WO2014068072A1

WO2014068072A1 - Identification, assessment and therapy of essential thrombocythemia with resistance to jak2 inhibitors

Info

Publication number: WO2014068072A1
Application number: PCT/EP2013/072844
Authority: WO
Inventors: Christine BELLANNE-CHANTELOT; Caroline MARTY; Isabelle PLO; Cécile SAINT-MARTIN; William Vainchenker
Original assignee: Institut Gustave-Roussy; Institut National De La Sante Et De La Recherche Medicale (Inserm); Assistance Publique - Hopitaux De Paris; Universite Pierre Et Marie Curie (Paris 6)
Priority date: 2012-10-31
Filing date: 2013-10-31
Publication date: 2014-05-08

Abstract

The inventors herein disclose mutations that naturally occur in the JAK2 gene sequence of human patients suffering from essential thrombocythemia and that confer resistance to commonly used JAK2 inhibitors and/or Hsp90 inhibitors. The present invention therefore relates to methods, compositions and kits aiming to detect the presence of these mutations so as to predict and try to overcome the patient resistance to treatment involving JAK2 inhibitors and/or Hsp90 inhibitors. Moreover, the invention describes a model to test new drugs and JAK2 inhibitors.

Description

IDENTIFICATION, ASSESSMENT AND THERAPY OF ESSENTIAL THROMBOCYTHEMIA WITH RESISTANCE TO JAK2 INHIBITORS

BACKGROUND OF THE INVENTION

Myeloproliferative neoplasms (MPN) are clonal malignancies that are caused by genetic defects that occurs in the hematopoietic stem cell and which result in overproduction of one or several myeloid lineages. The MPN are classified into three broad categories: 1) chronic myeloid leukemia, 2) classic MPN which include polycythemia vera (PV), essential thrombocyt hernia (ET) and primary myelofibrosis (PMF) and finally 3) unclassified MPN. From the genetic point of view, MPN familial cases have been described with family histories compatible with an autosomal dominant inheritance with incomplete penetrance. Essential thrombocyt hernia (ET) is a myeloproliferative neoplasm (MPN) characterized by thrombocytosis with bone marrow megakaryocyte hyperplasia and a tendency to develop vascular complications, including thrombosis, microvascular disturbances, and hemorrhage. This disease affects an estimated 1 to 24 per 1 million people worldwide. The disease appears at all ages, with a median age of ~ 60 years, and shows a female predominance. Typical features of essential thrombocythemia are thrombotic and haemorrhagic complications, although most patients are asymptomatic. Transient ischaemic attacks, erythromelalgia and Budd-Chiari syndrome are complications which can occur in ET patients or can develop before the diagnosis of ET is apparent. Bleeding is usually associated with thrombocytosis exceeding 1500 x 10⁹/L due to acquired von Willebrand disease (Koopmans SM et al, The Netherlands Journal of Medicine, 2012). Other signs and symptoms of essential thrombocythemia include an enlarged spleen (splenomegaly); weakness; headaches; or a sensation in the skin of burning, tingling, or prickling. Some people with essential thrombocythemia have episodes of severe pain, redness, and swelling (erythromelalgia), which commonly occur in the hands and feet. Essential thrombocythemia can be inherited in an autosomal dominant pattern. When it is inherited, the condition is called "familial essential thrombocythemia" or "hereditary essential thrombocythemia". However, most of the cases of essential thrombocythemia are not inherited. Instead, the condition arises from gene mutations that occur sporadically. In 2005, several groups identified a mutation in the tyrosine kinase domain of JAK2 in MPN patients, resulting in a substitution of valine for phenylalanine at position 617 of JAK2 (JAK2V617F). The first genetic step is an acquired point mutation and results in a heterozygous mutational status. The homozygous JAK2V617F mutation is the result of mitotic recombination between homologous chromosomes 9p and results in loss of heterogeneity of 9p (LOH) and is a second genetic step in the etiology of the MPNs (Baxter E.J. et al, Lancet 2005). The JAK2V617F mutation is present in granulocytes, erythroblasts and megakaryocytes and in most erythropoietin (EPO)-independent erythroid colonies. SEQ ID NO: 12 represents the JAK2 nucleotide sequence encoding the JAK2 V617F mutation. The JAK2V617F mutation deregulates the JAK2 kinase activity. This mutation is located in the JH2 domain of the JAK2 gene, which negatively regulates the activity of the kinase domain, JHl . Valine 617 and cysteine 618 both maintain the kinase domain of JAK2 in an inactive state. Substitution of valine 617 for phenylalanine destabilises this inhibitory interaction, resulting in increased JAK2 kinase activity. Altogether, this suggests that there is a sustained JAK2 activation, while the feedback mechanism has been destroyed with a growth factor independent activation (James C. et al, Nature, 2005). Consequently, the erythroid colonies with the JAK2V617F mutation are able to grow in the absence of EPO and the JAK2V617F mutation also results in factor-independent growth of various haematopoietic cell lines. In fact, bone marrow progenitor cells carrying the JAK2V617F mutation are hypersensitive to thrombopoietin (TPO, that stimulates proliferation and differentiation of megakaryocytes), EPO (stimulates erythroblasts), stem cell factor (SCF, induces proliferation and self-renewal of multipotent haematopoietic progenitors) and granulocyte-stimulating factor (GSF, stimulates proliferation and differentiation of granulocytes). The hypersensitivity for these cytokines results in specific stimulation of the megakaryopoiesis, erythropoiesis and granulopoiesis (Koopmans SM et al, The Netherlands Journal of Medicine, 2012). Whereas the JAK2V617F mutation is the molecular abnormality more frequently found in ET, 3%-5% of patients display mutations in the thrombopoietin (TPO) receptor gene or the MPL gene (Pikman Y. et al, PloSMed. 2006). These mutations (MPL W515L/K) are associated with a gain of function and are also found in approximately 5%-10% of PMF patients, but not in PV. It is known that the hereditary and sporadic cases of thrombocythemia are induced by common molecular mechanisms affecting the MPL-TPO signaling pathway. As a matter of fact, specific mutations in the JAK2 and MPL genes lead to overactivation of the JAK/STAT pathway, thereby leading to overproduction of megakaryocytes, which results in an increased number of platelets. Excess platelets can cause thrombosis, which leads to many signs and symptoms of essential thrombocythemia.

However, 40% of patients with essential thrombocythemia do not have a mutation in any of the known genes associated with this condition. Researchers are currently working to identify other genes and/or mutations that may be involved in the condition so as to highlight potential novel molecular and cellular mechanisms leading to ET. This will ultimately trigger the finding of treatments that are more efficient than the existing ones.

The discovery of the JAK2 mutation triggered the development of a molecularly targeted therapy for the MPNs with the hope of reproducing the success of the tyrosine kinase inhibitors in chronic myeloid leukemia (Verstovsek S. et al, American Society of Hematology 2009). For now, the experience with the use of JAK2 inhibitors in ET patients who are not in the myelofibrotic phase is limited.

Therapy with JAK2 inhibitors such as INCBO 18424 and TGI 01348 induces rapid and marked reductions in spleen size and can lead to improvements in constitutional symptoms and overall quality of life.

In particular, Ruxolitinib (formerly known as INCBO 18424) achieved normalization of platelets counts in 49% of 39 ET patients resistant or intolerant to hydroxyurea after a median of 0.5 months, with 82% of them maintaining the platelets below 600 x 10⁹/L after a median follow-up of 15 months (Verstovsek S., et al, New England Journal of Medicine, 2012). In November 2011, ruxolitinib was approved by the USFDA for the treatment of intermediate or high-risk myelofibrosis based on results of the COMFORT - I and COMFORT-II Trials. TG101348 (SAR302503) is an orally available inhibitor of Janus kinase 2 (JAK-2) developed for the treatment of patients with myeloproliferative diseases including myelofibrosis. TG101348 acts as a competitive inhibitor of protein kinase JAK-2 with IC50=6 nM; related kinases FLT3 and RET are also sensitive, with IC₅o=25 nM and nM, respectively. Significantly less activity was observed against other tyrosine kinases including JAK3 (IC₅o=169 nM). In treated cells the inhibitor blocks downstream cellular signalling (JAK-STAT) leading to suppression of proliferation and induction of apoptosis. Phase I trial results focused on safety and efficacy of TG101348 in patients with high- or intermediate-risk primary or post-polycythemia vera/essential thrombocythemia myelofibrosis have been published in 2011 (Pardanani A. et al, Journal of Clinical Oncology, 2011).

CYT387 is an inhibitor of Janus kinases JAKl and JAK2, acting as an ATP competitor with IC₅₀ values of 11 and 18 nM, respectively. The inhibitor is significantly less active towards other kinases, including JAK3 (IC₅₀ = 0.16 μΜ) (Pardanani A. et al, Leukemia, 2009). As of 2011, CYT387 is being developed as a drug for myelofibrosis and currently undergoes Phase I/II clinical trials. Additional potential treatment indications for CYT387 include other myeloproliferative neoplasms, cancer (solid and liquid tumors) and inflammatory conditions.

The small molecule JAK2 inhibitor, AZ960 was discovered in 2008. AZ960 inhibits JAK2 kinase with a K_t of 0.00045 μΜ in vitro and treatment of TEL-JAK2 driven Ba/F3 cells with AZ960 blocked STAT5 phosphorylation and potently inhibited cell proliferation (GI₅₀ = 0.025 μΜ). AZ960 demonstrated selectivity for TEL-JAK2-driven STAT5 phosphorylation and cell proliferation when compared with cell lines driven by similar fusions of the other JAK kinase family members (Gozgit J.M. et al, Journal of Biological Chemistry, 2008).

Another JAK2 inhibitor, CEP701, showed lower efficacy than ruxolitinib, whereas it was associated with substantial gastrointestinal toxicity, mainly consisting of diarrhea and nausea. Finally, the JAK2 inhibitor BVB808 of the N-aryl-pyrrolopyrimidine scaffold class has been described recently. It has a 10-fold selectivity in vitro for JAK2 compared with JAK1, JAK3, or TYK2 (Weiger O. et al, J. Exp. Med. 2012).

Numerous authors have anticipated that resistance to tyrosine kinase inhibitors therapy would invariably develop, as observed in drug-resistant chronic myeloid leukemia patients carrying particular mutations in the BCL-ABL genes (Marit M.R. et al, PLoS One, 2012; Weigert O. J. Exp. Med. 2012). Yet, to date, no natural inhibitor-resistant JAK2 mutations have been ever identified in human or animal individuals. In contrast, several JAK2 mutants obtained by in vitro treatment of cell lines with inhibitors have been described (Deshpande A et al, Leukemia. 2012, Weigert O. et al, J. Exp. Med. 2012).

Interestingly, numerous reports show that JAK2 inhibitors fail to treat efficiently JAK2- related diseases, suggesting that, in some patients, JAK2 inhibitors are not able to inhibit efficiently the deregulation mediated by JAK2-occuring mutations, such as JAK2V617F (see for example in Eghtedar et al, Blood, 2012 : treatment of secondary Acute Myeloid Leukemia AML (post-NMP AML) or Acute Lymphoblastic Leukemia ALL, Chronic Myelomonocytic Leukemia CMML, Myelodysplasia Syndromes MDS with ruxolitinib). One can therefore hypothesize that, in some of cases, the patient cells have actually acquired resistance to the said JAK2 inhibitors. In this context, there is an immediate need to identify naturally-occurring mutations conferring resistance to JAK2 inhibitors in order to diagnose clinical resistance as early as possible and develop alternative means for preventing and/or treating disorders related to JAK2 aberrant expression and/or activity. These mutations could be also used in screening methods for identifying more potent JAK2 inhibitors (i.e., inhibitors which are likely to modulate JAK2 aberrant activity in nearly all patients and especially in those exhibiting the mutant proteins identified by the present inventors).

FIGURES Figure 1 shows the clinical and biological features of two pedigrees with hereditary thrombocytosis (A) and the sequence electrophoregrams of the germline JAK2 mutations 2265T>A (S755R), 2600OA (R867Q) and 2813G>A (R938Q) (B). Age at diagnosis (years), vascular complications (CVE, ischemic cerebrovascular event; IHD, ischemic heart disease event) with age of occurrence, blood counts at diagnosis and current treatment are indicated. Pit (platelets, 10⁹/L), Ht (hematocrit, %), Hb (hemoglobin level, g/L), Leu (leucocytes, 10⁹/L).

Figure 2 shows the location of JAK2 germline mutations 2265T>A (S755R), 2600OA (R867Q) and 2813G>A (R938Q) (A) and an in silico analysis of same (B).

Figure 3 shows BFU-E (A, B) and CFU-MK (C, D, E) progenitors from mononuclear cells of the patients from the two pedigrees versus control donors. (F, G) discloses the numbers of megakaryocytes per clusters. (H, I) discloses the signalisation studies on platelets of the patients of the two pedigrees or from control donors by western-blot analysis with specific antibodies. Figure 4 discloses the results of the signaling studies conducted in Ba/F3-EPOR and - MPL (Myeloproliferative Leukemia) cells. (A) shows the growth of Ba/F3-EPOR cells expressing the JAK2 forms, which were cultured for 72 h either in absence of cytokine (black arrow) or in presence of increasing doses of EPO (0.01 , 0.02, 0.03, 0.05, 0.1, 0.3 and 1 U/mL). (B) shows the growth of Ba/F3-MPL cells expressing the JAK2 forms in absence of cytokine (black arrow) or in presence of increasing doses of TPO (0.0015, 0.005, 0.015, 0.05, 0.15, 0.5, 1.5 and 5 ng/mL). (C) and (D) discloses the phosphorylation status of JAK2, STATl, STAT3, STAT5, AKT and ERKl/2 examined by Western blotting on Ba/F3-EPOR (C) or Ba/F3-MPL cells (D) expressing the different JAK2 constructs stimulated with (C) 1 U/mL EPO, (D) 0.05 or 5 ng/mL TPO at 37°C, as indicated.

Figure 5 discloses the sensitivity of JAK2 R867Q and JAK2 S755R/R938Q mutants to JAK2 and HSP90 inhibitors, (a) Ba/F3-MPL cells expressing either JAK2 R867Q, JAK2 S755R/R938Q or JAK2 V617F could be maintained in WEHI-supplemented medium but also exhibited cytokine-independent growth (Autonomous). Autonomous or WEHI-maintained cells were serum-starved for 6 hr and stimulated, or not (no TPO), with 5 ng/mL TPO for 15 min (+ TPO). Constitutive phosphorylation level of each of the JAK2 construct was analyzed by Western blotting. Level of phospho-STAT5 was also detected and expression of HSC70 served as a loading control. Blots are representative of a typical experiment, (b) Growth of autonomous Ba/F3-MPL cells expressing JAK2 V617F (x), R867Q (V) and S755R/R938Q mutants (□), as well as WEHI-dependent Ba/F3-MPL expressing JAK2 WT (grey circle), were determined in response to treatment with various concentrations of INCB018424, TG101348, CYT- 387, AZ960, (c) LY294002 and (d) AUY922, as indicated. A WST-1 proliferation asssay was performed after 72 hr of exposure to the inhibitors, in presence of 5 ng/niL TPO. Data (means ± SEM) were calculated as percentages of vehicle-treated cells and were conducted in duplicate in four independent experiments, (e) IC₅₀ values of cytokine-independent Ba/F3-MPL cells exposed to inhibitors for 72 hr were calculated using GraphPad PRISM software, (f) Co-immunoprecipitation (IP) was performed in Ba/F3-MPL cells using an anti-JAK2 antibody and blotted for the presence of HSP90 and MPL. Cell homogenates (H) show the amount of proteins before the IP. Figure 6 discloses the effect of JAK2 mutations on protein stability and chaperone function for MPL cell-surface expression, (a) Ba/F3 cells expressing the FLAG-tagged MPL and transduced with the bicistronic retroviral pMIGR-IRES-GFP vector encoding either JAK2 WT, V617F, R867Q, S755R/R938Q, S755R or R938Q were sorted for equal GFP levels and maintained in IL3-supplemented medium. GFP-expression allowed monitoring of JAK2 level in the various cell lines and MPL cell-surface expression was assessed by flow cytometry using PE fluorescence labeling of the extracellular FLAG-tag. (b) Histogram shows the mean fluorescence intensities (MFI) of PE-labeled cell surface MPL in IL3- and autonomously-maintained Ba/F3-MPL cells, (c) Ba/F3-MPL cells expressing either JAK2 WT, V617F, R867Q or S755R/R938Q and maintained in WEHI-supplemented medium were treated with cycloheximide (CHX, 50 μg/mL) for 0, 0.5, 1, 2, 5, 8 and 24 hr. Total JAK2 levels were examined by Western blotting and β-Actin serves as loading control. Table shows means ± SEM of the half- lives (Tl/2) of JAK2 WT and mutants and mature cell-surface MPL interpolated from Y=0.5 on the curves corresponding to half of the protein remaining in CHX-treated cells compared to CHX-untreated cells (n=3). Significance compared to JAK2 WT Tl/2 was assessed using the two-tailed student's t-test. *, p<0.05; **, p<0.01 and ***, p<0.001.

DETAILED DESCRIPTION OF THE INVENTION

The present inventors identified in patients displaying essential thrombocythemia (ET) three different mutations of the JAK2 gene (S755R, R938Q and R867Q) conferring resistance to some well-known and broadly used JAK2 inhibitors (namely INCB018424, TG101348, CYT387 and AZ960). Two of the three mutations that were identified are located in the kinase domain JH1 (R938Q and R867Q). The third is located in the pseudo-kinase domain JH2 (S755R) (see figure 1).

As shown in the experimental part below, the in vitro study of cell lineages expressing these mutants separately or in combination demonstrated that these mutants differ from the JAK2v₆i_7F mutant in their response to JAK2 inhibitors (see figure 5). As a matter of fact, cells expressing these mutants are 5 to 10 folds more resistant than JAK2 wild-type and JAK2v₆i_7F to classical JAK2 inhibitors such as TG101348, Ruxolitinib, CYT387 and AZ960, the two first being currently used in clinical trials (figure 5b). It is worth to note that, for certain particular JAK2 inhibitors such as TGI 01348 and AZ960, the resistance is observed at low dose of the inhibitors, but can be advantageously alleviated by using high doses of same (figure 5b).

Hsp 90 is the chaperone protein of the JAK2 protein. Hsp90 inhibitors are well-known to promote the destruction of both wild-type and JAK2_V6i_7F mutant proteins (see for example Praia DA et al, PLoS ONE, 2011 and Wang Y. et al, Blood 2009). It has been shown that some particular mutations conferring cell resistance to JAK2 inhibitors however do not reduce the sensitivity to inhibitors of Hsp90 such as AUY922 and the benzoquinone ansamycin 17-AAG (Weigert O. et al., J. Exp. Med. 2012).

Nevertheless, and importantly, the three mutant proteins JAK2_S755_R, JAK2_R938Q and JAK2_RS67Q appear to be also resistant to Hsp90 inhibitors such as AUY922 (see figure 5d). Therefore, the resistance mutations S755R, R938Q and R867Q prevent JAK2 degradation.

According to these surprising results, the present inventors propose to detect these mutations so as to predict the efficiency of a treatment based on JAK2 inhibitors and/or Hsp90 inhibitors. Moreover, they propose that these models could be used to screen other drugs or inhibitors.

In addition, the study of the hematopoietic progenitors obtained from the ET patients carrying the S755R, R938Q and/or R867Q JAK2 mutations showed an activation defect in the JAK / STAT pathway which was caused (at least in part) by an independence and/or an hypersensitivity to thrombopoietin (TPO) (see figure 4d).

Accordingly, it is hypothesized that patients carrying the mutations of the JAK2 gene identified by the present inventors, namely S755R, R938Q and/or R867Q, undergo over- proliferation and abnormal differentiation of megakaryocytes, ultimately leading to the onset of myeloproliferative neoplasms, and in particular essential thrombocythemia. Consequently, the mutations S755R, R938Q and R867Q of the JAK2 gene can be used to diagnose myeloproliferative neoplasms, and in particular essential thrombocythemia, caused by the mutations-induced TPO-deregulation of the hematopoietic progenitors of the patients. The JAK2 mutations of the invention

JAK2 belongs to the family of Janus Kinases (JAKs) which group together several intracytoplasmic tyrosine kinases: JAK1, JAK2, JAK3 and TYK2. The JAK proteins are involved in the intracellular signalling of numerous membrane receptors which have no intrinsic tyrosine kinase activity, like some members of the superfamily of cytokine receptors and in particular the Epo receptor (R-Epo). The JAK2 protein is encoded by a gene which comprises 23 exons. The size of the complementary DNA is 3500 base pairs and encodes a protein of 1132 amino acids (130 kD).

Of note, this is the first time that in vivo naturally-occurring mutations conferring resistance to JAK2 inhibitors are identified in the JAK2 gene (in the past, JAK2 mutations conferring resistance to JAK2 inhibitors have been identified only by random mutagenesis on the JAK2 gene sequence, cf. Marit M.R. et al, PLoS One, 2012; Weigert O. J. Exp. Med. 2012; Deshpande A et al, Leukemia. 2012).

It is also important to note that the three mutations of the JAK2 gene identified by the present inventors have never been disclosed.

In a first aspect, the present invention therefore targets an isolated Janus kinase 2 (JAK2) mutant protein comprising one, two or three mutation(s), preferably one or two mutation(s), located on amino acid(s) 755, 938, and/or 867 of the SEQ ID NO: l (also corresponding to the codons 755, 938, and/or 867 of the cDNA starting from the ATG starting codon.

SEQ ID NO: l corresponds to the amino acid sequence of the human JAK2 wild-type protein (NCBI, accession number NM_004972; Gl : 13325062). In a preferred embodiment, the said mutations are selected in the group consisting of: S755R, R938Q and R867Q (that is, respectively, the serine in position 755 is replaced by an arginine (S755R), the Arginine in position 938 is replaced by a Glutamine, and the Arginine in position 867 is replaced by a Glutamine).

The JAK2 proteins carrying these mutations are hereafter called the "JAK2 mutant proteins of the invention" or "JAK2 variant of the invention". More particularly,

• the JAK2 mutant protein carrying the mutation S755R is hereafter called "JAK2SV55_R", and is represented by SEQ ID NO:3,

• the JAK2 mutant protein carrying the mutation R938Q is hereafter called "JAK2 R_938Q", and is represented by SEQ ID NO:4,

• the JAK2 mutant protein carrying the mutation R867Q is hereafter called "JAK2 RS67Q", and is represented by SEQ ID NO:5,

• the JAK2 mutant protein carrying the mutation S755R and R938Q is hereafter called "JAK2_S755R+R938Q", and is represented by SEQ ID NO:6,

• the JAK2 mutant protein carrying the mutations S755R and R867Q is hereafter called "JAK2_S755_R+ _R867Q", which can easily be inferred from SEQ ID NO:3 and SEQ ID NO:5,

• the JAK2 mutant protein carrying the mutation R867Q and R938Q is hereafter called "JAK2_R867Q+_R938Q", which can easily be inferred from SEQ ID NO:4 and SEQ ID NO:5, and

• the JAK2 mutant protein carrying the mutation S755R, R867Q and R938Q is hereafter called "JAK2_S755_R+_R867Q+_R938Q", which can easily be inferred from SEQ ID NO:5, and SEQ ID NO:6. In a preferred embodiment, the isolated Janus kinase 2 (JAK2) mutant protein of the invention is chosen in the group consisting of: SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, and SEQ ID NO:6.

The present invention also targets equivalents of the above-mentioned JAK2 mutant proteins, corresponding to JAK2 proteins of other mammals mutated at one or more of the position(s) 755, 938, and/or 867, for example in rat (NP_113702, SEQ ID NO: 13) or mouse (NP 001041642; SEQ ID NO:14). It also targets variants of SEQ ID N°l which comprise one or more alterations which do not affect the activity and 3D structure of the variant. In a second aspect, the present invention also concerns an isolated polynucleotide whose sequence encodes a JAK2 mutant protein as defined above.

As used herein, the term "polynucleotide" designates any nucleotide sequence, either naturally-occurring or genetically obtained. It is for example DNA (deoxyribonucleic acid) or RNA (ribonucleic acid). As used herein, a nucleotide sequence "encodes" a protein if, when expressed, it results in the production of that protein; i.e., it "encodes" the amino acid sequence of that protein.

In a preferred embodiment, the sequence of the polynucleotide of the invention is chosen from the ones that have been identified in the ET human patients, that is, from the group consisting of: SEQ ID NO:8 (2265T>A, resulting in S755R), SEQ ID NO:9 (2813G>A, resulting in R938Q), and SEQ ID NO:10 (2600OA, resulting in R867Q). The present invention also concerns any isolated JAK2 polynucleotide whose sequence contains two or three of the above-mentioned mutations, preferably SEQ ID NO: 11 (containing 2265T>A and 2813G>A),. All these polynucleotides are hereafter referred to as the "JAK2 gene variants of the invention". The present invention also concerns any polynucleotide whose sequence is homologous to SEQ ID NO: 8 to 11 but, due to codon degeneracy, does not contain precisely the same nucleotide sequence.

By "homologous", it is herein meant that the sequences encodes the same proteins but, due to codon degeneracy, are not identical and have sequence similarity. The term "sequence similarity", in all its grammatical forms, refers to the degree of identity or correspondence between the said nucleic acid sequences.

The present invention also concerns isolated nucleotide sequence from other mammals, for example from rat (NM 031514) or mouse (NM 008413), encoding JAK2 proteins mutated at one or more of the position(s) 755, 938, and/or 867, which are preferably mutated into S755R, R938Q and/or R867Q.

Tools for expressing the mutated JAK2 proteins of the invention

The polynucleotide of the invention may be found or integrated in any cloning and/or expression vector known in the art, said vector being for example useful for ensuring its propagation in a host cell, or for ensuring its expression. The recombinant DNA technologies used to construct the cloning and/or expression vector of the invention are well-known to those skilled in the art. Standard techniques are used for cloning, DNA isolation, amplification and purification; enzymatic reactions involving DNA ligase, DNA polymerase, restriction endonucleases are performed following the manufacturer's instructions. These techniques are generally conducted in accordance with Sambrook et al, 1989. The cloning and/or expression vectors targeted in the present invention include plasmids, cosmids, bacteriophages, retroviruses and other animal viruses, artificial chromosomes such as YAC, BAC, HAC and other similar vectors.

In a third aspect, the present invention therefore targets a cloning and/or an expression vector containing at least one of the JAK2 gene variants of the invention, whose sequence has been described above.

The term "vector" herein means the vehicle by which a DNA or RNA sequence of a foreign gene can be introduced into a recombinant cell so as to transform it and promote expression of the introduced sequence. Vectors may include for example, plasmids, phages, and viruses and are discussed in greater detail below. Indeed, any type of plasmid, cosmid, YAC or viral vector may be used to prepare a recombinant nucleic acid construct which can be introduced to a recombinant cell where expression of the protein of interest is desired. Alternatively, wherein expression of the protein of interest in a particular type of host cell is desired, viral vectors that selectively infect the desired cell type or tissue type can be used. Also important in the context of the invention are vectors for use in gene therapy (i.e. which are capable of delivering the nucleic acid molecule to a host organism). For example, viral vectors, such as lentiviruses, retroviruses, herpes viruses, adenoviruses, adeno-associated viruses, vaccinia virus, baculovirus, and other recombinant viruses with desirable cellular tropism. Methods for constructing and using viral vectors are known in the art (see, Miller and Rosman, BioTechniques, 7:980-990, 1992).

In a preferred embodiment, said cloning and / or expression vector is a viral or a plasmid or a naked DNA or bacterial stock. In another preferred embodiment, the said cloning and/or expression vector contains an efficient promoter which is operatively linked to - and controls the expression of - the polynucleotide sequence of the invention.

As used herein, a "promoter" is a sequence of nucleotides from which transcription may be initiated of DNA operably linked downstream (i.e. in the 3' direction on the sense strand of double-stranded DNA). Within the promoter sequence will be found a transcription initiation site (conveniently found, for example, by mapping with nuclease SI), as well as protein binding domains (consensus sequences) responsible for the binding of RNA polymerase. Promoters which may be used to control gene expression in the context of the present invention are for example the ones that are functional in non- vertebrate cells or in vertebrate cells.

Promoters suitable for constitutive expression in mammalian cells include the cytomegalovirus (CMV) immediate early promoter, the adenovirus major late promoter, the phosphoglycero kinase (PGK) promoter, and the thymidine kinase (TK) promoter of herpes simplex virus (HSV)-l, the elongation factor 1 alpha (EF1 alpha) promoter, the Rous Sarcoma Virus (RSV) promoter, andlong terminal repeats (LTR) retroviral promoters. Inducible eukaryotic promoters regulated by exogenously supplied compounds, include without limitation, the zinc-inducible metallothionein (MT) promoter, the dexamethasone (Dex)-inducible mouse mammary tumor virus (MMTV) promoter, the T7 polymerase promoter system (WO 98/10088), the ecdysone insect promoter, the tetracycline-repressible promoter, the tetracycline-inducible promoter, the RU486-inducible promoter and the rapamycin-inducible promoter. For example, for non-vertebrate cells, the regulatory sequences of the metallothionein gene can be used (Brinster et al, Nature, 296:39-42, 1982).

In a fourth aspect, the present invention also targets a recombinant cell containing the cloning and / or expression vector of the invention and therefore expressing the JAK2 mutant protein of the invention. This recombinant cell can be any cell provided that it is not an human embryonic stem cell or a human germinal cell. In particular, in the context of the present invention, "recombinant" cells are any cells which can be used for producing recombinant proteins, such as "non-vertebrate" (or invertebrate) cells, vertebrate cells, plant cells, yeast cells, or prokaryote cells. They are preferably non- vertebrate and vertebrate cells. In the context of the invention, non- vertebrate cells are preferably insect cells, such as Drosophila or Mosquito cells, more preferably Drosophila S2 cells. Examples of cells derived from vertebrate organisms that are useful as recombinant cell lines include non-human embryonic stem cells or derivative thereof, for example avian EBX cells; monkey kidney CVI line transformed by SV40 sequences (COS-7, ATCC CRL 1651); a human embryonic kidney line (293); baby hamster kidney cells (BHK, ATCC CCL 10); Chinese hamster ovary cells (CHO); mouse Sertoli cells [TM4]; monkey kidney cells (CVI, ATCC CCL 70); African green monkey kidney cells (VERO-76, ATCC CRL- 1587); human cervical carcinoma cells (HeLa, ATCC CCL 2); canine kidney cells (MDCK, ATCC CCL 34); buffalo rat liver cells (BRL 3A, ATCC CRL 1442); human lung cells (W138, ATCC CCL 75 ); human liver cells (Hep G2, HB 8065); mouse mammary tumor cells (MMT 060562, ATCC CCL51); rat hepatoma cells [HTC, M1.5]; YB2/0 (ATCC n° CRL1662); NIH3T3; HEK and TRI cells. In the context of the invention, vertebrate cells are preferably EBX, CHO, YB2/0, COS, HEK, NIH3T3 cells or derivatives thereof. Plant cells which can be used in the context of the invention are the tobacco cultivars Bright Yellow 2 (BY2) and Nicotiana Tabaccum 1 (NT-1). Yeast cells which can be used in the context of the invention are: Saccharomyces cerevisiae, Schizosaccharomyces pombe, and Hansenula polymorpha, as well as methylotropic yeasts like Pichia pastoris and Pichia methanolica. Prokaryote cells which can be used in the context of the invention are typically E. Coli bacteria or Bacillus Subtilis bacteria.

In a preferred embodiment, the recombinant cell of the invention is a mammalian cell, and, more preferably, a CD34⁺ progenitor cell, a polynuclear neutrophil, a granulous, T- or B- lymphocyte, or any progenitors of human or mouse hematopoietic cells.

Consequently, in another preferred embodiment, the vector of the invention contains a promoter which is efficient in mammalian cells and, more preferably, in human CD34⁺ progenitor cell, in polynuclear neutrophils or in granulous, T- or B- lymphocytes or in progenitors of human or mouse hematopoietic cells. Such a promoter is for example the JAK2 promoter, the LTR promoter, the EF1 alpha promoter, or the PGK promoter.

Methods for generating recombinant cells are well-known. Some of them are described in EP 1692281 and are incorporated herein by reference. Briefly, the recombinant transgene containing the JAK2 mutation(s), optionally contained in a linearized or non- linearized vector, or in the form of a vector fragment, are for example inserted in a host cell using microinjection into the nucleus (US 4,873,191), transfection by calcium phosphate precipitation, lipofection, electroporation, transformation with cationic polymers (PEG, polybrene, DEAE-Dextran) or viral infection.

In a fifth aspect, the present invention also targets a non-human transgenic animal expressing at least one of the JAK2 mutant proteins of the invention. Preferably, said animal has integrated into its genome a nucleotide sequence coding for at least one of the JAK2 mutant protein of the invention, for example at least the sequence of the JAK2 variant of the invention. More preferably, the transgenic animal of the invention is a mouse or rat.

These animals may reproduce essential thrombocythemia but also any myeloproliferative disorder induced by JAK2-deregulation. They can therefore be used to conduct functional screening of tyrosine kinase inhibitors, especially screening of inhibitors that are efficient on the JAK2 mutant proteins of the invention.

Transgenic rats or mice which can be used as models may be obtained by any method commonly used by those skilled in the art, in particular by Knock-in method (targeted insertion of a sequence), by homologous recombination or by directed recombination with the Cre-LoxP or FLP-FRT systems in embryonic stem cells (ES cells). According to one preferred embodiment of the invention, the inventive transgenic cell is obtained by gene targeting of the JAK2 2265T>A, 2813G>A and/or 2600OA variant (selected in the group consisting of SEQ ID NO:8 to 11) at one or more sequences of the host cell genome. Methods for inserting the said mutations in a host genome are well-known. Some of them are disclosed for example in EP 1692281 and are incorporated herein by reference. A particular method consists of injecting a viral vector (retrovirus or lentivirus or others) able to express the JAK2 mutant protein(s) of the invention in hematopoietic stem cells, progenitor cells or ES cells so as to produce animal models of essential thrombocythemia or other myeloproliferative disorders. The present invention also discloses diagnostic tools enabling to detect the presence or absence of the above-mentioned mutations in animals (more specifically in humans) suffering from or likely to show a disorder related to JAK2 aberrant expression and/or activity (for example a myeloproliferative disorder).

In this aspect, the invention therefore discloses primers and probes which can be used to detect the presence (or absence) of the above-mentioned mutations in the JAK2 gene or in the JAK2 protein.

More specifically, the present invention targets isolated nucleic acid primers or probes containing at least 10, at least 12, at least 15, at least 20, at least 30, at least 40 or at least 50 nucleotides (e.g., 10 to 30 nucleotides or 10 to 25 nucleotides) and hybridizing with the genomic DNA, mRNA or cDNA of the JAK2 gene. More precisely the said primers or probes hybridize with a nucleotide sequence containing at least one of the nucleotide in position 2265, 2813 or 2600 of the human JAK2 gene of SEQ ID NO:7, or equivalent nucleotide(s) thereof in the JAK2 gene of other mammals.

In a preferred embodiment, the primers or probes of the invention hybridize with a nucleotide sequence comprising at least the wild-type nucleotide(s) 2265T, 2813G or 2600G of the human JAK2 gene SEQ ID NO:7, or equivalent nucleotide(s) thereof in the JAK2 gene of other mammals, for example in the JAK2 gene of rat (NM 031514) or in the JAK2 gene of mouse (NM 008413). Equivalent nucleotide(s) in other mammals can be easily determined by identifying which codon encodes the wild-type amino acids 755S, 938R and/or 867R.

In another preferred embodiment the primers or probes of the invention hybridize with a nucleotide sequence comprising at least the mutated nucleotide 2265 A, 2813A or 2600 A of the human JAK2 gene SEQ ID NO: 7 (see SEQ ID NO: 8 to 11) or equivalent nucleotide thereof in the JAK2 gene of other mammals, for example in the JAK2 gene of rat (NM_031514) or in the JAK2 gene of mouse (NM_008413). Equivalent nucleotide(s) in other mammals can be easily determined by identifying which codon encodes the mutated amino acids 755R, 938Q and/or 867Q. As meant herein, a "nucleic acid primer" more specifically refers to a nucleic acid or a polynucleotide that serves as a starting point for amplification of a genomic region of interest.

Examples of primers of the invention include, but are not limited to, the primers of sequence: Primers JAK2 755R (SEQ ID NO : 15 and 16)

^5' GCA GTG GAG GAG ATA AAC CTC TAA GAG CTC TGG ATT CTC AAA GAA AGC^3' ^3' CGT CAC CTC CTC TAT TTG GAG ATT CTC GAG ACC TAA GAG TTT CTT TCG⁵

Primers JAK2 938R (SEQ ID NO: 17 and 18)

5^' GGA ATA TTT ACC ATA TGG AAG TTT ACA AGA CTA TCT TCA AAA ACA TAA AGA ACG G^3'

^3' CCT TAT AAA TGG TAT ACC TTC AAA TGT TCT GAT AGA AGT TTT TGT ATT TCT TGC C^5' Primers JAK2 867R (SEQ ID NO: 19 and 20)

5 ' GGGAGTGTGGAGATGTGCCAGTATGACCCTCTACAGGAC AACACTGG 3 '

3'CCCTCACACCTCTACACGGTCATACTGGGAGATGTCCTGTTGTGACC 5' Primers JAK2 755R (SEQ ID NO:21 and 22)

5 ' GGAAACTTGAAGTTGCTAAAC AGTTGG3 '

5 ' GGCCTGAAATCTGGTTCAT3 '

Primers JAK2 938R and 867R (SEQ ID NO:23 and 24)

5 ' GAGGATAGGTGCCCTAGGG3 '

5'CTCGTTGCCAGATCCCTGTGG3'

The present invention also targets "nucleic acid probes" that more specifically refer to a nucleic acid or a polynucleotide that can be used for detecting a genomic region of interest. This term encompasses various derivative forms such as "fluorescent probes". In the context of the invention, a labelled probe can be used to detect the presence (or absence of) the 2265T>A, 2813G>A or 2600OA mutations in the JAK2 gene for example in the methods described below. Probes may be labelled by isotopes, radio labels, binding moieties such as biotin, haptens such as digoxygenin, luminogenic, mass tags, phosphorescent or fluorescent moieties, or by fluorescent dyes alone (e.g., MGB, FAM, VIC, TET, NED, TAMRA, JOE, HEX, ROX, etc) or in combination with other dyes. These labels provide signals detectable by fluorescence, radioactivity, colorimetry, gravimetry, X-ray diffraction or absorption, magnetism, enzymatic activity, mass spectrometry, binding affinity and the like, and facilitate the detection or quantification of the nucleotide region of interest.

The nucleic acid primers or probes of the invention may be labelled with radioactive, fluorescent or enzymatic labellers using any technique known to those skilled in the art. The primers or probes of the invention are consequently specific to the mutation(s) 2265T>A, 2813G>A or 2600OA of the human JAK2 gene, and can therefore be used to detect and discriminate patients carrying the said mutation(s) and those who do not. They can be used for example in PCR-based technologies (see below), for example LightCycler® and TaqMan® technologies. The primers or probes of the invention preferably hybridize to the JAK2 wild-type or mutated sequences under stringent hybridization conditions. One example of stringent hybridization conditions is when hybridization is carried out at a temperature from about 50°C to about 65°C using a salt solution which is about 0.9 molar. However, the skilled person will be able to vary such conditions in order to take into account variables such as the primer length, its base composition, type of ions present, etc. All these conditions are thoroughly detailed in Sambrook, Fritsch and Maniatis -"Molecular Cloning - A Laboratory Manual" Second Edition Cold Spring Harbor Laboratory, 1989.

It is understood that the sequences of nucleic acid fragments as provided herein are expressed in standard IUB/IUPAC nucleic acid code. The present invention also targets probes which are able to distinguish between the JAK2 mutant protein(s) of the invention, the wild-type JAK2 protein and/or the mutated protein JAK2_V6i7F.

In the context of the invention, a probe is able to "distinguish between the JAK2 mutant protein(s) of the invention, the wild-type JAK2 protein and/or the mutated protein

the said probes do not bind the JAK2 wild-type protein of SEQ ID NO: 1 (corresponding to the human JAK2 protein), and optionally do not bind the JAK2v6i7F mutant protein of SEQ ID NO:2 (corresponding to the human JAK2V617F mutant protein), but bind to at least one of the human JAK2 mutant protein(s) of the invention, for example chosen in the group consisting of: SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, and SEQ ID NO:6, the said probes do not bind the JAK2 wild-type protein of another mammal (e.g., SEQ ID NO: 13 for rat, SEQ ID NO: 14 for mouse), and/or the corresponding JAK2v6i7F mutant protein, but bind the JAK2 mutant protein(s) of this mammal carrying a mutation which is equivalent or identical to the S755R, R938Q and/or R967Q mutation(s),

the said probes bind the JAK2 wild-type protein of SEQ ID NO: l

(corresponding to the human JAK2 protein), and/or the JAK2V617F mutant protein of SEQ ID NO:2 (corresponding to the human JAK2V617F mutant protein), but do not bind any of the human JAK2 mutant protein(s) of the invention, for example chosen in the group consisting of: SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, and SEQ ID

NO:6, or the said probes bind the JAK2 wild-type protein of another mammal (e.g., SEQ ID NO: 13 for rat, SEQ ID NO: 14 for mouse), and/or the corresponding JAK2v6i7F mutant protein, but do not bind any of the JAK2 mutant protein(s) of this mammal, carrying a mutation which is equivalent or identical to the S755R, R938Q and/or R967Q mutation(s).

In the context of the present invention, a probe is said to "bind" a peptide or a protein having a define sequence if said probe has an affinity constant IQ (which is the inverted dissociation constant, i.e. 1/IQ) higher than 10⁵ M^"1, preferably higher than 10⁶ M^"1, more preferably higher than 10⁷ M^"1 for said peptide / protein. Conversely, a probe is said "not to bind" a peptide or a protein having a define sequence if it has an affinity constant IQ lower than 10⁵ M^"1 for said peptide / protein.

As the probes of the invention are specific to the mutation(s) S755R, R938Q, and/or R967Q of the JAK2 protein, they can therefore be used to detect and discriminate patients carrying the said mutation(s) and those who do not.

They can be used for example in immunohistochemistry, ELISA, western-blots or flow cytometry (see below). They are preferably labelled, for example with a detectable label chosen in the group consisting of: enzymes, prosthetic groups, fluorescent materials, luminescent materials, bio luminescent materials, and radioactive materials. Examples of suitable enzymes include horseradish peroxidase, alkaline phosphatase, beta - galactosidase, or acetylcholinesterase. Examples of suitable prosthetic group complexes include streptavidin/biotin and avidin/biotin. Examples of suitable fluorescent materials include umbelliferone, fluorescein, fluorescein isothiocyanate, rhodamine, dichlorot[pi]azinylamine fluorescein, dansyl chloride or phycoerythrin. Example of a luminescent material includes luminol. Examples of bio luminescent materials include luciferase, luciferin, and aequorin. Examples of suitable radioactive material include ¹²⁵I, ¹³¹I, ³⁵S or ³H.

In a particular embodiment, the probe of the invention is an antibody, said antibody being specific to at least one of the JAK2 variant of the invention. The antibodies of the present invention can be monoclonal or polyclonal antibodies, single chain or double chain, chimeric or humanised antibodies or portions of immunoglobulin molecules containing the portions known in the state of the art to correspond to the antigen binding fragments.

As used herein, the term "polyclonal antibody" designates antibodies that are obtained from different B cell resources. It typically includes various antibodies directed against various determinants, or epitopes, of the target antigen. These antibodies may be produced in animals. Conventional techniques of molecular biology, microbiology and recombinant DNA techniques are within the skill of the art. Such techniques are explained fully in the literature. For example, the antibodies of the invention may be prepared by the following conventional method. A mammal (e.g. a mouse, hamster, or rabbit) can be immunized with a JAK2 protein mutant of the invention, which elicits an antibody response in the mammal. Techniques for conferring immunogenicity on a polypeptide include conjugation to carriers or other techniques well known in the art. For example, the polypeptide can be administered in the presence of adjuvant. The progress of immunization can be monitored by detection of antibody titers in plasma or serum. Standard ELISA or other immunoassay procedures can be used with the immunogen as antigen to assess the levels of antibodies. Following immunization, antisera can be obtained and, if desired, polyclonal antibodies isolated from the sera.

In the present invention, monoclonal antibodies are however preferred, due to their higher specificity. As used herein, the term "monoclonal antibody" means an antibody arising from a nearly homogeneous antibody population. More particularly, the individual antibodies of a population are identical except for a few possible naturally- occurring mutations which can be found in minimal proportions. In other words, a monoclonal antibody consists of a homogeneous antibody arising from the growth of a single cell clone (for example a hybridoma, a eukaryotic host cell transfected with a DNA molecule coding for the homogeneous antibody, a prokaryotic host cell transfected with a DNA molecule coding for the homogeneous antibody, etc.). Monoclonal antibodies are highly specific and are directed against a single antigen. In addition, in contrast with preparations of polyclonal antibodies, each monoclonal antibody is directed against a single epitope of the antigen. Obtaining said monoclonal antibodies is within the reach of persons skilled in the art. Briefly, monoclonal antibodies can be prepared by immunizing a mammal, e.g. a mouse, rat or other mammals with purified JAK2 mutant proteins. Antibody producing cells (lymphocytes) can be harvested from the immunized animal as described above and fused with myeloma cells by standard somatic cell fusion procedures thus immortalizing these cells and yielding hybridoma cells. Such techniques are well known in the art (e. g. the hybridoma technique originally developed by Kohler and Milstein {Nature 256; 495- 497 (1975)) as well as other techniques such as the human B-cell hybridoma technique (Kozbor et al, Immunol Today 4 72 (1983)), the EBV-hybridoma technique to produce human monoclonal antibodies (Cole et al, Methods Enzymol, 121 ; 140-67 (1986)), and screening of combinatorial antibody libraries (Huse et al, Science 246; 1275 (1989)). Hybridoma cells can be screened immunochemically for production of antibodies specifically reactive with the target polypeptide so that only monoclonal antibodies binding to this polypeptide are isolated. Such hybridoma cells are used as production source for the monoclonal antibody of the invention.

The antibodies directed against the JAK2 mutant protein of the invention may in some cases show a cross reaction with the wild-type JAK2 protein or the V617F mutant protein. If this is the case, a selection of the antibodies specific to the mutant of the invention is required. In this respect, affinity chromatography may be used for example with the wild-type JAK2 protein to capture the antibodies showing a cross reaction with wild-type JAK2.

If the probe of the invention is an antibody (Ab), the affinity constant which is used to characterize its binding to a peptide or an antigen (Ag) is the inverted dissociation constant defined as follows:

Ab + Ag AbA _ [AbAgJ _ 1

^" \ \M ^" ¾

This affinity can be measured for example by equilibrium dialysis or by fluorescence quenching, both technologies being routinely used in the art.

In another aspect, the present invention targets the hybridoma cells as defined above which produce the monoclonal antibody of the invention. To summarize, the present invention relates preferably to a monoclonal antibody specifically recognizing the JAK2 mutant protein(s) of the invention and to the hybridoma cells producing same. The invention also concerns in vitro assays using said antibody, to detect the presence or absence of the particular mutations S755R, R938Q and/or R967Q in the JAK2 protein in a biological sample of a subject.

Of note, it is also possible to use aptamers directed to the JAK2 mutant protein(s) of the invention, that is, oligonucleotides or oligopeptides which can recognize the JAK2 mutant protein(s) of the invention with high affinity and specificity.

Prognosis methods of the invention

The in vitro study of cell lineages expressing these mutants separately or in combination demonstrated that these mutants differ from the JAK2v₆i_7F mutant in their response to JAK2 and Hsp90 inhibitors (see figure 5). As a matter of fact, cells expressing these mutants are 5 to 10 folds more resistant than JAK2 wild-type and JAK2v₆i_7F to classical JAK2 inhibitors such as TG101348, Ruxolitinib, CYT387 and AZ960, the two first being currently used in clinical trials (figure 5b). Moreover, the three mutant proteins JAK2s755R, JAK2_R93SQ and JAK2_R867Q appear to be resistant to the Hsp90 inhibitor AUY922 (see figure 5d).

Therefore, the present inventors propose to use these mutations so as to predict or prognose the efficiency of a treatment based on JAK2 inhibitors and/or Hsp90 inhibitors. Consequently, the present invention targets an in vitro method for determining the sensitivity of a subject to a treatment with JAK2 and/or Hsp90 inhibitors, comprising the steps of: a) obtaining a nucleic acid sample from said subject, b) detecting in said sample the presence of one or more mutation(s) in the JAK2 gene, said mutated gene encoding the JAK2 mutant protein of the invention, in particular, the JAK2 mutant proteins of SEQ ID NO:3 to 6, wherein the presence of said mutation(s) indicates that said subject has a high risk to be resistant to a treatment with JAK2 and/or Hsp90 inhibitors. In other words, the present invention targets an in vitro method for predicting the efficiency of JAK2 and/or Hsp90 inhibitors in a subject in need thereof, comprising the steps of: a) obtaining a nucleic acid sample from said subject, b) detecting, in said sample, the presence of one or more mutation(s) in the JAK2 gene, said mutated gene encoding the JAK2 mutant protein of the invention, wherein the presence of said mutation(s) indicates that the said JAK2 and/or Hsp90 inhibitors have a high risk to be inefficient for treating said subject.

As disclosed herein, the terms "in vitro" and "ex vivo" are equivalent and refer to studies or experiments that are conducted using biological components (e.g. cells or population of cells) that have been isolated from their usual host organisms (e.g. animals or humans). Such isolated cells can be further purified, cultured or directly analyzed to assess the presence of the mutant proteins. These experiments can be for example reduced to practice in laboratory materials such as tubes, flasks, wells, eppendorfs, etc. In contrast, the term "in vivo " refers to studies that are conducted on whole living organisms. In the context of these methods, the term "nucleic acid sample" means a sample containing a detectable amount of oligonucleotides encoding the JAK2 protein, that is, sufficient amount of mR A, genomic DNA or cDNA (derived from mR A) encoding the JAK2 protein. The nucleic acid sample may be obtained from any hematopoietic cell source or bone marrow biopsy or any tissue biopsy. These cells must be of hematopoietic origin and may be obtained from circulating blood, from hematopoietic tissue or any fluid contaminated with blood cells. The method of the invention can include the steps consisting of obtaining a biological sample from said subject and extracting the nucleic acid from said biological sample. The DNA can be extracted using any known method in the state of the art. The RNA can also be isolated, for example from tissues obtained during a biopsy, using standard methods well known to those skilled in the art, such as extraction by guanidium-thiophenate-phenol-chloroform.

In a preferred embodiment, the said JAK2 inhibitor is chosen in the group consisting of: INCB018424, AZD1480, AG-490, WP1066, TG101348 (SAR302503), TG101209, NVP-BSK805, AT9283, LY2784544, CEP33779 and CYT387, preferably in the group consisting of: INCB018424, TG101348, CYT387, and AZ960.

INC B018424 (CAS number 941678-49-5) is the other name of ( betaR)-beta- Cyclopentyl-4-(7H-pyrrolo[2 -d]pvrimidin-4-yl)-lH-pyrazole-l-propanenitrile of formula:

TG101348 (CAS number 936091-26-8) is the other name of SAR302503 or ruxolitinib or N-( 1 , 1 -Dimethylethyl)-3 - [ [5 -methyl-2- [ [4- [2-( 1 -pyrrolidinyl)ethoxy]phenyl] amino] - 4-pyrimidinyl]amino]benzenesulfonamide of formula:

CYT387 (CAS number 1056634-68-4) is the other name of N-(Cyanomethyl)-4-[2-[[4- (4-morpholinyl)phenyl] amino] -4-pyrimidinyl]benzamide of formula:

AZ960 (CAS number 905586-69-8) is the other name of 5-Fluoro-2-[[(lS)-l-(4- fluorophenyl)ethyl]amino] -6- [(5 -methyl- 1 H-pyrazol-3 -yl)amino] -3 -pyridinecarbonitrile of formula:

Moreover, it is important to note that:

• AZD1480 is the drug having the CAS number 935666-88-9,

• AG-490 is the drug having the CAS number 133550-30-8,

· WP1066 is the drug having the CAS number 857064-38-1,

• TG101209 is the drug having the CAS number 936091-14-4,

• NVP-BSK805 is the drug having the CAS number 1092499-93-8,

• AT9283 is the drug having the CAS number 896466-04-9,

• LY2784544 is the drug having the CAS number 1229236-86-5, and

· CEP33779 is the drug having the CAS number 1346168-57-7.

In a preferred embodiment, the said Hsp90 inhibitor is chosen in the group consisting of: 17-AAG (Tanespimycin), AUY922 (NVP-AUY922), 17-DMAG HC1 (Alvespimycin), BIIB021, NVP-BEP800, STA-9090 (Ganetespib), AT13387, Geldanamycin, SNX-2112 and PF-04929113 (SNX-5422), and is preferably AUY922. AUY922 (CAS number 747412-49-3) is the other name of NVP-AUY922 or 5-(2,4- dihydroxy-5 -isopropyl-phenyl)-N-ethyl-4- [4-(morpholinomethyl)phenyl]isoxazo le-3 - carboxamide, having the formula:

Moreover, it is important to note that:

• 17-AAG (or Tanespimycin) is the drug having the CAS number 75747-14-7,

• 17-DMAG HCl (or Alvespimycin) is the drug having the CAS number 467214- 21 -7,

• BI IB021 is the drug having the CAS number 848695-25-0,

• NVP-BEP800 is the drug having the CAS number 847559-80-2,

• STA-9090 (or Ganetespib) is the drug having the CAS number 888216-25-9,

• MPC-3 100 is the drug having the CAS number 958025-66-6,

· AT I 387 is the drug having the CAS number 91 2999-49-6,

• Geldanamycin is the drug having the CAS number 30562-34-6,

• SNX-2112 is the drug having the CAS number 908112-43-6, and

• PF-04929113 (or SNX-5422) is the drug having the CAS number 908115-27-5.

In a preferred embodiment, the said subject is an animal, preferably a mammal such as a rat, a mouse or a human, and is more preferably a human. In a more preferred embodiment, said subject is suffering from a disorder related to JAK2-aberrant expression and/or activity, such as a myeloproliferative neoplasm or leukaemia, and, in particular, from essential thrombocythemia. In step b), the presence of the said mutation(s) can be detected by sequencing, amplifying and/or hybridising the targeted nucleotide regions containing the position(s) 2265, 2813 and/or 2600 of the JAK2 gene (potentially containing the mutations encoding S755E, R867Q and/or R938Q, for example 2265T>A, 2813G>A and/or 2600G>A) with specific primers.

In the methods of the invention, the nucleic acids of the tested sample may be PCR- amplified before detection of the allelic variation, so as to improve signal detection. Amplification may be carried out by on genomic DNA, on RNA, or on cDNA obtained after reverse transcription of the RNA, using primers which hybridize in close vicinity of the position(s) 2265, 2813 or 2600 of the JAK2 gene and therefore allow amplification of the region(s) containing the mutation(s) (with this respect, it is not mandatory to use primers that are specific to the mutated site(s), as described above). This amplification step is typically followed by a detection step allowing discrimination between the samples with respect to the sought variant. Different techniques adapted for this purpose are described in EP 1186672 such as DNA sequencing, sequencing by SSCP, DGGE, TGGE hybridisation, heteroduplex analysis, CMC, enzymatic mismatch cleavage, hybridisation-based- so lid-phase hybridisation, DNA chips, Taqman™ hybridisation phase solution (US 5,210,015 and US 5,487,972) and the RFLP technique. Analysis of the sequence of the targeted region(s) reveals to the skilled person if the tested subject carries or not one of the mutations identified by the present inventors.

Alternatively, the method of the invention may comprise an hybridisation step with at least one primer of the invention, which hybridises specifically with a region containing a mutated nucleotide (and in particular to 2265T>A, 2813G>A or 2600G>A for the human JAK2 gene), said primer being preferably labelled with a detectable marker. The hybridization of this primer with the target region is then assessed by detecting the signal produced by the label of said primer. Detection can be conducted using different alternative methods: FRET, fluorescence quenching, polarised fluorescence, chemiluminescence, electro-chemiluminescence, radioactivity and colorimetry. In particular, this detection may be implemented using the Taqman® Technology enabling allelic discrimination. Essentially, this method consists of i) the recognition of the mutated allele of the JAK2 gene by fluorescently-labelled primer(s) specific to said mutated allele, followed by ii) a PCR reaction (with a polymerase with 5 ' exonuclease activity), iii) detection of the fluorescence of the hybridised primer, and iv) determination of the genotype by reading end point fluorescence (obtaining an image showing clusters of mutated homozygous, heterozygous and normal DNA). Accordingly, the presence of a mutated nucleotide according to the present invention is detected if at least one primer of the invention is hybridized to the nucleic acid sample. In this particular embodiment, an amplification step may be performed prior to the hybridisation step, so as to improve signal detection.

Finally, the method of the invention may be performed by amplifying the nucleic acid of the subject with at least one primer of the invention, which hybridises specifically a region containing the mutated position in the JAK2 gene (typically the position 2265, 2813 or 2600 of the human JAK2 gene) and a second primer which hybridizes in close vicinity of the said position. The amplification of the target region is then assessed by conventional means (SDS-PAGE, etc.). The presence of a mutated nucleotide according to the present invention is indirectly observed if an amplification product is detected after the above-described amplification, using one primer of the invention. As a matter of fact, if the JAK2 mutation of the invention is absent from the nucleic acid sample of the subject, the primer of the invention will not bind the said nucleic acid sample and no amplification will occur.

In a preferred embodiment, the tested subject carries at least one mutation chosen in the group consisting of: 2265T>A, 2813G>A and 2600OA in the JAK2 gene, that is, a mutated gene chosen in the group consisting of SEQ ID NO: 8 to 11.

In another embodiment, the mutant protein of the invention can be detected directly at the protein level.

For this purpose, the present invention targets an in vitro method for determining the sensitivity of a subject to a treatment with JAK2 and/or Hsp90 inhibitors, comprising the steps of: a) obtaining a biological sample from said subject, b) detecting in said sample the presence of at least one of the JAK2 mutant protein of the invention, wherein the presence of said JAK2 mutant protein(s) indicates that said subject has a high risk to be resistant to a treatment with JAK2 and/or Hsp90 inhibitors.

The present invention also targets an in vitro method for predicting the efficiency of JAK2 and/or Hsp90 inhibitors in a subject in need thereof, comprising the steps of: a) obtaining a biological sample from said subject, b) detecting, in said sample, the presence of at least one of the JAK2 mutant protein of the invention, wherein the presence of said JAK2 mutant protein(s) indicates that the said JAK2 and/or Hsp90 inhibitors have a high risk to be inefficient for treating said subject. Said JAK2 mutant protein can be detected by any suitable method known in the state of the art. For example, a biological sample taken from an individual can be contacted with the probe of the invention, as defined above, and more specifically with the monoclonal antibody of the invention, which is able to distinguish between the mutant proteins of the invention and the wild-type JAK2 protein (and any other protein). As used in the context of these methods, the term "biological sample" refers to a sample that is obtained from the tested subject such as a serum sample, a plasma sample, a blood sample, a lymph sample, or a bone marrow biopsy. Such a sample must allow for the determination of the presence of the mutant or wild-type JAK2 protein. Preferably, the said biological sample is a blood sample. Indeed, such a blood sample may be obtained by a completely harmless blood collection from the patient and thus allows for a non- invasive prognosis of the treatment efficiency. This blood sample is preferably enriched in granulocytes, lymphocytes, red cells, platelets, and/or hematopoitic progenitors.

Examples of analytical methods useful for assessing the presence of mutated JAK2 proteins include, but are not limited to, ELISA, western-blots, flow cytometry cell sorting (for example FACS), and immunohistochemistry (IHC). All these methods indeed allow the detection of the mutated JAK2 proteins provided that the probes of the invention are used. These methods are well known and broadly described in the art. When antibodies are used, they can be detected by direct labeling of the antibodies themselves with detectable markers. Alternatively, unlabeled primary antibody can be used in conjunction with a labeled secondary antibody, comprising antisera, polyclonal antisera or a monoclonal antibody specific for the primary antibody. In a preferred embodiment, the methods of the invention are an ELISA or a Western Blot assay.

As mentioned above, the methods of the invention enable to detect whether a subject has an increased risk to be resistant to a treatment with JAK2 and/or Hsp90 inhibitors or whether the said JAK2 and/or Hsp90 inhibitors have an increased risk to be inefficient for treating said subject.

As used herein, a subject is said to be "resistant" to a treatment with a JAK2 and/or an Hsp90 inhibitor if a conventional dosage regimen of said inhibitor does not alleviate the JAK2-aberrant expression and/or activity observed in this subject, i.e., in particular, if a conventional dosage regimen of said inhibitor does not block the proliferation and spontaneous differentiation of hematopoietic progenitors which is observed in the presence of the mutant proteins of the invention. Also, JAK2 and/or Hsp90 inhibitors are said to be "inefficient" in a subject in the very same conditions.

As used herein, the term "conventional dosage regimen" or "conventional dose" of a JAK2 inhibitor or a Hsp90 inhibitor means a dosage regimen of the said compound that is commonly used in clinical trials or that is recommended by the manufacturer after the marketing authorization has been obtained. It obviously depends on the JAK2 or Hsp90 inhibitor which is considered. Conventional dosage regimen of said inhibitors is predicted to be comprised between 5 and 50 mg per day for the treatment of human patients. For example, conventional dosage regimen of ruxolitinib is of 5 to 25 mg two times per day depending on the platelet amount in the patient. The skilled person well knows which doses are conventional and have to be administered to patients, depending of the nature of the inhibitors, the weight and age of the patient, etc.

As used herein, a subject is said to have "a high risk to be resistant to an inhibitor" if he/she has more than 50%, preferably more than 60% and more preferably more than 75% of risk of being resistant to said inhibitor. Resistance to an inhibitor can be monitored in vivo for example by measuring spleen size or blood parameters or in vitro by treating blood progenitors with inhibitors and count viable cells.

In addition, as used herein, the said inhibitors have "a high risk to be inefficient for treating a subject" if they have more than 50%, preferably more than 60% and more preferably more than 75% of risk of having no effect on said subject. Efficiency of an inhibitor can be monitored for example in vivo by measuring spleen size or blood parameters or in vitro by treating blood progenitors with inhibitors and count viable cells.

Treating methods of the invention

It is worth to note that, for certain particular JAK2 inhibitors such as TGI 01348 and AZ960, the resistance is observed at low dose of the inhibitors, but can be advantageously alleviated by using high doses of same (figure 5b).

The present invention therefore also targets a method for optimizing a treatment and / or for treating subjects in need thereof, said method comprising the steps of: a) obtaining a nucleic acid sample from said subject, b) detecting, in said sample, the presence of one or more mutation(s) in the JAK2 gene, said mutated gene encoding the JAK2 mutant protein of the invention, c) treating said subject with conventional doses of JAK2 and/or Hsp90 inhibitors if it does not carry said one or more mutation(s), or d) treating said subject with high dose of the JAK2 inhibitor TG101348 and/or AZ960 if it carries said one or more mutation(s).

In a preferred embodiment, the said mutated gene in step b) is chosen in the group consisting of SEQ ID NO: 8 to 11. The present invention also targets a method for optimizing a treatment and / or for treating subjects in need thereof, said method comprising the steps of: a) obtaining a biological sample from said subject, b) detecting, in said sample, the presence of at least one of the JAK2 mutant protein of the invention, c) treating said subject with conventional doses of JAK2 and/or Hsp90 inhibitors if the said mutant protein is not present in the tested sample, or d) treating said subject with high dose of the JAK2 inhibitor TG101348 and/or AZ960 if the said mutant protein is present in the tested sample.

The said "nucleic acid sample" and "biological sample" have to be understood as defined previously. Furthermore, the detection of i) the presence of one or more mutation(s) in the JAK2 gene, and ii) the presence of at least one of the JAK2 mutant protein in said samples can be carried out as defined previously, preferably by using the primer(s) and probe(s) of the invention.

As used herein, the term "high dose of JAK2 inhibitor TG101348" designates a dose that is higher than the conventional dose of the same inhibitor. It is for example a dose of 100 mg per day, preferably 200 mg per day and even more preferably 300 mg per day for a patient.

As used herein, the term "high dose of JAK2 inhibitor AZ960" designates a dose that is higher than the conventional dose of the same inhibitor. It is for example a dose of 100 mg per day, preferably 200 mg per day and even more preferably 300 mg per day for a patient.

This method is preferably applied to subjects suffering from disorders related to (or resulting from) JAK2-aberrant expression and/or activity.

As used herein, the term "disorders related to JAK2-aberrant expression and/or activity" designates myeloproliferative disorders, cancers or inflammatory diseases that are due to constitutive signaling and over-proliferation of cells carrying mutated and hyperactive JAK2 proteins such as JAK2v₆i_7F, and/or the mutant proteins of the invention.

The said disorder related to JAK2-aberrant expression and/or activity is preferably chosen in the group consisting of: a myeloproliferative neoplasm, a lymphoid or myeloid cancer, breast cancer and an inflammatory disease. In a preferred embodiment, said disorder is a myeloproliferative neoplasm chosen in the group consisting of: chronic myeloid leukemia, polycythemia vera (PV), essential thrombocythemia (ET) and primary myelofibrosis (PMF). In a more preferred embodiment, said disorder is essential thrombocythemia (ET).

siRNA of the invention

In another aspect, the present invention targets a siRNA capable of reducing by more than 50%, or more than 95%, the expression of the JAK2 mutant protein of the invention.

These siRNAs can be injected into the cells or tissues by lipofection, transduction or electroporation. They can be used to specifically destroy the mRNAs encoding the JAK2 mutant protein of the invention, thereby entailing numerous possible therapeutic applications, in particular the treatment of Essential Thrombocythemia. srRNAs are described in US 60/068562 (CARNEGIE). The RNA is characterized in that it has a region with a double strand structure (ds). Inhibition is specific to the target sequence, the nucleotide sequence of one strand of the RNA ds region comprising at least 25 bases and being identical to the portion of the target gene. The nucleotide sequence of the other strand of the RNA ds region is complementary to that of the first strand and to the portion of the target gene. Also, application WO 02/44 321 (MIT/MAX PLANCK INSTITUTE) describes a double strand RNA (or oligonucleotides of same type, chemically synthesized) of which each strand has a length of 19 to 25 nucleotides and is capable of specifically inhibiting the post- transcriptional expression of a target gene via an RNA interference process in order to determine the function of a gene and to modulate this function in a cell or body. Finally, WO 00/44895 (BIOPHARMA) concerns a method for inhibiting the expression of a given target gene in a eukaryote cell in vitro, in which a dsRNA formed of two separate single strand RNAs is inserted into the cell, one strand of the dsRNA having a region complementary to the target gene, characterized in that the complementary region has at least 25 successive pairs of nucleotides. Persons skilled in the art may refer to the teaching contained in these documents to prepare the siRNAs of the invention.

More specifically, the invention relates to double strand RNAs of approximately 15 to 30 nucleotides, preferably 19 to 25 nucleotides, or preferably around 19 nucleotides in length that are complementary (strand 1) and identical (strand 2) to nucleotide regions comprising the JAK2 mutations identified by the present inventors - in particular comprising the nucleotide 2265 A, 2813 A or 2600A of the human JAK2 gene of SEQ ID NO: l . These siRNAs of the invention may also comprise a dinucleotide TT or UU at the 3 ' end. Numerous computer programmes are available for the design of the siRNAs of the invention.

In one particular embodiment, the siRNAs of the invention described above are tested and selected for their capability of reducing, even specifically blocking the expression of the JAK2 mutant protein of the invention, affecting as little as possible the expression of wild-type JAK2. For example, the invention concerns siRNAs allowing a reduction of more than 80%, 90%, 95% or 99% of the expression of the JAK2_S755_R, JAK2_R938Q, or JAK2_RS67Q and no reduction or a reduction of less than 50%>, 25%, 15%, 10% or 5% or even 1% of wild-type JAK2. The present invention also concerns a therapeutic composition comprising at least one of the siRNA of the invention, in an efficient amount, and a pharmaceutically acceptable vehicle.

An "effective amount" refers to an amount that is effective, at dosages and for periods of time necessary, to achieve the desired result, i.e., to treat effectively the patient. An effective amount as meant herein should also not have any toxic or detrimental severe effects.

By "pharmaceutically acceptable vehicle", it is herein designated any and all solvents, buffers, salt solutions, dispersion media, coatings, antibacterial and antifungal agents, isotonic and absorption delaying agents, and the like that are physiologically compatible. The type of carrier can be selected based upon the intended route of administration. In various embodiments, the carrier is suitable for intravenous, intraperitoneal, subcutaneous, intramuscular, topical, transdermal or oral administration. Pharmaceutically acceptable carriers include sterile aqueous solutions or dispersions and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersion. The use of media and agents for pharmaceutically active substances is well known in the art.

The present invention also targets the composition, for use for treating subjects expressing at least one of the JAK2 mutant proteins of the invention. In a preferred embodiment, the said composition is therefore intended to treat a disorder related to JAK2-aberrant expression and/or activity. The said disorder related to JAK2-aberrant expression and/or activity is preferably chosen in the group consisting of: a myeloproliferative neoplasm, a lymphoid or myeloid cancer, breast cancer and an inflammatory disease. In a preferred embodiment, said disorder is a myeloproliferative neoplasm chosen in the group consisting of: chronic myeloid leukemia, polycythemia vera (PV), essential thrombocythemia (ET) and primary myelofibrosis (PMF). In a more preferred embodiment, said disorder is essential thrombocythemia (ET).

Diagnostic methods of the invention As disclosed in the experimental part below, the hematopoietic progenitors obtained from the ET patients carrying the S755R, R938Q and/or R867Q JAK2 mutations showed an activation defect in the JAK / STAT pathway which was caused (at least in part) by an hypersensitivity to thrombopoietin (TPO) (see figure 4d).

Accordingly, it is hypothesized that patients carrying the mutations of the JAK2 gene identified by the present inventors, namely S755R, R938Q and/or R867Q, undergo over- proliferation and abnormal differentiation of megakaryocytes, ultimately leading to the onset of myeloproliferative neoplasms, and in particular essential thrombocythemia. Consequently, the mutations S755R, R938Q and R867Q of the JAK2 gene can be used to diagnose myeloproliferative neoplasms, and in particular essential thrombocythemia, caused by the mutations-induced TPO-deregulation of the hematopoietic progenitors of the patients. In another aspect, the present invention is thus drawn to an in vitro method for diagnosing in a subject a JAK2-aberrant expression and/or activity, said method comprising the steps of: a) obtaining a nucleic acid sample from said subject, b) detecting, in said sample, the presence of one or more mutation(s) in the JAK2 gene, said mutated gene encoding the JAK2 mutant protein of the invention, wherein the presence of at least one of said mutations indicates that the JAK2 protein of said subject has aberrant expression and/or activity.

In a preferred embodiment, the said mutated gene in step b) is chosen in the group consisting of SEQ ID NO : 8 to 11.

The present invention also targets an in vitro method for diagnosing a JAK2-aberrant expression and/or activity in a subject, comprising the steps of: a) obtaining a biological sample from said subject, b) detecting, in said sample, the presence of at least one of the JAK2 mutant protein of the invention, wherein the presence of said JAK2 mutant protein(s) indicates that the JAK2 protein of said subject has aberrant expression and/or activity.

The "JAK2-aberrant expression and/or activity" in a subject can for example result in spontaneous growth of the hematopoietic progenitors and/or their independency toward thrombopoietin (TPO) stimulation. These deficiencies resulting in constitutive signaling through the JAK2 tyrosine kinase, they may induce proliferation of hematopoietic cells and lead to myeloid malignancy, B cell lymphomas and/or breast cancers (Weigert O., J. Exp. Med. 2012).

Consequently, it will be possible to diagnose that a subject is suffering - and/or to predict that a subject is likely to suffer in the future - from a disorder resulting from JAK2-aberrant expression and/or activity.

In another aspect, the present invention is thus drawn to an in vitro method for diagnosing if a subject is suffering - or for predicting that a subject will suffer - from a disorder related to JAK2-aberrant expression and/or activity, said method comprising the steps of: a) obtaining a nucleic acid sample from said subject, b) detecting, in said sample, the presence of one or more mutation(s) in the JAK2 gene, said mutated gene encoding the JAK2 mutant protein of the invention, wherein the presence of at least one of said mutations indicates that said subject is suffering - or will suffer - from a disorder related to JAK2-aberrant expression.

In a preferred embodiment, the said mutated gene in step b) is chosen in the group consisting of SEQ ID NO: 8 to 1 1.

The present invention also targets an in vitro method for diagnosing if a subject is suffering - or for predicting that a subject will suffer - from a disorder related to JAK2- aberrant expression and/or activity, said method comprising the steps of: a) obtaining a biological sample from said subject, b) detecting, in said sample, the presence of at least one of the JAK2 mutant protein of the invention, wherein the presence of said JAK2 mutant protein(s) indicates that said subject is suffering - or will suffer - from a disorder related to JAK2-aberrant expression and/or activity.

The said disorder related to JAK2-aberrant expression and/or activity is preferably chosen in the group consisting of: a myeloproliferative neoplasm, a lymphoid or myeloid cancer, breast cancer and an inflammatory disease. In a preferred embodiment, said disorder is a myeloproliferative neoplasm chosen in the group consisting of: chronic myeloid leukemia, polycythemia vera (PV), essential thrombocythemia (ET) and primary myelofibrosis (PMF). In a more preferred embodiment, said disorder is essential thrombocythemia (ET). Kits of the invention

According to another aspect, the invention relates to kits which are useful to implement the methods of the invention defined above.

These kits may contain one or more probes or primers of the invention, as defined above, for the specific detection of the presence or absence of the JAK2 mutations highlighted by the present inventors.

In particular, said kit may comprise at least one, preferably two and more preferably three primer(s) of the invention, for the specific detection of the presence of the mutations S755R, R938Q and/or R867Q of the JAK2 gene. In a preferred embodiment, the said kit may also comprise at least one element chosen from: a thermoresistant polymerase for PCR amplification, one or more solutions for the amplification and/or the hybridization step, and any reagent for detecting a label.

According to another embodiment, the kit of the invention contains at least one, preferably two and more preferably three probe(s) of the invention, for the specific detection of the presence of the JAK2_S755R, JAK2_R938Q, JAK2_R867Q, JAK2_S755R₊R₈6₇Q,

JAK2s₇55R+R9₃8Q, JAK2R867Q+R9₃8Q and JAK2s₇55R+R867Q+R9₃8Q.

In a preferred embodiment, the said kit comprises at least one, preferably two and more preferably three monoclonal antibodies such as those defined above. It may also contain any reagent adapted for hybridisation or immunological reaction on a solid carrier. It may finally contain a revealing agent, such as secondary antibodies which are preferably labelled. Screening methods

In a final aspect, the present invention also targets a method for identifying therapeutic products that are efficient for treating JAK2 -related disorders, said method comprising the steps of: a) contacting a candidate therapeutic product with at least one of the JAK2 mutant proteins of the invention, or a recombinant cell expressing same, or a fraction of said recombinant cell containing said JAK2 mutant protein, or a transgenic animal of the invention, under suitable conditions, d) detecting, directly or indirectly, if said JAK2 mutant protein is inhibited or altered by said candidate therapeutic product, c) selecting said candidate therapeutic product if said JAK2 mutant protein is efficiently inhibited or altered by said candidate therapeutic product.

As used herein, a JAK2 mutant protein is said to be "inhibited" or "altered" by a compound if said compound is able to bind to said mutant protein and if the JAK2- induced constitutive signalling is diminished by 50%, preferably by 75% and more preferably by 90%. This inhibition or alteration can be assessed or detected for example by JAK2 protein kinase activity or STAT phosphorylations. It is also possible to detect the said inhibition or alteration by studying the altered proliferation of recombinant megacaryoblasts cells expressing at least one JAK2 mutant protein of the invention or in megacaryoblasts cells of the transgenic animal of the invention. In this case, the candidate therapeutic product is selected if it induces a decrease of 50%>, preferably by 75% and more preferably by 90% in said proliferation. In a preferred embodiment, the candidate therapeutic product is selected if it exhibits an IC₅₀ for at least one of the JAK2 mutant protein of the invention of less than Ι μΜ, preferably of lOOnM.

This method may also comprise measurement of the fixing onto wild-type JAK2 so as to identify the above-mentioned molecules which have an IC₅₀ for wild-type JAK2 of less than 5 μΜ, or less thanl μΜ (negative selection step).

The present invention concerns in particular in vitro screening methods using the recombinant cells of the invention or cells that have been isolated from the transgenic animals of the invention. As shown in the experimental part below, these cells are capable of proliferating and differentiating in the absence of thrombopoietin (TPO). One particular screening method consists in: i) placing the cells in culture in a medium containing SCF and IL-3, ii) adding the compounds to the culture medium and iii) measuring the proliferating capacity of the cells and/or their ability to differentiate into megakaryocytes (41⁺42⁺) cells. The compounds that are worth to be selected are those for which a decrease in megakaryocytes (41⁺42⁺) cells is observed. In a particular embodiment, STAT phosphorylations can be used to determine if JAK2 is inhibited and to what extent.

The invention also relates to in vivo screening methods, comprising the steps of i) administering candidate compounds to the non- human transgenic animal of the invention, ii) determining the effect of the candidate compound and iii) selecting the said compound if it causes a reduction or a blocking in the proliferation and/or spontaneous erythroblast differentiation. More particularly, this method is performed by using a transgenic mouse or a transgenic rat of the invention.

Among the candidate compounds, mention may be made for example of the siRNAs of the invention, in particular those targeting a nucleotide sequence containing the nucleotide in position 2265, 2813 or 2600 of the human JAK2 gene of SEQ ID NO: 1.

The present invention will be better understood in the light of the following detailed description of experiments, including examples. Nevertheless, the skilled artisan will appreciate that this detailed description is not limitative and that various modifications, substitutions, omissions, and changes may be made without departing from the scope of the invention.

EXAMPLES

1. Material and Methods 1.1. Materials

Liquid cell culture media, including Iscove's Modified Dulbecco Medium (IMDM) and Dulbecco's modified Eagle's medium (DMEM), were from Invitrogen (Cergy Pontoise, France). Human recombinant erythropoietin (EPO) and interleukin-3 (IL-3) were generous gifts from Amgen (Neuilly, France). SCF was from Biovitrum AB (Stockholm, Sweden) and recombinant thrombopoietin (TPO) from Kirin (Tokyo, Japan). Restriction enzymes were purchased from Fermentas (St Leon-Rot, Germany). 1.2. Methods

Patients and cell purification

Two pedigrees of hereditary thrombocytosis registered in the collection of myeloproliferative neoplasms and hereditary thrombocytosis stored at Pitie-Salpetriere hospital (DC 2009-957) were analysed. All participants of this study gave their written informed consent. Clinical and biological annotations were recorded in an Access database approved by the French computer commission (CNIL #815419).

Thrombocytosis was defined by a platelet count above 450 x 10⁹/L in patients who had no evidence for reactive thrombocytosis and no WHO criteria for essential thrombocytemia or other myeloproliferative neoplasm. No patients were carrier of the JAK2V617F mutation.

Peripheral blood from patients was collected in sterile citrated tubes. Platelet-rich plasma (PRP) was obtained by centrifugation at 180 x g for 15 min at 20 °C. PRP was mixed with acid citrate dextrose at 9: 1 ratio and centrifuged at 1,500 x g for 15 min at 20 °C. Platelet pellet was carefully resuspended in PBS with 0.1% EDTA and cell counts were determined using a Sysmex KX-21N Automated Hematology Analyzer (Sysmex France, Roissy-CDG, France). For signalization studies, approximately 60 x 10⁶ platelets per condition were resuspended in PBS and stimulated with TPO. Mononuclear cells and granulocytes were separated over a Ficoll density gradient and CD34⁺ and CD3⁺ cells were either purified by a double-positive magnetic cell sorting system (AutoMACS, Miltenyi Biotec, Paris, France), according to the manufacturer's recommendations or plated in 6-well plates for 1 hr to remove monocytes and then seeded in methylcellulose and plasma clot cultures. Alternatively, CD34⁺ cells were cultured in IMDM with penicillin/streptomycin/glutamine, alpha-thioglycerol, bovine serum albumin (BSA), a mixture of sonicated lipids and insulin-transferrin, in the presence of recombinant human cytokines (25 ng/mL SCF, 100 U/mL IL-3, 1 U/mL EPO, and 10 ng/mL TPO). At day 10, the presence of megacaryocyte or erythroblasts were attested by flow cytometry after double labeling with the anti-CD41a-PE and anti- CD42-APC or anti-CD36-APC and anti-Gpa-PE (PharMingen, San Diego, CA).

Quantification of clonogenic progenitors in semi-solid cultures.

Mononuclear cells (300,000 cells) were plated either in methylcellulose assay to quantify erythroid (BFU-E) and granulocytic (CFU-GM) progenitors or in serum-free fibrin clot assay for quantification of MK (Megakaryocyte) progenitors (CFU-MK). Cultures in methylcellulose were stimulated by addition of recombinant human growth factors: IL-3 (100 U/mL), SCF (50 ng/mL) and with or without human EPO (1 U/mL). Cultures in fibrin clot were stimulated with or without 10 ng/mL TPO and 50 ng/mL SCF. They were incubated at 37°C in a fully humidified atmosphere containing 5% CO2 and scored after 12-14 days for BFU-E-, CFU-GM and CFU-GEMM-derived colonies using an inverted microscope. MK colonies were enumerated at day 12 after labeling by an indirect immuno-alkaline phosphatase staining technique using an anti- CD41a monoclonal Ab (Becton Dickinson, clone HIP8), as previously described. (Debili et al, 2004) Culture dishes were entirely scanned under an inverted microscope at 40 X or 100 X magnification. JAK2 molecular analysis

All participants gave their written informed consent for genetic analysis. Amplification of the 25 exons and intron-exon boundaries of JAK2 was performed in the probands on genomic DNA extracted from mononuclear blood cells. Purified PCR products were sequenced in both directions using the BigDye Terminator chemistry (Applied Biosystems). Sequencing reactions were run on an ABI3730 Genetic Analyser and analysed with the Seqscape software V.2.2 (Applied Biosystems). Germline JAK2 mutations were confirmed on DNA extracted from CD34⁺ and CD3⁺ cells obtained by FACS sorting. Mutations are numbered as recommended by the Human Genome Variation Society (http://www.hgvs.org/), using the reference sequence NM_004972.3.

Plasmids, DNA manipulations, production of retroviruses

The 2265T>A (S755R), 2600OA (R867Q) and 2813G>A (R938Q) point mutations were introduced into the MIGR1 -human JAK2WT-IRES-GFP plasmid by the QuikChange site-directed mutagenesis method using the PfuUltra high-fidelity DNA polymerase (Stratagene Amsterdam, The Netherlands). Full-length JAK2 mutant cDNAs were verified by sequencing. Alternatively, JAK2 mutant cDNAs were cloned in the pMEGIX-IRES-GFP plasmid. Vesicular stomatitis virus glycoprotein (VSV-G) pseudotyped viral particles were produced into 293EBNA cells using jet PRIME transfection reagent (Ozyme, Saint Quentin en Yvelines, France) according to manufacturer's instructions. Cell lines

The murine pro B Ba/F3 cells were grown in DMEM supplemented with 10% fetal bovine serum (FBS) (Stem Cell Technologies, Grenoble, France) and 5% WEHI- conditionned media as a source of murine IL-3. Ba/F3 cells were retrovirally transduced to stably express the human receptor to EPO (EPOR) or to TPO (MPL) harboring a N- terminal FLAG tag and maintained in presence of 1 U/mL EPO and 5% WEHI, respectively. Ba/F3-EPOR and Ba/F3-MPL cell lines expressing the various JAK2 mutants were generated by infecting with concentrated retrovirus supematants and sorting by flow cytometry (FACS, MoFlo cytometer, DakoCytomation, Fort Collins, CO, USA) 72 hrs later to isolate GFP-positive cells.

Proliferation assay

The premixed WST-1 cell proliferation assay system was carried out according to manufactor's instructions (Takara Bio Europe/Clontech, Saint-Germain-en-Laye, France). Briefly, Ba/F3 cell lines were plated in 96-well flat-bottom plates at a concentration of 3 x 10³/100 μΕΛνεΙΙ in presence of the indicated cytokines (EPO or TPO) and various JAK2 and HSP90 inhibitors. After 48 or 72 hr, WST-1 reagent was added at a 1 :20 dilution, incubated 30 min to 1 hr and absorbance read at 450 nm and 655 nm (reference wavelength) using a microplate reader (Model 680, Bio-Rad, Marnes-la-Coquette, France). Experiments were done in triplicate. For inhibitor treatments, values were transformed to percent inhibition relative to vehicle (DMSO)- treated cells and sigmoidal curves were fitted according to nonlinear regression analysis of the data using GraphPad PRISM software to calculate IC₅₀ Dose-response curves to EPO and TPO were expressed as percent of viability of the maximal response. Western blot analysis

Signalization was studied in human platelets and Ba/F3 cell lines by Western blotting. Cells were lysed on ice in a buffer containing 20 mM Tris-HCl, pH 7.4, 100 mM NaCl, 1 mM EDTA, 1% Triton X-100 and IX protease inhibitor mixture (Roche Diagnostics, Meylan, France). Cleared lysate was mixed with Laemmli buffer and boiled for 5 min. Samples were subjected to Western blot analysis using polyclonal antibodies against the phosphorylated forms of JAK2 (Tyr 1007/1008), STAT1 (Tyr 701), STAT3 (Tyr 705), STAT5 (Tyr 694), ERK1/2 (Thr 202/Tyr 204), AKT (Thr 308) and the pan proteins were all from Cell Signaling Technology (Ozyme). Hsc70 was used as loading control and was from Stressgen (Victoria, Canada).

Cell-surface expression of FLAG-tagged MPL in Ba/F3 cells

Expression of MPL at the surface of Ba/F3 cells in presence of JAK2WT and the various JAK2 mutants was examined by flow cytometry. After blocking with 2% BSA in PBS for 10 min at RT, cells were stained with 10 μg/mL monoclonal anti-FLAG M2 antibody (Sigma, Saint Quentin Fallavier, France) for 30 min at 4 °C. Cells were washed and incubated with 1 :400-diluted PE-conjugated anti-mouse IgG(H+L) from Jackson ImmunoResearch Laboratories (Interchim, Montlucon, France) for 30 min at 4 °C. PE fluorescence was analyzed by FACS together with the IRES-controlled GFP expression as indicator of JAK2 levels.

2. Results

2.1. Identification of new germline JAK2 mutations

A pangenomic study on two families showing only thrombocytosis has been performed (figure 1 A). This study revealed several region of interest among which one was located on chromosome 9. The JAK2 gene has been entirely sequenced and a new mutation has been identified in one family (JAK2_RS67Q). TWO other new mutations have been highlighted on the same allele JAK2S755_R/_R 38Q in the other family having the same phenotype (figure IB). These mutations have only been identified in the members suffering from thrombocytosis and are transmitted through an autosomal dominant pattern. The germline transmission of these mutations have been confirmed by sequencing both CD34+ and CD3+ cells of all affected patients. Figure 2 shows the location of JAK2 germline mutations 2265T>A (S755R), 2600OA (R867Q) and 2813G>A (R938Q) (A) and an in silico analysis of same (B).

Interestingly, patient 9 of family 1, which is a 22-year-old asymptomatic boy carrying the mutation JAK2S755R/R938Q, has a platelet level of 437.10⁹/L, which is thus superior to the normal one (400.10⁹/L). The identification of the mutation JAK2S755R/R938Q suggests that he is likely to develop thrombocytosis in the next years.

2.2. JAK2 mutants specifically act on megacaryocytic lineage in primary cells from patients

These mutations have been further studied. In particular, the function of these mutations in these patients and in cell lineages has been assessed. The study of hematopoietic progenitors in patients (6 subjects) either in methylcellulose or in plasmatic coagulum shows a light effect only on the megakaryocyte lineage with an increase of the progenitor numbers CFU-MK and their size without spontaneous growth (figure 3, A to G). Signalization assays on platelets confirmed that there is no spontaneous phosphorylation of STAT3, STAT5, AKT and ERK (figure 3, H, I).

2.3. Gain-of-function JAK2 mutants induce spontaneous growth and hypersensibility to thrombopoietin (TPO) as well as constitutive signalisation in Ba/F3-MPL whereas they have no impact on erythropoietin (EPO) in Ba/F3- EPOR.

The effect of these mutations has then been studied in cell lineages Ba/F3 cells expressing the human receptor to EPO (EPOR) or to TPO (MPL). To do so, 4 retroviral constructs containing the different mutations of JAK2 (JAK2_R867Q, JAK2_S755_R/_R938Q, JAK2S755_R and JAK2_R938Q) have been generated by mutagenesis. Several cell lineage of Ba/F3-EPOR or Ba/F3-MPL have been generated by retroviral transduction, as described above. a) Results on Ba/F3-EPOR cells

Ba/F3-EPOR cells expressing each of the JAK2 forms were cultured for 72 h either in absence of cytokine or in presence of increasing doses of EPO (0.01, 0.02, 0.03, 0.05, 0.1, 0.3 and 1 U/mL). Viable cells were quantified by WST-1 proliferation assay (figure 4 A, dose response curves are means expressed in percentages of maximum growth value ± SEM (n=4 in triplicate)).

In addition, Ba/F3-EPOR cells expressing the different JAK2 constructs were serum- and cytokine-starved for 6 h prior to a 15 min stimulation with 1 U/mL EPO. Cells were lysed and the phosphorylation status of JAK2, STATl, STAT3, STAT5, AKT and ERK1/2 was examined by Western blotting with the respective anti-phospho specific antibodies. Expression of Hsc70 in the samples was used as loading control and was consistent with expression of total AKT, ER 1/2 and the individual STAT isoforms. Blots shown on figure 4C were reproduced in two independent experiments.

As a result, it was observed that these mutations do not induce any modification to the proliferative response due to EPO in the lineage Ba/F3-EPOR (no spontaneous growth, no hypersensitivity, see figure 4A). They do not either induce any spontaneous signalization, as shown by analysis of the phosphorylation status of JAK2, STAT1, STAT3, STAT5, AKT and ERK1/2 (see figure 4C). b) Results on Ba/F3-MPL cells

Proliferation was then assayed 48 h after culturing Ba/F3-MPL cells expressing each of the JAK2 forms in absence of cytokine (black arrow) or in presence of increasing doses of TPO (0.0015, 0.005, 0.015, 0.05, 0.15, 0.5, 1.5 and 5 ng/niL) (figure 4B, data (means ± SEM) are representative of 4 independent experiments performed in triplicate).

In addition, Ba/F3-MPL cells expressing the different JAK2 constructs were serum- and cytokine-starved for 6 h prior to a 15 min stimulation with 0.05 or 5 ng/mL TPO at 37°C. Cells were lysed and the phosphorylation status of JAK2, STAT1 , STAT3, STAT5, AKT and ERK1/2 was examined by Western blotting with the respective anti- phospho specific antibodies. Expression of Hsc70 in the samples was used as loading control and was consistent with expression of total AKT, ERK1/2 and the individual STAT isoforms. Blots shown on figure 4D were reproduced in two independent experiments. Interestingly, the mutations JAK2_R867Q, JAK2_S755R/R938Q, JAK2_S755R and JAK2_R938Q induce independency and hypersensitivity of Ba/F3 to TPO. These are correlated with spontaneous signalization in Ba/F3-MPL, measured by means of the STAT1, STAT3, STAT5, AKT and ER phosphorylation levels by western blot (figure 4D). The increased in TPO-induced signalization is responsible for an augmentation in cell proliferation specifically on cell that express MPL receptor. Therefore it gives rise to ET.

2.4. JAK2 mutants display resistance to classical JAK2 inhibitors and a HSP90 inhibitor in Ba/F3 cell lines.

Randomly generated point mutations in the kinase domain of JAK2 V617F have been shown to be resistant to JAK2 inhibitors while still sensitive to inhibition of HSP90, a chaperone for JAK2. Therefore, we tested the impact of the R867Q and S755R/R938Q mutations on the sensitivity of these mutated kinases to JAK2 inhibitors (INCBO 18424, TG101348, CYT387 and AZ960) and to a HSP90 inhibitor (AUY922) by MTT assays. Ba/F3-MPL cells expressing either JAK2R₈67Q, JAK2_S755R-R938Q or JAK2_V617F as a control, were grown autonomously and serum-starved for 6 h and stimulated, or not, with 5 ng/niL TPO. After cell lysis, constitutive phosphorylation level of each of the JAK2 construct was analysed by Western blotting. Level of phospho-STAT5 was also detected and expression of Hsc70 served as a loading control. Blots of figure 5a) are representative of a typical experiment. Autonomous Ba/F3-MPL cell lines (growing without cytokines for at least three weeks) expressing either JAK2 R867Q, JAK2 S755R/R938Q or JAK2 V617F displayed constitutive phosphorylation of JAK2 and STAT5 (Figure 5a). JAK2 R867Q was reproducibly found to be more phosphorylated than JAK2 S755R/R938Q and JAK2 V617F.

Moreover, the sensitivity of the cells expressing the JAK2 mutants to various JAK2 and HSP90 inhibitors has been assessed (HSP90 being the chaperone protein of JAK2). The growth of autonomous Ba/F3-MPL cells expressing JAK2_V6i7F (X), R867Q (V) and S755R-R938Q (□), as well as WEHI-dependent Ba/F3-MPL expressing JAK2_WT ( · )_> was determined in response to treatment with various concentrations of INCBO 18424, TG101348, CYT-387, AZ960 and AUY922 (figure 5 b and d, data (means ± SEM) were calculated as percentages of vehicle-treated cells and were conducted in triplicate in four independent experiments). A WST-1 proliferation asssay was performed after 72 h of exposure to the inhibitors, in presence of 5 ng/niL TPO. Also, the IC₅₀ values of cytokine-independent Ba/F3-MPL cells exposed to inhibitors for 72 h was determined (cf. figure 5e).

Interestingly, the JAK2 R867Q- and S755R/R938Q-expressing cells were 5- to 15-fold less sensitive than their JAK2 WT and V617F counterparts to classical JAK2 inhibitors currently used in clinics and clinical trials such as TG101348 (SAR302503) and INCB018424 (Ruxolitinib), AZ960 and CYT387. Whereas high doses of TG101348 and AZ960 (>1 μΜ) prevented growth of all three mutated cell lines, equivalent doses of INCB018424 and CYT387 failed to completely inhibit the proliferation of the cells expressing JAK2 R867Q and JAK2 S755R/R938Q (Figures 5b, e).

The R867Q and S755R/R938Q JAK2 mutants presented similar sensitivity than JAK2 V617F to a PI3K inhibitor (LY-294002) (Figure 5c), suggesting that the three JAK2 mutants (R867Q, S755R/R938Q and V617F) require downstream PI3K for Ba/F3-MPL cell proliferation. However, they were less sensitive than JAK2 V617F to a HSP90 inhibitor (AUY922), even at high doses (Figure 5d). Accordingly, HSP90 co- immunoprecipitated to a greater extent with JAK2 mutants (R867Q, S755R/R938Q) than with JAK2 V617F and WT (Figure 5f).

Altogether, these results show that the new JAK2 mutants are more resistant to both JAK2 and HSP90 inhibitors than JAK2 V617F. 2.5. Characterization of JAK2 mutant stability, interaction with MPL receptors and the effect of JAK2 mutants on MPL cell surface localization.

We also assessed the effect of the JAK2 mutations disclosed above on MPL cell-surface expression by flow cytometry using an anti-FLAG antibody. Briefly, Ba/F3 cells expressing the FLAG-tagged MPL and transduced with the bicistronic retroviral pMIGR-IRES-GFP vector encoding either JAK2_WT, JAK_V6IVF, JAK2_R867Q, JAK2_S755R- _R938Q, JAK2_S755_R or JAK2_R938Q were sorted for equal GFP levels and maintained in WEHI-supplemented medium. GFP-expression allowed monitoring of JAK2 levels in the various cell lines and MPL cell-surface expression was assessed by flow cytometry using PE fluoresence labeling of the extracellular FLAG-tag.

As previously described (Pecquet C et al,. Blood. 2012), overexpression of JAK2 led to increased MPL cell- surface expression, whereas JAK2 V617F induced its decrease. In good agreement with the stability of JAK2 mutants, JAK2 S755R/R938Q allowed a 2- fold augmentation of MPL cell-surface expression and JAK2 R867Q behaved similarly as JAK2 WT (Figure 6a). Thus, the longer the half-life of the JAK2 mutants, the more pronounced the effect on promoting cell surface localization of MPL was. When the cells were deprived of cytokines, MPL surface expression increased with JAK2 R867Q and JAK2V617F but not with JAK2 S755R/R938Q mutant (Figure 6b) demonstrating that this last mutant had a marked effect on MPL cell-surface expression independently of cytokine stimulation.

These results suggest that only JAK2_S755_R-_R938Q mutant can enhance MPL cell-surface expression thereby contributing to an overactivation of the MPL/JAK2 signalization.

In order to better understand the properties of these JAK2 mutants, their stability was checked. Therefore, different cell lines were treated with cycloheximide (CHX, 50 μg/mL; for different time periods up to 24 hours) and a Western blot analysis was performed with an anti-JAK2 antibody and anti-MPL antibodies (Figure 6c). JAK2 S755R/R938Q mutant was 2-fold more stable than JAK2 WT, whereas JAK2 V617F was two-fold less stable than JAK2 WT. JAK2 R867Q was found as stable as JAK2 WT (Figure 6c). Moreover, JAK2 S755R/R938Q significantly increased the stability of cell- surface MPL compared to the other JAK2 (Figure 6c).

The results of JAK2 stability are in good agreement with the expression of MPL cell surface expression in JAK2_S755R-R938Q and JAK2R₈67Q mutant cells. BIBLIOGRAPHIC REFERENCES

Baxter E.J. et al, Lancet 2005 ; 365(9464) : 1054-61

Cole et al, Methods Enzymol, 121; 140-67 (1986)

Deshpande A et al, Leukemia. 2012, 26(4):708-15

Eghtedar et al., Blood, 2012, 1 19(20):4614-8

Gozgit J.M. et al, Journal of Biological Chemistry, 2008 ; 283(47):32334-43

Huse et al, Science 246; 1275 (1989)

James C. et al, Nature, 2005; 434(7037): 1 144-8

Kohler and Milstein, Nature 256; 495- 497 (1975)

Koopmans SM et al, The Netherlands Journal of Medicine, 2012

Kozbor et al, Immunol Today 4 72 (1983)

Marit M.R. et al, PLoS One, 2012 ; 7(8):e43437

Newton & Graham, PCR 2^nd edition, BIOS Scientific Publishers Limited 1997

Pardanani A. et al, Leukemia, 2009 ; 23(8): 1441-5

Pardanani A. et al, Journal of Clinical Oncology, 201 1 ;29(7):789-96

Pecquet C et al,. Blood. 2012; 1 19(20):4625-4635.

Pikman Y. et al, PloSMed. 2006 ; 3(7):e270

Proia DA et al, PLoS ONE, 201 1 ; 6(4):el8552

Sambrook, Fritsch and Maniatis -"Molecular Cloning - A Laboratory Manual" Second Edition Cold Spring Harbor Laboratory, 1989

Seavey M.M. et al, Mol. Cancer. Ther. 2012, 11 ;984

Verstovsek S. , American Society of Hematology 2009; 636-42

Verstovsek S., et al, New England Journal of Medicine, 2012; 366(9):799-807

Wang Y. et al, Blood 2009 ; 114(24):5024-33 Weigert O. et al, J. Exp. Med. 2012 ; 209(2 ):259-73

Claims

1. An isolated Janus kinase 2 (JAK2) mutant protein of SEQ ID NO: l comprising one or more mutation(s) on amino acid(s) 755, 938, and/or 867, particularly selected in the group consisting of: S755R, R938Q and R867Q, or equivalents of said JAK2 mutant protein in other mammals.

2. The isolated Janus kinase 2 (JAK2) mutant protein of claim 1, wherein it is chosen in the group consisting of: SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, and SEQ ID NO:6.

3. An isolated polynucleotide whose sequence encodes a JAK2 mutant protein as defined in claim 1 or 2, in particular chosen in the group consisting of: SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO: 10, and SEQ ID NO: l l .

4. A cloning and/or viral expression vector wherein it comprises the polynucleotide sequence of claim 3 under the control of an efficient promoter.

5. The expression vector of claim 4, wherein it is a viral or a plasma vector or in the form of naked DNA.

6. The expression vector of claim 4 or 5, wherein said promoter is efficient in mammalian cells.

7. A recombinant cell, with the exception of human embryonic stem cells or germinal cells, containing the expression vector of any one of claim 4 to 6, wherein it expresses one of the JAK2 mutant proteins defined in claim 1 or 2.

8. A non-human transgenic animal expressing a JAK2 mutant protein as defined in claim 1 or 2.

9. The non-human transgenic animal of claim 8, wherein it is a mouse or a rat having integrated into its genome a sequence coding for the JAK2 mutant protein of claim 1 or 2, in particular the sequence of claim 3.

10. Nucleic acid primers or probes containing 10 to 30 nucleotides and hybridizing specifically with a nucleotide sequence comprising at least the nucleotide(s) in position 2265, 2813 and/or 2600 of the human JAK2 gene of SEQ ID NO:7, or equivalent nucleotide(s) thereof in other mammals.

11. A probe binding the mutant protein as defined in claim 1 or 2, wherein it does not bind the JAK2 protein of SEQ ID NO: l nor the JAK2_V6i7F mutant protein of SEQ ID NO:2.

12. The probe of claim 11, wherein it is a monoclonal antibody.

13. An hybridoma which produces the monoclonal antibody of claim 12.

14. An in vitro method for determining the sensitivity of a subject to a treatment with a JAK2 and/or a Hsp90 inhibitor, comprising the steps of: a) obtaining a nucleic acid sample from said subject, b) detecting in said sample the presence of one or more mutation(s) in the JAK2 gene, said mutated gene encoding the JAK2 mutant protein of claim 1 or 2, wherein the presence of said mutation(s) indicates that said subject has a high risk to be resistant to a treatment with a JAK2 and/or a Hsp90 inhibitor.

15. An in vitro method for predicting the efficiency of a JAK2 and/or a Hsp90 inhibitor in a subject in need thereof, comprising the steps of: a) obtaining a nucleic acid sample from said subject, b) detecting, in said sample, the presence of one or more mutation(s) in the JAK2 gene, said mutated gene encoding the JAK2 mutant protein of claim 1 or 2, wherein the presence of said mutation(s) indicates that the said JAK2 and/or Hsp90 inhibitor has a high risk to be inefficient for treating said subject.

16. An in vitro method for diagnosing a myeloproliferative neoplasm or a leukaemia in a subject, and/ or for predicting that a subject will suffer from a myeloproliferative neoplasm or a leukaemia, said method comprising the steps of: a) obtaining a nucleic acid sample from said subject, b) detecting, in said sample, the presence of one or more mutation(s) in the JAK2 gene, said mutated gene encoding the JAK2 mutant protein of claim 1 or 2, wherein the presence of at least one of said mutations indicates that said subject is suffering or will suffer from a myeloproliferative neoplasm or a leukaemia.

17. The method of any one of claim 14 to 16, wherein it comprises a step of hybridization with at least one primer as defined in claim 10.

18. The method of any one of claim 14 to 17, wherein it comprises a step of amplification by PCR reaction with at least one primer as defined in claim 10.

19. The method of any one of claim 14 to 18, wherein the mutated gene is one of the polynucleotide defined in claim 3.

20. An in vitro method for determining the sensitivity of a subject to a treatment with a JAK2 and/or a Hsp90 inhibitor, comprising the steps of: a) obtaining a biological sample from said subject, b) detecting in said sample the presence of at least one of the JAK2 mutant protein defined in claim 1 or 2, wherein the presence of said JAK2 mutant protein(s) indicates that said subject has a high risk to be resistant to a treatment with a JAK2 and/or aHsp90 inhibitor.

21. An in vitro method for predicting the efficiency of a JAK2 and/or a Hsp90 inhibitor in a subject in need thereof, comprising the steps of: a) obtaining a biological sample from said subject, b) detecting, in said sample, the presence of at least one of the JAK2 mutant protein defined in claim 1 or 2, wherein the presence of said JAK2 mutant protein(s) indicates that the said JAK2 and/or Hsp90 inhibitor has a high risk to be inefficient for treating said subject.

22. The method of any one of claim 14 to 21, wherein said JAK2 inhibitor is chosen in the group consisting of: INCBO 18424, AZD1480, AZD960, AG-490, WP1066, TG101348 (SAR302503), TG101209, NVP-BSK805, AT9283, LY2784544, CEP33779 and CYT387, and said Hsp90 inhibitor is chosen in the group consisting of: 17-AAG (Tanespimycin), AUY922 (NVP-AUY922), 17-DMAG HC1 (Alvespimycin), BIIB021, NVP-BEP800, STA-9090 (Ganetespib), MPC-3100, AT13387, Geldanamycin, SNX- 2112 and PF-04929113 (SNX-5422).

23. An in vitro method for diagnosing a myeloproliferative neoplasm or a leukaemia in a subject, and/ or for predicting that a subject will suffer from a myeloproliferative neoplasm or a leukaemia, said method comprising the steps of: a) obtaining a biological sample from said subject, b) detecting, in said sample, the presence of at least one of the JAK2 mutant protein defined in claim 1 or 2, wherein the presence of said JAK2 mutant protein(s) indicates that said subject is suffering or will suffer from a myeloproliferative neoplasm or a leukaemia.

24. The method of any one of claims 20 to 23, wherein the detecting step b) is performed by using the probe defined in claim 11 or 12.

25. The method of any one of claims 20 to 24, wherein it is an ELISA assay.

26. A kit for use in any of the method disclosed in claims 14 to 19, comprising at least one primer as defined in claim 10, for the specific detection of the presence of mutations of the JAK2 gene encoding S755R, R938Q and/or R867Q.

27. The kit of claim 26, also comprising at least one element chosen from a thermoresistant polymerase for PCR amplification, one or more solutions for the amplification and/or the hybridization step, and also any reagent for detecting a label.

28. A kit for use in any of the method disclosed in claims 20 to 25, comprising at least one probe as defined in claim 1 1 or 12, for the specific detection of the presence of the

JAK2s755R, JAK2R938Q, JAK2R867Q, JAK2S755R+R867Q, JAK2S755R+R938Q, JAK2R867Q+R938Q and/or JAK2s755R+R867Q+R938Q-

29. A method for identifying therapeutic products that are efficient for treating JAK2- related disorders, comprising the steps of: a) contacting a candidate therapeutic product with at least one of the JAK2 mutant protein defined in claim 1 or 2, or with the recombinant cell defined in claim 7, or with a fraction thereof containing said at least one JAK2 mutant protein, or with the transgenic animal defined in claim 8 or 9, under suitable conditions, b) detecting, directly or indirectly, if said JAK2 mutant protein is inhibited or altered by said candidate therapeutic product, c) selecting said therapeutic product if said JAK2 mutant protein is efficiently inhibited or altered by said candidate therapeutic product.

30. The method of claim 29, wherein the therapeutic product is selected if it exhibits an IC₅₀ for said JAK2 mutant protein of less than Ι μΜ, preferably of ΙΟΟηΜ.

31. The method of any one of claim 29 or 30, wherein the inhibition and/ or alteration of said JAK2 mutant protein is detected by studying its phosphorylation state, preferably by immunoprecipitation.

32. The method of any one of claim 29 or 30, wherein the inhibition and/ or alteration of said JAK2 mutant protein is detected by studying the spontaneous proliferation and differentiation of recombinant erythroblasts cells as defined in claim 7 or in erythroblasts cells of the transgenic animal of claim 8 or 9, wherein the therapeutic product is selected if it induces a decrease in said proliferation and differentiation.

33. siRNA capable of reducing by more than 50%, or more than 95%, the expression of the JAK2 mutant protein of claim 1 or 2, wherein it contains from 19 to 25 nucleotides.

34. Composition comprising the siRNA of claim 33 and a pharmaceutically acceptable vehicle.

35. The composition of claim 34, for use for treating subjects expressing at least one of the JAK2 mutant proteins as defined in claim 1 or 2.