28 (4): 1771-1779.

Chow K.C. and Tung W.L. (1999). "Electrotransformation of Chlorella vulgaris." Plant Cell Reports 18: 778-780.

Jarvis E.E. and Brown L.M. (1991). "Transient expression of firefly luciferase in protoplasts of the green alga Chlorella ellipsoidea." Current Genetics 19 (4): 317-321.

Lu Y., Kong R. and Hu L. (2011). "Preparation of Protoplasts from Chlorella Protothecoids." World Journal of Microbiology and Biotechnology 28 (4): 1827-1830.

Maruyama M., Horakova I., Honda H., Xing X.H., Shiragami N. and Unno H. (1994). "Introduction of foreign DNA into Chlorella saccharophila by electroporation." Biotechnology Techniques 8 (11): 821-826.

Needleman S.B. and Wunsch CD. (1970). "A troublesome method for the search for similarities in the amino acid sequence of two proteins." Journal of Molecular Biology 48 (3): 443-453.

Rakkhumkaew N., Kawasaki T., Fujie M. and Yamada T. (2012). "Prolonged synthesis of hyaluronan by Chlorella cells infected with chloroviruses." Journal of Bioscience and Bioengineering [Epub ahead of print].

Thomas J.L., Bardou J., The Hosts J., Mauchamp B., and Chavancy G. (2001). "Helium burst biolistic device adapted to penetrate fragile insect tissues". Journal of Insect Science.

Zaslavskaia L., Casey Lippmeier J., Kroth P., Grossman A. and Apt E. (2000). "Transformation of the diatom Phaeodactylum tricornutum (Bacillariophyceae) with a variety of selectable marker and reporter genes." Journal of Phycology 36: 379-386.

of the agent 364871D32009

indications are given of all designations

RESERVED FOR RECEIVER OFFICE

Aoustin, Isabelle

RESERVED FOR THE INTERNATIONAL BUREAU

0-5 This sheet has reached the Office

international:

0-5-1 Authorized Official

SUBSTITUTE SHEET (RULE 26)

Claims

1. A process for obtaining a stable microalgae transformant of the genus Chlorella comprising the steps of:

an expression cassette, in particular heterologous; and

an endogenous nucleic acid sequence of the nuclear genome of said chlorella microalgae and / or a stabilizing nucleic acid sequence having at least 80% identity with said endogenous stabilizing nucleic acid sequence over the entire length of said microalgae of the genus Chlorella; sequence; said endogenous stabilizing nucleic acid sequence being from 10 bp to 300 kbp in length; and

selection of a stable transformant.

The method of claim 1, wherein said endogenous nucleic acid sequence is a coding sequence.

The method of claim 2, wherein said endogenous stabilizing nucleic acid sequence is a coding sequence of ribosomal RNA.

The method of claim 3, wherein said endogenous stabilizing nucleic acid sequence encoding ribosomal RNA is selected from the group consisting of:

the sequence of the gene encoding 18S rRNA;

the sequence of the gene encoding 28S rRNA;

the sequence of the gene encoding 5.8S rRNA; and

their fragments of at least 10 bp in length.

The method of any one of claims 1 to 4, wherein said endogenous stabilizing nucleic acid sequence is the only endogenous sequence of said microalgae of the genus Chlorella included in said expression vector.

The method of any one of claims 1 to 4, wherein said vector comprises two stabilizing nucleic acid sequences selected from the group consisting of:

a stabilizing nucleic acid sequence having at least 80% identity with said endogenous stabilizing nucleic acid sequence throughout the length of said sequence.

The method according to claim 6, wherein the two stabilizing nucleic acid sequences are endogenous sequences of the nuclear genome of said microalgae of the genus Chlorella and are the only endogenous sequences of said microalgae of the genus Chlorella included in said expression vector .

The method of claim 6 or 7 wherein said nucleic acid stabilizer sequences are the same or different.

The method according to any one of claims 4 to 8, wherein said endogenous stabilizing nucleic acid sequence (s) is (are) a fragment of the sequence of the gene encoding the 18S rRNA, said fragment being of a length ranging from 300 bp to 800 bp, in particular from 400 bp to 750 bp.

The method according to any one of claims 1 to 9, wherein said microalgae of the genus Chlorella is selected from the group consisting of Chlorella protothecoids, Chlorella sorokiniana and Chlorella beijerinckii, in particular Chlorella protothecoids.

The method according to claim 9, wherein said Chlorella microalgae is Chlorella protothecoids and said endogenous stabilizing nucleic acid sequence (s) is (are) selected from the group consisting of: the sequence SEQ ID NO: 13, the sequence SEQ ID NO: 14, the sequence SEQ ID NO: 43, the sequence SEQ ID NO: 44, the sequence SEQ ID NO: 45, in particular in the group consisting of the sequence SEQ ID NO: 13 and the sequence SEQ ID NO: 14.

The method of claim 1 wherein said Chlorella microalgae is Chlorella protothecoids and said expression vector is as defined in any one of claims 15 to 17.

The method of any one of claims 1 to 12, said method further comprising the steps of:

(iii) isolating said stable transformant; and

(iv) culturing said stable transformant.

A process for producing a substance of interest comprising carrying out the method of any one of claims 1 to 13, wherein said expression cassette is a heterologous expression cassette comprising a DNA sequence encoding said substance of interest.

15. Vector filed December 20, 2012 at CCAP under registration number CCAP 21 1/122.

16. Expression vector comprising:

an expression cassette, in particular heterologous; and

an endogenous nucleic acid sequence which is endogenous to the nuclear genome of a microalgae of the Chlorella genus and / or a stabilizing nucleic acid sequence having at least 80% identity with said endogenous stabilizing nucleic acid sequence over the entire length said sequence; said endogenous stabilizing nucleic acid sequence being from 10 bp to 10 kbp in length and being a coding sequence for ribosomal RNA, in particular the 18S rRNA gene sequence or fragment thereof.

An expression vector according to claim 16 comprising:

an expression cassette, in particular heterologous; and

an endogenous nucleic acid sequence which is endogenous to the nuclear genome of a microalgae of the Chlorella genus and / or a stabilizing nucleic acid sequence having at least 80% identity with said endogenous stabilizing nucleic acid sequence over the entire length said sequence; said endogenous stabilizing nucleic acid sequence being SEQ ID NO: 13; and an endogenous nucleic acid sequence of the nuclear genome of a microalgae of the genus Chlorella and / or a stabilizing nucleic acid sequence having at least 80% identity with said endogenous stabilizing nucleic acid sequence over the entire length of the genome. said sequence; said endogenous stabilizing nucleic acid sequence being SEQ ID NO: 14.

18. Microalga of the genus Chlorella comprising at least one vector as defined according to any one of claims 1 5 to 17.