WO2013117968A1

WO2013117968A1 - Methods for lysing bacteria from sample and isolating cellular components therefrom, and kits therefor

Info

Publication number: WO2013117968A1
Application number: PCT/IB2012/050630
Authority: WO
Inventors: Maloy GHOSH; Archana Padmanabhan NAIR; Sridhar RAMANATHAN
Original assignee: Reametrix Inc.
Priority date: 2012-02-10
Filing date: 2012-02-13
Publication date: 2013-08-15

Abstract

The invention provides a method for isolation of bacterial DNA from a sample. The method comprises preparing the sample to provide a prepared sample, which is characterized by providing a composition for sample preparation comprising at least one reducing agent; and at least one chaotrope; adding sample to the composition for sample preparation to provide a sample mixture; filtering the sample mixture to provide a filtered sample mixture; and concentrating the filtered sample mixture to provide a prepared sample. The method then includes contacting the prepared sample with an effective amount of lysing agent. Further, cellular components can be isolated from the lysed bacteria without being damaged. Also, the cellular components are made available for further downstream processing such as amplification and detection. A bacteria lysing kit for lysing bacteria from sample to provide cellular components that may then be used for amplification and detection is also described herein.

Description

METHODS FOR LYSING BACTERIA FROM SAMPLE AND ISOLATING CELLULAR COMPONENTS THEREFROM, AND KITS THEREFOR

This is an international application claiming priority from the Indian Patent Specification No. 498/CHE/2012 titled "METHODS FOR LYSING BACTERIA FROM SAMPLE AND ISOLATING CELLULAR COMPONENTS THEREFROM, AND KITS THEREFOR" filed on 10^th February 2012.

TECHNICAL FIELD

[0001] The invention relates generally to methods for lysing bacteria and more specifically to lysing bacteria and isolating cellular components such as DNA of the bacteria from a sample, and further downstream processing such as amplification and detection.

BACKGROUND

[0001] Sputum from humans is used to diagnose tuberculosis and detection of infection in cystic fibrosis patients. Sputum is a highly viscous liquid in its native state, which poses several challenges towards sample processing and treatment. Typically, in tuberculosis detection, a patient is asked to produce a certain volume of sputum (which typically ranges from about 2 milliliters to about 5 milliliters), which is then treated appropriately to enable viewing under a microscope for Mycobacteria. The sputum sample may be stained using a suitable reporter such as a dye having specificity towards bacterial cell membrane to facilitate viewing of the Mycobacteria. This technique is also sometimes referred to as acid fast staining. The technique is an inexpensive method, requiring little infrastructure and materials. However, this method of diagnosing tuberculosis has been found to have only about 50% sensitivity, in other words, there is an equal possibility of detecting presence of tuberculosis as not detecting it when the patient actually has tuberculosis. The lack of sensitivity is due to the inability of the existing sample preparation protocols to make available with equal probability all the Mycobacteria in the sample an equal opportunity to be stained. In addition, sensitivity of the detection technology could be improved many fold by concentrating Mycobacteria from total sputum sample. Also, the sensitivity of the testing protocols is affected by the statistics of number of stained bacteria that is actually being viewed under a microscope, for example. This lack of sensitivity results in many patients suffering from tuberculosis not getting treated for it. Further, these undiagnosed patients form a potential threat to spread the disease. [0002] Further, the traditional sputum liquefaction process typically involves freshly prepared reagents stable for few hours. The sputum samples need to be decontaminated with alkali solution followed by treatment with liquefaction reagent. In addition, successful downstream applications require extensive washing steps through centrifugation to remove traces of alkali and liquefaction reagents. The current process thus inherits multiple sources of variability that include, for example, duration of decontamination with alkali, quality of liquefaction reagent prepared each day, washing conditions using centrifugation, and the like. These steps introduce a number of uncertainties and variability in the results.

[0003] One useful technique for improved diagnosis involves lysing the bacterial cell walls using a suitable lysing enzyme, and releasing the nucleic acids from within the cells. This renders the bacteria harmless, which facilitates transportation of the sample. Ezaki and Suzuki (J. Clin. Microbiol., Nov. 1982, Vol. 16, No. 5, p. 844-846) and US 5,185,242 provides a description of the use of Achromopeptidase for this purpose. An assay based on this method would be highly dependent on the skill of the operator to provide samples that have a viable bacteria for diagnostic purposes, or an attempt to improve the efficiency of the process would result in the process becoming too time consuming, highly complex and generally expensive to be translated from a laboratory setting to clinical situations, especially in resource poor settings. For example, when culturing Mycobacteria sample, a typical sample takes a minimum of 10 days for liquid culture and up to 6 weeks in cases of solid culture to arrive at an objective result. Currently, there are no available alternatives to prepare sputum samples for rapid diagnosis of patients, especially in resource poor settings. Further, a safe and stable sample transportation strategy could thus improve access of diagnosis of serious situations such as MDR-TB cases.

[0004] Thus, there is an urgent need for simple and rapid sputum sample processing methodology that can facilitate lysing Mycobacteria, when present, and followed by other downstream processes, such as isolation, amplification and detection of cellular components that enable rapid diagnosis and treatment, wherein such methods are also accessible to resource poor settings.

BRIEF DESCRIPTION [0005] In one aspect, the invention provides a method for lysing bacteria isolated from samples. The method comprises preparing the sample to provide a prepared sample, which is characterized by providing a composition for sample preparation comprising at least one reducing agent; and at least one chaotrope; adding the sample to the composition for sample preparation to provide a sample mixture; filtering the sample mixture to provide a filtered sample mixture; and concentrating the filtered sample mixture to provide a prepared sample. The method then includes contacting the prepared sample with an effective amount of lysing agent.

[0006] In another aspect, the invention provides a method for isolating cellular component of bacteria from a sample based on the method for lysing the bacteria as described herein. [0007] In yet another aspect, the invention provides a bacteria lysing kit for lysing bacteria from a sample, wherein the kit comprises a composition for sample preparation and an effective amount of lysing agent.

DRAWINGS

[0008] These and other features, aspects, and advantages of the present invention will become better understood when the following detailed description is read with reference to the accompanying drawings in which like characters represent like parts throughout the drawings, wherein:

[0009] FIG. 1 shows the gel electrophoresis of the isolated and amplified DNA from

Mycobacterium smegmatis following the methods of the invention; [0010] FIG. 2 shows the gel electrophoresis of the isolated and amplified DNA using a variety of experimental conditions as described in Example 3; and

[0011] FIG. 3 shows the gel electrophoresis of isolated and amplified DNA from lysed Mycobacterium tuberculosis in tuberculosis positive sputum samples as described in Example 4. DETAILED DESCRIPTION

[0012] The definitions provided herein are to facilitate understanding of certain terms used frequently herein and are not meant to limit the scope of the present disclosure. [0013] As used in this specification and the appended claims, the singular forms "a",

"an", and "the" encompass embodiments having plural referents, unless the content clearly dictates otherwise.

[0014] Unless otherwise indicated, all numbers expressing feature sizes, amounts, and physical properties used in the specification and claims are to be understood as being modified in all instances by the term "about." Accordingly, unless indicated to the contrary, the numerical parameters set forth in the foregoing specification and attached claims are approximations that can vary depending upon the desired properties sought to be obtained by those skilled in the art utilizing the teachings disclosed herein. [0015] As used in this specification and the appended claims, the term "or" is generally employed in its sense including "and/or" unless the content clearly dictates otherwise.

[0016] As used herein, the term "tuberculosis," also sometimes abbreviated as TB, refers to a common and in many cases lethal infectious disease caused by various strains of Mycobacteria. Important species within the family of include avium, M. intracellularae, M. gordonae, M. tuberculosis, M. kansasii, M. fortuitum, M. chelonae, M. boyis, M. scrofulaceum, M. paratuberculosis, M. marinum, M. simiae, M. szulgai, M. intracellulare, M. xenopj., M. ulcerans, M. leprae, M. lepraemurium, M. smegmatis, M. flavescens, M. terrae, M. nonchromo genicum, M. malmoense, M. asiaticum, M. yaccae, M. gastri, M. triviale, M. haemophilum, M. africanum, M. thermoresistable, and phlei. Several of the Mycobacteria are pathogenic. For example, M tuberculosis, which already infects millions of people each year, is an important Mycobacteria from an epidemiologic and clinical viewpoint. In addition, M. averium, M. boyis,M_. intracellularae, M. africanum, M. leprae, M. chelonae, M. paratuberculosis, and M. marinum, are also significant from an epidemiological and clinical viewpoint.

[0017] As used herein, "sputum" is mucus that is made available from the lower airways of the lungs. Sputum is useful for microbiological investigations of respiratory infections, such as tuberculosis. Without being bound to any theory, it is known that sputum is a complex polymeric structure made up of mucins. N and C terminal of the mucin monomers contain large number of cysteine residues. Disulphide bridges between cysteine molecules of mucin results in long and complex polymeric structure. In addition, heavy glycosylation of mucin renders a hydrophobic structure to it. The mycobacteria, when present, are entrapped within the structure of mucins. The complex structure and the hydrophobic outer coating of mucins protect the Mycobacteria contained within it. Sputum solubility may also vary from sample to sample depending on the complexity. Usually, when sputum is being extracted from a patient, some quantity of saliva is also extracted out. In existing diagnostic methods, microflora contained within the saliva may interfere with any diagnostic testing conditions.

[0018] As noted herein, in one aspect the invention provides a method for lysing bacteria from a sample. Sample as used herein includes any source of bacteria. For example, in one embodiment sample means the saliva, sputum, urine, sweat, blood, and the like. Samples may be obtained from human or animal sources. In another embodiment, sample is also meant to include prepared sample such as cultured samples used for further steps. Samples as described herein may or may not contain bacteria depending on whether they are a positive or negative sample, and the bacterial presence may be determined advantageously by the use of the methods of the invention described herein. Other forms of samples are also included within the scope of the invention, and the nature of it will become obvious to one skilled in the art. The method comprises preparing the sample to provide a prepared sample. The prepared sample is made by following these steps as described herein: providing a composition for sample preparation comprising at least one reducing agent; and at least one chaotrope; adding the sample to the composition for sample preparation to provide a sample mixture; filtering the sample mixture to provide a filtered sample mixture; and concentrating the filtered sample mixture to provide a prepared sample. The method for lysing then includes contacting the prepared sample with an effective amount of lysing agent. In one exemplary embodiment, the sample is a sputum sample. [0019] Useful reducing agents in the invention include, but not limited to, dithiothreitol (DTT), dithioerythritol (DTE), Beta-marcaptoethanol, thioredoxin, Tris(2- carboxyethyl)phosphine hydrochloride (TCEP), mixture of N-Acetyl Cysteine (NAC) and Lysine, and so on, and combinations thereof. In some specific instances, the reducing agent useful in the invention is TCEP. In other instances, the reducing agent useful in the invention is a mixture of NAC and Lysine.

[0020] The reducing agent is present in a concentration range in the composition for sample preparation such that in the final liquid sample it is made available at a concentration that ranges from about 0.5 millimoles per liter to about 200 millimoles per liter. When a mixture of NAC and Lysine is used as the reducing agent, the relative amounts of the two components is decided such that the final composition has a pH that ranges from about 5.5 to 7.4. Such concentration range varies from about 1 mole of lysine to about 5 moles of lysine per mole of NAC.

[0021] Useful chaotropes in the invention include, but not limited to, guanidinium salts such as guanidinium thiocyanate, guanidinium isothiocyanate, guanidinium hydrochloride. In one specific instance, the chaotrope used in the invention is guanidinium hydrochloride. [0022] The chaotrope is present in a concentration range in the sample such that in the final liquid sample it is made available at a concentration that ranges from about 2 moles per liter to about 6 moles per liter.

[0023] The reducing agent and chaotrope useful in the invention are available from a variety of commercial sources. Alternately, the components of the composition for sample preparation may be made using standard techniques known in the art.

[0024] The composition for sample preparation of the invention may further comprise a detergent. Useful detergents typically comprise surface active agents that are well-known in the art. Exemplary detergents include sarcosyl, NP40, poly(ethylene oxide)-based surfactants, sorbitol-based surfactants, and the like. In the situation of the sample being a sputum sample, detergents may be added to ensure releasing of the Mycobacteria from within the mucins. Thus, the sputum sample prepared using the composition for sputum sample preparation of the invention can then be preserved for longer time periods, and even facilitates transporting prepared samples.

[0025] The composition for sample preparation of the invention also includes buffering agent so as to maintain the pH of the prepared sputum sample at a certain pH, such as for example, pH 5.5 or pH 6.8 or pH 7.2, and the like. Depending on the desired pH, the buffering salt may comprise appropriate reagents, such as sodium citrate, sodium dihydrogen phosphate, potassium acetate, Tris-EDTA and the like, and combinations thereof. Buffering agents for a given pH are also available directly from commercial sources. [0026] The compositions for sample preparation of the invention are made by techniques known in the art, and may include, for example, solid mixing, blending, compounding, solution mixing, and the like. The exact choice of methods depend on various factors, such as, physical nature of components (for example, whether the components are solid or liquid), density, stability, and the like, and combinations thereof. In some instances, the components may be combined in solution in a common solvent, and subsequently the solvent is removed using known techniques, such as boiling, rotary evaporation, lyophilization etc. The exact methods for making the composition of the invention will become obvious to one skilled in the art. The composition of the invention may be made available as a solid formulation or a liquid formulation. In some instances, the composition is a solid formulation. Solid formulations provide advantages such as of ease of transportation, better storage and stability, reduced wastage, ease of handling, and the like.

[0027] The composition of the invention is capable of liquefying a thick, viscous sample such as sputum at room temperature within 10-15 minutes. Further, the composition is capable of being unitized and be provided as a solid formulation. This provides the added advantage of stability and storability at room temperature.

[0028] The sample mixture is filtered through a suitable filtering medium to provide a filtered sample mixture. Useful filtering medium in the invention include, but not limited to, paper-based filters, nylon filters, Teflon filters, silica-based filters, glass wool, and the like, and combinations thereof. Several such variations and combinations of filters are known to one of ordinary skill in the art, and are contemplated to be within the scope of the invention.

[0029] The filtered sample mixture is then concentrated to provide a prepared sample in the method of the invention for lysing bacteria. Typical concentration methods include, but not limited to, filtering, centrifuging, lyophilizing, evaporating, blotting, decanting, charge based adhesion, induced sedimentation technique, electrical field, magnetic field, affinity based separation, and the like, and combinations thereof. Such methods are known to those of ordinary skill in the art, and the most appropriate method may be chosen without undue experimentation.

[0030] The method for lysing also includes contacting the prepared sample with a lysing agent. The lysing agents of the invention comprise at least one lysing enzyme. Useful lysing enzyme includes Achromopeptidase, also known as lysyl endopeptidase. Achromopeptidase provides the advantage of lysing the usually difficult to lyse Mycobacteria without destroying the cellular contents. The use of Achromopeptidase for lysing purpose has been described in, for example, US 5,185,242 and US 2011/0275090. Other useful lysing enzymes include, for example, but not limited to, O-Glycanase, Lyticase, Hyaluronidase, Thermolysin, Fucosidase, and so on, and combinations thereof. The lysing enzyme may be mixed with a buffering agent to provide the lysing agent. Useful buffering agents have been described herein. A useful effective amount of lysing enzyme ranges from about 50 units to about 1000 units. As used herein, one unit of Achromopeptidase is defined as the amount of Achromopeptidase that will produce a change in A₆oo of 0.001 per minute per mL at pH 8.0 at 37 °C using a suspension of Micrococcus lysodeikticus as substrate (1 cm light path). This concentration may be present such that a volume ranging from about 25 microliters to about 2500 microliters comprises this amount of lysing enzyme. The exact amount of lysing enzyme to be present in the lysing agent can be arrived at without undue experimentation by one skilled in the art.

[0031] Thus the concentrated bacteria in the prepared sample are then lysed using the lysing enzyme in the manner described. The method of the invention allows for the cellular components to be made available for further processing and diagnosing in a rapid and facile manner. Further, the method of the invention is readily adaptable to a resource poor setting, such as remote rural areas having little access to power, components, skilled manpower and the like.

[0032] Cellular components useful in the invention include the nucleic acids DNA and RNA. Other cellular components may also be used, and include, for example, ribosomes, plasmids, chromosomes, and so on.

[0033] In some instances, the lysing agent is provided on a substrate. Useful substrates in the invention are absorbent such that they are capable of taking wet samples and immobilize the released cellular components. Suitable substrates useful in the invention include materials selected from a group consisting of cellulose derivatives, vinyl polymers, nylon, polyesters, and combinations thereof. Useful vinyl polymers include acrylic polymers such as poly(acrylic acid), poly(methacrylic acid), poly(methyl methacrylate), poly(vinyl alcohol), and the like; poly(styrene); poly(ethylene); and the like and combinations thereof. Useful polyesters include, for example, poly(ethylene terephthalate), poly(propylene terephthalate), poly(ethylene succinate), poly(butylene succinate), poly(lactic acid), and the like, and combinations thereof. Nylons include for example, nylon-6,6, nylon-6, nylon-6,10, and so on. Nylons are also meant to encompass other polyamides such as, but not limited to, poly(aspartic acid), poly(phenylene terephthalimide), poly(hexamethylene glucaramide), and the like, and combinations thereof. Blends of polymers are also contemplated to be within the scope of the invention. Polymers mixed with metal particles, such as gold nanoparticles, and the like are also capable of being adapted for this invention, and can be arrived at without undue experimentation by one skilled in the art. A particularly useful substrate material is cellulosic paper that has been prepared to suit this purpose. Cellulosic paper is a known and commercially available product that can be used in the invention. [0034] Substrates also comprise base that is capable of maintaining the pH at an alkaline level, generally between about 7.2 to about 9.0. One suitable base useful for this purpose is tris (hydroxymethyl aminomethane) buffer. Substrates also comprise a chelating agent that is capable of chelating onto the released cellular component like DNA. Useful chelating agents include EDTA and salts thereof. The substrate may further comprise a detergent as described herein. All these components may be mixed into the substrate, or they may be added to the substrate in situ. The entire substrate with all the components may be made available with a plastic backing to provide strength and rigidity. Other components may also be present in the substrate. Some exemplary components and construction of the unit are further described in for example US 5,496,562; US 5,756,126; and US 5,807,527. Methods for making all the components available for reaction with the concentrated bacteria are known in the art. One particularly useful method is immobilizing effective amounts of each of the components in a given location such that it is readily available for reaction once exposed to the bacteria.

[0035] In another aspect, the invention provides a method for isolating cellular components of bacteria after lysing the bacteria as described herein to provide an isolated cellular component. Techniques for isolating cellular components depend on the nature and composition of the cellular component in question, and are known to one skilled in the art. Exemplary isolation techniques known in the art include, for example, use of mechanical force in the form of homogenization, heating/boiling, sonication, bead beating etc.; use of chemical agents such as, but not limited to alkali treatment, high salt treatment, hexadecyltrimethylammonium bromide (CTAB), organic solvents like phenol, chloroform and the like; use of detergents such as Sodium dodecyl sulfate (SDS), poly(ethylene oxide) based detergents, polysorbate based surfactants, etc.; use of enzymes like Protinase K; use of resin or column based DNA isolation such as positively charged ion exchange columns, silica columns and so on; use of magnetic bead based isolation; and the like; and combinations of the above. Useful cellular components in the invention include DNA and RNA, and methods for isolating from a lysed cell of bacteria are known and described elsewhere. Lysing agent may also be provided on a substrate with suitable additional components as described herein.

[0036] Once isolated, the cellular components may then be subjected to a variety of useful steps. In one embodiment, the cellular component is subjected to a step of detection. DNA detection techniques, for example, are known in the art, and may include, for example, by fluorescent labeling or other reporter based technologies like chemiluminiscence, color based (HRP system), probe based hybridization, Biotin-SAV based system, Digoxin/digoxigenin based system, silica based system, assay formats such as bead based assays, chip based or lateral flow assays, and the like, and combinations thereof. In the case of lysing agent being provided on a substrate, the reporter may be part of the substrate, wherein the binding between the cellular component and the reporter happens on the substrate. Specific detection moieties may be used for detection of DNA, thus allowing for rapid screening tests, such as providing positive or negative results for samples. Further, quantitation can be incorporated into the detection technique to enable classification of samples on the WHO scale, such that suitable treatment may be rapidly provided to the patient.

[0037] In another embodiment, the isolated cellular component, such as DNA, is subjected to an amplification step to provide an amplified isolated cellular component. In the case of the lysing agent being provided on a substrate, the lysed cellular components may be separated from the substrate using known techniques and then subjected to the amplification steps. Reagents and methods required for isolation and amplification of the nucleic acids are known to one skilled in the art. An exemplary amplification technique known in the art is Polymerase Chain Reaction (abbreviated in the art as PCR), and variants thereof such as Real-Time PCR (RT-PCR). The amplified isolated cellular component can be read in many ways using the current available techniques known to one skilled in the art to diagnose, for example, TB and its variants such as but not limited to MDR TB (Multi-drug-resistant tuberculosis). Alternately, the nucleic acids may be amplified using isothermal reactions known to those skilled in the art. Nucleic acid of Mycobactera isolated from processed sputum sample could also be detected by amplification free DNA sensor or similar technologies known to one skilled in the art. The amplification step provides a higher number of cellular components from a smaller number of cellular components, which facilitates visualizing and diagnosis and provides other advantages. [0038] In one particular embodiment, the method of the invention is adapted to be used for lysing Mycobacteria from a sputum sample. In this particular instance, a sputum sample is prepared using the composition for sample preparation, which then provides a sputum sample mixture. This is then filtered to provide a filtered sputum sample, which is then concentrated as described herein to provide a prepared sputum sample. The prepared sputum sample is then subjected to a lysing agent as described herein to lyse the Mycobacteria. In this manner, bacteria that causes tuberculosis and other diseases that are present in sputum can be lysed. The lysed Mycobacteria may then be detected using techniques known in the art, and hence, diagnosis of the particular disease is enabled using the method of the invention. Once lysed, the cellular components of Mycobacteria can be isolated as described herein, and be amplified as also described herein.

[0039] The methods described herein allows for short turnaround times (-90 minutes) from sample collection to diagnostic data interpretation. The rapidity and high sensitivity of the process allows same day diagnosis and treatment a reality for the patients. The quick turnaround time prevents further dissemination of disease within the community thereby reducing the epidemic burden. The methods of the invention are designed for room temperature processing without any specialized instrumentation, thus enabling the resource poor settings to diagnose samples with high degree of sensitivity for any appropriate afflictions, such as tuberculosis.

[0040] The lysed bacteria and the cellular components obtained from therein may be stored for future use. In the situation wherein the lysing agent is provided on a substrate, the substrate may then be used for storage of the lysed components as such. Further, the substrate may be configured such that the portion exposed to the prepared sample to lyse the bacteria and provide the cellular components may be separated out by using known methods, such as cutting. Such techniques for storage of nucleic acid include commercially available products, for example, FTA® card or FTA® elute and the like, that may be adapted in a facile manner for this situation. The stored nucleic acid samples could be transported to suitable locations (such as a centralized testing laboratory) for further testing or for repository collections.

[0041] In yet another aspect, the invention provides a bacteria lysing kit for lysing bacteria, wherein the bacteria lysing kit comprises the composition for sample preparation of the invention and an effective amount of lysing agent. Appropriate components useful for the lysing kit will become apparent without undue experimentation to one skilled in the art. Additional features such as incorporating a fluorescent dye for DNA detection, for example may be included within the bacteria lysing kit. Optional components to enable intimate contact between components of the composition of the invention and the collected sample may be included in the sample preparation kit. In an exemplary embodiment, the bacteria lysing kit may be made of disposable plastics easy for disposal.

[0042] In another exemplary embodiment for the bacteria lysing kit of the invention, the lysing agent is provided on a substrate along with the additional components of base, chelating agent and detergent as described herein. The substrate may further comprise a suitable reporter. The substrate may further be made available with a suitable plastic backing, and in a housing to provide protection for the sample against any mechanical forces, dust, and the like. Other additional features and components to be included in the substrate will become known to one skilled in the art, and is contemplated to be within the scope of the invention. Further, the portion of the substrate exposed to the prepared sample to provide lysed bacteria may be capable of being separated from the rest of the substrate. This may be achieved by providing the substrate with a plurality of perforations along the region which needs to be separated. Other methods for separating such as cutting, tearing and the like are known in the art and are contemplated to be within the scope of the invention.

EXAMPLE 1 Method for isolating Mycobacteria from sputum

[0043] Combinations of Chaotropic salts, reducing agents, were tested on sputum sample. Fixed volume of the sputum preparation reagent comprising of chaotropic salts, reducing agents, detergents in buffered solution was added to approximately 2 ml of sputum and mixed by inverting the tube 10 times. Viscous sputum samples are readily liquefied in 10 minutes incubation at room temperature condition. The liquefied sputum mixture was prefiltered to remove insoluble materials and subjected to centrifugation at 1300g for 10 minutes. The supernatant was removed carefully. The pellet was resuspended in smaller volume of 50 to 200 microliters to derive prepared sputum sample. The prepared sputum sample would likely to have Mycobacterial cells present in Tuberculosis positive sputum sample. EXAMPLE 2

Method for isolation of Mycobacteria DNA isolation and compatibility to PCR amplification

[0044] Mycobacterium smegmatis bacteria were cultured in suitable medium and an aliquot of bacterial culture was used as a surrogate for Mycobacteria DNA isolation and amplification. The lysis buffer is composed of 1 unit per microliter Achromopeptidase enzyme (Sigma) dissolved in 10 millimolar Tris, 1 millimolar EDTA solution, pH 8.0. 400 microliters of the lysis buffer was added to 100 microliters of bacterial culture and incubated at 37 °C for 5 minutes. The resulting solution was either used for direct PCR amplification or incubated at 95 °C for 5 minutes to inactivate the Achromopeptidase enzyme followed by centrifuging at 13000 rpm to remove the debris before adding to PCR. [0045] PCR was performed on "Eppendorf Master Cycler Gradient" from Eppendorff,

Inc. USA. 25 microliters reaction was set up for each with following recipe, template DNA 5 microliters, 200 micromoles of dNTPs, 10 picomoles of each of Forward primers having the sequence (from 5' to 3'): AGGTCGACGACATCGACCACTTC and reverse primers having the sequence (from 5' to 3'): TACGGCGTCTCGATGAAGCCGAAC, 3 units of Taq polymerase enzyme from NEB, Taq polymerase buffer from NEB. PCR amplification was carried out with primers specific for RpoB gene sequence of Mycobacterium smegmatis. Following PCR conditions were used for amplification: 94°C for 1 minutes; 40 cycles consisting of, 94°C for 30 seconds; 55°C for 30 seconds; 72°C for 30 seconds; 72°C for 2 minutes; 4°C for 30 minutes. The PCR amplified products were analyzed through gel electrophoresis, shown in Fig. 1. Distinct PCR amplification of 450bp product was observed in samples with Lysis buffer, as evidenced by the left lane of the gel electrophoresis that shows strong band associated with the 450bp RpoB sequence, which is not seen on the negative control experiment shown on the right lane of the gel electrophoresis. The results indicate that Mycobacterial DNA isolation and amplification using Achromopeptidase enzyme based system without applying heating, sonication or other physical forces.

EXAMPLE 3 Room temperature lysis of Mycobacteria and wider range of Achromopeptidase concentration for Mycobacteria DNA isolation and amplification

[0046] Mycobacterium smegmatis was cultured in suitable medium and an aliquot of bacterial culture was used for Mycobacteria DNA isolation and amplification. 100 microliters of bacterial culture was incubated with 400 microliters of lysis buffer. Achromopeptidase concentration in Lysis buffer was varied between 0.25U/ microliter to 2.5U/ microliter for a final concentration of 100U to 1000U per reaction. The bacterial lysis was carried out at two temperature settings 25°C and 37°C for 5 minutes, 10 minutes and 15 minutes. Following cell lysis the lysate was directly added to PCR reaction. The PCR protocol and PCR product analysis was carried out as described in Example 2. The various conditions under which the Mycobacteria were lysed and the DNA was isolated and amplified are given in Table 1, and the corresponding gel electrophoresis results are shown in Fig. 2.

TABLE 1: Experimental Conditions for lysing Mycobacteria, and isolation and amplification of Mycobacteria DNA

[0047] Various combination of Achromopeptidase concentration and incubation condition resulted in positive amplification of the RpoB target sequence of Mycobacterium smegmatis. Combination of 100 units of Achromopeptidase per reaction and 10 minutes incubation at 25°C was found to be sufficient for Mycobacterium smegmatis DNA isolation and amplification. EXAMPLE 4

Method for Mycobacteria DNA isolation and amplification from sputum samples

[0048] TB sputum sample was processed using sputum preparation reagent. Briefly, fixed volume of sputum preparation reagent was added to sputum samples, the reagent was mixed by inverting the container few times. The resulting mixture was filtered through glass wool filters to obtain filtered sputum mixture. The resulting solution was centrifuged to concentrate Mycobacteria that might be present in sputum sample. . The pellet was washed with 10 mM Tris and 1 millimolar EDTA to remove residual salts and was resuspended in 100 miroliters of 10 millimolar Tris and 1 millimolar EDTA buffer to obtain prepared sputum sample. The prepared sputum sample was then processed for DNA isolation using the Achromopeptidase based isolation protocol as described in Example 2.

The lysate prepared from TB positive sputum sample may contain Mycobacterium tuberculosis DNA. PCR amplification of Mycobacterium tuberculosis DNA was carried in 25 microliter reactions containing cell lysate 5 microliters, 200 micromoles of dNTPs, 10 picomole of each of Forward and Reverse primers, 3 units of Taq polymerase enzyme from NEB, taq polymerase buffer from NEB. PCR amplification was carried out with primers specific for IS6110 sequence of Mycobacterium tuberculosis, wherein the forward primer for IS6110 has the sequence (from 5' to 3'): CCTGCGAGCGTAGGCGTCGG, and the reverse primer for IS6110 has the sequence (from 5' to 3'): CTCGTCC AGCGCCGCTTCGG . Following PCR conditions were used for successful amplification,

• 94°C for 5 minutes

• 40 cycles consisting of,

• 94°C for 30 seconds

• 68°C for 30 seconds · 72°C for 30 seconds

• 72°C for 2 minutes

• 4°C for 30 minutes [0049] The data was analyzed by gel electrophoresis of PCR amplified products. Two tuberculosis positive sputum samples and known negative sputum samples were used as positive and negative control samples. Fig. 3 shows the gel electrophoresis of the PCR amplified products, wherein the lane M is the DNA molecular weight marker, lanes 1 and 2 are the positive sputum sample, while lanes 3 and 4 are the negative sputum samples. PCR amplification of DNA from Tuberculosis positive sputum samples revealed unique amplified product of 123bp DNA in 2% agarose gel electrophoresis.

[0050] The results confirm the compatibility of TB sputum processing methods using sputum preparation reagent and downstream DNA isolation and amplification process with the room temperature Mycobacteria lysis method. This unique process of rapid, room temperature compatible Achromopeptidase based DNA isolation protocol is highly significant in developing PCR based TB diagnostics development, especially in resource poor setting. The concept could be extended to detect Multi drug resistant (MDR) TB diagnosis.

[0051] While only certain features of the invention have been illustrated and described herein, many modifications and changes will occur to those skilled in the art. It is, therefore, to be understood that the appended claims are intended to cover all such modifications and changes as fall within the true spirit of the invention.

Claims

We Claim:

1. A method for lysing bacteria, wherein the method comprises: preparing a sample to provide a prepared sample; and applying an effective amount of lysing agent on the prepared sample to lyse the bacteria; wherein the preparing the sample is characterized by: providing a composition for sample preparation, the composition comprising at least one reducing agent; and at least one chaotrope; adding the sample to the composition to provide a sample mixture; filtering the sample mixture to provide a filtered sample mixture; and concentrating the filtered sample mixture to provide a prepared sample.

2. The method of claim 1 wherein the sample is sputum.

3. The method of claim 1 wherein the composition for sample preparation further comprises a buffering agent.

4. The method of claim 1 wherein the composition for sample preparation further comprises a detergent.

5. The method of claim 1 wherein the lysing agent comprises a lysing enzyme selected from a group consisting of Achromopeptidase, O-Glycanase, Lyticase, Hyaluronidase, Thermolysin, Fucosidase, and combinations thereof.

6. The method of claim 1 wherein the concentrating is by filtering, centrifuging, lyophilizing, evaporating, blotting, decanting, charge based adhesion, induced sedimentation technique, electrical field, magnetic field, affinity based separation, and combinations thereof.

7. The method of claim 1 wherein the lysing agent further comprises a buffering agent.

8. The method of claim 5 wherein the lysing enzyme is present in an effective amount that ranges from about 50 units to about 1000 units.

9. The method of claim 1 wherein the bacteria is Mycobacteria.

10. A sample prepared by the method of claim 2.

11. The method of claim 1 further comprising isolating a cellular component of the bacteria.

12. The method of claim 11 wherein the sample is sputum.

13. The method of claim 11 wherein the bacteria is Mycobacteria.

14. The method of claim 11 wherein the isolating is by the use of at least one of mechanical force, chemical agents, detergents, enzymes, resin, column, magnetic bead, and combinations thereof.

15. The method of claim 11 wherein the cellular component is at least one of DNA, RNA, or combinations thereof.

16. The method of claim 11 further comprising amplifying the isolated cellular component to provide an amplified isolated cellular component.

17. The method of claim 15 wherein the amplifying is by PCR technique.

18. The method of claim 17 wherein the PCR technique includes an incubation time ranging from about 1 minute to about 60 minutes, and an incubation temperature ranging from about 15 °C to about 70 °C.

19. The method of claim 11 further comprising detecting the isolated cellular component using at least one of fluorescence, chemiluminescence, color based detection, probe based hybridization detection, biotin-SAV detection system, digoxin/digoxigenin based detection system, bead assay system, lateral flow assay system, and combinations thereof.

20. The method of claim 16 further comprising detecting the amplified isolated cellular component using at least one of fluorescence, chemiluminescence, color based detection, probe based hybridization detection, biotin-SAV detection system, digoxin/digoxigenin based detection system, bead assay system, lateral flow assay system, and combinations thereof.

21. A bacteria lysing kit for lysing bacteria from a sample to provide at least one cellular component from a lysed bacteria, wherein the kit comprises a composition for sample preparation and an effective amount of lysing agent; wherein the composition for sample preparation comprises at least one reducing agent; and at least one chaotrope.

22. The bacteria lysing kit of claim 21 wherein the composition for sample preparation further comprises a detergent.

23. The bacteria lysing kit of claim 21 further comprising a buffering agent.

24. The bacteria lysing kit of claim 21 wherein the lysing agent comprises at least one lysing enzyme.

25. The bacteria lysing kit of claim 24 wherein the at least one lysing enzyme is selected from a group consisting of Achromopeptidase, O-Glycanase, Lyticase, Hyaluronidase, Thermolysin, Fucosidase, and combinations thereof.

26. The bacteria lysing kit of claim 25 wherein the lysing enzyme is present in an effective amount that ranges from about 50 units to about 1000 units.

27. The bacteria lysing kit of claim 21 wherein the kit is configured such that the sample contacts the composition for sample preparation to provide a prepared sample; and the prepared sample is allowed to contact the lysing agent.

28. The bacteria lysing kit of claim 21 further comprising a filtration means to filter the prepared sample to provide a filtered prepared sample, wherein the filtered prepared sample is then allowed to contact the lysing agent.

29. The bacteria lysing kit of claim 28 further comprising a concentration means to concentrate the filtered prepared sample to provide a concentrated prepared sample, wherein the concentrated prepared sample is then allowed to contact the lysing agent.

30. The bacteria lysing kit o claim 21 further comprising a reporter to detect the at least one cellular component.

31. A Mycobacteria lysing and diagnosing kit for lysing Mycobacteria and diagnosis of tuberculosis from a sputum sample, wherein the kit comprises a composition for sputum sample preparation, an effective amount of a lysing agent, and at least one reporter.

32. A method for lysing Mycobacteria from sputum sample, wherein the method comprises: preparing a sputum sample to provide a prepared sputum sample; and applying an effective amount of lysing agent on the prepared sputum sample to lyse the Mycobacteria; wherein the preparing the sputum sample is characterized by: providing a composition for sample preparation, the composition comprising at least one reducing agent; and at least one chaotrope; adding sputum sample to the composition to provide a sputum sample mixture; filtering the sputum sample mixture to provide a filtered sputum sample mixture; and concentrating the filtered sputum sample mixture to provide a prepared sputum sample.

33. The method of claim 32 wherein the composition for sample preparation further comprises a buffering agent.

34. The method of claim 32 wherein the composition for sample preparation further comprises a detergent.

35. The method of claim 32 wherein the lysing agent comprises a lysing enzyme selected from a group consisting of Achromopeptidase, O-Glycanase, Lyticase, Hyaluronidase, Thermolysin, Fucosidase, and combinations thereof.

36. The method of claim 32 wherein the concentrating is by filtering, centrifuging, lyophilizing, evaporating, blotting, decanting, charge based adhesion, induced sedimentation technique, electrical field, magnetic field, affinity based separation, and combinations thereof.

37. The method of claim 32 wherein the lysing agent further comprises a buffering agent.

38. The method of claim 37 wherein the lysing enzyme is present in an effective amount that ranges from about 50 units to about 1000 units.

39. The method of claim 32 further comprising isolating a cellular component of the Mycobacteria.

40. The method of claim 39 wherein the isolating is by the use of at least one of mechanical force, chemical agents, detergents, enzymes, resin, column, magnetic bead, and combinations thereof.

41. The method of claim 39 wherein the cellular component is at least one of

DNA, RNA, or combinations thereof.

42. The method of claim 39 further comprising amplifying the isolated cellular component to provide an amplified isolated cellular component.

43. The method of claim 42 wherein the amplifying is by PCR technique.

44. The method of claim 43 wherein the PCR technique includes an incubation time ranging from about 1 minute to about 60 minutes, and an incubation temperature ranging from about 15 °C to about 70 °C.

45. The method of claim 39 further comprising detecting the isolated cellular component using at least one of fluorescence, chemiluminescence, color based detection, probe based hybridization detection, biotin-SAV detection system, digoxin/digoxigenin based detection system, bead assay system, lateral flow assay system, and combinations thereof.

46. The method of claim 42 further comprising detecting the amplified isolated cellular component using at least one of fluorescence, chemiluminescence, color based detection, probe based hybridization detection, biotin-SAV detection system, digoxin/digoxigenin based detection system, bead assay system, lateral flow assay system, and combinations thereof.