WO2014055825A1

WO2014055825A1 - A formulation of mycobacterial components as an adjuvant for inducing th17 responses

Info

Publication number: WO2014055825A1
Application number: PCT/US2013/063388
Authority: WO
Inventors: Alan Sher; Kevin SHENDEROV; Vincenzo Cerundolo; Gurdyal S. Besra
Original assignee: The United States Of America, As Represented By The Secretary, Department Of Health & Human Services
Priority date: 2012-10-04
Filing date: 2013-10-04
Publication date: 2014-04-10

Abstract

The invention provides immunogenic compositions comprising CARD9 and/or Caspase 1 agonists and methods of using the composition to induce or enhance an immune response.

Description

A FORMULATION OF MYCOBACTERIAL COMPONENTS AS

AN ADJUVANT FOR INDUCING TH17 RESPONSES

RELATED APPLICATIONS

This application claims priority to U.S. Provisional Application No. 61/709,713, filed October 4, 2012, incoporated by reference in its entirety herein.

STATEMENT OF RIGHTS TO INVENTIONS MADE UNDER FEDERALLY SPONSORED RESEARCH

Research supporting this application was carried out by the United States of America as represented by the Secretary, Department of Health and Human Services, and the Division of Intramural Research Program of the National Institute of Allergy and Infectious Diseases. The Government has certain rights in the invention.

BACKGROUND OF THE INVENTION

Adjuvants are traditionally used to increase the magnitude of adaptive response to a vaccine. Increasingly, specific adjuvants have been designed to illicit immune responses to specific pathogens and thus increase vaccine efficacy. For example, the adjuvant MF59 is currently approved for use in pandemic flu vaccines. The adjuvant's pattern of immune stimulation makes it especially suited to stimulating a response against flu - it stimulates stronger antibody responses, generates marked memory responses, and leads to a pattern of induced genes that is both larger and distinct from that induced by other adjuvants or unadjuvanted vaccines.

The choice of adjuvants is often a critical factor in the success of vaccines, but the number of adjuvants available for clinical use is limited. Effective adjuvants are known to act on the innate immune system to not only increase the magnitude of vaccine-induced immune responses, but also to direct the appropriate class of effector response. However, the innate immune pathways that must be targeted in order to elicit particular types of adaptive immunity are poorly understood, thus hampering the design of novel adjuvants.

Historically, mycobacteria and their components have been the basis of numerous adjuvants and immunotherapies. For instance, BCG instillation is widely used to treat superficial bladder cancer and BCG has been employed as an adjuvant in experimental vaccines against Leishmania spp. and other pathogens. However, the best-known use of mycobacteria for stimulating the immune system is in complete Freund' s adjuvant (CFA), a water-in-oil emulsion containing heat-killed M. tuberculosis strain H37Ra or M. butyricum. Although not appropriate for human use because of its adverse inflammatory side-effects, CFA has for decades been the adjuvant of choice for inducing strong humoral and cellular immune responses in experimental animals. Moreover, administering self antigens (e.g., myelin basic protein) in CFA breaks self tolerance and results in autoimmunity. Previous studies have shown that CFA promotes strong T helper 1 (Thl) and T helper 17 (Thl7) CD4⁺ T cell responses, and this is a likely explanation for the potency of the adjuvant in inducing experimental autoimmune disease.

Although Thl and Thl7 responses cause autoimmunity under certain circumstances, they are also protective against many pathogens, and adjuvants triggering their

differentiation may be useful tools for vaccination. While Thl responses have long been appreciated for their role in cell-mediated immunity against intracellular pathogens, Thl7 responses are now known to be protective against fungi and some extracellular bacteria. This is clearly evident in Job's Syndrome patients, who mount defective Thl7 responses as a result of mutations in the STAT3 gene, and are highly susceptible to Candida albicans and other fungal infections. Moreover, it has recently been shown that Thl7 and Thl cells can cooperate in host defense against two major intracellular pathogens - M. tuberculosis and Francisella tularensis.

Although Thl7 responses are known to be involved in host resistance to pathogenic agents, there are currently no adjuvants on the market that specifically promote a Thl7 response. Improved adjuvants that are capable of eliciting such a response are therefore needed for use in vaccines against pathogenic agents. SUMMARY OF THE INVENTION

As described below, the present invention generally features adjuvants or immunogenic compositions comprising a CARD9 agonist and/or a caspase 1 (caspase 1 inflammasome) agonist, and methods of using the adjuvant or composition to induce or enhance an immune response.

In aspects, the invention provides an adjuvant containing a CARD9 agonist and/or a caspase 1 agonist. In embodiments, the adjuvant further contains an oil (e.g., a mineral oil, a squalene based oil, and the like). In some embodiments, the adjuvant also contains a surfactant (e.g., Tween 80, Span 85, and the like). In aspects, the invention provides an immunogenic composition containing a CARD9 agonist and/or a caspase 1 agonist. In embodiments, the immunogenic composition further contains an oil (e.g., a mineral oil, a squalene based oil, and the like). In some embodiments, the immunogenic composition also contains a surfactant (e.g., Tween 80, Span 85, and the like).

In embodiments, the immunogenic composition further contains an immunogen. In related embodiments, the immunogen is an antigen derived from an infectious agent (e.g., a virus, bacteria, fungus, parasite, and the like). In some embodiments, the infectious agent is Klebsiella pneumoniae, Staphylococcus aureus, Escherichia coli, Salmonella enterica, Bordetella pertussis, Porphyromonas gingivalis, Mycobacterium tuberculosis, Listeria monocytogenes, Mycoplasma pneumoniae, Streptococcus pneumoniae, Pseudomonas Aeruginosa, Neisseria gonorrhoeae, Yersinia enterocolitica, Citrobacter rodentium, Francisella tularensis, Candida albicans, Cryptococcus neoformans, Pneumocystis carinii, Coccidioides posadasii, Histoplasma capsulatum, or Blastomyces dermatitidis.

In embodiments, the immunogenic composition further contains a pharmaceutically acceptable excipient, carrier, or diluent. The pharmaceutically acceptable excipient, carrier, or diluent can be any pharmaceutically acceptable excipient, carrier, or diluent well known in the art. See Remington's Pharmaceutical Sciences (Mack Pub. Co. N.J. current edition).

In any of the above aspects and embodiments, the CARD9 agonist can be

mycobacterial cord factor, SAP30, a peptide having a fungal alpha-mannose residue, a fungal alpha-mannan, or a fungal beta-glucan. In embodiments, the CARD9 agonist is mycobacterial cord factor.

In any of the above aspects and embodiments, the caspase 1 agonist is peptidoglycan, a double stranded DNA, flagellin, anthrax lethal toxin, ATP, alum, silica, a pore-forming toxin, or a Candida albicans peptide. In embodiments, the caspase 1 agonist is

peptidoglycan.

In any of the above aspects and embodiments, the adjuvant or immunogenic composition is capable of eliciting or modulating an immune response. In embodiments, the immune response is a cell mediated response and/or a Thl7 response.

In any of the above aspects and embodiments, the immunogenic composition is a vaccine.

In aspects, the invention provides methods for inducing or modulating an immune response in a subject. In embodiments, the method involves administering an effective amount of at least one of the adjuvants or immunogenic compositions described herein, thereby inducing or modulating an immune response in the subject.

In embodiments, the method prevents or treats an infection. In related embodiments, the infection is a viral infection, a bacterial infection, a fungal infection, or a parasitic infection. In some embodiments, the infection is infection by Klebsiella pneumoniae,

Staphylococcus aureus, Escherichia coli, Salmonella enterica, Bordetella pertussis,

Porphyromonas gingivalis, Mycobacterium tuberculosis, Listeria monocytogenes, Mycoplasma pneumoniae, Streptococcus pneumoniae, Pseudomonas Aeruginosa, Neisseria gonorrhoeae, Yersinia enterocolitica, Citrobacter rodentium, Francisella tularensis, Candida albicans, Cryptococcus neoformans, Pneumocystis carinii, Coccidioides posadasii, Histoplasma capsulatum, or Blastomyces dermatitidis.

In aspects, the invention provides methods for treating or preventing an infection by an infectious agent in a subject. In embodiments, the methods involve administering an effective amount of at least one of the adjuvants or immunogenic compositions described herein. In embodiments, the methods involve generating an immune response in the subject, wherein the immune response prevents or treats the infection.

In aspects, the invention provides methods for inducing or enhancing a Thl7 response in a subject. In embodiments, the methods involve administering an effective amount of at least one of the adjuvants or immunogenic compositions described herein. In embodiments, the method prevents or treats an infection. In related embodiments, the infection is a viral infection, a bacterial infection, a fungal infection, or a parasitic infection. In some embodiments, the infection is infection by Klebsiella pneumoniae, Staphylococcus aureus, Escherichia coli, Salmonella enterica, Bordetella pertussis, Porphyromonas gingivalis,

Mycobacterium tuberculosis, Listeria monocytogenes, Mycoplasma pneumoniae, Streptococcus pneumoniae, Pseudomonas Aeruginosa, Neisseria gonorrhoeae, Yersinia enterocolitica,

Citrobacter rodentium, Francisella tularensis, Candida albicans, Cryptococcus neoformans, Pneumocystis carinii, Coccidioides posadasii, Histoplasma capsulatum, or Blastomyces dermatitidis.

In aspects, the invention provides methods for inducing or enhancing production of IL- Ι β in a subject. In embodiments, the methods involve administering an effective amount of at least one of the adjuvants or immunogenic compositions described herein. In embodiments, the method prevents or treats an infection. In related embodiments, the infection is a viral infection, a bacterial infection, a fungal infection, or a parasitic infection. In some embodiments, the infection is infection by Klebsiella pneumoniae, Staphylococcus aureus, Escherichia coli, Salmonella enterica, Bordetella pertussis, Porphyromonas gingivalis,

Mycobacterium tuberculosis, Listeria monocytogenes, Mycoplasma pneumoniae, Streptococcus pneumoniae, Pseudomonas Aeruginosa, Neisseria gonorrhoeae, Yersinia enterocolitica, Citrobacter rodentium, Francisella tularensis, Candida albicans, Cryptococcus neoformans, Pneumocystis carinii, Coccidioides posadasii, Histoplasma capsulatum, or Blastomyces dermatitidis.

In aspects, the invention provides methods for immunizing a subject (e.g., against an infectious agent). In embodiments, the methods involve administering an effective amount of at least one of the adjuvants or immunogenic compositions described herein. In embodiments, the method prevents or treats an infection. In related embodiments, the infection is a viral infection, a bacterial infection, a fungal infection, or a parasitic infection. In some embodiments, the infection is infection by Klebsiella pneumoniae, Staphylococcus aureus, Escherichia coli, Salmonella enterica, Bordetella pertussis, Porphyromonas gingivalis,

In any of the above aspects and embodiments, the subject is human.

In any of the above aspects and embodiments, the adjuvant or immunogenic composition is administered systemically or locally. In embodiments, the adjuvant or immunogenic composition is administered by intramuscular injection, intradermal injection, intravenous injection, or subcutaneous injection.

In any of the above aspects and embodiments, the adjuvant or immunogenic composition is administered in a prime boost regimen.

In aspects, the invention provides pharmaceutical compositions for the treatment or prevention of infection by an infectious agent. In embodiments, the pharmaceutical compositions contain an effective amount of at least one of the adjuvants or immunogenic compositions described herein. In some embodiments, the pharmaceutical compositions also contain a pharmaceutically acceptable excipient, carrier, or diluent.

In aspects, the invention provides kits for the treatment or prevention of infection by an infectious agent. In embodiments, the kits contain an effective amount of at least one of the adjuvants or immunogenic compositions described herein. In some embodiments, the kits also contain instructions for using the kit in one of the methods described herein.

Additional objects and advantages of the invention will be set forth in part in the description which follows, and in part will be obvious from the description, or may be learned by practice of the invention. The objects and advantages of the invention will be realized and attained by means of the elements and combinations disclosed herein, including those pointed out in the appended claims. It is to be understood that both the foregoing general description and the following detailed description are exemplary and explanatory only and are not restrictive of the invention as claimed. The accompanying drawings, which are incorporated in and constitute a part of this specification, illustrate several embodiments of the invention and, together with the description, serve to explain the principles of the invention.

Definitions

As used herein, "adjuvant" is understood as a pharmacological or immunological agent that modifies the effect of other agents (e.g., immunogen or target antigen in an immunogenic composition) while having few if any direct effects when given by itself. Adjuvants are frequently administered with vaccines to enhance the recipient' s immune response to a supplied antigen while keeping the injected foreign material at a minimum. Adjuvants may be essentially inert when administered alone.

By "agent" is meant any small molecule chemical compound, antibody, nucleic acid molecule, or polypeptide, or fragments thereof.

By "ameliorate" is meant decrease, suppress, attenuate, diminish, arrest, or stabilize the development or progression of a disease or a symptom thereof.

By "analog" is meant a molecule that is not identical, but has analogous functional or structural features. For example, a polypeptide analog retains the biological activity of a corresponding naturally-occurring polypeptide, while having certain biochemical modifications that enhance the analog's function relative to a naturally occurring polypeptide. Such biochemical modifications could increase the analog's protease resistance, membrane permeability, or half-life, without altering, for example, ligand binding. An analog may include an unnatural amino acid.

By "CARD9" is meant a polypeptide or fragment thereof having at least about 85% amino acid sequence identity to GenBank Accession No. CAI13932.1.

An exemplary CARD9 sequence (NCBI CAI13932.1) is provided below: wsvlegfrvt ltsvidpsr i tpylrqckvl npddeeqvls dpnlvirkrk

61 tghkgyvaf1 eslelyypql ykkvtgkepa rvf smiidas gesgltqllm

121 t qdltallssk ddf ikelrvk dsllrkhqer vqr lkeecea gsrelkreke

181 e hqseekgaal mrnrdlqlei dqlkhslmka eddckverkh tlklrhameq

241 r qqekallqar vqeleasvqe gkldrsspyi qvleedwrqa lrdhqeqant

301 i gearrlrcme ekemfelqcl alrkdskmyk drieaillqm eevaierdqa

361 i harglqekda lrkqvrelge kadelqlqvf qceaqllave grlrrqqlet

421 1 sprr sqelsl pqdledtqls dkgclagggs pkqpfaalhq eqvlrnphda

errr lkesfe nyrrkralrk mqkgwrqgee drenttgsdn

By "Caspase 1" is meant a polypeptide or fragment thereof having at least about 85% amino acid sequence identity to GenBank Accession Nos. NP_150634.1, NP_001214.1, and NP_150635.1. .

Exemplary Caspase 1 sequences (NP_150634.1, NP 001214.1, and NP_150635.1, respectively) are provided below:

1 madkvlkekr klfirsmgeg tinglldell qtrvlnkeem ekvkrenatv mdktralids

61 vipkgaqacq icityiceed sylagtlgls adqtsgnyln mqdsqgvlss fpapqavqdn

121 pamptssgse gnvklcslee aqriwkqksa eiypimdkss rtrlaliicn eefdsiprrt

181 gaevditgmt mllqnlgysv dvkknltasd mtteleafah rpehktsdst flvfmshgir

241 egicgkkhse qvpdilqlna ifnmlntknc pslkdkpkvi iiqacrgdsp gvvwfkdsvg

301 vsgnlslptt eefeddaikk ahiekdfiaf csstpdnvsw rhptmgsvfi grliehmqey

361 acscdveeif rkvrfsfeqp dgraqmptte rvtltrcfyl fpgh

1 madkvlkekr klfirsmgeg tinglldell qtrvlnkeem ekvkrenatv

mdktralids

61 vipkgaqacq icityiceed sylagtlgls aapqavqdnp amptssgseg nvklcsleea

121 qriwkqksae iypimdkssr trlaliicne efdsiprrtg aevditgmtm llqnlgysvd

181 vkknltasdm tteleafahr pehktsdstf lvfmshgire gicgkkhseq vpdilqlnai

241 fnmlntkncp slkdkpkvii iqacrgdspg vvwfkdsvgv sgnlslptte efeddaikka

301 hiekdfiafc sstpdnvswr hptmgsvfig rliehmqeya cscdveeifr kvrfsfeqpd

361 graqmptter vtltrcfylf pgh

1 madkvlkekr klfirsmgea pqavqdnpam ptssgsegnv klcsleeaqr

iwkqksaeiy

61 pimdkssrtr laliicneef dsiprrtgae vditgmtmll qnlgysvdvk knltasdmtt

121 eleafahrpe hktsdstflv fmshgiregi cgkkhseqvp dilqlnaifn mlntkncpsl

181 kdkpkviiiq acrgdspgvv wfkdsvgvsg nlslptteef eddaikkahi ekdfiafess 241 tpdnvswrhp tmgsvfigrl iehmqeyacs cdveeifrkv rfsfeqpdgr

aqmpttervt

301 ltrcfylfpg h

As used herein, "changed as compared to a control" sample or subject is understood as having a level of the analytic or diagnostic or therapeutic indicator to be detected at a level that is statistically different than a sample from a normal, untreated, or control sample. Control samples include, for example, cells in culture, one or more laboratory test animals, or one or more human subjects. Methods to select and test control samples are within the ability of those in the art. An analytic substance can be a naturally occurring substance that is characteristically expressed or produced by the cell or organism (e.g., antibodies, pathogenic peptides or particles, and the like) or a substance produced by a reporter construct (e.g, β-galactosidase or luciferase). Depending on the method used for detection the amount and measurement of the change can vary. Determination of statistical significance is within the ability of those skilled in the art.

In this disclosure, "comprises," "comprising," "containing" and "having" and the like can have the meaning ascribed to them in U.S. Patent law and can mean " includes," "including," and the like; "consisting essentially of or "consists essentially" likewise has the meaning ascribed in U.S. Patent law and the term is open-ended, allowing for the presence of more than that which is recited so long as basic or novel characteristics of that which is recited is not changed by the presence of more than that which is recited, but excludes prior art embodiments.

"Co-administration" as used herein is understood as administration of one or more agents to a subject such that the agents are present and active in the subject at the same time. Co- administration does not require a preparation of an admixture of the agents or simultaneous administration of the agents.

"Contacting a cell" is understood herein as providing an agent to a cell e.g., a cell to be treated in culture, ex vivo, or in an animal, such that the agent can interact with the cell (e.g., cell to be treated), potentially be taken up by the cell, and have an effect on the cell. The agent (e.g., an adjuvant) can be delivered to the cell directly (e.g., by addition of the agent to culture medium or by injection into the cell or tissue of interest), or by delivery to the organism by a topical or parenteral route of administration for delivery to the cell by vascular, lymphatic, or other means. One of ordinary skill in the art will readily understand that administration of the agonists of the invention to a subject involves contacting the agonist with a cell of the subject. By "cytokine" is meant a hormone that acts locally and that modulates an individual's immune response.

As used herein, "detecting", "detection" and the like are understood that an assay performed to determine one or more characteristics of a sample, e.g. identifying the presence, absence or amount of the analyte to be detected. For example, detection can include identification of a specific analyte in a sample or an activity of an agent in a sample. Detection can include the determination of the presence of nucleic acid, protein (e.g., antibody, cytokine, and the like) by PCR, immunoassay (e.g., ELISA), microscopy, pathogen challenge, and the like. The amount of analyte or activity detected in the sample can be none or below the level of detection of the assay or method.

By "disease" is meant any condition or disorder that damages or interferes with the normal function of a cell, tissue, or organ. Examples of diseases include pathogenic infections, such as infection by a bacteria, fungus, parasite, and/or virus.

The terms "effective amount," "therapeutically effective amount," "effective dose," or "therapeutically effective dose" refers to that amount of an agent to produce the intended pharmacological, therapeutic, or preventive result. For example, the pharmacologically effective amount results in the prevention or delay of onset of disease after contact with a pathogen, either in an individual or in the frequency of disease in a population. More than one dose may be required to provide an effective dose. It is understood that an effective dose in one population may or may not be sufficient in all populations. Thus, in connection with the administration of an agent or immunogenic composition, the agent or immunogenic composition is "effective against" a disease or condition when administration in a clinically appropriate manner results in a beneficial effect for at least a statistically significant fraction of subjects, such as a prevention of disease onset, improvement of symptoms, a cure, a reduction in disease signs or symptoms, extension of life, improvement in quality of life, or other effect generally recognized as positive by medical doctors familiar with treating the particular type of disease or condition.

By "enhances" is meant a positive alteration of at least 10%, 25%, 50%, 75%, 100%, or any number therebetween.

By "fragment" is meant a portion of a polypeptide or nucleic acid molecule. This portion contains, preferably, at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, or 90% of the entire length of the reference nucleic acid molecule or polypeptide. A fragment may contain 10, 20, 30, 40, 50, 60, 70, 80, 90, or 100, 200, 300, 400, 500, 600, 700, 800, 900, or 1000 nucleotides or amino acids. "Hybridization" means hydrogen bonding, which may be Watson-Crick, Hoogsteen or reversed Hoogsteen hydrogen bonding, between complementary nucleotide bases. For example, adenine and thymine are complementary nucleotide bases that pair through the formation of hydrogen bonds.

As used herein, the terms "identity" or "percent identity" refers to the subunit sequence similarity between two polymeric molecules, e.g. , two polynucleotides or two polypeptides. When a subunit position in both of the two molecules is occupied by the same monomeric subunit, e.g. , if a position in each of two peptides is occupied by serine, then they are identical at that position. The identity between two sequences is a direct function of the number of matching or identical positions, e.g. , if half (e.g. , 5 positions in a polymer 10 subunits in length), of the positions in two peptide or compound sequences are identical, then the two sequences are 50% identical; if 90% of the positions, e.g. , 9 of 10 are matched, the two sequences share 90% sequence identity. The identity between two sequences is a direct function of the number of matching or identical positions. Thus, if a portion of the reference sequence is deleted in a particular peptide that deleted section is not counted for purposes of calculating sequence identity. Identity is often measured using sequence analysis software e.g. , BLASTN or BLASTP (available at (www.ncbi.nih.gov/BLAST). The default parameters for comparing two sequences (e.g. , "Blast"-ing two sequences against each other), by BLASTN (for nucleotide sequences) are reward for match = 1, penalty for mismatch = -2, open gap = 5, extension gap = 2. When using BLASTP for protein sequences, the default parameters are reward for match = 0, penalty for mismatch = 0, open gap = 11, and extension gap = 1. Additional, computer programs for determining identity are known in the art.

By "substantially identical" is meant a polypeptide or nucleic acid molecule exhibiting at least 50% identity to a reference amino acid sequence (for example, any one of the amino acid sequences described herein) or nucleic acid sequence (for example, any one of the nucleic acid sequences described herein). Such a sequence can be at least 60%, 70%, 80%, 85%, 90%, 95%, 99%, or any number therebetween, identical at the amino acid or nucleic acid level to the sequence used for comparison.

As used herein, an "immunoassay" is a detection method based on the specific binding of at least one antibody to an antigen, e.g., ELISA, RIA, western blot, and the like.

As used herein "immunogen", "immunogenic", and the like refer to substances that can promote an immune response, e.g., an antibody based or cell mediated immune response, in at least one organism. By "immunogenic composition" is meant a composition comprising a molecule capable of inducing or modulating an immune response in a subject. Such an immune response may be a prophylactic or therapeutic immune response. In embodiments, the immunogenic composition is a vaccine.

As used herein "inducing immunity" is meant to refer to any immune response generated against an antigen. In embodiments, immunity is mediated by antibodies against an infectious agent, which is exhibited by a vertebrate (e.g., a human), that prevents or ameliorates an infection or reduces at least one symptom thereof. The immunogenic compositions of the invention can stimulate the production of antibodies that, for example, neutralize infectious agents, block infectious agents from entering cells, block replication of infectious agents, and/or protect host cells from infection and destruction. The term can also refer to an immune response that is mediated by T- lymphocytes and/or other white blood cells against an infectious agent, exhibited by a vertebrate (e.g., a human), that prevents or ameliorates an infection or reduces at least one symptom thereof.

By "isolated" is meant a material that is free to varying degrees from components which normally accompany it as found in its native state. "Isolate" denotes a degree of separation from original source or surroundings.

By "isolated polynucleotide" is meant a nucleic acid (e.g., a DNA) that is free of the genes which, in the naturally-occurring genome of the organism from which the nucleic acid molecule of the invention is derived, flank the gene. The term therefore includes, for example, a recombinant DNA that is incorporated into a vector; into an autonomously replicating plasmid or virus; or into the genomic DNA of a prokaryote or eukaryote; or that exists as a separate molecule (for example, a cDNA or a genomic or cDNA fragment produced by PCR or restriction endonuclease digestion) independent of other sequences. In addition, the term includes an RNA molecule that is transcribed from a DNA molecule, as well as a recombinant DNA that is part of a hybrid gene encoding additional polypeptide sequence.

By an "isolated polypeptide" is meant a polypeptide of the invention that has been separated from components that naturally accompany it. Typically, the polypeptide is isolated when it is at least 60%, by weight, free from the proteins and naturally-occurring organic molecules with which it is naturally associated. Preferably, the preparation is at least 75%, more preferably at least 90%, and most preferably at least 99%, by weight, a polypeptide of the invention. An isolated polypeptide of the invention may be obtained, for example, by extraction from a natural source, by expression of a recombinant nucleic acid encoding such a polypeptide; or by chemically synthesizing the protein. Purity can be measured by any appropriate method, for example, column chromatography, polyacrylamide gel electrophoresis, or by HPLC analysis.

As used herein, "nucleic acid" as in a nucleic acid for delivery to a cell is understood by its usual meaning in the art as a polynucleotide or oligonucleotide which refers to a string of at least two base-sugar-phosphate combinations. Nucleotides are the monomeric units of nucleic acid polymers. The term includes deoxyribonucleic acid (DNA) and ribonucleic acid (RNA) in the form of an oligonucleotide messenger RNA, anti-sense, plasmid DNA, parts of a plasmid DNA, genetic material derived from a virus, and the like. Polynucleotides include nucleic acids of at least two monomers. Anti-sense polynucleotides are nucleic acids that interfere with the function of DNA or RNA. An siRNA or an shRNA is a double stranded RNA that inhibits or disrupts activity or translation, for example by promoting degradation of modifying splicing or processing of the cellular nucleic acid, e.g., mRNA, microRNA, and the like, to which it is targeted. As used herein, siRNA and shRNA include any double stranded RNA molecule that can modulate the stability, translation, or splicing of an RNA to which at least one strand of the double stranded nucleic acid hybridizes. RNAs are well known in the art, see e.g., patent publications WO02/44321, WO/2003/099298, US

20050277610, US 20050244858; and US Patents 7,297,786, 7,560,438 and 7,056,704, all of which are incorporated herein by reference. Nucleic acid as used herein is understood to include non-natural nucleotides (not occurring in nature), for example: a derivative of natural nucleotides such as phosphothionates or peptide nucleic acids (such as those described in the patents and applications cited immediately above). A nucleic acid can be delivered to a cell in order to produce a cellular change that is therapeutic. The delivery of a nucleic acid or other genetic material for therapeutic purposes is gene therapy. The nucleic acid may express a protein or polypeptide, e.g., a protein that is missing or non- functional in the cell or subject. The nucleic acid may be single or double stranded, may be sense or anti-sense, and can be delivered to a cell as naked DNA, in combination with agents to promote nucleic acid uptake into a cell (e.g., transfection reagents), in the context of a viral vector, and the like. The nucleic acid can be targeted to a nucleic acid that is endogenous to the cell (mRNA or microRNA), or a heterologous nucleic acid (e.g., nucleic acid from a pathogen, such as a viral gene). Delivery of a nucleic acid means to transfer a nucleic acid from outside a subject to within the outer cell membrane of a cell in the subject.

"Obtaining" is understood herein as manufacturing, purchasing, synthesizing, isolating, purifying, or otherwise coming into possession of. The phrase "pharmaceutically acceptable carrier, excipient, or diluent" is art recognized and includes a pharmaceutically acceptable material, composition or vehicle, suitable for administering compounds of the present invention to mammals. As used herein, the term "pharmaceutically acceptable" means being approved by a regulatory agency of the Federal or a state government or listed in the U.S. Pharmacopia, European Pharmacopia or other generally recognized pharmacopia for use in mammals, e.g., humans.

A "polypeptide" or "peptide" as used herein is understood as two or more independently selected natural or non-natural amino acids joined by a covalent bond (e.g., a peptide bond). A peptide can include 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or more natural or non-natural amino acids joined by peptide bonds. Polypeptides as described herein include full length proteins (e.g., fully processed proteins) as well as shorter amino acids sequences (e.g., fragments of naturally occurring proteins or synthetic polypeptide fragments).

As used herein, the terms "prevent," "preventing," "prevention," "prophylactic treatment" and the like refer to reducing the probability of developing a disorder or condition in a subject, who does not have, but is at risk of or susceptible to developing a disorder or condition. For example, prevention can be understood as to limit, reduce the rate or degree of onset, or inhibit the development of at least one sign or symptom of a disease or condition in a subject, e.g., a subject prone to developing the disease or disorder, e.g., due to geographic location, lack of clean water, immunosuppressed state, and the like. A subject immunized with the immunogenic composition of the invention will not develop the disease for at least 1 year, 2 years, 3 years, 4 years, 5 years, 6 years, 7 years, 8 years, 9 years, 10 years, or more after immunization. Prevention can require the administration of more than one dose of an agent or therapeutic. Prevention may occur in only a subset of individuals to whom the vaccine is administered who are subsequently exposed to the pathogen. There may be a delay from the time of administration until the vaccine is effective in preventing productive viral infection. Such considerations are well known to those of skill in the art.

By "reduces" is meant a negative alteration of at least 10%, 25%, 50%, 75%, 100%, or any number therebetween.

As used herein, "recombinant" includes reference to a polypeptide produced using cells that express a heterologous polynucleotide encoding the polypeptide. The cells produce the recombinant polypeptide because they have been genetically altered by the introduction of the appropriate isolated nucleic acid sequence. The term also includes reference to a cell, or nucleic acid, or vector, that has been modified by the introduction of a heterologous nucleic acid or the alteration of a native nucleic acid to a form not native to that cell, or that the cell is derived from a cell so modified. Thus, for example, recombinant cells express genes that are not found within the native (non-recombinant) form of the cell, express mutants of genes that are found within the native form, or express native genes that are otherwise abnormally expressed, under-expressed or not expressed at all.

By "reference" is meant a standard or control condition.

A "sample" as used herein refers to a biological material that is isolated from its environment (e.g., blood or tissue from an animal, cells, or conditioned media from tissue culture). In embodiments, the sample is suspected of containing, or known to contain an analyte, such as an infectious agent or a protein of interest (e.g., antibody, cytokine, and the like). A sample can also be a partially purified fraction of a tissue or bodily fluid. A reference sample can be a "normal" sample, from a donor not having the disease or condition fluid, or from a normal tissue in a subject having the disease or condition, or an untreated subject (e.g., a subject not treated with the vaccine). A reference sample can also be taken at a "zero time point" prior to contacting the cell or subject with the agent or therapeutic intervention to be tested.

By "specifically binds" is meant recognition and binding to a target (e.g., polypeptide, cell, and the like), but which does not substantially recognize and bind other molecules in a sample, for example, a biological sample

A "subject" as used herein refers to a living organism. In embodiments, the living organism is an animal. In embodiments, the subject is a mammal. In embodiments, the subject is a domesticated mammal or a primate including a non-human primate. Examples of subjects include, but are not limited to, humans, monkeys, dogs, cats, mice, rats, cows, horses, swine, goats, sheep, and birds. A subject may also be referred to as a patient.

A subject "suffering from or suspected of suffering from" a specific disease, condition, or syndrome has a sufficient number of risk factors or presents with a sufficient number or combination of signs or symptoms of the disease, condition, or syndrome such that a competent individual would diagnose or suspect that the subject was suffering from the disease, condition, or syndrome. Methods for identification of subjects suffering from or suspected of suffering from infection is within the ability of those in the art. Subjects suffering from, and suspected of suffering from, a specific disease, condition, or syndrome are not necessarily two distinct groups. As used herein, "susceptible to" or "prone to" or "predisposed to" a specific disease or condition and the like refers to an individual who based on genetic, environmental, health, and/or other risk factors is more likely to develop a disease or condition than the general population. An increase in likelihood of developing a disease may be an increase of about 10%, 20%, 50%, 100%, 150%, 200%, or more.

As used herein, the terms "treat," treating," "treatment," and the like refer to reducing or ameliorating a disorder and/or symptoms associated therewith. It will be appreciated that, although not precluded, treating a disorder or condition does not require that the disorder, condition or symptoms associated therewith be completely eliminated.

As used herein, the term "vaccine" refers to a formulation which contains a target immunogen and an adjuvant as described herein, which is in a form that is capable of being administered to a vertebrate and which induces a protective immune response sufficient to induce immunity to prevent and/or ameliorate an infection and/or to reduce at least one symptom of an infection. Typically, the vaccine comprises an oil-in-water emulsion in which the composition of the present invention is suspended or dissolved. In this form, the composition of the present invention can be used conveniently to prevent, ameliorate, or otherwise treat an infection. Upon introduction into a host, the vaccine is able to provoke an immune response including, but not limited to, the production of antibodies and/or cytokines and/or the activation of cytotoxic T cells, antigen presenting cells, helper T cells (e.g., Thl7), dendritic cells and/or other cellular responses.

The antigen can be a live pathogen, e.g., an attenuated pathogen, an inactivated pathogen, a mixture of proteins, an isolated protein, a nucleic acid, a carbohydrate, a chemical, or any other agent that can induce an immune response, or any combination thereof. A vaccine can induce an immune response after a single immunization or may need to be administered multiple times (e.g., 2, 3, 4, or more times) either at short intervals

(multiple administrations within a year) to produce a sustained response, or at long intervals, e.g., every 5, 10, 15, 20, or more years to maintain immunity. Administration of a dose of the vaccine can also be prompted by possible or known exposure to the pathogen. Such considerations are understood by those of skill in the art.

Ranges provided herein are understood to be shorthand for all of the values within the range. For example, a range of 1 to 50 is understood to include any number,

combination of numbers, or sub-range from the group consisting 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50. Unless specifically stated or obvious from context, as used herein, the term "or" is understood to be inclusive.

Unless specifically stated or obvious from context, as used herein, the terms "a", "an", and "the" are understood to be singular or plural.

Unless specifically stated or obvious from context, as used herein, the term "about" is understood as within a range of normal tolerance in the art, for example within 2 standard deviations of the mean. About can be understood as within 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1%, 0.5%, 0.1%, 0.05%, or 0.01% of the stated value. Unless otherwise clear from context, all numerical values provided herein can be modified by the term about.

The recitation of a listing of chemical groups in any definition of a variable herein includes definitions of that variable as any single group or combination of listed groups. The recitation of an embodiment for a variable or aspect herein includes that embodiment as any single embodiment or in combination with any other embodiments or portions thereof.

Any compositions or methods provided herein can be combined with one or more of any of the other compositions and methods provided herein.

BRIEF DESCRIPTION OF THE DRAWINGS

Figure 1 depicts the general strategy for using the adjuvants of the present invention.

Figures 2A-2G show that MyD88 is critical for CFA-induced Thl7 polarization, but not T cell priming, (a) Draining LN cells were harvested from WT or Myd88 ^~'^~ mice 14 days after CF A/OVA immunization and intracellular cytokine staining (ICS) for IL-17 and IFN-γ was performed after ex vivo OVA restimulation. (b) CD45.1 congenic Ragl -'- OTII cells were transferred into CD45.2 congenic WT or Myd88 ^~'^~ mice prior to immunization with CFA/OVA₃2₃-339. Draining LNs were harvested 10 days after immunization and the frequency of CD44^hi CD45. T OTII cells was analyzed by flow cytometry, (c) Total number of OTII cells in the draining LNs of mice immunized in b. (d) Draining LN cells from WT and Myd88 ^~'^~ mice described in b were restimulated with OVA₃2₃-339 and IL-17 and IFN-γ production by the OTII cells was analyzed by ICS. (e) Frequency of IL-17 single-producing, IFN-γ single-producing, and IL-17/IFN-y double-producing populations among the draining LN OTII cells described in d. (f) Flow cytometric analysis of ROR/yt and CXCR5 expression in non-restimulated draining LN OTII cells from WT and Myd88 ^_/~ mice described in b. (g) Flow cytometric analysis of Bcl6 and CXCR5 expression in non-restimulated draining LN OTII cells from WT and Myd88 ^~'^~ mice described in b. Plots are gated on CD4⁺ CD44^hi Foxp3^" cells (a), CD4⁺ cells (b), or CD4⁺ CD45.T OTII cells (d, f, g). Data are representative of at least three independent experiments (a, b, d, f, g) or are from four to five pooled experiments (c, e).

Figures 3A-3C show that CD4⁺ T cells are primed in Myd88 ^_/~ hosts and do not differentiate into Foxp3⁺ cells, (a) Draining LN cells were harvested from WT or Myd88 ^~'^~ mice 14 days after CFA/OVA immunization and labeled with carboxyfluorescein succinimidyl ester (CFSE). The LN cells were then stimulated for 5 days with 100 ug/ml OVA (open histogram) or left unstimulated (filled histogram) and CFSE dilution was analyzed by flow cytometry. Plots are gated on CD4⁺ CD44^hi Foxp3^~ cells, (b) CD45.1 congenic Ragl OTII cells were transferred into CD45.2 congenic WT or Myd88 mice prior to immunization with CFA/OVA₃2₃-339. Draining LNs were harvested 10 days after immunization and T-bet and ROR/yt expression was analyzed by ICS. Plots are gated on CD4⁺ CD45.T OTII cells, (c) The frequency of CD45.T Foxp3⁺ OTII cells among the draining LN cells described in b was analyzed by flow cytometry. Plots are gated on CD4⁺ T cells. Data are representative of at least two independent experiments. Figures 4A-4F show that IL-Ιβ / IL-1R signaling on both the T cell and non-T cell compartments accounts for the MyD88 requirement in CFA-induced Thl7 polarization, (a-c) The indicated mice were immunized with CFA/OVA and draining LN cells were harvested 14 days after CFA/OVA immunization. IL-17 and IFN-γ production were analyzed by ICS after OVA restimulation, and frequencies of cytokine-producing cells among the CD4⁺ CD44^hi Foxp3^~ cells are shown, (d) CD45.1 congenic Illrl ^+/+ or Illrl ^_/" OTII cells were transferred into CD45.2 congenic WT or Illrl ^_/~ mice prior to immunization with CFA/OVA₃2₃-339. Draining LNs were harvested 10 days after immunization and the total number of CD4⁺ CD45.1⁺ OTII cells is shown, (e) RORyt expression in the draining LN OTII cells described in d was analyzed by flow cytometry, (f) The draining LN cells described in d were restimulated with OVA₃2₃-339 and IL-17 and IFN-γ production by the OTII cells was analyzed by ICS. Data are representative of three independent experiments (a) or are pooled from two to four experiments (b-f). Figures 5A-5D show that IL-1R signaling in the non-T cell compartment is required for early Thl7 differentiation, (a) CD45.1 congenic Ragl OTII cells were transferred into CD45.2 congenic WT or Illrl ^_/~ mice prior to immunization with CFA/OVA₃2₃-339. Draining LNs were harvested 10 days after immunization and the total number of CD4⁺ CD45.1⁺ OTII cells is shown, (b) RORyt expression in the draining LN OTII cells described in a was analyzed by ICS. (c) The draining LN cells described in a were restimulated with OVA₃2₃-339 and IL-17 and IFN-γ production by the OTII cells was analyzed by ICS. (d) WT or Illrl ^_/~ mice were immunized with enriched CFA emulsions containing 5 mg/ml heat- killed M.tb. H37Ra. After 18 hours, mice were bled to obtain serum, and cytokine levels were measured by ELISA. Dashed lines represent the limits of detection of the assays. ND = not detected.

Figures 6A-6G show that the signaling adaptor CARD9 is required for pro-IL-Ιβ induction and Thl7 differentiation in response to CFA. (a-c) The indicated mice were immunized with CFA/OVA and injection site skin was excised at the time points shown. RNA was isolated and transcript levels of the indicated genes were measured by quantitative PCR (qPCR). Fold induction over mRNA levels in unimmunized skin is shown. Data are mean ± SEM. (d) CD45.1 congenic Ragl ^~'^~ OTII cells were transferred into CD45.2 congenic WT, Nodi ^_/~ Nod2 ^_/~, or Card9 ^~'^~ mice prior to immunization with CFA/OVA₃2₃-339. Draining LNs were harvested 10 days after immunization and the total number of CD4⁺ CD45.1⁺ OTII cells is shown, (e) RORyt expression in the draining LN OTII cells described in d was analyzed by ICS. (f) The draining LN cells described in d were restimulated with OVA₃2₃-339 and IL-17 and IFN-γ production by the OTII cells was analyzed by ICS. (g) CXCR5 and Bcl6 expression in the draining LN OTII cells described in (d) were analyzed by ICS. Data are representative of two independent experiments (a) or pooled from two to four experiments (b-g).

Figures 7A-7C show that Nodi ^_/~ Nod2 ^_/~ mice display defective endogenous CD4⁺ T cell responses and reduced LN cellularity after CFA immunization, (a) Draining LN cells were harvested from WT or Nodi ^_/~ Nod2 ^_/~ mice 14 days after CFA/OVA immunization and ICS for IL-17 and IFN-γ was performed after ex vivo OVA restimulation. Plots are gated on CD4⁺ CD44^hi Foxp3^~ cells, (b) CD45.1 congenic Ragl ^_/" OTII cells were transferred into CD45.2 congenic WT or Myd88 ^~'^~ mice prior to immunization with CFA/OVA₃2₃-339. Draining LNs were harvested 10 days after immunization and the total number of LN cells was enumerated, (c) The frequency of CD44^hl CD45.1⁺ OTII cells in the draining LNs described in b was analyzed by flow cytometry. Data are pooled from two to four experiments.

Figures 8A-8E show that recognition of mycobacterial cord factor by mincle is upstream of the CARD9 requirement in CFA-induced pro-IL-Ιβ production and Thl7 polarization, (a) WT or Card9 ^_/~ mice were immunized with OVA in PBS, IFA, IFA supplemented with cord factor (TDM), or CFA. Injection site skin was excised 12 hours post-immunization, RNA was isolated, and Mb transcript levels were measured by qPCR. Fold induction over mRNA levels in unimmunized skin is shown. Data are mean ± SEM. (b) WT, Card9 ^~'^~ , or Mincle ^~'^~ (Clec4e ^~'^~) mice were immunized with CF A/OVA and RNA was isolated from injection site skin 12 hours after immunization. Levels of indicated transcripts were measured by qPCR and fold induction over mRNA levels in unimmunized skin is shown, (c) CD45.1 congenic Ragl ^_/~ OTII cells were transferred into CD45.2 congenic WT, Card9 ^_/~, or Mincle ^_/~ mice prior to immunization with CFA/OVA₃2₃-339. Draining LNs were harvested 10 days after immunization and the total number of CD4⁺ CD45.1⁺ OTII cells is shown, (d) RORyt expression in the draining LN OTII cells described in c was analyzed by ICS. (e) The draining LN cells described in c were restimulated with OVA₃2₃-339 and IL-17 and IFN-γ production by the OTII cells was analyzed by ICS. Data are pooled from three to six experiments (a-e).

Figures 9A-9F show that activation of the inflammasome by mycobacterial peptidoglycan contributes to CFA-induced Thl7 polarization, (a, b) The indicated mice were immunized with CF A/OVA and draining LN cells were harvested 14 days after CF A/OVA immunization. IL-17 and IFN-γ production were analyzed by ICS after OVA restimulation and frequencies of cytokine-producing cells among the CD4⁺ CD44^hi Foxp3^~ cells are shown, (c) LPS-primed bone marrow-derived macrophages (BMDM) were stimulated with heat-killed M. tuberculosis H37Ra (20 μg/ml, 100 μg/ml, or 500 \x.glm\), alum, or ATP. Supernatants and cell lysates were harvested and immunoblotted for IL-Ι β, caspase 1, and GAPDH. (d) LPS-primed BMDM generated from WT, Nlrp3 or Nlrc4 ^~'^~ mice were stimulated with heat-killed H37Ra or flagellin and supernatants and cell lysates were immunoblotted for IL-Ι β and caspase 1. (e) Polar lipids, nonpolar lipids, lipoglycans, mycolic acid methyl esters (MAMES), and arabinogalactan (AG) were sequentially extracted from the cell wall of heat-killed H37Ra, as described in the Materials and Methods, and used to stimulate LPS-primed BMDM. Supernatants and cell lysates were then immunoblotted as above, (f) The insoluble H37Ra fractions remaining after each extraction described in e (mAGP = mycolyl-arabinogalactan-peptidoglycan, AGP = arabinogalactan- peptidoglycan, PGN = peptidoglycan) were used to stimulate LPS-primed BMDM and supernatants and cell lysates were immunoblotted as above. Data are pooled from three experiments (a) or representative of at least three independent experiments (b-f). SN = supernatant.

Figures 10A-10D show that tnflammasome activation by heat-killed M.tb. H37Ra requires phagocytosis, potassium efflux, and reactive oxygen species, but not secretion of ATP. (a) LPS-primed bone marrow-derived macrophages (BMDM) were stimulated with heat-killed M. tuberculosis H37Ra in the absence or presence of NaCl (10 mM or 50 mM) or KC1 (10 mM or 50 mM). Supernatants and cell lysates were harvested and immunoblotted for IL-Ιβ and caspase 1. (b) LPS-primed BMDM were stimulated with heat-killed M. tuberculosis H37Ra in the absence or presence of the ROS scavengers propyl gallate (PG; 100 μΜ) or butylated hydroxyanisole (BHA; 200 μΜ). Supernatants and cell lysates were blotted as above, (c) LPS-primed BMDM were stimulated with heat-killed M. tuberculosis H37Ra, ATP, or alum in the absence or presence of cytochalasin D (CytD; 2 μΜ). Supernatants and cell lysates were blotted as above, (d) LPS-primed BMDM from WT or P2rx7 ^_/~ mice were stimulated with heat-killed M. tuberculosis H37Ra or ATP. Supernatants and cell lysates were blotted as above. Data are representative of at least two independent experiments.

Figures 11A and 11B show that NODI and NOD2 are dispensable for inflammasome activation and IL- 1 β maturation in response to mycobacterial peptidoglycan. (a) BMDM from WT and Nodi ^~'^~ Nod2 ^~'^~ mice were primed for 6 hours with LPS (5 ng/ml) alone or in combination with the NODI and NOD2 ligands Tri-DAP (10 /πύ) and N-glycolyl MDP (40 μ /ηι1). The cells were then stimulated with peptidoglycan from heat- killed M. tuberculosis H37Ra (PGN; 250 μg/ml) or with ATP (5 mM). Supernatants and cell lysates were harvested and immunoblotted for IL-Ιβ and GAPDH. (b) Supernatants and cell lysates from cells treated as in a were immunoblotted for caspase 1 and GAPDH. Data are representative of three independent experiments.

Figures 12A-12D show that supplementation of IFA with cord factor and peptidoglycan recapitulates the Th 17 -inducing capacity of CFA. (a) CD45.1 congenic Ragl ^_/~ OTII cells were transferred into CD45.2 congenic WT mice prior to immunization with OVA₃2₃-339 in IFA or CFA. Draining LNs were harvested 10 days after immunization and the frequency of CD44^hi CD45.1⁺ OTII cells was analyzed by flow cytometry, (b) Draining LN cells from the mice described in a were restimulated with OVA₃2₃-339 and IL-17 and IFN-γ production by the CD4⁺ CD45.1⁺ OTII cells was analyzed by ICS. (c) WT recipients of CD45.1 congenic Ragl OTII cells were immunized with OVA₃2₃-339 in IFA, IFA supplemented with cord factor (TDM), IFA supplemented with peptidoglycan (PGN), or IFA supplemented with both TDM and PGN. Draining LNs were harvested 10 days after immunization. ICS was performed for IL-17 and IFN-γ production by the CD4⁺ CD45.1⁺ OTII cells after restimulation with OVA₃2₃-339. (d) CD45.1 congenic Ragl ^_/" OTII cells were transferred into CD45.2 congenic WT, Card9 ^_/~, or Caspl ^_/~ mice prior to immunization with OVA₃2₃-339 in IFA or IFA supplemented with TDM and PGN. Draining LNs were harvested 10 days after immunization. IL-17 and IFN-γ production by the CD4⁺ CD45.1⁺ OTII cells was assayed by ICS after restimulation with OVA₃2₃-339. Data are representative of at least three independent experiments (a, b) or pooled from two to four experiments (c, d).

DETAILED DESCRIPTION OF THE INVENTION

The invention provides adjuvants and immunogenic compositions comprising a CARD9 agonist and/or a caspase 1 (caspase 1 inflammasome) agonist, and methods of using the adjuvant or composition to induce or enhance an immune response.

The invention is based, at least in part, on the discovery of the mycobacterial ligands responsible for the Thl7-polarizing activity in complete Freund's adjuvant (CFA).

Historically, mycobacteria and their components have been the basis of numerous adjuvants and immunotherapies. The best known use of mycobacteria for stimulating the immune system is in CFA, a water-in-oil emulsion containing heat-killed M. tuberculosis strain H37Ra or M. butyricum. Although not appropriate for human use because of its adverse inflammatory side-effects, CFA has for decades been the adjuvant of choice for inducing strong humoral and cellular immune responses in experimental animals.

Previous studies have shown that CFA promotes T lymphocyte responses called T helper 17 (Thl7) responses, which are known to be involved in host resistance to infectious pathogens. As described herein, it has been determined that cord factor (i.e., tetrahelose dimycolate) and peptidoglycan, i.e., agonists of CARD9 and caspase 1 (caspase 1 inflammasome), are the mycobacterial ligands in CFA that initiate a host Thl7 response. Specifically, cord factor induces production of pro-IL-Ιβ, and the activated caspase 1 inflammasome complex processes pro-IL-Ιβ to its mature bio-active form. Accordingly, novel adjuvants comprising at least one CARD9 agonist and at least one caspase 1 agonist can be formulated for use in immunogenic compositions to improve the host Thl7 immune response against the target immunogen.

Activation of CARD9 and Caspase 1 Enhances Thl7 Immune Responses

The present invention relates to the use of CARD9 agonists and/or caspase 1 agonists as adjuvants or in immunogenic compositions to enhance an immunogenic response against a target antigen (e.g., an antigen from an infectious agent, such as a virus, a bacteria, a fungus, or a parasite).

CARD9 is a member of the CARD protein family, which is defined by the presence of a characteristic caspase-associated recruitment domain (CARD) at its N-terminus. In addition, CARD9 contains a coiled-coil region that functions in protein oligomerization at its C-terminus. The CARD domain is a protein interaction domain known to participate in activation or suppression of CARD containing members of the caspase family, and thus most CARD domain proteins play a regulatory role in apoptosis. CARD9 was identified by its selective association with the CARD domain of BCLIO, a positive regulator of apoptosis and NF-KB activation. In particular, CARD9 is thought to function as a molecular scaffold for the assembly of a BCLIO signaling complex that activates NF-κΒ. Card9 plays important roles as part of the innate immune response for the defense against pathogens. Specifically, CARD9 mediates signals from pattern recognition receptors and downstream signalling pathways such as NF-κΒ, thereby activating pro-inflammatory cytokines that appropriate innate and adaptive immune response for the efficient clearance of the infection.

Caspase 1, formerly called interleukin 1β (IL-Ιβ) converting enzyme (ICE), is a member of the caspase family of cysteine proteases that specifically recognize an aspartic acid residue in the PI position of their substrates. Most members of this family of proteases are involved in mediating programmed cell death by promoting the cleavage of critical intracellular proteins upon apoptopic activation. In contrast, caspase 1 is a component of the inflammasome and functions in the inflammatory response by cleaving the precursors of IL- 1 β, IL-18, and IL-33. Indeed, the activation of caspase 1 serves as the rate-limiting step in triggering inflammation mediated by IL-Ιβ or IL-18. Inactive pro-caspase 1 is converted to an active enzyme via dimerization, followed by an autocatalytic reaction that generates an active molecule composed of two large and two small subunits. The autocatalysis of pro- caspase 1 to active caspase 1 is tightly controlled by the inflammasome. The caspase 1 dependent maturation and secretion of the pro-inflammatory cytokines IL-Ιβ and IL-18 induces pyroptosis to eliminate the infectious agent.

As described in detail herein, it has been discovered that activation of CARD9 and/or caspase 1 are useful in promoting an immune response against an immunogen.

In aspects, the invention provides for methods of inducing an immune response in a subject involving administering an effective amount of an immunogenic composition containing one or more CARD9 agonists, one more caspase 1 agonists, and an immunogen. In embodiments, the immunogen is specific to an infectious agent responsible for a viral infection, a bacterial infection, a fungal infection, or a parasitic infection. The use of a CARD9 agonist and a caspase 1 agonist induces or enhances a Thl7 immune response against the immunogen, and thereby prevents or treats an infection resulting from the infectious organism. Furthermore, the methods of the invention will also induce or enhance the production of IL-Ιβ in the subject receiving the CARD9 agonist and/or caspase 1 agonist.

The methods of the invention may be used to treat or prevent diseases and disorders caused by bacterial infections resulting from infection by, among others, Escherichia coli, Caulobacter crescentus, Pseudomonas aeruginosa, Agrobacterium tumefaciens, Branhamella catarrhalis, Citrobacter diversus, Enterobacter aerogenes, Enterobacter cloacae,

Enterobacter sakazakii, Enterobacter asburiae, Pantoea agglomerans, Klebsiella pneumoniae, Klebsiella oxytoca, Klebsiella rhinoscleromatis, Proteus mirabilis, Salmonella typhimurium, Salmonella enteriditis, Serratia marcescens, Shigella sonnei, Neisseria gonorrhoeae,

Acinetobacter baumannii, Acinetobacter calcoaceticus, Acinetobacter Iwoffi, Fusobacterium nucleatum, Veillonella parvula, Bacteroides forsythus, Actinobacillus actinomycetemcomitans, Aggregatibacter actinomycetemcomitans, Porphyromonas gingivalis, Helicobacter pylori, Francisel tularensis, Yersinia pestis, Borrelia burgdorferi, Neisseria meningitidis,

Haemophilus influenza, Staphylococcus aureus, Staphylococcus epidermidis, Staphylococcus saprophyticus, Streptococcus pyogenes, Streptococcus faecalis, Enterococcus faecalis, Enterococcus faecium, Bacillus subtilis, Bacillus anthracis, Bacillus cereus, Micrococcus luteus, Mycobacterium tuberculosis, Clostridium difficile, Propionibacterium acnes,

Streptococcus mutans, Actinomyces viscosus, Actinomyces naeslundii, Streptococcus sanguis, Streptococcus pneumoniae, Streptococcus viridans, and Streptococcus salivarius.

The methods of the invention may be used to treat or prevent diseases caused by fungal infections including aspergilloses, blastomycosis, candidoses, coccidioidomycosis, cryptococcosis, histoplasmosis, mycetomas, and paracoccidioidomycosis.

In embodiments, the methods of the invention is suited to preventing or treating infections resulting from Klebsiella pneumoniae, Staphylococcus aureus, Escherichia coli, Salmonella enterica, Bordetella pertussis, Porphyromonas gingivalis, Mycobacterium

tuberculosis, Listeria monocytogenes, Mycoplasma pneumoniae, Streptococcus pneumoniae, Pseudomonas Aeruginosa, Neisseria gonorrhoeae, Yersinia enterocolitica, Citrobacter rodentium, Francisella tularensis, Candida albicans, Cryptococcus neoformans, Pneumocystis carinii, Coccidioides posadasii, Histoplasma capsulatum, or Blastomyces dermatitidis.

CARD9 and Caspase 1 Agonists

Adjuvants are immunostimulating agents that enhance vaccine effectiveness.

CARD9 and/or caspase 1 agonists can function as adjuvants and are administered in combination with an immunogen/antigen of interest (e.g., a pathogenic antigen derived from a virus, a bacteria, a fungus, a parasite, and the like). The presence of the CARD9 and/or caspase 1 agonist enhances the effectiveness of the immune response generated against the antigen of interest.

Agonists suitable for use in the invention include organic molecules, peptides, polypeptides, nucleic acids, nucleic acid ligands, antibodies, and the like that induce expression of the biological activities associated with CARD9 or caspase 1. The agonist can mimic the activity of CARD9 or caspase 1 (e.g., peptide mimetic). Alternatively, the agonist can induce or enhance the activity of CARD9 or caspase 1.

CARD9 is the downstream effector of several C type lectin receptors. Exemplary C type lectin receptors include, but are not limited to, Mincle, Dectin-1, and Dectin-2. As such, CARD9 agonists include organic molecules, peptides, polypeptides, nucleic acids, nucleic acid ligands, antibodies, and the like that bind and activate C type lectin receptors. Exemplary agonists that induce or enhance the activity of CARD9 include, but are not limited to, glycolipids such as mycobacterial cord factor, SAP30, peptides having fungal alpha-mannose residues, fungal alpha-mannans, and fungal beta-glucans (see Osorio, F. et ah , Immunity 34:651-664 (2011), which is hereby incorporated by reference in its entirety).

Caspase 1 is activated by several inflammasomes. Exemplary inflammasomes include, but are not limited to, the AIM2 inflammasome, the NLRP1 inflammasome, the NLRP3 inflammasome, and the NLRC4 inflammasome. As such, caspase 1 agonists include organic molecules, peptides, polypeptides, nucleic acids, nucleic acid ligands, antibodies, and the like that bind and activate these inflammasomes. Exemplary agonists that induce or enhance the activity of the inflammasome include, but are not limited to, dsDNA, flagellin peptide, anthrax lethal toxin, ATP, crystals such as alum and silica, pore-forming toxins, peptidoglycan, and pathogens such as Candida albicans (see Schroder, K. and Tschopp, J., Cell 140:821-832 (2010), which is hereby incorporated by reference in its entirety).

In aspects, the invention provides an adjuvant having one or more CARD9 agonists and/or one or more caspase 1 agonists. In embodiments, the adjuvant contains an oil. In related embodiments, the oil is a mineral oil or a squalene based oil (e.g., MF59 and AS03).

In aspects, the invention provides immunogenic compositions having one or more CARD9 agonists and/or one or more caspase 1 agonists. In embodiments, the composition contains an oil. In embodiments, the composition contains an immunogen. In embodiments, the composition contains a pharmaceutically acceptable excipient, carrier (e.g., oil), or diluent.

The CARD9 and/or caspase 1 agonists may be combined with any other adjuvant known in the art. Effective adjuvants include, but are not limited to, aluminum salts such as aluminum hydroxide and aluminum phosphate, muramyl peptides, bacterial cell wall components, saponin adjuvants, liposomes, and other substances that act as

immunostimulating agents to enhance the effectiveness of the composition.

In aspects, the invention provides methods for inducing or modulating an immune response in a subject by administering an effective amount of a CARD9 and/or caspase 1 agonists. In embodiments, the methods prevent or treat an infection (e.g., a viral infection, a bacterial infection, a fungal infection, a parasitic infection, and the like).

In aspects, the invention provides methods for treating or preventing an infection by administering to the subject an effective amount of a CARD9 and/or caspase 1 agonists. In embodiments, the methods generate an immune response in the subject that prevents or treats the infection. In aspects, the invention provides methods for inducing or enhancing a Thl7 response in a subject by administering to the subject an effective amount of a CARD9 and/or caspase 1 agonists.

In aspects, the invention provides methods for inducing or enhancing a IL-Ιβ response in a subject by administering to the subject an effective amount of a CARD9 and/or caspase 1 agonists.

In aspects, the invention provides methods for immunizing a subject by

administering to the subject an effective amount of a CARD9 and/or caspase 1 agonists.

In any of the above aspects, the CARD9 and/or caspase 1 agonists is administered in combination with an immunogen/antigen of interest.

Immunogenic Compositions

Immunogenic compositions of the invention, including vaccines, are useful as therapeutics and prophylactics for the treatment or prevention of infection by an infectious agent (e.g., virus, bacteria, fungus, parasite, and the like). The immunogenic compositions contain at least one CARD9 agonist and/or at least one caspase 1 agonist. For example, the CARD9 agonist can be cord factor, and the caspase 1 agonist can be peptidoglycan.

Advantageously, these immunogenic compositions can be tailored to treat any infectious agent. At least one antigen (and optionally a plurality of antigens) from the infectious agent is administered in combination with the CARD9 agonist and the caspase 1 agonist, and the presence of the agonists enhance the host immune response against the target antigen/infectious agent. For example, the agonists can promote a Thl7 immune response, which makes the host more resistant to the infectious agents.

In embodiments, the immunogen (e.g., antigen from the infectious agent) is a nucleic acid. In related embodiments, the agonists are co- administered as polynucleotides. In related embodiments, the agonists are co-administered as polypeptides.

In embodiments, the immunogen (e.g., antigen from the infectious agent) is a polypeptide. In related embodiments, the agonists are co-administered as polynucleotides. In related embodiments, the agonists are co-administered as polypeptides.

Optionally, the immunogenic compositions are formulated with an oil to generate a water-in-oil emulsion product.

The immunogenic compositions of the invention induce a systemic immune response and/or a mucosal immune response. In embodiments, an immune response can be a T cell or a B cell (e.g., antibody) immune response. In embodiments, the T cell immune response comprises increased T cell cytolytic function or reduction in T regulatory cells.

Inflammatory conditions cause the release of chemokines and other factors that, by upregulating and activating adhesion molecules on inflammatory cells, promote adhesion, morphological changes, and extravasation concurrent with chemotaxis through the tissues. In embodiments, an immune response involves the production of high avidity antibodies specific for the immunogen(s).

In embodiments, the immune response is an antibody response. In related embodiments, the immune response involves the production of high avidity antibodies specific for the immunogen(s).

In embodiments, the immune response is a systemic immune response.

The immune response may be a T cell immune response. In embodiments, the T cell immune response can comprise increased T cell cytolytic function. In embodiments, the T cell immune response comprises a reduction in T regulatory cells. In embodiments, the T cell immune response can modulate the pattern of the immune response.

In embodiments, the immune response is a T cell response and an antibody response. The immunogenic compositions described herein can contain a pharmaceutically acceptable carrier, including any suitable diluent or excipient, which includes any pharmaceutical agent that does not itself induce the production of an immune response harmful to a subject receiving the composition, and which may be administered without undue toxicity. As used herein, the term "pharmaceutically acceptable" means being approved by a regulatory agency of the Federal or a state government or listed in the U.S. Pharmacopia, European Pharmacopia or other generally recognized pharmacopia for use in mammals, and more particularly in humans. These compositions can be useful as a vaccine and/or antigenic compositions for inducing a protective and/or therapeutic immune response in a subject.

Pharmaceutically acceptable carriers include but are not limited to saline, buffered saline, dextrose, water, glycerol, ethanol, sterile isotonic aqueous buffer, and combinations thereof. A thorough discussion of pharmaceutically acceptable carriers, diluents, and other excipients is presented in Remington's Pharmaceutical Sciences (Mack Pub. Co. N.J. current edition), which is hereby incorporated by reference. Suitable carriers include, but are not limited to, large macromolecules that are slowly metabolized, such as proteins,

polysaccharides, polylactic acids, polyglycolic acids, polymeric amino acids, amino acid copolymers, lipid aggregates, and inactive virus particles. Such carriers are well known to those skilled in the art. These carriers may also function as adjuvants. Further suitable agents useful for pH maintenance, solution stabilization, or for the regulation of osmotic pressure include, but are not limited to, salts, such as sodium chloride, or potassium chloride, and carbohydrates, such as glucose, galactose or mannose, and the like.

The formulation should suit the mode of administration. In embodiments, the formulation is suitable for administration to humans, preferably is sterile, non-particulate and/or non-pyrogenic.

The immunogenic composition, if desired, can also contain auxiliary substances such as wetting or emulsifying agents, pH buffering agents, and the like. The composition can be a solid form, such as a lyophilized powder suitable for reconstitution, a liquid solution, suspension, emulsion, tablet, pill, capsule, sustained release formulation, or powder. Oral formulations can include standard carriers such as pharmaceutical grades of mannitol, lactose, starch, magnesium stearate, sodium saccharine, cellulose, magnesium carbonate, and the like.

In embodiments, the immunogenic composition is supplied in liquid form, for example in a sealed container indicating the quantity and concentration of the immunogen (and optionally adjuvant) in the composition. In embodiments, the liquid form of the immunogenic composition is supplied in a hermetically sealed container.

In embodiments, the immunogenic compositions contain one or more antigens from an infectious agent. The infectious agent can be a virus, bacteria, fungus, or parasite. In embodiments, the infectious agent is Klebsiella pneumoniae, Staphylococcus aureus,

Escherichia coli, Salmonella enterica, Bordetella pertussis, Porphyromonas gingivalis,

In addition to the CARD9 and caspase 1 agonists, additional adjuvants can be used in the immunogenic composition.

Adjuvants enhance the immunogenicity of an antigen but are not necessarily immunogenic themselves. Adjuvants enhance the host's immune response to an

immunogen(s). Adjuvants may act by retaining the antigen locally near the site of administration to produce a depot effect facilitating a slow, sustained release of antigen to cells of the immune system. Adjuvants can also attract cells of the immune system to an antigen depot and stimulate such cells to elicit immune responses.

Examples of co-adjuvants for use in the immunogenic compositions described herein include, but are not limited to: (1) aluminum salts (alum), such as aluminum hydroxide, aluminum phosphate, aluminum sulfate, etc; (2) oil-in-water emulsion formulations (with or without other specific immunostimulating agents such as muramyl peptides (see below) or bacterial cell wall components), such as for example (a) MF59 (PCT Publ. No. WO

90/14837), containing 5% Squalene, 0.5% Tween 80, and 0.5% Span 85 (optionally containing various amounts of MTP-PE (see below), although not required) formulated into submicron particles using a microfluidizer such as Model 1 lOy microfluidizer

(Microfluidics, Newton, Mass.), (b) SAF, containing 10% Squalane, 0.4% Tween 80, 5% pluronic-blocked polymer L121, and thr-MDP (see below) either microfluidized into a submicron emulsion or vortexed to generate a larger particle size emulsion, and (c) RIBI™ adjuvant system (RAS), (Ribi Immunochem, Hamilton, Mo.) containing 2% Squalene, 0.2% Tween 80, and one or more bacterial cell wall components from the group consisting of monophosphorylipid A (MPL), trehalose dimycolate (TDM), and cell wall skeleton (CWS), preferably MPL+CWS (DETOX™); (3) saponin adjuvants, such as STIMULON™

(Cambridge Bioscience, Worcester, Mass.) may be used or particles generated therefrom such as ISCOMs (immunostimulating complexes); (4) Complete Freunds Adjuvant (CFA) and Incomplete Freunds Adjuvant (IFA); (5) cytokines, such as interleukins (e.g., IL-1, IL-2, IL-4, IL-5, IL-6, IL-7, IL-12, etc.), interferons (e.g., gamma interferon), macrophage colony stimulating factor (M-CSF), tumor necrosis factor (TNF), etc; and (6) other substances that act as immunostimulating agents to enhance the effectiveness of the composition, e.g., monophosphoryl lipid A. In embodiments, the adjuvant is alum or monophosphoryl lipid A.

In embodiments, the co- adjuvant is interferon alpha, Klebsiella pneumoniae glycoprotein, and interleukin-2.

Chitosans are derivatives of chitin or poly-N-acetyl-D-glucosamine in which the greater proportion of the N-acetyl groups have been removed through hydrolysis. European Patent Application 460 020, which is hereby incorporated by reference, discloses pharmaceutical formulations including chitosans as mucosal absorption enhancers. As such, chitosans and chitosan derivatives are further examples of adjuvants suitable for use in the present invention.

One of skill in the art would be familiar with choosing the appropriate

pharmaceutically acceptable carrier(s), excipient(s), and diluent(s) for use in the immunogenic compositions of the invention. Furthermore, one of skill in the art would be familiar with choosing the appropriate co-adjuvant(s) for use in the immunogenic compositions of the invention. Dosage and Administration

The immunogenic preparations are administered in a manner compatible with the dosage formulation, and in such amount as will be therapeutically affective, protective and immunogenic.

The immunogenic compositions may be administered through different routes, including, but not limited to, oral, parenteral, buccal and sublingual, rectal, aerosol, nasal, intramuscular, subcutaneous, intradermal, and topical. The term parenteral as used herein includes, for example, intraocular, subcutaneous, intraperitoneal, intracutaneous, intravenous, intramuscular, intraarticular, intraarterial, intrasynovial, intrastemal, intrathecal, intralesional, and intracranial injection, or other infusion techniques.

In embodiments, the immunogenic compositions formulated according to the present invention are formulated and delivered in a manner to evoke a systemic immune response. For example, the pharmaceutical composition can be systemically administered, e.g., by subcutaneous or intramuscular injection using a needle and syringe, or a needleless injection device. The pharmaceutical composition can also be systemically administered by intravenous injection using a needle and syringe.

Thus, in embodiments, the formulations are prepared by uniformly and intimately bringing into association the active ingredient with liquid carriers. Formulations suitable for parenteral administration include aqueous and non-aqueous sterile injection solutions which may contain anti-oxidants, buffers, bacteriostats and solutes which render the formulation isotonic with the blood of the intended recipient, and aqueous and non-aqueous sterile suspensions which may include suspending agents and thickening agents. The formulations may be presented in unit-dose or multi-dose containers, for example, sealed ampoules and vials, and may be stored in a freeze-dried (lyophilized) condition requiring only the addition of the sterile liquid carrier, for example, water for injections, immediately prior to use. Extemporaneous injection solutions and suspensions may be prepared from sterile powders, granules and tablets commonly used by one of ordinary skill in the art.

The immunogenic compositions may be administered in different forms, including, but not limited to, solutions, emulsions and suspensions, microspheres, particles, microparticles, nanoparticles, liposomes, and the like. The immunogenic compositions are administered in a manner compatible with the dosage formulation, and in such amount as will be therapeutically effective, immunogenic and protective. The quantity to be administered depends on the subject to be treated, including, for example, the capacity of the individual's immune system to synthesize antibodies and/or to produce a cell-mediated immune response. Precise amounts of active ingredients required to be administered depend on the judgment of the practitioner.

However, suitable dosage ranges are readily determinable by one skilled in the art and may be of the order of micrograms to milligrams of the active ingredient(s) per vaccination. Suitable regimes for initial administration and booster doses are also variable, but may include an initial administration followed by subsequent booster administrations. The dosage may also depend on the route of administration and will vary according to the size of the host.

Exemplary unit dosage formulations are those containing a dose or unit, or an appropriate fraction thereof, of the administered ingredient. It should be understood that in addition to the ingredients mentioned herein, the formulations of the present invention may include other agents commonly used by one of ordinary skill in the art.

The immunogenic compositions are administered in one or more doses as required to achieve the desired effect. Thus, the immunogenic preparations or vaccines may be administered in 1, 2, 3, 4, 5, or more doses. Further, the doses may be separated by any period of time, for example hours, days, weeks, months, and years.

The quantity to be administered depends on the subject to be treated. Precise amounts of active ingredient required to be administered depend on the judgment of the practitioner. However, suitable dosage ranges are readily determinable by one skilled in the art. Suitable regimes for initial administration and booster doses are also variable, but may include an initial administration followed by subsequent administrations. The dosage may also depend on the route of administration and will vary according to the size of the host. Prime boost regimens are also contemplated in the invention, as described herein.

The immunogenic composition should be administered to a subject in an amount effective to stimulate a protective immune response in the subject. Specific dosage and treatment regimens for any particular subject will depend upon a variety of factors, including the activity of the specific compound employed, the age, body weight, general health status, sex, diet, time of administration, rate of excretion, drug combination, the severity and course of the disease, condition or symptoms, the subject's disposition to the disease, condition or symptoms, method of administration, and the judgment of the treating physician. Actual dosages can be readily determined by one of ordinary skill in the art.

The immunogenic compositions can be formulated as liquids or dry powders, or in the form of microspheres.

The immunogenic compositions may be stored at temperatures of from about -100°C to about 4°C. The composition may also be stored in a lyophilized state at different temperatures including room temperature. The composition may be sterilized through conventional means known to one of ordinary skill in the art. Such means include, but are not limited to, filtration. The composition may also be combined with bacteriostatic agents to inhibit bacterial growth.

The amount of active ingredient that may be combined with carrier materials to produce a single dosage form will vary depending upon the host treated and the particular mode of administration. In embodiments, a preparation will contain from about 1% to about 95% active compound (w/w) or from about 20% to about 80% active compound.

In embodiments, the pH of the formulation may be adjusted with pharmaceutically acceptable acids, bases, or buffers to enhance the stability of the formulated compound or its delivery form.

In embodiments, the pharmaceutical carriers may be in the form of a sterile injectable preparation, for example, as a sterile injectable aqueous or oleaginous suspension. In embodiments, the immunogenic compositions are prepared in solution acceptable for use in conjunction with vaccines.

Among the acceptable vehicles and solvents that may be employed are mannitol, water, Ringer' s solution and isotonic sodium chloride solution.

In addition, sterile, fixed oils are conventionally employed as a solvent or suspending medium. For this purpose, any bland fixed oil may be employed including synthetic mono-or diglycerides. Fatty acids, such as oleic acid and its glyceride derivatives are useful in the preparation of injectables, as are natural pharmaceutically-acceptable oils, such as olive oil or castor oil, especially in their polyoxyethylated versions. These oil solutions or suspensions may also contain a long-chain alcohol diluent or dispersant, or carboxymethyl cellulose or similar dispersing agents which are commonly used in the formulation of pharmaceutically acceptable dosage forms such as emulsions and or suspensions. Suitable oils include, but are not limited to, mineral oil and squalene based oils (e.g., MF59 and AS03). Other commonly used surfactants such as TWEEN or SPAN and/or other similar emulsifying agents or bioavailability enhancers which are commonly used in the manufacture of pharmaceutically acceptable solid, liquid, or other dosage forms may also be used for the purposes of formulation.

In embodiments, the immunogenic compositions can be delivered in an exosomal delivery system. Exosomes are small membrane vesicles that are released into the extracellular environment during fusion of multivesicular bodies with plasma membrane. Exosomes are secreted by various cell types including hematopoietic cells, normal epithelial cells and even some tumor cells. Exosomes are known to carry MHC class I, various costimulatory molecules and some tetraspanins. Recent studies have shown the potential of using native exosomes as immunologic stimulants.

Also contemplated by the invention is delivery of the immunogenic composition using nanoparticles. For example, the immunogenic compositions provided herein can contain nanoparticles having at least one or more immunogenic compositions linked thereto, e.g., linked to the surface of the nanoparticle. A composition typically includes many nanoparticles with each nanoparticle having at least one or more immunogenic compositions linked thereto. Nanoparticles can be colloidal metals. A colloidal metal includes any water- insoluble metal particle or metallic compound dispersed in liquid water. Typically, a colloid metal is a suspension of metal particles in aqueous solution. Any metal that can be made in colloidal form can be used, including gold, silver, copper, nickel, aluminum, zinc, calcium, platinum, palladium, and iron. In some cases, gold nanoparticles are used, e.g., prepared from HAuCl₄. Nanoparticles can be any shape and can range in size from about 1 nm to about 10 nm in size, e.g., about 2 nm to about 8 nm, about 4 to about 6 nm, or about 5 nm in size. Methods for making colloidal metal nanoparticles, including gold colloidal nanoparticles from HAuCl₄, are known to those having ordinary skill in the art. For example, the methods described herein as well as those described elsewhere (e.g., US Pat. Publication Nos. 2001/005581; 2003/0118657; and 2003/0053983, which are hereby incorporated by reference) are useful guidance to make nanoparticles.

In certain cases, a nanoparticle can have two, three, four, five, six, or more immunogenic compositions linked to its surface. Typically, many molecules of an immunogenic composition are linked to the surface of the nanoparticle at many locations. Accordingly, when a nanoparticle is described as having, for example, two immunogenic compositions linked to it, the nanoparticle has two distinct immunogenic compositions, each having its own unique molecular structure, linked to its surface. In some cases, one molecule of an immunogenic composition can be linked to the nanoparticle via a single attachment site or via multiple attachment sites.

An immunogenic composition can be linked directly or indirectly to a nanoparticle surface. For example, linked directly to the surface of a nanoparticle or indirectly through an intervening linker.

Any type of molecule can be used as a linker. For example, a linker can be an aliphatic chain including at least two carbon atoms (e.g., 3, 4, 5, 6, 7, 8, 9, 10 or more carbon atoms), and can be substituted with one or more functional groups including ketone, ether, ester, amide, alcohol, amine, urea, thiourea, sulfoxide, sulfone, sulfonamide, and disulfide functionalities. In cases where the nanoparticle includes gold, a linker can be any thiol- containing molecule. Reaction of a thiol group with the gold results in a covalent sulfide (- S-) bond. Linker design and synthesis are well known in the art.

Any type of immunogenic composition or any type of additional agent can be linked to a nanoparticle. Examples of agents include, without limitation, immunostimulatory agents, anti-bacterial agents, anti-viral, anti-fungal agents, anti-parasitic agents, and therapeutic agents.

In embodiments, the nanoparticle is linked to a targeting agent. A targeting functionality can allow nanoparticles to accumulate at the target at higher concentrations than in other tissues. In general, a targeting molecule can be one member of a binding pair that exhibits affinity and specificity for a second member of a binding pair. For example, an antibody or antibody fragment therapeutic agent can target a nanoparticle to a particular region or molecule of the body (e.g., the region or molecule for which the antibody is specific) while also performing a therapeutic function. In some cases, a receptor or receptor fragment can target a nanoparticle to a particular region of the body, e.g., the location of its binding pair member. Other therapeutic agents such as small molecules can similarly target a nanoparticle to a receptor, protein, or other binding site having affinity for the therapeutic agent.

When the compositions of this invention comprise a combination of a compound of the formulae described herein and one or more additional therapeutic or prophylactic agents, both the compound and the additional agent should be present at dosage levels of between about 1 to 100%, or between about 5 to 95% of the dosage normally administered in a monotherapy regimen. The additional agents may be administered separately, as part of a multiple dose regimen, from the compounds of this invention. Alternatively, those agents may be part of a single dosage form, mixed together with the compounds of this invention in a single composition.

The administration of the immunogenic compositions of the invention elicits an immune response against the immunogen, e.g., antigen from an infectious agent. Typically, the dose can be adjusted within this range based on, e.g., the subject's age, the subject's health and physical condition, the capacity of the subject's immune system to produce an immune response, the subject's body weight, the subject's sex, diet, time of administration, the degree of protection desired, and other clinical factors. Those in the art can also readily address parameters such as biological half-life, bioavailability, route of administration, and toxicity when formulating the immunogenic compositions of the invention.

Prime Boosting

The immunogenic compositions described herein can be administered in a prime- boost regimen. The prime-boost regimen may be a homologous prime boost (e.g., the same immunogenic composition is administered as the prime and the boost) or a heterologous prime boost (e.g., different immunogenic compositions are administered as the prime and the boost).

The priming administration (priming) is the administration of an immunogenic or immunological composition type and may comprise one, two, or more administrations. In embodiments, the priming administrations are separated by about 1, 2, 3, 4, 5, 6, or more weeks. The boost administration is the administration of a second immunogenic or immunological composition type and may comprise one, two or more administrations, and, for instance, may comprise or consist essentially of annual administrations. In embodiments, the boost administrations are separated by about 1, 2, 3, 4, 5, 6, or weeks or by about 1, 2, 3, 3, 4, 5, 6, or more months. The "boost" may be administered anytime after the priming, for example in certain embodiments from about 2 weeks to about 12 months after the priming, such as from about 6 week to about 6 months, or from about 3 to about 6 weeks after the priming, or from about 4 weeks after the priming.

One of skill in the art can readily determine the appropriate dosage, route of administration, and prime-boost schedule.

Kits The immunogenic compositions of the invention can be assembled into kits or pharmaceutical systems for use in eliciting an immune response in a subject.

The immunogenic composition can be any immunogenic composition described herein (i.e., an immunogenic composition comprising a CARD9 and/or caspase 1 agonist). In embodiments, the immunogenic composition contains at least one immunogen (e.g., antigen from infectious agent). In embodiments, the immunogenic composition contains at least one co-adjuvant.

In embodiments, the present invention encompasses a finished packaged and labeled pharmaceutical product or laboratory reagent. This article of manufacture may include the appropriate instructions for use. A pharmaceutical product may contain, for example, the immunogenic composition of the invention in a unit dosage form in a first container, and in a second container, sterile water or a water-in-oil mix.

As with any pharmaceutical product, the packaging material and container are designed to protect the stability of the product during storage and shipment. Further, the products of the invention include instructions for use or other informational material that advise the physician, technician, or subject on how to appropriately prevent or treat the disease or disorder in question. In other words, the article of manufacture includes instructions indicating or suggesting a dosing regimen including, but not limited to, actual doses, monitoring procedures, and other monitoring information.

In embodiments, the invention provides an article of manufacture including packaging material, such as a box, bottle, tube, vial, container, sprayer, needle for administration, envelope and the like; and at least one unit dosage form of the immunogenic composition contained within the packaging material, and the packaging material includes instruction which indicate that the compound can be used to immunize a subject against viral infection using specific dosing regimens as described herein.

In embodiments, the kits contain instructions for using the immunogenic

compositions in any of the methods described herein.

Co-administration of compounds

The compositions and methods of the invention can be combined with any other composition(s) and method(s) known or not yet known in the art for the prevention, amelioration, or treatment of infection by an infectious agent. The compositions and methods provided herein can be used in combination with any other therapeutic methods deemed appropriate by the treating physician.

In the combination therapies of the invention, the therapy components can administered simultaneously, or within 1, 3, 5, 7, 14, 21 or 28 (or more) days of each other, in amounts sufficient to inhibit prevent or treat infection by an infectious agent.

The administration of a combination of the present invention can also allow for the administration of lower doses of each compound, providing similar efficacy and lower toxicity compared to administration of either compound alone. Alternatively, such combinations result in improved efficacy in treating or preventing infections with similar or reduced toxicity.

The practice of the present invention employs, unless otherwise indicated, conventional techniques of molecular biology (including recombinant techniques), microbiology, cell biology, biochemistry and immunology, which are well within the purview of the skilled artisan. Such techniques are explained fully in the literature, such as, "Molecular Cloning: A Laboratory Manual", second edition (Sambrook, 1989);

"Oligonucleotide Synthesis" (Gait, 1984); "Animal Cell Culture" (Freshney, 1987);

"Methods in Enzymology" "Handbook of Experimental Immunology" (Weir, 1996); "Gene Transfer Vectors for Mammalian Cells" (Miller and Calos, 1987); "Current Protocols in Molecular Biology" (Ausubel, 1987); "PCR: The Polymerase Chain Reaction", (Mullis, 1994); "Current Protocols in Immunology" (Coligan, 1991), each of these references are hereby incorporated in its entirety. These techniques are applicable to the production of the immunogenic compositions of the invention, and, as such, may be considered in making and practicing the invention.

Having now generally described the invention, the same will be more readily understood through reference to the following Examples, which are provided by way of illustration, and are not intended to be limiting of the present invention.

EXAMPLES

Example 1. MyD88 is required for CFA-induced Thl7 polarization but not CD4⁺ T cell priming or T follicular helper cell differentiation

MyD88 signaling has previously been shown to play an important role in the adjuvant activity of CFA (Schnare, M., et al. , Nat. Immunol. 2:947-950 (2001)). To specifically investigate the requirement for this adaptor molecule in CFA-induced Thl7 responses, WT and Myd88 ^~*^~ mice were immunized subcutaneously with ovalbumin (OVA) in CFA and measured OVA-specific interleukin-17 (IL-17) and interferon-γ (IFN-γ) production by CD4⁺ T cells in the draining lymph nodes (LNs) two weeks later. As expected, CFA immunization induced robust differentiation of IL-17- and IFN-y-single producing CD4⁺ T cells, as well as a population of IL-17/IFN-y double-producing (DP) cells (Figure 2A). However, in Myd88 ^~*^~ mice, the Thl7 and IL-17/IFN-y DP responses were almost completely abrogated, although there was still a residual IFN-γ response.

The reduced frequencies of IL-17- and IFN-y-producing CD4⁺ T cells observed in Myd88 ^~'^~ mice could be explained either by a general defect in the priming of antigen- specific CD4⁺ T lymphocytes or a specific impairment in helper T cell differentiation. Arguing against the possibility of a block in T cell priming, CFSE-labeled LN CD4⁺ T cells from immunized WT as well as Myd88 ^~*^~ mice were found to proliferate extensively in response to OVA stimulation in vitro (Figure 2A). To more formally address this issue, CD45.1 congenic Ragl ' OTII cells were adoptively transferred into CD45.2 congenic WT or Myd88 ^~'^~ mice and then immunized with OVA₃2₃-339 peptide in CFA. Immunization of both WT and Myd88 ^~*^~ mice resulted in a strong expansion of CD4⁺CD45.1⁺ OTII cells in the draining lymph nodes (LN), although the increase in these cells was somewhat reduced in the Myd88 ^~*^~ mice (Figure 2B and 2C). Nevertheless, Myd88 ^~'^~ recipients contained markedly reduced frequencies of IL-17-producing and IL-17/IFN-y DP OTII T cells compared to WT recipients (Figure 2D and 2E). These results may reflect a defect in Thl7 differentiation, rather than a specific impairment in IL-17 production, since OTII cells from Myd88 ^~'^~ mice also showed a complete loss in expression of the Thl7 master regulator ROR/yt, while retaining partial T-bet expression (Figure 2F and 3B).

The efficient priming of OVA-specific T cells in Myd88 ^~*^~ mice immunized with

CF A/OVA, despite their defect in Thl7 differentiation, may be due to the cells adopting alternative effector or regulatory functions. However, significant production of the cytokines IL-4 or IL-13 by OTII cells from Myd88 ^~'^~ mice was not observed after immunization, arguing against the possibility of Th2 skewing. Moreover, Foxp3⁺ OTII cells were not detected in either WT or Myd88 ^~*^~ mice, indicating a lack of conversion into regulatory T cells (Figure 2C). Interestingly, when staining for Bcl6⁺CXCR5^hl T follicular helper (Tfh) cells among the CD45.1⁺ OTII population in the LN of immunized mice showed similar frequencies of these cells in WT and Myd88 ^~'^~ mice (Figure 2G). Thus, MyD88-dependent signaling in the non-T cell compartment may be required for the differentiation of Thl7 and IL-17/IFN-y DP cells, but not Tfh cells, after CFA immunization.

Example 2. The requirement for MyD88 in Thl7 responses reflects a role for IL-ip/IL- 1R signaling rather than TLRs or IL-18R

MyD88 is required for signaling via most TLRs as well as IL-IR family members. To understand the requirement for MyD88 in CFA-induced CD4⁺ T cell polarization, the role of TLRs, IL-IR, and IL-18R in the response to CFA was examined. The mycobacteria in CFA contain the TLR2 agonists 19 kDa lipoprotein and arabinose-capped

lipoarabinomannan, the TLR2/TLR4- activating phosphatidyl-myo-inositols (PIMs), and unmethylated CpG DNA (recognized by TLR9) (Kleinnij ennuis, J. et al., Clin. Dev.

Immunol. 2011:405310 (2011)). Therefore, the response of Tlr2 ^ Tlr9 ^ and Tlr4 ^ mice to immunization was examined. OVA-specific IL-17 production by LN CD4⁺ T cells was not significantly reduced in these mice (Figure 4A), suggesting that recognition of CFA by these TLRs is dispensable for adjuvant-induced T cell polarization. In contrast, IL-IR is required for CFA-driven Thl7 and IL-17/IFN-y DP responses, whereas IL-18R is dispensable in Illrl ^~*^~ and IU8rl ^~*^~ mice (Figure 4B).

Two IL-1 species— IL-la and IL-Ιβ— signal through IL-IR. Only a partial defect in IL-17 production was found in immunized Ilia ^~'^~ mice, compared to a marked reduction in Illb ^~'^~ mice (Figure 4C), suggesting that IL-Ιβ is the primary IL-1 cytokine required for CFA-induced Thl7 responses. Taken together, these findings suggest that the role of MyD88 in CFA-triggered Thl7 and IL-17/IFN-y DP cell differentiation is primarily downstream of IL-i /IL-lR signaling. Example 3. IL-IR signaling in both the T cell and non-T cell compartments is required for optimal Thl7 polarization

IL-IR is highly expressed on Thl7 cells and has been suggested to play an important T cell-intrinsic role in the early differentiation of this subset (Chung, Y. et al, Immunity 30:576-587 (2009)). To investigate whether IL-IR signaling acts primarily in T cells or in non-T cells in the CFA model, Illrl ^+l+ or Illrl ^ CD45.1 congenic OTII cells were transferred into WT or Illrl ^mice and then immunized with CFA/OVA₃2₃-339. IL-IR signaling was dispensable for expansion of OTII cells (Figure 4D), but, unexpectedly, IL-IR was found to be required in both the OTII cells and the recipient in order to generate an optimal Thl7 response (Figure 4E and 4F). Moreover, IL-1R signaling in the host compartment was important for early Thl7 differentiation, as the frequency of Thl7 cells was already lower in Illrl ^~'^~ recipients five days after CFA immunization, before terminal differentiation/expansion of Thl7 cells is known to occur in this model (Figures 5A-5C; see also McGeachy, M.J. et al , Nat. Immunol. 10:314-324 (2009)). Although IL-6 and TNF-oc are known to contribute to initial Thl7 differentiation (Veldhoen, M., Immunity 24: 179-189 (2006)), comparable levels of these cytokines were found in the serum of WT and Illrl ^~'^~ mice (Figure 5D), arguing against the possibility that IL-1R signaling in non-T cells contributes indirectly to CFA-induced Thl7 differentiation by promoting the production of these pro-inflammatory cytokines.

Example 4. The signaling adaptor CARD9 is required for pro-IL-Ιβ production and Thl7 differentiation in response to CFA

IL-Ιβ secretion requires two signals: the first, generally associated with TLR signaling, causes translocation of NFKB to the nucleus, where it induces transcription of Illb gene and production of pro-IL-Ιβ, while the second triggers activation of the caspase 1 inflammasome, which cleaves pro-IL-Ιβ to its bioactive form (Davis, B.K. et al, Ann. Rev. Immunol. 29:707-735 (2011)). To determine whether the first signal for pro-IL-Ιβ induction in response to CFA involves TLR signaling, WT and Myd88 ^~'^~ Trif^~'^~ mice (which lack all TLR signaling) were immunized with CF A/OVA. Injection site skin was harvested from these mice at various time points and mRNA levels of Illb and other pro-inflammatory cytokines were measured. Although Illb induction was slightly delayed in Myd88 ^~*^~ Trif^~'^~ mice, total transcript levels were not reduced compared to WT mice (Figure 6A), suggesting that TLR signaling is largely dispensable for pro-IL-Ιβ production in this system.

Bacterial peptidoglycan subunits can induce innate cytokine production via the cytosolic receptors NODI and NOD2 (Girardin, S.E. et al , Science 300: 1584-1587 (2003); and Inohara, N. et al , J. Biol. Chem. 278:5509-5512 (2003)), and mycobacteria have also been shown to trigger several C type lectins that signal via the adaptor CARD9 (Ishikawa, E. et al. , J. Exp. Med. 206:2879-2888 (2009); Schoenen, H. et al. , J. Immunol. 184:2756-2760 (2010); McGreal, E.P. et al. , Glycobiology 16:422-430 (2006); Rothfuchs, A.G. et al. , J. Immunol. 179:3463-3471 (2007); and Osorio, F. & Reis e Sousa, C. Immunity 34:651-664 (2011)). To determine whether either of these pathways contribute to pro-IL-Ιβ induction in response to CFA, Nodi ^~'^~ Nod2 ^~'^~or Card9 ^~*^~ mice were immunized and Illb transcript was measured in the injection site skin. While post-immunization Illb mRNA levels were comparable in the skin of Nodi ^~*^~ Nod2 ^~*^~ and WT mice (Figure 6B), they were greatly reduced in Card9 ^~*^~ animals, particularly at later time points (Figure 6C). Transcripts encoding the Thl7-polarizing cytokines IL-6 and IL-23pl9 were also diminished in the Card9 ^~*^~ mice. These data suggest that CFA provides "signal one" for IL- 1 β production via CARD9- rather than TLR- or NODl/NOD2-dependent signaling.

To determine whether the defects in pro-inflammatory cytokine induction in the Card9 ^{~ ~} mice affect CD4⁺ T cell responses, CD45.1 congenic Ragl ' OTII cells were adoptively transferred into WT, Nodi ^~*^~ Nod2 or Card9 ^~*^~ mice, and the mice were immunized with CFA/OVA₃2₃-339. Transferred OTII cells were found to expand in the LN of all three strains of mice, albeit to a lesser extent in the Card9 ^~'^~ animals (Figure 6D). While a partial defect was noted in the endogenous CD4⁺ T cell responses of Nodi -^/~ Nod2 -^/- mice, OTII cells transferred into these mice normally differentiated into IL-17-producing cells (Figure 6E and Figure 7). In contrast, the IL-17 and IL-17/IFN-y DP OTII responses were nearly absent in the Card9 ^recipients, as was the RORyt population (Figure 6E and 6F). Interestingly, as observed in the Myd88 ^~*^~ mice, the Tfh response remained intact in the Card9 ^~'^~ animals (Figure 6G).

Example 5. Recognition of mycobacterial cord factor by mincle is a major CARD9- dependent signal for CFA-induced IL-Ιβ production and Thl7 polarization

Mycobacteria are known to trigger several CARD9-dependent C type lectin receptors, including dectin-1, dectin-2, and mincle (Ishikawa, E. et al, J. Exp. Med.

206:2879-2888 (2009); Schoenen, H. et al, J. Immunol. 184:2756-2760 (2010); McGreal, E.P. et al, Glycobiology 16:422-430 (2006); and Rothfuchs, A.G. et al, J. Immunol.

179:3463-3471 (2007)). The latter is of interest since recent studies have identified trehalose dimycolate (TDM) as one of its ligands (Ishikawa, E. et al , J. Exp. Med. 206:2879-2888 (2009); and Schoenen, H. et al, J. Immunol. 184:2756-2760 (2010)). TDM, also known as "cord factor", is a mycobacterial glycolipid with potent adjuvant activity that was discovered while investigating the cording phenomenon observed during infection with virulent mycobacteria (Saito, R. et al, Infect. Immun. 13:776-781 (1976); and Davidsen, J. et al,

Biochim. Biophys. Acta 1718:22-31 (2005)). To determine whether TDM could account for the CARD9 -dependent Illb induction observed after CFA injection, Illb mRNA expression in the skin of mice immunized with incomplete Freund's adjuvant (IFA; mineral oil and surfactant without mycobacteria), IFA supplemented with TDM, or CFA itself was compared. IFA was a poor inducer of Mb, but the addition of TDM resulted in robust Mb upregulation comparable to that observed with CFA. This response to TDM was ablated in Card9 ^~*^~ mice (Figure 8A).

Having shown that TDM in IFA stimulates Mb expression, it was then determined whether recognition of TDM by mincle is required for CFA-induced pro-IL- 1 β production as well as Thl7 polarization. It was found that Clec4e ^~*^~ (Mincle ^~*^~) mice exhibited reduced cutaneous Mb induction after CFA immunization, although the response was less impaired than in the Card9 ^~*^~ mice (Figure 8B). Moreover, while OTII cells transferred into Mincle ^~ ^_ mice expanded normally (Figure 8C), their differentiation into IL- 17 -producing cells was defective (Figures 8D and 8E). Nevertheless, the Thl7 response was not as greatly reduced as in the Card9 ^~'^~ recipients, thus implicating additional CARD9-dependent receptors in CFA-induced Thl7 polarization. Example 6. Activation of the inflammasome by M. tuberculosis peptidoglycan contributes to CFA-induced Thl7 differentiation

After demonstrating that mincle/CARD9-dependent signaling provides "signal one" for pro-IL- 1 β production after CFA immunization, it was determined whether activation of the inflammasome provides the "signal two" required for IL-Ιβ maturation and subsequent Thl7 polarization. To address this question, Caspl Pycard (Asc) Nlrp3 and Nlrc4 ^ mice were immunized with CFA/OVA. A substantial defect in Thl7 responses in Caspl ^~ '^~ and Asc ^~'^~ mice was observed, but only a slight reduction in Nlrp3 ^~'^~ mice and unimpaired responses in Nlrc4 ^~*^~ animals were observed (Figures 9A and 9B).

To further analyze the inflammasome' s role in the response to CFA, bone marrow- derived macrophages (BMDM) in vitro were stimulated and assayed their activation of caspase 1 and ability to secrete mature IL-Ιβ. Stimulation of LPS-primed BMDM with heat- killed M. tb. H37Ra was sufficient to induce caspase 1 cleavage and IL- 1 β secretion, and this required NLRP3 as well as phagocytosis of the M.tb. , potassium efflux, and reactive oxygen species (Figures 9C, 9D, and 10). Infection of macrophages with live M. tb. is known to activate the NLRP3 inflammasome, and this is thought to occur in response to the mycobacterial ESX-1 secretion system (Koo, I.C. et al , Cell Microbiol 10:1866-1878 (2008)). However, since heat-killed mycobacteria do not secrete proteins, the basis for their activation of the inflammasome was investigated. To do so, heat-killed H37Ra was biochemically fractionated, successively extracting polar and nonpolar lipids, lipoglycans, mycolic acid methyl esters, and arabinogalactan, as described previously (Dobson, G. et al. , Systematic analysis of complex mycobacterial lipids, in Chemical methods in bacterial systematics (eds. Goodfellow, M. & Minnikin, D.E.) pp. 237-265 (Academic Press, Orlando, 1985); Mishra, A.K. et αί , Μοί Microbiol. 80: 1241-1259 (2011); Besra, G.S. et al. , Biochemistry 34:4257-4266 (1995); and Davidson, L.A. et al, J. Gen. Microbiol. 128:823-828 (1982)). Each of these soluble fractions were tested as well as the insoluble fractions remaining after each step. None of the soluble fractions triggered the inflammasome, whereas all of the insoluble fractions— including PGN alone— contained this activity (Figures 10E and 10F). These data implicate PGN as a primary stimulus for inflammasome activation by heat-killed H37Ra.

Previous studies utilizing other bacteria (e.g., Salmonella) have shown that PGN can activate the inflammasome, and this activity has generally been ascribed to the ubiquitous PGN subunit MDP acting via the receptor NOD2 (Martinon, F. et al , Curr. Biol. 14: 1929- 1934 (2004); Hsu, L.C. et al , Proc. Natl. Acad. Sci. U. S. A. 105:7803-7808 (2008); and Pan, Q. et al , J. Leukoc. Biol. 82: 177-183 (2007)). However, macrophages iro Nodl ^~'^~ Nod2 ^~*^~ mice were found to display normal caspase 1 cleavage and IL- 1 β secretion in response to H37Ra PGN (Figure 11), indicating that mycobacterial PGN can activate the inflammasome independently of these NOD receptors.

Example 7. IFA supplemented with TDM and PGN recapitulates the Thl7-polarizing effects of CFA

The above experiments demonstrated major roles for mincle/CARD9-dependent recognition of TDM and inflammasome-mediated recognition of PGN in triggering IL- 1 β production in response to CFA. It was then determined whether combining these two mycobacterial components results in a Thl7 response comparable to that induced by the unfractionated mycobacteria found in CFA.

In contrast to CFA, IFA is incapable of inducing Thl7 responses even though it promotes CD4⁺ T cell priming (Figures 12A and 12B), thereby demonstrating the importance of the mycobacteria in CD4⁺ T cell polarization. To test the immunostimulatory effects of TDM and PGN, these components were added to IFA either individually or in combination. Emulsions with OVA₃2₃-339 were then prepared and used to immunize mice that had received adoptively transferred CD45.1 Ragl ^~*^~ OTII cells. IFA containing TDM or PGN alone induced little or no Thl7 response, but IFA supplemented with TDM and PGN combined induced robust Thl7 differentiation (Figure 12C). As expected, the IL-17 response to the IFA+TDM+PGN adjuvant was dependent on both CARD9 and caspase 1 (Figure 12D). T cell subset differentiation is largely directed by the innate immune system.

Recognition of pathogen-associated molecular patterns and danger signals by germline- encoded innate immune receptors leads to cellular activation and production of T cell- polarizing cytokines (Billiau, A. & Matthys, P., /. Leukoc. Biol. 70:849-860 (2001)).

However, in the case of complex pathogenic stimuli, it is not clear how activation of particular combinations of pattern recognition receptors causes innate immune cells to promote CD4⁺ T cell differentiation into specific subsets. For instance, mycobacteria in CFA are known to activate several Toll-like receptors, the intracellular NODI and NOD2 receptors, and multiple C type lectin receptors (Ishikawa, E. et al , J. Exp. Med. 206:2879- 2888 (2009); Schoenen, H. et al. , J. Immunol. 184:2756-2760 (2010); McGreal, E.P. et al , Glycobiology 16:422-430 (2006); Rothfuchs, A.G. et al , J. Immunol. 179:3463-3471 (2007); Kleinnijenhuis, J. et al, Clin Dev Immunol 2011:405310 (2011); Fritz, J.H. et al. , Immunity 26:445-459 (2007); and Magalhaes, J.G. et al , J. Immunol. 181:7925-7935 (2008)), but the respective contributions of these innate immune pathways in triggering Thl7 differentiation in response to CFA immunization are poorly understood.

In the present study, a systematic investigation was undertaken of innate immune receptors activated by CFA to understand their respective roles in promoting Thl7 polarization. The results described herein deconstruct the key innate immune recognition events required for the induction of Thl7 differentiation by the mycobacterial component of complete Freund's adjuvant in vivo. A two-step mechanism was identified whereby dual recognition of mycobacterial cord factor and peptidoglycan synergistically drives production of IL-Ιβ and other cytokines necessary for Thl7 polarization. These findings provide a general strategy for the rational design of Thl7-skewing adjuvants.

An unexpected conclusion of these results is that the mycobacteria in CFA contribute only marginally to the priming and expansion of CD4⁺ T cells, as IFA was only slightly less effective than CFA in expanding OTII cells after immunization. Moreover, while MyD88- dependent signaling, particularly downstream of TLRs, has previously been argued to be important for antigen-presenting cell activation and subsequent T cell priming (Schnare, M. et al , Nat. Immunol. 2:947-950 (2001)), MyD88-deficient recipients were observed to be capable of supporting robust expansion of adoptively-transferred T cells. The discrepancy with previously published findings is likely due to differences in the sensitivities of the proliferation assay used previously and the adoptive transfer analyses performed here.

While playing only a minor role in T cell priming, MyD88-dependent signaling in the non-T cell compartment was critical for CFA-induced Thl7 polarization. Interestingly, although intact Myd88 ^_/~ mice display impaired Thl responses, a Thl defect was not observed in the adoptive transfer experiments in which the OTII CD4⁺ T cells were MyD88- sufficient, in agreement with earlier work indicating a role for T cell-intrinsic MyD88 expression in promoting Thl polarization (LaRosa, D.F. et al. , Proc. Natl. Acad. Sci. U. S. A. 105:3855-3860 (2008)). Moreover, Tfh differentiation was unimpaired in Myd88 ^_/" recipients, and was comparable in IFA- versus CFA-immunized mice (data not shown), suggesting that innate immune stimulation by the adjuvant's mycobacterial component is largely dispensable for driving primary Tfh responses. This is consistent with previous work showing similar total antibody responses in WT and MyD88-deficient mice immunized with IFA or CFA (Gavin, A.L. et al. , Science 314: 1936-1938 (2006)).

The role of MyD88 in CFA-induced CD4⁺ T cell responses was initially thought to reflect the involvement of TLRs in recognition of the mycobacterial component of the adjuvant (Schnare, M. et al. , Nat. Immunol. 2:947-950 (2001)). However, deficiencies found in TLRs implicated that the response to mycobacteria failed to have a major impact on Thl7 differentiation following CFA immunization. Instead, the requirement for MyD88 in Thl7 skewing could largely be explained by the role of IL-Ι β / IL-1R signaling. This finding is consistent with previous studies demonstrating a major function for IL-1R signaling in driving CFA-induced Thl7 polarization, especially in the context of autoimmune disease models such as experimental autoimmune encephalomyelitis (EAE) and uveitis (EAU) (Chung, Y. et al. , Immunity 30:576-587 (2009); Sutton, C. et al., J. Exp. Med. 203: 1685- 1691 (2006); Su, S.B. et al. , J. Immunol. 175:6303-6310 (2005); and Fang, J. et al. , Invest. Ophthalmol. Vis. Sci. 51:3092-3099 (2010)). Although IL-1 is known to promote T cell proliferation (Ben-Sasson, S.Z. et al. , Proc. Natl. Acad. Sci. U. S. A. 106:7119-7124 (2009)), the CFA model showed that IL-1R signaling is necessary only for CD4⁺ T cell polarization, not expansion.

Previously, the role of IL-1 in Thl7 polarization was not completely understood. Earlier work showed that T cell-intrinsic IL-1R signaling is critical for the initiation of Thl7 differentiation (Chung, Y. et al. , Immunity 30:576-587 (2009)). It has now been discovered that in order to drive an optimal Thl7 response to CFA, IL-1R expression is additionally required on the non-T cell compartment. Moreover, in common with IL-1R signaling on the T cell, IL- 1 must act on the non-T cell compartment at an early stage following

immunization to promote Thl7 skewing. This requirement may reflect a role for IL-1 in triggering the production of an additional Th 17 -polarizing factor.

Having identified IL-Ιβ as a key mediator of the CFA-induced Thl7 response, the innate immune pathways that drive production of this cytokine after immunization were investigated. Although TLRs are thought to provide a major stimulus for NFi B-dependent pro-IL-Ιβ induction (Mariathasan, S. & Monack, D.M., Nat Rev Immunol 7:31-40 (2007)), it has been found that upregulation of Illb message in response to CFA was intact in Myd88 ^_/~ Trif ^_/~ mice. In contrast, it was observed that CARD9-dependent signaling plays a major role in inducing pro-IL-Ιβ production in CFA- immunized mice and that mincle is a principal upstream receptor that triggers this pathway. However, while CFA-induced Thl7 differentiation was almost completely ablated in the Card9 ^_/~ mice, a residual Thl7 response remained in the Mincle ^_/~ mice, indicating the involvement of additional CARD9- dependent receptors in the recognition of CFA. As Dectin-1 and dectin-2 have each been shown to recognize mycobacteria, these molecules may be involved (McGreal, E.P. et al , Glycobiology 16:422-430 (2006); and Rothfuchs, A.G. et al , J. Immunol. 179:3463-3471 (2007)). Moreover, the dectin-1 agonist curdlan was previously shown to augment Thl7 differentiation in vivo via a CARD9-dependent pathway, although the role of IL-1 signaling was not investigated in this model (LeibundGut-Landmann, S. et al, Nat. Immunol. 8:630- 638 (2007)).

Previous studies have demonstrated a role for NODI and NOD2 in CFA-induced CD4⁺ T cell responses (Fritz, J.H. et al, Immunity 26:445-459 (2007); and Magalhaes, J.G. et al, J. Immunol. 181:7925-7935 (2008). As described herein, intact Nodi ^~'^~ Nod2 ^~'^~ mice immunized with CFA displayed partially impaired CD4⁺ T cell responses. Surprisingly however, OTII cells adoptively transferred into these mice mounted normal Thl/Thl7 responses. Moreover, induction of Illb, 116, and 1123a was unimpaired in the skin of immunized Nodi ^_/~ Nod2 ^_/~ mice. Based on this evidence and recent data suggesting a T cell-intrinsic role for NOD2 in Toxoplasma

Thl responses (Shaw, M.H. et al, Nat. Immunol. 10:1267-1274 (2009)), the requirement for NOD signaling in the response to CFA may reflects an intrinsic function in the T cell compartment rather than in innate immune recognition of the adjuvant. In addition to the induction of pro-IL- 1 β by Mincle/CARD9-dependent signaling, it was found that the Thl7-skewing effects of CFA were partially dependent on the inflammasome. In agreement with previous studies, in vitro stimulation with heat-killed M.tb. induced caspase 1 cleavage and mature IL-Ιβ production by macrophages in an NLRP3 -dependent manner (Lalor, SJ. et al, J. Immunol. 186:5738-5748 (2011)). However, Nlrp3 ^_/~ mice displayed only a mild reduction in Thl7 differentiation in response to CFA compared to Caspl ^_/~ and Asc ^_/~ mice, indicating the involvement of other inflammasome sensors in vivo. In addition, the Thl7 defect in Caspl ^_/~ mice was not as profound as that in Illb ^_/~ mice, implicating inflammasome-independent mechanisms of IL-Ιβ maturation acting in vivo.

The results of the fractionation experiments implicate peptidoglycan as the primary trigger for the inflammasome in heat-killed M. tb. Interestingly, experiments performed decades ago identified the peptidoglycan subunit MDP as the minimal mycobacterial component that recapitulated the adjuvant activity of CFA when added to IFA (Ellouz, F. et al, Biochem. Biophys. Res. Commun. 59:1317-1325 (1974)). More recently, MDP has also been reported to activate the inflammasome in a NOD2-dependent manner (Martinon, F. et al, Curr. Biol. 14:1929-1934 (2004); Hsu, L.C. et al. , Proc. Natl. Acad. Sci. U. S. A.

105:7803-7808 (2008); and Pan, Q. et al, J. Leukoc. Biol. 82:177-183 (2007)). However, the above results demonstrates that the Th 17 -polarizing activity of CFA does not depend on NOD1/NOD2 signaling in the non-T cell compartment and that, in contrast to MDP, polymeric peptidoglycan isolated from heat-killed M. tb. was able to induce inflammasome activation and IL-Ιβ maturation in Nodi ^_/~ Nod2 ^_/~ macrophages. While mycobacterial diaminopimelic acid (DAP)-containing peptidoglycan is distinct from Staphylococcus aureus lysine-type peptidoglycan, the latter has also recently been reported to activate the inflammasome independently of NOD2 (Shimada, T. et al. , Cell Host Microbe 7:38-49

(2010)). Therefore, peptidoglycan need not be processed into subunits recognized by NOD receptors in order to activate the inflammasome.

Confirmation of the ability of mycobacterial cord factor and peptidoglycan to drive Thl7 responses was obtained in experiments in which these components were admixed into IFA, and CARD9- and caspase 1-dependent Thl7 polarization comparable to that observed with CFA was achieved. Recent studies investigating the basis of vaccine-induced protection to fungal and some bacterial infections have revealed a key role for the Thl7 response (Khader, S.A. et al, Nat. Immunol. 8:369-377 (2007); and Wuthrich, M. et al, J. Clin. Invest. 121:554-568 (2011)). For this reason, chemically defined agents that promote the differentiation of Thl7 cells are important tools in the development of vaccines against these pathogens. The results described herein establish the principle of combining a CARD9-dependent pro-IL- 1 β inducer with an inflammasome activator as a strategy for developing Thl7-skewing immunostimulants.

The results reported herein were obtained using the following methods and materials.

Mice

C57BL/6 mice were purchased from Taconic Farms. IU8rl ^_/~ mice were purchased from The Jackson Laboratory. CD45.1 congenic Ragl OTII mice and Illrl mice backcrossed to B 6 for 10 generations were supplied by Taconic Farms via a contract with NIAID. Myd88 ^_/~ mice, backcrossed to B6 for 10 generations, were obtained from S. Akira (Osaka University, Osaka, Japan). CD45.1 congenic Illrl -'- OTII mice were generated by crossing CD45.1 congenic Ragl ^_/~ OTII and Illrl ^_/~ mice. Tlr2 ^_/~ Tlr9 ^_/~, Tlr4 ^_/~, and Myd88 ^_/~ Prif ^{~ ~} mice were generously provided by D. Golenbock and E. Lien (University of Massachusetts, Worcester, MA). Nodi ^_/~ Nod.2 ^_/~ mice⁴⁷, backcrossed to B6 for 10 generations, were originally obtained from G. Nunez (University of Michigan, Ann Arbor, MI). Ilia and III b ^~'^~ mice were generated by Y. Iwakura (University of Tokyo, Tokyo, Japan) and generously provided by T. Merkel (Food and Drug Administration, Bethesda, MD). Card9 ^~'^~ mice (Hsu, Y.M. et al. , Nat Immunol 8: 198-205 (2007)) were generated by X. Lin (MD Anderson, Houston, TX). Clec4e ^_/~ (mincle ^_/~) mice (Yamasaki, S. et al. , Proc. Natl. Acad. Sci. U. S. A. 106: 1897-1902 (2009)), backcrossed at least 7 generations to B6, were kindly provided by S. Yamasaki (Kyushu University, Kyushu, Japan). Pycard ^_/~ (Asc ^_/") mice were generated by Millenium Pharmaceuticals (Cambridge, MA). Caspl mice were generously supplied by R. Flavell (Yale University, New Haven, CT) and subsequently backcrossed to B6 until 10 generations. NlrpS ^_/~ and Nlrc4 ^_/~ mice were kindly provided by V. Dixit (Genentech, San Francisco, CA). All animals were maintained in an A ALAC- accredited animal facility at the National Institute of Allergy and Infectious Diseases (NIAID), National Institutes of Health (Bethesda, MD). Mice were used according to animal study proposals approved by the NIAID Animal Care and Use Committee.

Bone marrow from P2xr7 ^_/~ mice was kindly provided by F. Tarn (Imperial College, London, UK). Reagents

CFA, IFA, trehalose dimycolate (TDM), ATP, Brefeldin A, cytochalasin D, propyl gallate, butylated hydroxyanisole, NaCl, and KC1 were purchased from Sigma- Aldrich. Imject OVA and alum were from Pierce/Thermo Fisher Scientific. OVA₃2₃-339 peptide was from the NIAID Research Technologies Branch. Ultrapure LPS, N-glycolyl muramyl dipeptide (MDP), TriDAP, and flagellin were from Invivogen. Heat-killed M. tuberculosis H37Ra was from Difco/BD Biosciences.

Immunizations

For IFA and CFA immunizations, mice were injected subcutaneously at four sites along the back (100 μΐ per site) with a total of 100 μg OVA protein or OVA₃2₃-339 peptide. CFA emulsions contained 0.5 mg/ml heat-killed M. tuberculosis H37Ra. For IFA supplementation experiments, TDM was dissolved in IFA and heated to 55°C and sonicated prior to preparing emulsions with OVA₃2₃-339 peptide. TDM was used at a concentration of 0.125 mg/ml in these emulsions. H37Ra peptidoglycan was suspended in IFA and used in emulsions at a concentration of 0.5 mg/ml.

Adoptive transfer and ex vivo T cell restimulation

To measure polyclonal CD4⁺ T cell responses, draining (inguinal, axillary, and brachial) LNs were harvested 14 days after CFA/OVA immunization. LNs were dissociated through 100 μιη cell strainers and LN cells were plated at 1χ10^Λ6 cells per well in a flat- bottom 96 well plate. The cells were incubated with 100 μg/ml OVA protein for 1.5 h at 37 °C. Brefeldin A (5 μg/ml) was then added and the cells were incubated for an additional 5-6 hours at 37°C. For adoptive transfer experiments, mice received 3χ10^Λ5 CD45.1 congenic Ragl ^_/~ OTII cells intravenously and were then immunized with CFA/OVA₃2₃-339 peptide the next day. Draining LNs were harvested 10 days later and cells were restimulated with 25 μg/ml OVA₃2₃-339 as above. Illrl ^_/~ OTII experiments were performed similarly to other adoptive transfer experiments, except mice received 9χ10^Λ5 CD45.1 congenic Illrl ^+/+ or Illrl ^_/~ OTII cells intravenously the day before immunization.

For carboxyfluorescein succinimidyl ester (CFSE) dilution experiments, draining LN cells harvested 14 days after CFA/OVA immunization were resuspended in PBS at a concentration of 1χ10^Λ7 cells/ml. CFSE (Molecular Probes/Invitrogen) was added at a final concentration of 5 μΜ and the cells were incubated for 15 min at room temperature. Labeled cells were plated out at 1χ10^Λ6 cells per well in a 48 well plate. The cells were incubated with 100 μg/ml OVA protein for 4-5 days at 37°C and then CFSE dilution was analyzed by flow cytometry. Antibodies and flow cytometry

Antibodies against the following molecules were purchased from eBioscience, Biolegend, or BD Biosciences: CD4 (RM4-4), CD45.1 (A20), CD45.2 (104), CD44 (IM7), CXCR5 (2G8), IFN-Y (XMG1.2), IL-17 (eBiol7B7), Foxp3 (FJK-16s), RORyt (B2D), T-bet (4B10), and Bcl6 (Kl 12-91). Blue fixable live/dead cell stain and streptavidin-Qdot605 were from Molecular Probes/Invitrogen. All samples were acquired on an LSRII flow cytometer (Becton Dickinson) and analyzed using Flowjo software (Tree Star).

Tissue harvest and quantitative PCR

Skin was harvested from the injection site of CF A/OVA immunized mice at various times after immunization. Subcutaneous fat was removed and the skin was homogenized in Trizol (Invitrogen). Total RNA was extracted according to the manufacturer's protocol and cDNA was reverse transcribed with Superscript III reverse transcriptase and random primers (Invitrogen). Quantitative PCR was performed on an ABI Prism 7900 HT Sequence

Detection System using Power SYBR Green Master Mix (Applied Biosystems/Life

Technologies) for detection. Fold induction of gene expression was calculated using the

AACT method, normalizing mRNA levels for each sample to levels of hypoxanthine guanine phosphoribosyl transferase (HPRT) and comparing to mRNA levels in unimmunized controls. The following primer pairs, derived from the literature or designed with

ProbeFinder software (Roche), were used:

Hprt F: GCCCTTGACTATAATGAGTACTTCAGG, Hprt R: TTCAACTTGCGCTCATCTTAGG

Illb F: TGTAATGAAAGACGGCACACC, Illb R: TCTTCTTTGGGTATTGCTTGG

116 F: ACAACCACGGCCTTCCCTACTT, 116 R: CACGATTTCCCAGAGAACATGTG

1123a F: CACCAGCGGGACATATGAA, 1123a R: CCTTGTGGGTCACAACCAT Cytokine ELISA

Serum cytokine levels in CFA-immunized mice were measured with IL-6 and TNF-oc Duoset kits from R&D Systems. Macrophage stimulation and immunoblotting

Bone marrow-derived macrophages (BMDM) were prepared by growing bone marrow cells in 30% L929 cell-conditioned medium for 6-8 days. BMDM were then harvested, primed for 3-4 hours with 20 ng/ml LPS, and then stimulated for 1 hr with 5 mM ATP or overnight with heat-killed H37Ra (500

or flagellin (1 μg/ml) in OptiMEM serum-free media. DOTAP liposomal transfection reagent (Roche) was used according to the manufacturer's instructions to deliver flagellin intracellularly. For inhibition of potassium efflux, KC1 or NaCl were added to the OptiMEM medium. For experiments with cytochalasin D or reactive oxygen species (ROS) scavengers, the inhibitors were present both during LPS priming and during the subsequent inflammasome stimulation step. For stimulation with heat-killed H37Ra fractions, all fractions except for polar and nonpolar lipids were used at a concentration of 250 μg/ml. Lipids were used at 50 μg/ml because of toxicity at higher concentrations.

After stimulation, supernatants were harvested and cells were lysed with cell lysis buffer (Cell Signaling Technology) supplemented with 2 mM phenylmethanesulfonyl fluoride (Sigma- Aldrich) and a protease inhibitor cocktail (EMD Chemicals). Supernatants were precipitated with 1 volume methanol and 0.25 volumes chloroform and the protein pellets were resuspended in reducing sample buffer (Pierce/Thermo Fisher Scientific). The samples were then separated on 15% polyacrylamide gels and transferred to Hybond-P PVDF membranes (GE Healthcare). IL-Ιβ was detected with a goat anti-IL-Ιβ antibody (AF-401; R&D systems) and caspase 1 was detected with rabbit anti-mouse caspase 1 (sc- 514; Santa Cruz Biotechnology). For loading controls, equal amounts of cell lysates were separated on 12% polyacrylamide gels and blotted as above or with mouse anti-GAPDH antibody (sc-32233; Santa Cruz Biotechnology).

Polar and nonpolar lipid extraction from heat-killed H37Ra

Polar and nonpolar lipids were extracted as described (Dobson, G. et ah , Systematic analysis of complex mycobacterial lipids, in Chemical methods in bacterial systematics (eds. Goodfellow, M. & Minnikin, D.E.) 237-265 (Academic Press, Orlando, 1985)). Briefly, freeze-dried M. tuberculosis H37Ra cells were treated in 22 ml of methanolic saline (20 ml 0.3% NaCl and 20 ml CH₃OH) and 22 ml of petroleum ether for 2 h. The suspension was centrifuged and the upper layer containing nonpolar lipids was separated. An additional 22 ml of petroleum ether was added, mixed and centrifuged as described above. The two upper petroleum ether fractions were combined and dried. For polar lipids, 26 ml

CHC1₃/CH₃OH/0.3% NaCl (9: 10:3, v/v/v) was added to the lower aqueous phase and stirred for 4 h. The mixture was filtered and the filter cake re-extracted twice with 8.5 ml of CHC1₃/CH₃OH/0.3% NaCl (5: 10:4, v/v/v). The delipidated cells were retained for further extraction and purification of lipoglycans as described below. Equal amounts of CHC1₃ and 0.3% NaCl (14.5 ml each) were added to the combined filtrates and stirred for 1 h. The mixture was allowed to settle, and the lower layer containing the polar lipids recovered and dried. The polar and nonpolar lipid extracts were examined by two dimensional thin-layer chromatography (2D-TLC) on aluminum backed plates of silica gel 60 F254 (Merck 5554) using solvent systems A-E with the appropriate staining solution to detect the presence of lipids, glycolipids or phospholipids as described (Dobson, G. et al. , Systematic analysis of complex mycobacterial lipids, in Chemical methods in bacterial systematics (eds.

Goodfellow, M. & Minnikin, D.E.) 237-265 (Academic Press, Orlando, 1985)). Isolation and extraction of lipoglycans

Lipoglycans were extracted from the above delipidated cells as previously

28

described . Briefly, cells were broken by sonication (MSE Soniprep 150, 12 micron amplitude, 60s ON, 90s OFF for 10 cycles, on ice) and the cell debris refluxed 5 times with 50% C₂H₅OH at 68°C, for 12 h intervals. The cell debris (mAGP) was removed by centrifugation and the supernatant containing lipoglycans, neutral glycans and proteins dried. This dried extract was then treated with hot phenol-H₂0. The aqueous phase was dialyzed and dried, followed by extensive treatments with a-amylase, DNase, RNase chymotrypsin and trypsin. This fraction was dialyzed to remove the low MW break-down products formed after the enzyme treatment, thus yielding the crude lipoglycan fraction, containing lipoarabinomannan, lipomannan and glucans.

Preparation of the mycolyl-arabinogalactan-peptidoglycan (mAGP) complex and release of mycolic acid methyl esters (MAMES), soluble arabinogalactan (AG), and peptidoglycan (PGN) from the mAGP complex.

The crude insoluble material from the above lipoglycan extraction was extracted three times with 2% SDS in phosphate buffered saline at 95°C for 1 h, washed with water, 80% (v/v) acetone in water, and acetone, and finally lyophilized to yield a highly purified cell wall mAGP preparation (Besra, G.S. et al , Biochemistry 34:4257-4266 (1995)).

Mycolic acid methyl esters were prepared initially from the mAGP by treatment with 0.5 % (w/v) KOH in methanol at 37°C for 4 days (Davidson, L.A. et al., J. Gen. Microbiol. 128:823-828 (1982)). The treated mAGP was collected by centrifugation at 27,000 g for 20 min, and then washed repeatedly with methanol, and re-centrifuged at 27,000 g and the pellet recovered. The mycolic acid methyl esters were then extracted from the treated mAGP using diethyl ether, re-centrifuged at 27, 000 g and the pellet (AGP) and soluble mycolic acid methyl esters recovered in the diethyl ether supernatant. The extraction process using diethyl ether was repeated thrice. The combined ether fractions were evaporated to dryness to provide the mycolic acid methyl esters. The AGP complex was hydrolyzed with 0.2 M H₂S0₄ at 85°C for 30 min and neutralized with BaC0₃. The supernatant, which contained the solubilized AG, was recovered after centrifugation at 27,000 g for 30 min and was dialyzed (MWCO 3,500). The residual pellet was the PGN fraction. The supernatant was then made up to 80 % cold ethanol and left at -20°C overnight to precipitate polysaccharides. The pellet was then recovered by centrifugation, at 27,000 g for 30 min, and freeze-dried to afford AG, which was stored at -20°C. The recovered PGN fraction was finally extensively washed with water, freeze dried, and stored at -20°C.

Statistical analysis

The statistical significance of differences between groups was analyzed via unpaired Student's t test using Graphpad Prism software version 5.0c. The p values are shown as follows: * p < 0.05, ** p < 0.01, *** p < 0.001.

Other Embodiments

From the foregoing description, it will be apparent that variations and modifications may be made to the invention described herein to adopt it to various usages and conditions. Such embodiments are also within the scope of the following claims.

The recitation of a listing of elements in any definition of a variable herein includes definitions of that variable as any single element or combination (or subcombination) of listed elements. The recitation of an embodiment herein includes that embodiment as any single embodiment or in combination with any other embodiments or portions thereof.

All patents and publications mentioned in this specification are herein incorporated by reference to the same extent as if each independent patent and publication was specifically and individually indicated to be incorporated by reference.

Claims

What is claimed is:

1. An adjuvant comprising a CARD9 agonist and/or a caspase 1 agonist.

2. The adjuvant of claim 1, further comprising an oil, a mineral oil, or a squalene based oil.

3. An immunogenic composition comprising a CARD9 agonist and/or a caspase 1 agonist.

4. The immunogenic composition of claim 3, wherein the immunogenic composition further comprises an oil, a mineral oil, or a squalene based oil.

5. The adjuvant or immunogenic composition of any one of claims 1 to 4, wherein the CARD9 agonist is mycobacterial cord factor, SAP30, a peptide having a fungal alpha- mannose residue, a fungal alpha-mannan, or a fungal beta-glucan.

6. The adjuvant or immunogenic composition of claim 5, wherein the CARD9 agonist is mycobacterial cord factor.

7. The adjuvant or immunogenic composition of any one of claims 1 to 6, wherein the caspase 1 agonist is peptidoglycan, a double stranded DNA, flagellin, anthrax lethal toxin, ATP, alum, silica, a pore-forming toxin, or a Candida albicans peptide.

8. The adjuvant or immunogenic composition of claim 7, wherein the caspase 1 agonist is peptidoglycan.

9. The immunogenic composition of any one of claims 3 to 9, wherein the immunogenic composition further comprises an immunogen.

10. The immunogenic composition of claim 9, wherein the immunogen is an antigen derived from an infectious agent.

11. The immunogenic composition of claim 10, wherein the infectious agent is a virus, bacteria, fungus, or parasite.

12. The immunogenic composition of claim 7, wherein the infectious agent is Klebsiella pneumoniae, Staphylococcus aureus, Escherichia coli, Salmonella enterica, Bordetella pertussis, Porphyromonas gingivalis, Mycobacterium tuberculosis, Listeria monocytogenes, Mycoplasma pneumoniae, Streptococcus pneumoniae, Pseudomonas Aeruginosa, Neisseria gonorrhoeae, Yersinia enterocolitica, Citrobacter rodentium, Francisella tularensis, Candida albicans, Cryptococcus neoformans, Pneumocystis carinii, Coccidioides posadasii, Histoplasma capsulatum, or Blastomyces dermatitidis.

13. The immunogenic composition of any one of claims 3 to 12, wherein the immunogenic composition further comprises a pharmaceutically acceptable excipient, carrier, or diluent.

14. The adjuvant or immunogenic composition of any one of claims 1 to 13, wherein the adjuvant or immunogenic composition is capable of eliciting or modulating an immune response.

15. The adjuvant or immunogenic composition of claim 14, wherein the immune response is a cell mediated response.

16. The adjuvant or immunogenic composition of claim 15, wherein the immune response is a Thl7 response.

17. The immunogenic composition of any one of claims 3 to 16, wherein the

immunogenic composition is a vaccine.

18. A method of inducing an immune response in a subject, wherein the method comprises administering an effective amount of the adjuvant or immunogenic composition of any one of claims 1 to 17 to the subject.

19. A method of modulating an immune response in a subject, wherein the method comprises administering an effective amount of the adjuvant or immunogenic composition of any one of claims 1 to 17 to the subject.

20. The method of claim 18 or 19, wherein the method prevents or treats an infection.

21. The method of claim 20, wherein the infection is a viral infection, a bacterial infection, a fungal infection, or a parasitic infection.

22. A method for treating or preventing an infection by an infectious agent in a subject, wherein the method comprises i) administering to the subject an effective amount of the adjuvant or immunogenic composition of any one of claims 1 to 17; and ii) generating an immune response in the subject, wherein the immune response prevents or treats the infection.

23. A method of inducing or enhancing a Thl7 response in a subject comprising administering to the subject an effective amount of the adjuvant or immunogenic composition of any one of claims 1 to 17.

24. A method of inducing or enhancing production of IL-Ι β in a subject comprising administering to the subject an effective amount of the adjuvant or immunogenic composition of any one of claims 1 to 17.

25. A method of immunizing a subject, the method comprising administering to the subject an effective amount of the adjuvant or immunogenic composition of any one of claims 1 to 17.

26. The method of any one of claims 22 to 25, wherein the method prevents or treats an infection.

27. The method of claim 26, wherein the infection is a viral infection, a bacterial infection, a fungal infection, or a parasitic infection.

28. The method of any one of claims 22 or 27, wherein the infectious agent is Klebsiella pneumoniae, Staphylococcus aureus, Escherichia coli, Salmonella enterica, Bordetella pertussis, Porphyromonas gingivalis, Mycobacterium tuberculosis, Listeria monocytogenes, Mycoplasma pneumoniae, Streptococcus pneumoniae, Pseudomonas Aeruginosa, Neisseria gonorrhoeae, Yersinia enterocolitica, Citrobacter rodentium, Francisella tularensis, Candida albicans, Cryptococcus neoformans, Pneumocystis carinii, Coccidioides posadasii, Histoplasma capsulatum, or Blastomyces dermatitidis.

29. The method of any of claims 18 to 28, wherein the subject is human.

30. The method of any of claims 18 to 29, wherein the adjuvant or immunogenic composition is administered systemically or locally.

31. The method of claim 30, wherein the adjuvant or immunogenic composition is administered by intramuscular injection, intradermal injection, intravenous injection, or subcutaneous injection.

32. The method of any one of claims 18 to 31, wherein the adjuvant or immunogenic composition is administered in a prime boost regimen.

33. A pharmaceutical composition for the treatment or prevention of infection by an infectious agent comprising an effective amount of the adjuvant or immunogenic composition of any one of claims 1 to 17 and a pharmaceutically acceptable excipient, carrier, or diluent.

34. A kit for the treatment or prevention of infection by an infectious agent, the kit comprising an effective amount of the adjuvant or immunogenic composition of any one of claims 1 to 17.

35. The kit of claim 34, wherein the kit further comprises instructions for using the kit in the method of any one of claims 18 to 32.