WO2013071233A1

WO2013071233A1 - Methods for detecting infectious agents and a novel virus detected thereby

Info

Publication number: WO2013071233A1
Application number: PCT/US2012/064668
Authority: WO
Inventors: Ning Zhi; Neal S. Young; Baoyan Xu; Sachiko Kajigaya
Original assignee: The United States Of America, As Represented By The Secretary, Department Of Health & Human Services
Priority date: 2011-11-10
Filing date: 2012-11-12
Publication date: 2013-05-16

Abstract

The invention provides methods for detecting infectious agents in a sample. The invention further provides a novel virus, immunogenic and vaccine compositions comprising the novel virus, and methods of using such compositions for the treatment or prevention of infection by the novel virus.

Description

METHODS FOR DETECTING INFECTIOUS AGENTS AND

A NOVEL VIRUS DETECTED THEREBY

CROSS-REFERENCE TO RELATED APPLICATION

This application claims the benefit of U.S. Provisional Application No. 61/558,363, filed November 10, 2011, the content of which is incorporated herein by reference in its entirety.

STATEMENT OF RIGHTS TO INVENTIONS MADE UNDER FEDERALLY

SPONSORED RESEARCH

Research supporting this application was carried out by the United States of America as represented by the Secretary, Department of Health and Human Services. The government has certain rights in the invention.

SEQUENCE LISTING

The instant application contains a Sequence Listing which has been submitted in ASCII format via EFS-Web and is hereby incorporated by reference in its entirety. Said ASCII copy, created on November 12, 2012, is named 89210WO.txt and is 103,555 bytes in size.

BACKGROUND OF THE INVENTION

Viral and bacterial infections are one of the leading causes of human death worldwide, but our knowledge about these infectious agents is still incomplete. Due to technological difficulties, most current studies focus on the investigation of known viruses or bacteria. Discovery of an unknown virus or bacteria, and production of first diagnostic and therapeutic reagents, is very difficult and remains a rare occurrence. In addition, enhanced tools for identifying viral and bacterial infections, especially in cases of complex infection, will allow for improved diagnosis and treatment of infected individuals. Therefore, improved methods for detecting infectious agents, and development of corresponding diagnostic and therapeutic agents, are urgently required. SUMMARY OF THE INVENTION

As described below, the present invention provides novel methods and compositions for identifying infectious agents in a sample. Using these methods, a novel virus has been identified in seronegative hepatitis patients. Accordingly, the present invention also provides nucleic acids and polypeptides of the novel virus, expression systems for producing the novel virus, diagnostic and clinical reagents for the novel virus, immunogenic and vaccine compositions comprising the novel virus, and methods of using such compositions for the treatment or prevention of infection by the novel virus.

In aspects, the invention provides a random hexameric primer having the nucleic acid sequence set forth in SEQ ID NO:l. In embodiments, the invention provides compositions containing the random hexameric primer.

In aspects, the invention provides methods for amplifying a target nucleic acid. In embodiments, the methods involve contacting a ribonucleic acid with the random hexameric primer or the composition containing the random hexameric primer, thereby forming a mixture. In embodiments, the methods involve incubating the mixture under conditions whereby a population of amplified DNA molecules that are complementary to all or a portion of the ribonucleic acid is synthesized, thereby amplifying a target nucleic acid.

In aspects, the invention provides methods for detecting a target nucleic acid in a sample. In embodiments, the methods involve obtaining a sample comprising a ribonucleic acid. In embodiments, the methods involve contacting the ribonucleic acid with the random hexameric primer or the composition containing the random hexameric primer, thereby forming a mixture. In embodiments, the methods involve incubating the mixture under conditions whereby a population of amplified DNA molecules that are complementary to all or a portion of the ribonucleic acid is synthesized, thereby amplifying a target nucleic acid. In embodiments, the methods involve detecting the amplified DNA molecules in the mixture.

In aspects, the invention provides methods for identifying an infectious agent in a sample. In embodiments, the methods involve isolating a ribonucleic acid from an infectious agent in a sample. In embodiments, the methods involve contacting the ribonucleic acid with the random hexameric primer or the composition containing the random hexameric primer, thereby forming a mixture. In embodiments, the methods involve incubating the mixture under conditions whereby a population of amplified DNA molecules that are complementary to all or a portion of the ribonucleic acid is synthesized. In embodiments, the methods involve detecting the amplified DNA molecules in the mixture, wherein detection of the amplified DNA molecules indicates the presence of the infectious agent in the sample. In aspects, the invention provides methods for identifying an infectious agent in a subject. In embodiments, the methods involve obtaining a sample from a subject. In embodiments, the methods involve isolating a ribonucleic acid from an infectious agent in the sample. In embodiments, the methods involve contacting the ribonucleic acid with the random hexameric primer or the composition containing the random hexameric primer, thereby forming a mixture. In embodiments, the methods involve incubating the mixture under conditions whereby a population of amplified DNA molecules that are complementary to all or a portion of the ribonucleic acid is synthesized. In embodiments, the methods involve detecting the amplified DNA molecules in the mixture, wherein detection of the amplified DNA molecules indicates the presence of the infectious agent in the subject.

In any of the above aspects, the sample can be a biological sample. In embodiments, the biological sample is tissue, a tissue homogenate, a tissue slice, a cell, a biopsy sample, bodily fluid, blood, plasma, serum, urine, semen, saliva, or stool.

In any of the above aspects, the amplified DNA molecules can be detected by nucleic acid sequencing, immunoassay, spectroscopy, or gel electrophoresis. In embodiments, the nucleic acid sequencing is Sanger sequencing, single nucleotide addition, or sequencing by synthesis. In embodiments, the nucleic acid sequencing is sequencing by synthesis.

In any of the above aspects, the subject can be a mammal. In embodiments, the subject is a human.

In any of the above aspects, the subject is at risk of developing an infection or is suspected of having an infection.

In any of the above aspects, the subject has been diagnosed with seronegative hepatitis.

In any of the above aspects, the infectious agent is a virus, bacteria, fungus, or parasite.

In embodiments, the infectious agent is a virus. In related embodiments, the ribonucleic acid is viral ribonucleic acid. In embodiments, the virus is a parvovirus, papo virus, adenovirus, herpesvirus, poxvirus, reo virus, picomavirus, togavirus, rhabo virus, paramyxovirus, orthomyxovirus, retrovirus, circovirus, or hepadnavirus.

In embodiments, the infectious agent is a bacterium. In related embodiments, the ribonucleic acid is bacterial ribonucleic acid. In embodiments, the bacteria is a Legionella pneumophila, Listeria monocytogenes, Campylobacter jejuni, Staphylococcus aureus, Escherichia coli, Borrelia burgdorferi, Helicobacter pylori, Ehrlichia chaffeensis, Coxiella burnetii, Clostridium difficile, Vibrio cholerae, Salmonella enterica, Bartonella henselae, Streptococcus pyogenes, Chlamydia pneumoniae, Clostridium botulinum, Vibrio vulnificus, Parachlamydia, Corynebacterium amycolatum, Klebsiella pneumoniae, Acinetobacter baumannii, Enterococcus faecium, or Enterococcus faecalis.

In any of the above aspects, the ribonucleic acid is isolated in the presence of a carrier RNA. In embodiments, the carrier RNA is synthetic poly A RNA.

In any of the above aspects, the amplified DNA molecules can be synthesized by reverse transcription.

In aspects, the invention provides methods for identifying an infectious agent in a subject diagnosed with seronegative hepatitis. In embodiments, the methods involve obtaining a sample from the subject. In embodiments, the methods involve isolating a ribonucleic acid from an infectious agent in the sample, wherein the ribonucleic acid is isolated in the presence of a carrier RNA. In embodiments, the methods involve contacting the ribonucleic acid with the random hexameric primer or the composition containing the random hexameric primer, thereby forming a mixture. In embodiments, the methods involve incubating the mixture under conditions whereby a population of amplified DNA molecules that are complementary to all or a portion of the viral ribonucleic acid is synthesized by reverse transcription. In embodiments, the methods involve detecting the amplified DNA molecules in the mixture, wherein detection of the amplified DNA molecules indicates the presence of the infectious agent in the subject. In embodiments, the methods further involve sequencing the amplified DNA molecules to determine the identity of the infectious agent.

In aspects of the invention, the invention provides nucleic acid molecules comprising: a) a nucleic acid encoding NIH-CQV or fragment thereof; b) a nucleic acid encoding NIH- CQV-Co or fragment thereof; c) a nucleic acid encoding NIH-CQV VPl, NIH-CQV-Co VPl, or fragment thereof; d) a nucleic acid encoding NIH-CQV VP2, NIH-CQV-Co VP2, or fragment thereof; e) a nucleic acid encoding NIH-CQV VP3, NIH-CQV-Co VP3, or fragment thereof; f) a nucleic acid encoding NIH-CQV NS, NIH-CQV-Co NS, or fragment thereof; g) a nucleic acid encoding an NIH-CQV 15 kDa protein or fragment thereof; h) a nucleic acid encoding an NIH-CQV-Co 17 kDa protein or fragment thereof; or i) a nucleic acid encoding a polypeptide having at least 85%, 90%, 95%, or 99% sequence identity to the amino acid sequence set forth in SEQ ID NO: 9, 11, 13, 15, 17, 24, 26, 28, 30, or 32.

In aspects of the invention, the invention provides nucleic acid molecules having at least 85%, 90%, 95%, or 99% sequence identity to the nucleotide sequence set forth in SEQ ID NO: 3, 4, 5, 6, 8, 10, 12, 14, 16, 18, 19, 20, 21, 23, 25, 27, 29, or 31. In aspects of the invention, the invention provides polypeptides comprising: a) NIH- CQV or a fragment thereof; b) NIH-CQV-Co or a fragment thereof; c) NIH-CQV VP1, NIH- CQV-Co VP 1, or a fragment thereof; d) NIH-CQV VP2, NIH-CQV-Co VP2, or a fragment thereof; e) NIH-CQV VP3, NIH-CQV-Co VP3, or a fragment thereof; f) NIH-CQV NS, NIH-CQV-Co NS, or a fragment thereof; g) an NIH-CQV 15 kDa protein or a fragment thereof; h) an NIH-CQV-Co 17 kDa protein or a fragment thereof; or i) a polypeptide having at least 85%, 90%, 95%, or 99% sequence identity to the amino acid sequence set forth in SEQ ID NO: 9, 11, 13, 15, 17, 24, 26, 28, 30, or 32.

In aspects of the invention, the invention provides nucleic acid molecules encoding a viral VP1 protein, wherein i) the nucleic acid has at least 85%, 90%, 95%, or 99% sequence identity to the nucleotide sequence set forth in SEQ ID NO: 8 or 23; or ii) the nucleic acid encodes a polypeptide having at least 85%, 90%, 95%, or 99% sequence identity to the amino acid sequence set forth in SEQ ID NO: 9 or 24. In embodiments, at least about 50-100% of the nucleic acid molecule's codons are optimized for expression in a nonpermissive or semipermissive mammalian cell.

In aspects of the invention, the invention provides nucleic acid molecules encoding a viral VP2 protein, wherein i) the nucleic acid has at least 85%, 90%, 95%, or 99% sequence identity to the nucleotide sequence set forth in SEQ ID NO: 10 or 25; or ii) the nucleic acid encodes a polypeptide having at least 85%, 90%, 95%, or 99% sequence identity to the amino acid sequence set forth in SEQ ID NO: 11 or 26. In embodiments, at least about 50-100% of the nucleic acid molecule's codons are optimized for expression in a nonpermissive or semipermissive mammalian cell.

In aspects of the invention, the invention provides nucleic acid molecules encoding a viral VP3 protein, wherein i) the nucleic acid has at least 85%, 90%, 95%, or 99% sequence identity to the nucleotide sequence set forth in SEQ ID NO: 12 or 27; or ii) the nucleic acid encodes a polypeptide having at least 85%, 90%, 95%, or 99% sequence identity to the amino acid sequence set forth in SEQ ID NO: 13 or 28. In embodiments, at least about 50-100% of the nucleic acid molecule's codons are optimized for expression in a nonpermissive or semipermissive mammalian cell.

In aspects of the invention, the invention provides nucleic acid molecules encoding a viral NS protein, wherein i) the nucleic acid has at least 85%, 90%, 95%, or 99% sequence identity to the nucleotide sequence set forth in SEQ ID NO: 14 or 29; or ii) the nucleic acid encodes a polypeptide having at least 85%, 90%, 95%, or 99% sequence identity to the amino acid sequence set forth in SEQ ID NO: 15 or 30. In embodiments, at least about 50-100% of the nucleic acid molecule's codons are optimized for expression in a nonpermissive or semipermissive mammalian cell.

In aspects of the invention, the invention provides nucleic acid molecules encoding an NIH-CQV 15 kDa protein, wherein i) the nucleic acid has at least 85%, 90%, 95%, or 99% sequence identity to the nucleotide sequence set forth in SEQ ID NO: 16; or ii) the nucleic acid encodes a polypeptide having at least 85%, 90%, 95%, or 99% sequence identity to the amino acid sequence set forth in SEQ ID NO: 17. In embodiments, at least about 50-100% of the nucleic acid molecule's codons are optimized for expression in a nonpermissive or semipermissive mammalian cell.

In aspects of the invention, the invention provides nucleic acid molecules encoding an

NIH-CQV 17 kDa protein, wherein i) the nucleic acid has at least 85%, 90%, 95%, or 99% sequence identity to the nucleotide sequence set forth in SEQ ID NO: 31; or ii) the nucleic acid encodes a polypeptide having at least 85%, 90%, 95%, or 99% sequence identity to the amino acid sequence set forth in SEQ ID NO: 32. In embodiments, at least about 50-100% of the nucleic acid molecule's codons are optimized for expression in a nonpermissive or semipermissive mammalian cell.

In any of the above- aspects, the nonpermissive or semipermissive mammalian cell can be selected from the group consisting of 293T cells, COS cells, HeLa cells and UT7/Epo-Sl cells.

In aspects of the invention, the invention provides polypeptides having at least 85%,

90%, 95%, or 99% sequence identity to the amino acid sequence of NIH-CQV or NIH-CQV- Co VP1 (see Figures 7 and 12, respectively).

In aspects of the invention, the invention provides polypeptides having at least 85%, 90%, 95%, or 99% sequence identity to the amino acid sequence of NIH-CQV or NIH-CQV- Co VP2 (see Figures 7 and 12, respectively).

In aspects of the invention, the invention provides polypeptides having at least 85%, 90%, 95%, or 99% sequence identity to the amino acid sequence of NIH-CQV or NIH-CQV- Co VP3 (see Figures 7 and 12, respectively).

In aspects of the invention, the invention provides polypeptides having at least 85%, 90%, 95%, or 99% sequence identity to the amino acid sequence of NIH-CQV or NIH-CQV- Co NS (see Figures 7 and 12, respectively).

In aspects of the invention, the invention provides polypeptides having at least 85%, 90%, 95%, or 99% sequence identity to the amino acid sequence of the 15 kDa protein of NIH-CQV (see Figure 7). In aspects of the invention, the invention provides polypeptides having at least 85%, 90%, 95%, or 99% sequence identity to the amino acid sequence of the 17 kDa protein of NIH-CQV (see Figure 12).

In aspects of the invention, the invention provides a vector containing any of the above-described nucleic acids. In embodiments, the vector is an expression vector. In embodiments, the vector further contains a promoter capable of directing expression of a coding sequence in a cell. In related embodiments, the promoter is operably linked with the nucleic acid. In embodiments, the promoter is a viral promoter, a parvovirus promoter, a mammalian cell promoter, or an insect cell promoter. In embodiments, the promoter is p6, CMV, or SV40. In embodiments, the promoter is operably linked with the nucleic acid.

In aspects of the invention, the invention provides host cells containing the above- described vectors. In embodiments, the host cell is a bacterial, mammalian, insect, or yeast cell. In embodiments, the host cell is a human cell. In embodiments, the host cell is nonpermissive or semipermissive for expression of a viral protein or is a nonerythroid lineage cell. In related embodiments, the host cell is selected from the group consisting of 293T cells, COS cells, HeLa cells and UT7/Epo-Sl cells. In embodiments, the host cell expresses a viral polypeptide or fragment thereof at a level sufficient to modulate an immune response in a subject comprising the host cell.

In aspects of the invention, the invention provides polypeptide or fragment thereof produced from the above-described host cell. In embodiments, the polypeptide or fragment thereof is a VPl protein, VP2 protein, NS protein, 15 kDa protein, 17 kDa protein, or fragment thereof.

In aspects of the invention, the invention provides methods for producing a virus like particle (VLP). In embodiments, the methods involve introducing into a host cell a nucleic acid molecule encoding the VPl protein of the novel virus. In embodiments, the methods involve introducing into a host cell a nucleic acid molecule encoding the VP2 protein of the novel virus. In embodiments, the methods involve co-culturing viral VP3, NS, 15 kDa protein, and/or 17 kDa protein. In embodiments, the methods involve culturing the cells under conditions such that the viral VPl and VP2 proteins are produced and self assemble to form a viral capsid, thereby producing a VLP. In embodiments, the methods involve isolating the VLP.

In embodiments, the VPl and/or VP2 nucleic acid molecules are introduced into the host cell as recombinant nucleic acid molecules. In embodiments, the host cell is a nonpermissive, semipermissive, or non-erythroid mammalian cell.

In embodiments, the host cell is an insect cell, and the method involves infecting the insect cell with a recombinant baculovirus encoding the nucleic acid molecules.

In aspects of the invention, the invention provides a VLP produced by the above methods.

In aspects of the invention, the invention provides a VLP containing a viral VP1 protein having at least 85%, 90%, 95%, or 99% sequence identity to the amino acid sequence set forth in SEQ ID NO: 9 or 24, and a viral VP2 protein having at least 85%, 90%, 95%, or 99% sequence identity to the amino acid sequence set forth in SEQ ID NO: 11 or 26.

In aspects of the invention, the invention provides methods for producing antibodies to a virus. In embodiments, the methods involve immunizing an animal with any of the nucleic acids, polypeptides, or compositions described herein. In embodiments, the methods involve isolating the antibodies produced in the mammal.

In aspects of the invention, the invention provides antibodies produced by the above- described method.

In aspects of the invention, the invention provides antibodies that specifically bind to any of the nucleic acids or polypeptides or fragments thereof described herein.

In embodiments, the antibody is a monoclonal antibody.

In embodiments, the antibody is a polyclonal antibody.

In embodiments, the antibody is an antibody fragment described herein (e.g., Fab fragment, an Fab' fragment, an Fd fragment, a Fd' fragment, an Fv fragment, a dAb fragment, an F(ab')2 fragment, a single chain fragment, a diabody, or a linear antibody).

In embodiments, the antibody is a humanized antibody.

In embodiments, the antibody is conjugated to a therapeutic agent (e.g., anti- viral agent or agent that treats the symptoms of viral infection). In related embodiments, the therapeutic agent is a small molecule, nanoparticle, polypeptide, radioisotope, or inhibitory nucleic acid. In some related embodiments, the therapeutic agent is an antiviral agent or a toxin.

In embodiments, the antibody is conjugated to a detectable label. In related embodiments, the detectable label is detected by spectroscopic, photochemical, biochemical, immunochemical, physical, or chemical means. In some related embodiments, the detectable label is an enzyme, a fluorescent molecule, a particle label, an electron-dense reagent, a radiolabel, a microbubble, biotin, digoxigenin, or a hapten or a protein that has been made detectable.

In aspects of the invention, the invention provides compositions containing the above-described nucleic acid molecules, vectors, host cells, VLPs, antibodies, and/or polypeptides or fragments thereof.

In aspects of the invention, the invention provides immunogenic compositions containing the above-described nucleic acid molecules, vectors, host cells, VLPs, antibodies, and/or polypeptides or fragments thereof.

In any of the above aspects, the compositions or immunogenic compositions can further contain an adjuvant.

In any of the above aspects, the compositions or immunogenic compositions can further contain a pharmaceutically acceptable excipient, carrier, or diluent.

In aspects of the invention, the invention provides methods for eliciting an immune response in a subject. In embodiments, the methods involve administering any of the above- described compositions or immunogenic compositions.

In aspects of the invention, the invention provides methods for modulating an immune response in a subject. In embodiments, the methods involve administering any of the above- described compositions or immunogenic compositions.

In any of the above aspects, the methods can prevent or treat a viral infection.

In aspects of the invention, the invention provides methods for treating or preventing a viral infection in a subject. In embodiments, the methods involve administering to the subject an effective amount of any of the above-described compositions or immunogenic compositions. In embodiments, the methods involve generating an immune response in the subject, wherein the immune response prevents or treats a viral infection.

In any of the above aspects, the immune response may involve production of neutralizing antibodies.

In any of the above aspects, the compositions or immunogenic compositions can be administered as a prime boost regimen.

In any of the aspects described herein, the composition or immunogenic composition can be a vaccine composition. In embodiments, the vaccine composition is administered to a subject to treat and/or prevent a viral infection in the subject. In aspects, the invention provides methods for detecting a viral infection in a subject. In embodiments, the methods involve obtaining a sample from a subject. In embodiments, the methods involve contacting the sample with the above-described VLPs. In embodiments, the methods involve detecting the formation of a complex between the viral antibody and the VLP, wherein detection of the complex indicates that the subject has a viral infection. In embodiments, the VLP is labeled.

In aspects, the invention provides methods for detecting a viral infection in a subject. In embodiments, the methods involve obtaining a sample from a subject. In embodiments, the methods involve contacting the sample with the above-described antibodies. In embodiments, the methods involve detecting the formation of a complex between the viral antibody and a viral polynucleotide or viral polypeptide, wherein detection of the complex indicates that the subject has a viral infection. In embodiments, the antibody is labeled.

In embodiments, the complex is detected by immunoassay, spectroscopy, or gel electrophoresis.

In aspects, the invention provides methods for detecting a viral infection in a subject.

In embodiments, the methods involve obtaining a sample from a subject. In embodiments, the methods involve detecting the presence of the above-described nucleic acids or polypeptides, wherein detection of the nucleic acid or the polypeptide indicates that the subject has a viral infection.

In embodiments, the nucleic acid or the polypeptide is detected by DNA sequencing, immunoassay, spectroscopy, or gel electrophoresis. In related embodiments, the nucleic acid or the polypeptide is detected by the above-described antibody.

In any of the above aspects, the label can be any label known in the art. For example, the label can be detected by spectroscopic, photochemical, biochemical, immunochemical, physical, or chemical means. In embodiments, the label is an enzyme, a fluorescent molecule, a particle label, an electron-dense reagent, a radiolabel, a microbubble, biotin, digoxigenin, or a hapten or a protein that has been made detectable. In some embodiments, the label is a fluorescent label, a moiety that binds another reporter ion, a magnetic particle, a heavy ion, a gold particle, or a quantum dot.

In any of the above aspects, the sample can be a biological sample. In embodiments, the sample can be tissue, a tissue homogenate, a tissue slice, a cell, a biopsy sample, bodily fluid, blood, plasma, serum, urine, semen, saliva, or stool.

In any of the above aspects, the subject can be a mammal. In embodiments, the subject is a human. In any of the above aspects, the subject may be at risk of developing a viral infection or may be suspected of having a viral infection.

In any of the above aspects, the subject may have been diagnosed with seronegative hepatitis.

In aspects, the invention provides kits containing any of the above-described nucleic acids, vectors, cells, polypeptides, VLPs, antibodies, and/or compositions. In embodiments, the kits are used for in vitro or in vivo expression of a virus, a viral protein, or a fragment thereof. In related embodiments, the kits contain instructions for using the kit to express a virus, a viral protein, or a fragment thereof. In embodiments, the kits are used for any of the methods described herein. In related embodiments, the kits contain instructions for using the kit in any of the methods described herein.

Additional objects and advantages of the invention will be set forth in part in the description which follows, and in part will be obvious from the description, or may be learned by practice of the invention. The objects and advantages of the invention will be realized and attained by means of the elements and combinations disclosed herein, including those pointed out in the appended claims. It is to be understood that both the foregoing general description and the following detailed description are exemplary and explanatory only and are not restrictive of the invention as claimed. The accompanying drawings, which are incorporated in and constitute a part of this specification, illustrate several embodiments of the invention and, together with the description, serve to explain the principles of the invention.

Definitions

To facilitate an understanding of the present invention, a number of terms and phrases are defined below.

As used herein, the singular forms "a", "an", and "the" include plural forms unless the context clearly dictates otherwise. Thus, for example, reference to "a vo virus" includes reference to more than one virus.

Unless specifically stated or obvious from context, as used herein, the term "or" is understood to be inclusive.

The term "including" is used herein to mean, and is used interchangeably with, the phrase "including but not limited to."

As used herein, the terms "comprises," "comprising," "containing," "having" and the like can have the meaning ascribed to them in U.S. Patent law and can mean "includes," "including," and the like; "consisting essentially of or "consists essentially" likewise has the meaning ascribed in U.S. Patent law and the term is open-ended, allowing for the presence of more than that which is recited so long as basic or novel characteristics of that which is recited is not changed by the presence of more than that which is recited, but excludes prior art embodiments.

As used herein, the term "NIH-CQV" refers to the novel virus described herein. The nucleic acid sequences of NIH-CQV are shown in Figure 7. Figure 7 also identifies the NIH- CQV coding proteins (VP1, VP2, VP3, NS, and 15 kDa protein).

As used herein, the term "NIH-CQV-Co" refers to the novel virus described herein. The nucleic acid sequences of NIH-CQV-Co are shown in Figure 12. Figure 12 also identifies the NIH-CQV-Co coding proteins (VP1, VP2, VP3, NS, and 17 kDa protein).

By "viral structural protein" (e.g., parvovirus or parvovirus-like virus structural protein) is meant a polypeptide or fragment thereof that contributes to a viral capsid. In one embodiment, a viral structural protein has at least about 80% amino acid sequence identity to a naturally occurring VP1, VP2, or VP3 protein (e.g., parvovirus or parvovirus-like virus VP1, VP2, or VP3 protein) and having immunogenic activity in a mammal. In other embodiments, the amino acid sequence identity is at least about 85%, 90%, 95%, or more.

By "VP1 polypeptide" is meant a protein having at least about 80%, 85%, 90%, 95%, or more amino acid identity to the VP1 amino acid sequence identified in Figure 7 or 12, as well as the amino acid sequence set forth in SEQ ID NO: 9 or 24.

By "VP2 polypeptide" is meant a protein having at least about 80%, 85%, 90%, 95%, or more amino acid identity to the VP2 amino acid sequence identified in Figure 7 or 12, as well as the amino acid sequence set forth in SEQ ID NO: 11 or 26.

By "VP3 polypeptide" is meant a protein having at least about 80%, 85%, 90%, 95%, or more amino acid identity to the VP3 amino acid sequence identified in Figure 7 or 12, as well as the amino acid sequence set forth in SEQ ID NO: 13 or 28.

By "NS polypeptide" is meant a protein having at least about 80%, 85%, 90%, 95%, or more amino acid identity to the NS amino acid sequence identified in Figure 7 or 12, as well as the amino acid sequence set forth in SEQ ID NO: 15 or 30.

By "NIH-CQV 15 kDa protein," "NIH-CQV 15 kDa polypeptide," "15 kDa protein," or "15 kDa polypeptide" is meant a protein having at least about 80%, 85%, 90%, 95%, or more amino acid identity to the 15 kDa protein identified in Figure 7, as well as the amino acid sequence set forth in SEQ ID NO: 17. By "NIH-CQV-Co 17 kDa protein," "NIH-CQV-Co 17 kDa polypeptide," "17 kDa protein," or "17 kDa polypeptide" is meant a protein having at least about 80%, 85%, 90%,

95%, or more amino acid identity to the 17 kDa protein identified in Figure 12, as well as the amino acid sequence set forth in SEQ ID NO: 32.

By "p6 promoter" is meant a regulatory sequence having at least 80%, 85%, 90%,

95%, or more identity to any parvovirus p6 promoter known in the art. An exemplary parvovirus p6 promoter sequence is provided below.

GCTTGATCTTAGTGGCACGTCAACCCCAAGCGCTGGCCCAGAGCCAACCC TAATTCCGGAAGTCCCGCCCACCGGAAGTGACGTCACAGGAAATGACGTC ACAGGAAATGACGTAATTGTCCGCCATCTTGTACCGGAAGTCCCGCCTAC CGGCGGCGACCGGCGGCATCTGATTTGGTGTCTTCTTTTAAATTTTAGCGG GCTTTTTTCCCGCCTTATGCAAATGGGCAGCCATTTTAAGTGTTTTACTAT AATTTTATTGGTCAGTTTTGTAACGGTTAAAATGGGCGGAGCGTAGGCGG GGACTACAGTATATATAGCACAGCACTGCCGCAGCTCTTTCTTTCTGGGCT GCTTTTTCCTGGACTTTCTTGCTGTTTTTTGTGAGCTAACTAAC

(SEQ ID NO: 33)

By "nonpermissive or semipermissive mammalian cell" is meant a cell that fails to express detectable levels of infectious virus or that expresses only minimal levels of infectious virus.

By "codon optimized nucleic acid molecule" is meant that the polynucleotide includes certain sequence alterations relative to a wild-type nucleic acid sequence that provides for the detectable production of an encoded polypeptide in a cell type that does not typically permit the detectable production of such polypeptides. Thus, a "codon optimized nucleic acid molecule" is capable of expression in a nonpermissive or semipermissive mammalian cell.

By "non-erythroid progenitor cell" is meant a cell that does not produce erythroid progeny.

By "non-erythroid lineage cell" is meant a cell that is not an erythroid cell, does not produce erythroid progeny, and/or does not belong to a cell lineage capable of generating an erythroid cell type. Exemplary erythroid lineage cells are hematopoietic and endothelial stem cells. Exemplary non-erythroid lineage cells include, but are not limited to, 293T cells, COS cells, HeLa cells and UT7/Epo-Sl cells.

By "agent" is meant any small molecule chemical compound, antibody, nucleic acid molecule, or polypeptide, or fragments thereof.

As used herein, the term "adjuvant" is meant to refer to a compound that, when used in combination with a specific immunogen in a formulation, will augment, alter or modify the resultant immune response. In embodiments, the adjuvant is used in combination with a viral antigen described herein. Modification of the immune response includes intensification or broadening the specificity of either or both antibody and cellular immune responses.

Modification of the immune response can also mean decreasing or suppressing certain antigen-specific immune responses.

As used herein "inducing immunity" is meant to refer to any immune response generated against an antigen. In one embodiment, immunity is mediated by antibodies against an infectious agent, which is exhibited by a vertebrate (e.g., a human), that prevents or ameliorates an infection or reduces at least one symptom thereof. Viral antigens of the invention can stimulate the production of antibodies that, for example, neutralize infectious agents, block infectious agents from entering cells, block replication of infectious agents, and/or protect host cells from infection and destruction. The term can also refer to an immune response that is mediated by T- lymphocytes and/or other white blood cells against an infectious agent, exhibited by a vertebrate (e.g., a human), that prevents or ameliorates an infection, for example infection by the novel virus, or reduces at least one symptom thereof.

By "ameliorate" is meant decrease, suppress, attenuate, diminish, arrest, or stabilize the development or progression of a disease or a symptom thereof.

By "alteration" is meant a change (increase or decrease) in the expression levels or activity of a gene or polypeptide as detected by standard art known methods such as those described herein. As used herein, an alteration includes a 10% change in expression levels, a 25% change, a 40% change, or a 50% or greater change in expression levels. In

embodiments, the invention provides codon optimized nucleic acid molecules that encode viral structural proteins at an increased level in a nonpermissive or semipermissive cell type relative to the expression of a corresponding wild-type nucleic acid molecule in such cells.

By "analog" is meant a molecule that is not identical, but has analogous functional or structural features. For example, a polypeptide analog retains the biological activity of a corresponding naturally-occurring polypeptide, while having certain biochemical

modifications that enhance the analog's function relative to a naturally occurring polypeptide. Such biochemical modifications could increase the analog's protease resistance, membrane permeability, or half-life, without altering, for example, ligand binding. An analog may include an unnatural amino acid.

"Detect" refers to identifying the presence, absence or amount of the analyte to be detected. By "disease" is meant any condition or disorder that damages or interferes with the normal function of a cell, tissue, or organ. Examples of diseases include viral infections, including infection by the novel virus described herein.

By "effective amount" is meant the amount of an agent required to ameliorate the symptoms of a disease relative to an untreated patient. The effective amount of active compound(s) used to practice the present invention for prevention or treatment of a disease varies depending upon the manner of administration, the age, body weight, and general health of the subject. Ultimately, the attending physician or veterinarian will decide the appropriate amount and dosage regimen. Such amount is referred to as an "effective" amount.

By "fragment" is meant a portion of a polypeptide or nucleic acid molecule. This portion contains, for example, at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, or 90% of the entire length of the reference nucleic acid molecule or polypeptide. A fragment may contain 10, 20, 30, 40, 50, 60, 70, 80, 90, or 100, 200, 300, 400, 500, 600, 700, 800, 900, or 1000 nucleotides or amino acids.

"Hybridization" means hydrogen bonding, which may be Watson-Crick, Hoogsteen or reversed Hoogsteen hydrogen bonding, between complementary nucleobases. For example, adenine and thymine are complementary nucleobases that pair through the formation of hydrogen bonds.

By "immunogenic composition" is meant a composition comprising a molecule capable of inducing or modulating an immune response in a subject. Such an immune response may be a prophylactic or therapeutic immune response.

A polypeptide, antibody, polynucleotide, vector, cell, or composition can be an "isolated" polypeptide, antibody, polynucleotide, vector, cell, or composition, which is in a form not found in nature. Isolated polypeptides, antibodies, polynucleotides, vectors, cell or compositions include those which have been purified to a degree that they are no longer in a form in which they are found in nature. In some embodiments, an antibody, polynucleotide, vector, cell, or composition which is isolated is substantially pure.

As used herein, "substantially pure" refers to material which is at least 50% pure (i.e., free from contaminants), at least 75% pure, at least 80% pure, at least 85% pure, at least 90% pure, or at least 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% pure.

By "isolated polynucleotide" is meant a nucleic acid molecule (e.g., a DNA) that is free of the genes which, in the naturally-occurring genome of the organism from which the nucleic acid molecule of the invention is derived, flank the gene. The term therefore includes, for example, a recombinant DNA that is incorporated into a vector; into an autonomously replicating plasmid or virus; or into the genomic DNA of a prokaryote or eukaryote; or that exists as a separate molecule (for example, a cDNA or a genomic or cDNA fragment produced by PCR or restriction endonuclease digestion) independent of other sequences. In addition, the term includes an RNA molecule that is transcribed from a DNA molecule, as well as a recombinant DNA that is part of a hybrid gene encoding additional polypeptide sequence.

By an "isolated polypeptide" is meant a polypeptide of the invention that has been separated from components that naturally accompany it. Typically, the polypeptide is isolated when it is at least 60%, by weight, free from the proteins and naturally-occurring organic molecules with which it is naturally associated. In embodiments, the preparation is at least 75%, ably at least 90%, or at least 99%, by weight, a polypeptide of the invention. An isolated polypeptide of the invention may be obtained, for example, by extraction from a natural source, by expression of a recombinant nucleic acid encoding such a polypeptide; or by chemically synthesizing the protein. Purity can be measured by any appropriate method, for example, column chromatography, polyacrylamide gel electrophoresis, or by HPLC analysis.

As used herein, "obtaining" as in "obtaining an agent" includes synthesizing, purchasing, or otherwise acquiring the agent.

As used herein, the terms "prevent," "preventing," "prevention," "prophylactic treatment" and the like refer to reducing the probability of developing a disorder or condition in a subject, who does not have, but is at risk of or susceptible to developing a disorder or condition.

By "reduces" is meant a negative alteration of at least 10%, 25%, 50%, 75%, or

100%.

By "reference" is meant a standard or control condition.

A "reference sequence" is a defined sequence used as a basis for sequence comparison. A reference sequence may be a subset of or the entirety of a specified sequence; for example, a segment of a full-length cDNA or gene sequence, or the complete cDNA or gene sequence. For polypeptides, the length of the reference polypeptide sequence will generally be at least about 16 amino acids, at least about 20 amino acids, at least about 25 amino acids, about 35 amino acids, about 50 amino acids, or about 100 amino acids. For nucleic acids, the length of the reference nucleic acid sequence will generally be at least about 50 nucleotides, at least about 60 nucleotides, at least about 75 nucleotides, about 100 nucleotides or about 300 nucleotides or any integer thereabout or therebetween. Nucleic acid molecules useful in the methods of the invention include any nucleic acid molecule that encodes a polypeptide of the invention or a fragment thereof. Such nucleic acid molecules need not be 100% identical with an endogenous nucleic acid sequence, but will typically exhibit substantial identity. Polynucleotides having "substantial identity" to an endogenous sequence are typically capable of hybridizing with at least one strand of a double-stranded nucleic acid molecule. Nucleic acid molecules useful in the methods of the invention include any nucleic acid molecule that encodes a polypeptide of the invention or a fragment thereof. Such nucleic acid molecules need not be 100% identical with an endogenous nucleic acid sequence, but will typically exhibit substantial identity. Polynucleotides having "substantial identity" to an endogenous sequence are typically capable of hybridizing with at least one strand of a double-stranded nucleic acid molecule. By "hybridize" is meant pair to form a double-stranded molecule between complementary polynucleotide sequences (e.g., a gene described herein), or portions thereof, under various conditions of stringency. See, e.g., Wahl, G. M. and S. L. Berger (1987) Methods Enzymol. 152:399; Kimmel, A. R. (1987) Methods Enzymol. 152:507.

For example, stringent salt concentration will ordinarily be less than about 750 mM NaCl and 75 mM trisodium citrate, less than about 500 mM NaCl and 50 mM trisodium citrate, or less than about 250 mM NaCl and 25 mM trisodium citrate. Low stringency hybridization can be obtained in the absence of organic solvent, e.g., formamide, while high stringency hybridization can be obtained in the presence of at least about 35% formamide or at least about 50% formamide. Stringent temperature conditions will ordinarily include temperatures of at least about 30° C, at least about 37° C, or at least about 42° C. Varying additional parameters, such as hybridization time, the concentration of detergent, e.g., sodium dodecyl sulfate (SDS), and the inclusion or exclusion of carrier DNA, are well known to those skilled in the art. Various levels of stringency are accomplished by combining these various conditions as needed. In embodiments, hybridization will occur at 30° C in 750 mM NaCl, 75 mM trisodium citrate, and 1% SDS. In embodiments, hybridization will occur at 37° C in 500 mM NaCl, 50 mM trisodium citrate, 1% SDS, 35% formamide, and 100 μ^πιΐ denatured salmon sperm DNA (ssDNA). In embodiments, hybridization will occur at 42° C in 250 mM NaCl, 25 mM trisodium citrate, 1% SDS, 50% formamide, and 200 μg/ml ssDNA. Useful variations on these conditions will be readily apparent to those skilled in the art.

For most applications, washing steps that follow hybridization will also vary in stringency. Wash stringency conditions can be defined by salt concentration and by temperature. As above, wash stringency can be increased by decreasing salt concentration or by increasing temperature. For example, stringent salt concentration for the wash steps may be less than about 30 mM NaCl and 3 mM trisodium citrate or less than about 15 mM NaCl and 1.5 mM trisodium citrate. Stringent temperature conditions for the wash steps will ordinarily include a temperature of at least about 25° C, of at least about 42° C, or of at least about 68° C. In embodiments, wash steps will occur at 25° C in 30 mM NaCl, 3 mM trisodium citrate, and 0.1% SDS. In embodiments, wash steps will occur at 42 C in 15 mM NaCl, 1.5 mM trisodium citrate, and 0.1% SDS. In embodiments, wash steps will occur at 68° C in 15 mM NaCl, 1.5 mM trisodium citrate, and 0.1% SDS. Additional variations on these conditions will be readily apparent to those skilled in the art. Hybridization techniques are well known to those skilled in the art and are described, for example, in Benton and Davis (Science 196:180, 1977); Grunstein and Hogness (Proc. Natl. Acad. Sci., USA 72:3961, 1975); Ausubel et al. (Current Protocols in Molecular Biology, Wiley Interscience, New York, 2001); Berger and Kimmel (Guide to Molecular Cloning Techniques, 1987, Academic Press, New York); and Sambrook et al., Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory Press, New York.

By "substantially identical" is meant a polypeptide or nucleic acid molecule exhibiting at least 50% identity to a reference amino acid sequence (for example, any one of the amino acid sequences described herein) or nucleic acid sequence (for example, any one of the nucleic acid sequences described herein). For example, such a sequence can be at least 60%, 70%, 80%, 85%, 90%, 95%, or even 99% identical at the amino acid level or nucleic acid to the sequence used for comparison.

Sequence identity is typically measured using sequence analysis software (for example, Sequence Analysis Software Package of the Genetics Computer Group, University of Wisconsin Biotechnology Center, 1710 University Avenue, Madison, Wis. 53705,

BLAST, BESTFIT, GAP, or PILEUP/PRETTYBOX programs). Such software matches identical or similar sequences by assigning degrees of homology to various substitutions, deletions, and/or other modifications. Conservative substitutions typically include substitutions within the following groups: glycine, alanine; valine, isoleucine, leucine;

aspartic acid, glutamic acid, asparagine, glutamine; serine, threonine; lysine, arginine; and phenylalanine, tyrosine. In an exemplary approach to determining the degree of identity, a BLAST program may be used, with a probability score between e^"3 and e^"100 indicating a closely related sequence. The term "antibody" means an immunoglobulin molecule that recognizes and specifically binds to a target, such as a protein, polypeptide, peptide, carbohydrate, polynucleotide, lipid, or combinations of the foregoing through at least one antigen recognition site within the variable region of the immunoglobulin molecule. As used herein, the term "antibody" encompasses intact polyclonal antibodies, intact monoclonal antibodies, antibody fragments (such as Fab, Fab', F(ab')2, Fd, and Fv fragments), single chain Fv (scFv) mutants, multispecific antibodies such as bispecific antibodies generated from at least two intact antibodies, chimeric antibodies, humanized antibodies, human antibodies, fusion proteins comprising an antigen determination portion of an antibody, and any other modified immunoglobulin molecule comprising an antigen recognition site so long as the antibodies exhibit the desired biological activity. An antibody can be of any the five major classes of immunoglobulins: IgA, IgD, IgE, IgG, and IgM, or subclasses (isotypes) thereof (e.g. IgGl, IgG2, IgG3, IgG4, IgAl and IgA2), based on the identity of their heavy-chain constant domains referred to as alpha, delta, epsilon, gamma, and mu, respectively. The different classes of immunoglobulins have different and well known subunit structures and three- dimensional configurations. Antibodies can be naked or conjugated to other molecules such as toxins, radioisotopes, and the like.

The term "antibody fragment" refers to a portion of an intact antibody and refers to the antigenic determining variable regions of an intact antibody. Examples of antibody fragments include, but are not limited to Fab, Fab', F(ab')2, Fd, and Fv fragments, linear antibodies, single chain antibodies, and multispecific antibodies formed from antibody fragments.

A "monoclonal antibody" refers to homogenous antibody population involved in the highly specific recognition and binding of a single antigenic determinant, or epitope. This is in contrast to polyclonal antibodies that typically include different antibodies directed against different antigenic determinants. The term "monoclonal antibody" encompasses both intact and full-length monoclonal antibodies as well as antibody fragments (such as Fab, Fab', F(ab')2, Fd, Fv), single chain (scFv) mutants, fusion proteins comprising an antibody portion, and any other modified immunoglobulin molecule comprising an antigen recognition site. Furthermore, "monoclonal antibody" refers to such antibodies made in any number of manners including but not limited to by hybridoma, phage selection, recombinant expression, and transgenic animals.

The term "humanized antibody" refers to forms of non-human (e.g. murine) antibodies that are specific immunoglobulin chains, chimeric immunoglobulins, or fragments thereof that contain minimal non-human (e.g., murine) sequences. Typically, humanized antibodies are human immunoglobulins in which residues from the complementary determining region (CDR) are replaced by residues from the CDR of a non-human species (e.g. mouse, rat, rabbit, hamster) that have the desired specificity, affinity, and capability (Jones et al., 1986, Nature, 321 :522-525; Riechmann et al., 1988, Nature, 332:323-327; Verhoeyen et al., 1988, Science, 239: 1534-1536). In some instances, the Fv framework region (FR) residues of a human immunoglobulin are replaced with the corresponding residues in an antibody from a non-human species that has the desired specificity, affinity, and capability. The humanized antibody can be further modified by the substitution of additional residue either in the Fv framework region and/or within the replaced non-human residues to refine and optimize antibody specificity, affinity, and/or capability. In general, the humanized antibody will comprise substantially all of at least one, and typically two or three, variable domains containing all or substantially all of the CDR regions that correspond to the non-human immunoglobulin whereas all or substantially all of the FR regions are those of a human immunoglobulin consensus sequence. The humanized antibody can also comprise at least a portion of an immunoglobulin constant region or domain (Fc), typically that of a human immunoglobulin. Examples of methods used to generate humanized antibodies are described in U.S. Pat. 5,225,539.

The term "human antibody" means an antibody produced by a human or an antibody having an amino acid sequence corresponding to an antibody produced by a human made using any technique known in the art. This definition of a human antibody includes intact or full-length antibodies, fragments thereof, and/or antibodies comprising at least one human heavy and/or light chain polypeptide such as, for example, an antibody comprising murine light chain and human heavy chain polypeptides.

The term "chimeric antibodies" refers to antibodies wherein the amino acid sequence of the immunoglobulin molecule is derived from two or more species. Typically, the variable region of both light and heavy chains corresponds to the variable region of antibodies derived from one species of mammals (e.g. mouse, rat, rabbit, etc) with the desired specificity, affinity, and capability while the constant regions are homologous to the sequences in antibodies derived from another (usually human) to avoid eliciting an immune response in that species.

The term "epitope" or "antigenic determinant" are used interchangeably herein and refer to that portion of an antigen capable of being recognized and specifically bound by a particular antibody. When the antigen is a polypeptide, epitopes can be formed both from contiguous amino acids and noncontiguous amino acids juxtaposed by tertiary folding of a protein. Epitopes formed from contiguous amino acids are typically retained upon protein denaturing, whereas epitopes formed by tertiary folding are typically lost upon protein denaturing. An epitope typically includes at least 3, at least 5, or at least 8-10 amino acids in a unique spatial conformation.

That an antibody "specifically binds" to an epitope or antigenic molecule means that the antibody reacts or associates more frequently, more rapidly, with greater duration, with greater affinity, or with some combination of the above to an epitope or antigenic molecule than with alternative substances, including unrelated proteins. In certain embodiments, "specifically binds" means, for instance, that an antibody binds to a protein with a KD of about 0.1 mM or less, but more usually less than about 1 μΜ. In certain embodiments, "specifically binds" means that an antibody binds to a protein at times with a KD of at least about 0.1 μΜ or less, and at other times at least about 0.01 μΜ or less. Because of the sequence identity between homologous proteins in different species, specific binding can include an antibody that recognizes a particular protein in more than one species. It is understood that an antibody or binding moiety that specifically binds to a first target may or may not specifically bind to a second target. As such, "specific binding" does not necessarily require (although it can include) exclusive binding, i.e. binding to a single target. Generally, but not necessarily, reference to binding means specific binding.

By "structural protein" is meant a polypeptide that contributes to a viral capsid or envelope. In one embodiment the structural protein is viral VP1 or VP2.

By "subject" is meant a mammal, including, but not limited to, a human or non- human mammal, such as a bovine, equine, canine, ovine, or feline.

Ranges provided herein are understood to be shorthand for all of the values within the range. For example, a range of 1 to 50 is understood to include any number, combination of numbers, or sub-range from the group consisting 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50.

As used herein, the terms "treat," treating," "treatment," and the like refer to reducing or ameliorating a disorder and/or symptoms associated therewith. It will be appreciated that, although not precluded, treating a disorder or condition does not require that the disorder, condition or symptoms associated therewith be completely eliminated.

As used herein, the term "vaccine" refers to a formulation which contains a viral antigen as described herein which is in a form that is capable of being administered to a vertebrate and which induces a protective immune response sufficient to induce immunity to prevent and/or ameliorate an infection and/or to reduce at least one symptom of an infection. Typically, the vaccine comprises a conventional saline or buffered aqueous solution medium in which the composition of the present invention is suspended or dissolved. In this form, the composition of the present invention can be used conveniently to prevent, ameliorate, or otherwise treat an infection. Upon introduction into a host, the vaccine is able to provoke an immune response including, but not limited to, the production of antibodies and/or cytokines and/or the activation of cytotoxic T cells, antigen presenting cells, helper T cells, dendritic cells and/or other cellular responses.

As used herein, the term "virus-like particle" (VLP) refers to a structure that in at least one attribute resembles a virus but which has not been demonstrated to be infectious. Viruslike particles in accordance with the invention do not carry genetic information encoding for the proteins of the virus-like particles. In general, virus-like particles lack a viral genome and, therefore, are noninfectious. In addition, virus-like particles can often be produced in large quantities by heterologous expression and can be easily purified.

The recitation of a listing of chemical groups in any definition of a variable herein includes definitions of that variable as any single group or combination of listed groups. The recitation of an embodiment for a variable or aspect herein includes that embodiment as any single embodiment or in combination with any other embodiments or portions thereof.

Any compositions or methods provided herein can be combined with one or more of any of the other compositions and methods provided herein.

BRIEF DESCRIPTION OF THE DRAWINGS

Figure 1 provides a schematic diagram depicting a novel strategy for identifying an infectious agent (e.g., virus or bacteria) in a sample (e.g., biological sample).

Figure 2 is a schematic diagram of multiplex Solexa sequencing.

Figure 3 shows that non-polyA random hexamer significantly reduces the background of cDNA synthesis. Viral nucleic acid was extracted using QIAamp^® MinElute Virus Kit (Qiagen, Valencia, CA) following manufacture's instruction. Reverse transcription was initiated with ΙΟμΙ extracted viral nucleic acid and 100 pmol non-poly A random hexamer (5'NNNNNV3' (SEQ ID NO: 1)) or regular random hexamer. After synthesis, the double- strand cDNA products were sheared by sonication, and 10 μΐ of treated samples were subjected to agarose gel electrophoresis. Figure 3 includes a gel comparing the background cDNA synthesis in the samples. The gel shows that background cDNA synthesis was significantly reduced when non-poly A random hexamer was used in comparison with regular random hexamer. The numbers on the left indicate molecular size in base pairs.

Abbreviations: MK, molecular marker; R, random hexamer; NA, non-polyA random hexamer.

Figure 4 shows that non-polyA random hexamer significantly reduces the background of Solexa PCR. The double-strand cDNA samples were sheared by sonication and the fragmented cDNAs ranging from 200-500bps were purified using QIAquick^® PCR purification kit (Qiagen, Valencia, CA). The sheared cDNAs were end blunted and a 3' end A-tailing was added to the cDNA fragments. Following ligation of barcode adaptors to the end-repaired fragments, the DNA fragments were amplified using adapter primers for 17 cycles, and 10 μΐ of resulting products were subjected to agarose gel electrophoresis. Figure 4 includes a representative gel. The gel shows that the background of Solexa-PCR amplification was significantly reduced when non-poly A random hexamer was in comparison with regular random hexamer. The numbers on the left indicate molecular size in base pairs. Abbreviations: MK, molecular marker; R, random hexamer; NA, non-polyA random hexamer; SI and S2, sample 1 and 2.

Figure 5 compares the amplification efficiency of regular and non-polyA random hexamers. Virus was spiked into normal serum samples with serial dilutions as indicated. Viral nucleic acid was extracted using QIAamp^® MinElute Virus Kit (Qiagen, Valencia, CA) following manufacture's instruction with or without carrier RNA. The cDNA was synthesized by reverse transcription, which was initiated with ΙΟμΙ extracted viral nucleic acid and 100 pmol non-poly A random hexamer or regular random hexamer. The copy numbers of synthesized viral cDNA were assessed by real-time PCR targeting the B19V or lentivirus genome. Figure 5 includes summary graphs showing that at three different levels of viral input, there were no significant differences in the copy number of synthesized cDNA between non-poly A random hexamers and regular random hexamers. The data is expressed as mean + SD of 3 independent experiments.

Figure 6 shows the genome structure of NIH-CQV. Figure 6A is a schematic diagram of the NIH-CQV genome. The putative ORFs are diagramed in boxes and the arrows indicate the orientation of the ORFs. The conserved phosphate -binding loop (P-loop) and PLA2 motif are illustrated as shaded boxes in rep and cp, respectively. Figure 6B shows the sequences and structures of the ITRs. The numbers indicate the position of the nucleotides in the NIH-CQV genomes.

Figure 7 shows the genomic sequence of NIH-CQV. Both the plus and minus strand are listed (SEQ ID NOS:5 and 6, respectively). The sequences of the ITRs at the 5' and 3' termini are noted as follows: the stems are marked with ( ) and the loops are marked with ( ). The probable promoter sequences are identified by underlining the TATA- box sequences. The direct repeats in the large intergene region are shown in boxes. The translation start site for the Rep and CP proteins is in bold and the arrows indicate the direction of the ORFs. The amino acid sequences encoded by the three major ORFs are listed, and the conserved p-loop NTPase motif and the PLA₂ motif are underline and labeled.

Figures 8 A- 8 J include the nucleic acid and amino acid sequences of the novel virus identified in seronegative hepatitis patients (NIH-CQV). Figures 8A and 8B include the nucleic acid and amino acid sequences of the VP1 protein from the novel virus. Figures 8C and 8D include the nucleic acid and amino acid sequences of the VP2 protein from the novel virus. Figures 8E and 8F include the nucleic acid and amino acid sequences of the VP3 protein from the novel virus. Figures 8G and 8H include the nucleic acid and amino acid sequences of the NS protein from the novel virus. Figures 81 and 8J include the nucleic acid and amino acid sequences of the 15 kDa protein from the novel virus.

Figures 9A and 9B verify the NIH-CQV genome by overlapping PCR. In order to verify the sequence of the viral genome assembled from the Solexa data, six sets of overlapping primer pairs were designed and used to amplify overlapping DNA fragments from patient sample. Figure 9A is a schematic diagram of the NIH-CQV genome and positions of primer pairs for the overlapping PCR. Figure 9B shows the amplification of overlapping viral DNA fragments from patient sample. The numbers at top indicate the primer pair used for PCR as illustrated in panel A. The numbers on the left indicate molecular size in base pairs. MW: 1 kb plus DNA ladder marker.

Figure 10 is a scatter plot of tag counts normalized by gene length between the NS gene and the VP gene. Each point represents a sample. Note the average of the ratio between the two counts is close to 1.

Figures 11 A- 11C show the detection of a circular form of NIH-CQV in patient samples. Figure 11A is a gel showing the detection of circular NIH-CQV genome by inverse PCR. Inverse PCR assay were conducted for three samples (P1-P3) that were positive for real-time PCR, and reagent PCR controls (RC). The numbers on the left indicate molecular weight (MW) markers and the arrowhead indicates the positions of the inverse PCR products. Figure 1 IB is a schematic diagram of circular genome of NIH-CQV (NIH-CQV-Co). Three major ORFs encoding putative replication associated protein (rep), capsid protein (cp) and a 17-kDa protein are respectively illustrated as arrows. Arrowheads indicate the position for the primers used in the reverse PCR. LIR: large intergene region; SIR: Small intergene region. Figure 11C is an alignment of the sequences of the NIH-CQV-Co junction area region with the NIH-CQV terminal region. Positions of the primers used for the inverse PCR are represented with longer arrows. The sequences of NIH-CQV and NIH-CQV-Co are shown. The dashed lines indicate the sequences that are missing in NIH-CQV-Co. The numbers on the right indicate the nucleotide positions in NIH-CQV and NIH-CQV-Co.

Figure 12 shows the genomic sequence of NIH-CQV-Co. Both the plus and minus strands are listed. The probable promoter sequences are identified by underlining the TATA- box sequences. The direct repeats in the large intergene region are shown in boxes. The translation start site for the Rep and CP proteins is in boldface and the arrows indicate the direction of the ORFs. The amino acid sequences encoded by the three major ORFs are listed, and the conserved p-loop NTPase motif and the PLA₂ motif are underline and labeled.

Figures 13A-13J include the nucleic acid and amino acid sequences of the proteins encoded by NIH-CQV-Co. Figures 13A and 13B include the nucleic acid and amino acid sequences of the VP1 protein from NIH-CQV-Co. Figures 13C and 13D include the nucleic acid and amino acid sequences of the VP2 protein from NIH-CQV-Co. Figures 13E and 13F include the nucleic acid and amino acid sequences of the VP3 protein from NIH-CQV-Co. Figures 13G and 13H include the nucleic acid and amino acid sequences of the NS protein from NIH-CQV-Co. Figures 131 and 13J include the nucleic acid and amino acid sequences of the 17 kDa protein from NIH-CQV-Co.

Figures 14A and 14B show that the results from the phylogenetic analysis of Rep and

CP of NIH-CQV. Figure 14A shows the phylogenetic relationship of the Rep of NIH-CQV and other related circo viruses based on an alignment of amino acid sequences. Figure 14B shows the phylogenetic relationship of the CP of NIH-CQV and other related parvoviruses based on an alignment of amino acid sequences. The phylogenetic trees were constructed by neighbor-joining (NEIGHBOR program from PHYLIP) based on the alignment generated with CLUSTAL V, and 1 ,000 bootstrap replications were performed. All sequences were downloaded from GenBank and SwissProt with a BioPerl script.

Figure 15 shows the whole-proteome tree of NIH-CQV and members of the families Parvoviridae and Circoviridae. A total of 18 circoviruses and 28 parvoviruses were included in the analysis. The tree was constructed by neighbor-joining based on all the protein sequences using dynamical language method for K = 4. The different viral genera are color- coded by tree leaves.

Figures 16A and 16B show the dynamic features of selective forces on the complete NIH-CQV rep and cp sequences. Figures 16A and 16B depict the distribution of Ka and Ks throughout the rep and cp genes, respectively. The y-axis is the averaged values of Ka or Ks within a sliding window of 100 amino acids. The overall value of Ka/Ks across the whole gene region is indicated. Genomic regions with significant high Ka over Ks (p < 0.05; Binomial test) are highlighted in gray. Figure 17 shows the detection of NIH-CQV viral DNA by real-time PCR. DNA was extracted from serum obtained from patients (n = 92) and healthy controls (n = 45). Two hundred fifty nanograms of DNA were used for the real-time PCR assay, and the NIH-CQV DNA copy numbers per micro litter of sample are shown. Bars show the average for each group. Figures 18A and 18B show the result from immunoblot analysis of seronegative hepatitis patient serum using recombinant capsid protein CP (rCP) of NIH-CQV. Figure 18A include blots showing the specificity of the recombinant capsid protein (rCP) of NIH-CQV. The cell lysates derived from the cells transfected with the plasmids that expressed capsid proteins of AAV2, HP4, HBoV and B 19V, and purified rCP were subjected to SDS-PAGE, and then transferred to a nitrocellulose membrane. After blocking with 5 % non-fat milk for lh, the membrane was incubated with respective antisera at 1 : 1,000 dilution. The numbers on the left indicate molecular masses in kilodaltons based on the broad-range prestained standards (Bio-Rad, Hercules, CA). Figure 18B include blots showing the detection of specific antibodies against the NIH-CQV capsid protein. Samples subjected to SDS-PAGE consisted of 25 ng of affinity-purified rVP2. These proteins were transferred to a nitrocellulose membrane and incubated with a 1 : 1,000 dilution of patient serum. The numbers at the top represent patient identification numbers and only representatives results are shown in the figure. The patient plasmas used in this study including 92 seronegative patient serum and a mouse monoclonal antibody against polyhistidine tag. The numbers on the left indicate molecular masses in kilodaltons based on the broad-range prestained standards (Bio-Rad, Hercules, CA). DETAILED DESCRIPTION OF THE INVENTION

The invention features methods for identifying infectious agents in a sample. The invention is based, at least in part, on the discovery that use of a 5'-NNNNNV-3' random hexamer (N is selected from A, C, G, and T; and V is selected from A, C, and G) (SEQ ID NO: 1) enhances amplification of a target nucleic acid. Using the random hexamer in high- throughput sequencing to analyze human specimens, the methods of the invention successfully identified a novel infectious virus in samples from seronegative hepatitis patients.

Thus, the invention also pertains to the discovery of a novel virus. Based on the analysis described in detail herein, the novel virus was determined to be hybrid of the

Parvoviridae and Circoviridae families. The invention therefore features nucleic acids and polypeptides of the novel virus, expression systems for producing the novel virus, diagnostic and clinical reagents relating to the novel virus, immunogenic compositions comprising the novel virus and methods of using such compositions for the treatment or prevention of a viral infection.

Methods of Detecting an Infectious Agent

In general, the invention relates to the detection of an infectious agent (e.g., bacteria, viruses, fungi, parasites, protozoa, and the like) in a sample (e.g., a biological sample).

Target nucleic acid (e.g., ribonucleic acid from an infectious agent) is isolated, amplified in the presence of a 5'-NNNNNV-3' random hexamer (SEQ ID NO: 1), and detected (e.g., sequencing, immunoassay, spectroscopy, gel electrophoresis, and the like). Any method well-known in the art for isolating, amplifying, or detecting nucleic acid is suitable for use in the present invention.

Methods for isolating target nucleic acid (e.g., ribonucleic acid of an infectious agent) are well-known in the art and are described in many standard laboratory manuals, such as Davis et ah , Basic Methods in Molecular Biology (1986); Sambrook et ah , Molecular Cloning, A Laboratory Manual, Third Edition (2001); and Ausubel et ah, Current Protocols in Molecular Biology (2011), each of which is hereby incorporated by reference in its entirety. In aspects of the invention, an infectious agent is first isolated from a sample followed by extraction of the target nucleic acid (e.g., mRNA, genomic RNA, or total RNA of the infectious agent). In another aspect of the invention, the target nucleic acid is directly purified from a sample. Numerous kits suitable for use in the present invention are commercially available (e.g., MICROBExpress to purify bacterial mRNA, Ambion, Austin, TX; QIAamp^® Viral RNA Kit to purify viral RNA, Qiagen, Valencia, CA; innuSPEED Bacteria/Fungi RNA Kit, Analytik Jena, Jena, Germany; and the like).

In aspects of the invention, carrier RNA (e.g., synthetic poly A RNA) is used during the nucleic acid isolation step. Use of carrier RNA is believed to enhance binding of the target nucleic acid to a collection apparatus (e.g., filter column).

"Amplification" refers to increasing the copy number of a specific sequence of nucleic acid in a sample. Methods for amplifying nucleic acids are well known in the art, and are described in many standard laboratory manuals, such as Davis et al, Basic Methods in Molecular Biology (1986); Sambrook et al, Molecular Cloning, A Laboratory Manual, Third Edition (2001); and Ausubel et al, Current Protocols in Molecular Biology (2011), each of which is hereby incorporated by reference in its entirety. A commonly used amplification technique is polymerase chain reaction ("PCR"), a method described by Mullis and colleagues in U.S. Pat. Nos. 4,683,195; 4,683,202; and 4,800,159, each of which is incorporated herein by references in its entirety. This method uses "primer" sequences which are complementary to opposing regions on the nucleic acid sequence to be amplified. These primers are added to the nucleic acid target sample, along with a molar excess of nucleotide bases and a polymerase. Depending on whether the nucleic acid is a DNA or RNA molecule, one of ordinary skill in the art would select a DNA dependent DNA polymerase (e.g., Taq polymerase) or a RNA dependent DNA polymerase (e.g., reverse transcriptase such as murine leukemia virus reverse transcriptase), respectively. Primers bind to their target via base-specific binding interactions (e.g., adenine binds to thymine, cytosine to guanine). By repeatedly passing the reaction mixture through cycles of increasing and decreasing temperatures (to allow dissociation of the two nucleic acid strands and continued synthesis of complementary copies of the target strand by the polymerase), the copy number of a particular sequence of nucleic acid may be rapidly increased.

Other techniques for amplifying target nucleic acid sequences are also well-known in the art. For example, Walker et al. (U.S. Pat. No. 5,455,166 and EP 0 684 315) describes a method called Strand Displacement Amplification (SDA), which differs from PCR in that it operates at a single temperature and uses a polymerase/endonuclease combination of enzymes to generate single-stranded fragments of the target nucleic acid sequence, which then serve as templates for the production of complementary DNA (cDNA) strands. An alternative amplification procedure, termed Nucleic Acid Sequence-Based Amplification (NASBA) was disclosed by Davey et al. (U.S. Pat. No. 5,409,818 and EP 0 329 822).

Similar to SDA, NASBA employs an isothermal reaction, but is based on the use of RNA primers for amplification rather than DNA primers as in PCR or SDA. Another known amplification procedure includes Promoter Ligation Activated Transcriptase (LAT) described by Berninger et al. (U.S. Pat. No. 5,194,370).

In aspects of the invention, a 5'-NNNNNV-3' random hexamer (N is selected from A, C, G, and T; and V is selected from A, C, and G) (SEQ ID NO: 1) is used during the amplification step. It has been discovered that use of the 5'-NNNNNV-3' random hexamer (SEQ ID NO: 1) increases the sensitivity of the detection step. Not wishing to be bound by any theories, use of the 5'-NNNNNV-3' random hexamer (SEQ ID NO: 1) during nucleic acid amplification reduces the background resulting from contaminating agents (e.g., carrier RNA). Due to this increased sensitivity, the methods of the present invention are capable of detecting nucleic acids that are not identified using standard methodologies. The 5'- NNNNNV-3' random hexamer (SEQ ID NO: 1) can be prepared using any method well- known in the art, including synthetic methods such as chemical or enzymatic synthesis.

Methods for detecting and/or quantitating nucleic acids are well-known in the art. Such methods include, but are not limited to, immunoassay, spectroscopy, gel

electrophoresis, PCR (e.g., quantitative PCR), sequencing, and the like.

Among the many types of suitable immunoassays are competitive and noncompetitive assay systems using techniques such as BIAcore analysis, FACS analysis, immunofluorescence, Western blots (immunoblots), radioimmunoassays, ELISA, "sandwich" immunoassays, immunoprecipitation assays, precipitation reactions, gel diffusion

precipitation reactions, immunoradiometric assays, fluorescent immunoassays, and the like. Assays used in a method of the invention can be based on colorimetric readouts, fluorescent readouts, mass spectrometry, visual inspection, etc. Assays can be carried out, e.g., with suspension beads, or with arrays, in which antibodies or nucleic acid samples are attached to a surface such as a glass slide or a chip.

Suitable spectroscopic methods include, but are not limited to, UV spectroscopy, fluorescent spectroscopy, NMR spectroscopy, Raman spectroscopy, and the like.

Suitable electrophoresis methods include, but are not limited to, agarose gel electrophoresis, polyacrylamide gel electrophoresis, affinity electrophoresis, capillary electrophoresis, alkaline gel electrophoresis, pulsed field electrophoresis, electrofocusing, native gel electrophoresis, northern blotting, southern blotting, and the like.

Suitable PCR methods for use in detecting nucleic acids are well-known in the art and include, but are not limited to, quantitative PCR and real time PCR. Sequencing methods for detecting nucleic acids are well-known in the art. In general, two techniques have been traditionally used to sequence nucleic acids. In the first method, termed "Maxam and Gilbert sequencing" after its co-developers (Maxam, A. M. and Gilbert, W., Proc. Natl. Acad. Sci. USA 74:560-564 (1977)), DNA is radiolabeled, divided into four samples and treated with chemicals that selectively destroy specific nucleotides bases in the DNA and cleave the molecule at the sites of damage. By separating the resultant fragments into discrete bands by gel electrophoresis and exposing the gel to X-ray film, the sequence of the original DNA molecule can be read from the film. This technique has been used to determine the sequences of certain complex DNA molecules, including the primate virus SV40 (Fiers et al., Nature 273: 113-120 (1978); Reddy et al., Science 200:494-502 (1978)) and the bacterial plasmid pBR322 (Sutcliffe, G., Cold Spring Harbor Symp. Quant. Biol. 43:444-448 (1975)).

An alternative technique for sequencing, named "Sanger sequencing" after its developer (Sanger, F., and Coulson, A. R., J. Mol. Biol. 94:444,448 (1975)), is more commonly employed. This method uses the DNA-synthesizing activity of DNA polymerases which, when combined with mixtures of reaction-terminating dideoxynucleoside

triphosphates (Sanger et al., Proc. Natl. Acad. Sci. USA 74:5463-5467 (1977)) and a short primer (either of which may be detectably labeled), gives rise to a series of newly synthesized DNA fragments specifically terminated at one of the four dideoxy bases. These fragments are then resolved by gel electrophoresis and the sequence determined as described for Maxam and Gilbert sequencing above. By carrying out four separate reactions (once with each ddNTP), the sequences of even fairly complex DNA molecules may rapidly be determined (Sanger et al., Nature 265:678695 (1977); Barnes, W., Meth. Enzymol. 152:538-556 (1987)). Sanger sequencing can use any DNA polymerase (e.g., E. coli polymerase, T7 DNA polymerase, MuLV reverse transcriptase, AMV reverse transcriptase, mutants thereof, and the like).

Other variations for sequencing nucleic acid molecules have also been described (see Murray, Nucl. Acids. Res. 17:8889 (1989); Craxton, Methods: A Comparison to Methods in Enzymology, 3:20-25, (1991); Metzer, M.L., Genome Res. 15: 1767-1776 (2005); and Shendure et al., Nat. Rev. Genet. 5:335-344 (2004(, each of which is hereby incorporated by reference in its entirety). Alternative techniques include, but are not limited to, sequencing- by-hybridization (SBH), nanopore sequencing, and cyclic reversible termination (CRT). Additional exemplary techniques include single nucleotide addition (SNA) and sequencing- by-synthesis (SBS). SNA, e.g., pyrosequencing, is a DNA polymerase-dependent sequencing method. SNA uses limiting amounts of individual natural nucleotides to cause DNA synthesis to pause, which can be resumed with the addition of natural nucleotides. SBS uses fluorescently labeled nucleotides. When a labeled nucleotide is incorporated into a DNA primer by a DNA polymerases, the fluorescent signal from the nucleotide is detected to identify the base of the nucleotide.

Nucleoside triphosphates (dNTPs) used for the SBS can be dual-modified reversible terminators (DRTs), which are modified dNTPs having a reversible blocking group on the 3'- OH moiety (3'-0-blocking group) and a fluorophore on the base. 4 bases (A, T, G, and C) can be labeled with different fluorophores emitting lights of different wavelengths. Once a dNTP is incorporated into a primer chain by a DNA polymerase, the other dNTPs cannot be incorporated into the chain because of the 3'-0-blocking group of the incorporated nucleotide. Once the fluorescence of the fluorophore, and hence the identity of the incorporated nucleotide, is determined, the fluorophore and the 3'-0-blocking group are removed. The next nucleotide can be incorporated, identified, and removed, resulting in sequencing of the target nucleic acid.

Any known sequencing methods or variations thereof are suitable for use in the present invention.

In aspects, the invention provides a random hexamer having the sequence 5'- NNNNNV-3' (N is selected from A, C, G, and T; and V is selected from A, C, and G) (SEQ ID NO:l). In embodiments, the invention provides compositions comprising the random hexamer.

In aspects, the invention provides methods for amplifying a target nucleic acid. In embodiments, the methods involve contacting a ribonucleic acid with a 5'-NNNNNV-3' random hexameric primer (SEQ ID NO: 1), or a composition thereof, thereby forming a mixture. In related embodiments, the methods involve incubating the mixture under conditions whereby a population of amplified DNA molecules that are complementary to all or a portion of the ribonucleic acid is synthesized, thereby amplifying a target nucleic acid.

In aspects, the invention provides methods for detecting a target nucleic acid in a sample. In embodiments, the methods involve obtaining a sample comprising a ribonucleic acid. In embodiments, the methods involve contacting the sample with a 5'-NNNNNV-3' random hexameric primer (SEQ ID NO: 1), or a composition thereof, thereby forming a mixture. In related embodiments, the methods involve incubating the mixture under conditions whereby a population of amplified DNA molecules that are complementary to all or a portion of the ribonucleic acid is synthesized, thereby amplifying a target nucleic acid. In further related embodiments, the methods involve detecting the amplified DNA molecules in the mixture.

In aspects, the invention provides methods for identifying an infectious agent in a sample. In embodiments, the methods involve isolating a ribonucleic acid from an infectious agent in a sample. In embodiments, the methods involve contacting the ribonucleic acid with a 5'-NNNNNV-3' random hexameric primer (SEQ ID NO: 1), or a composition thereof, thereby forming a mixture. In related embodiments, the methods involve incubating the mixture under conditions whereby a population of amplified DNA molecules that are complementary to all or a portion of the ribonucleic acid is synthesized. In further related embodiments, the methods involve detecting the amplified DNA molecules in the mixture, wherein detection of the amplified DNA molecules indicates the presence of the infectious agent in the sample.

In aspects, the invention provides methods for identifying an infectious agent in a subject. In embodiments, the methods involve obtaining a sample from a subject. In related embodiments, the methods involve isolating a ribonucleic acid from an infectious agent in the sample. In embodiments, the methods involve contacting the ribonucleic acid with a 5'- NNNNNV-3' random hexameric primer (SEQ ID NO: 1), or a composition thereof, thereby forming a mixture. In related embodiments, the methods involve incubating the mixture under conditions whereby a population of amplified DNA molecules that are complementary to all or a portion of the ribonucleic acid is synthesized. In further related embodiments, the methods involve detecting the amplified DNA molecules in the mixture, wherein detection of the amplified DNA molecules indicates the presence of the infectious agent in the subject.

In any of the above aspects, the sample is a biological sample. In embodiments, the biological sample is tissue, a tissue homogenate, a tissue slice, a cell, a biopsy sample, bodily fluid, blood, plasma, serum, urine, semen, saliva, or stool.

In any of the above aspects, the amplified DNA molecules are detected by nucleic acid sequencing, immunoassay, spectroscopy, or gel electrophoresis. In embodiments, the nucleic acid sequencing is Sanger sequencing, single nucleotide addition, or sequencing by synthesis. In embodiments, the nucleic acid sequencing is sequencing by synthesis.

In any of the above aspects, the subject is a mammal. In embodiments, the subject is human or a non-human mammal, such as a non-human primate, bovine, equine, canine, ovine, or feline. In embodiments, the subject is human.

In any of the above aspects, the subject is at risk of developing an infection or is suspected of having an infection. In any of the above aspects, the infectious agent is a virus, bacteria, fungus, or parasite.

In embodiments, the infectious agent is a virus. In embodiments, the virus is a parvovirus, papovirus, adenovirus, herpesvirus, poxvirus, reovirus, picornavirus, togavirus, rhabo virus, paramyxovirus, orthomyxovirus, retrovirus, or hepadna virus.

In any of the above aspects, the infectious agent is a virus, and the ribonucleic acid is viral ribonucleic acid.

In embodiments, the infectious agent is a bacteria. In embodiments, the bacteria is a Legionella pneumophila, Listeria monocytogenes, Campylobacter jejuni, Staphylococcus aureus, Escherichia coli, Borrelia burgdorferi, Helicobacter pylori, Ehrlichia chaffeensis, Clostridium difficile, Vibrio cholerae, Salmonella enterica, Bartonella henselae,

Streptococcus pyogenes, Chlamydia pneumoniae, Clostridium botulinum, Vibrio vulnificus, Parachlamydia, Corynebacterium amycolatum, Klebsiella pneumoniae, Acinetobacter baumannii, Enterococcus faecium, or Enterococcus faecalis.

In any of the above aspects, the infectious agent is a bacteria, and the ribonucleic acid is bacterial ribonucleic acid.

In any of the above aspects, the amplified DNA molecules are synthesized by reverse transcription.

Methods of Identifying Hepatitis Causing Infectious Agents

Hepatitis is one of the most important diseases transmitted from a donor to a recipient by transfusion of blood products, organ transplantation and hemodialysis; it also can be transmitted via ingestion of contaminated foodstuffs and water, and by person to person contact. Viral hepatitis is known to include a group of viral agents with distinctive viral genes and modes of replication, causing hepatitis with differing degrees of severity of hepatic damage through different routes of transmission. In some cases, acute viral hepatitis may be clinically apparent and are associated with hepatitis A virus (HAV), hepatitis B virus (HBV), hepatitis C virus (HCV), hepatitis delta virus (HDV), hepatitis E virus (HEV), Epstein-Barr virus (EBV), cytomegalovirus (CMV), adenovirus, coxsackie virus, human herpes virus type 6 (HHV6), human herpes virus type 7 (HHV7), human herpes virus type 1 (HHV1), human herpes virus type 2 (HHV2), and TT virus (TTV). In some cases, acute viral hepatitis is clinically diagnosed by well-defined patient symptoms including jaundice, hepatic tenderness and an elevated level of liver transaminases such as aspartate transaminase (AST), alanine transaminase (ALT) and isocitrate dehydrogenase (ISD); however, known etiological agents are not identified in these cases and these subjects are diagnosed as having seronegative hepatitis.

The present invention can be use used to identify an infectious agent in seronegative hepatitis patients. Accordingly, any of the methods described herein can be performed with a sample obtained form a subject having seronegative hepatitis.

In aspects, the invention provides methods for an infectious agent in a subject diagnosed with seronegative hepatitis. In embodiments, the methods involve obtaining a sample from the subject. In related embodiments, the methods involve isolating a ribonucleic acid from an infectious agent in the sample, wherein the ribonucleic acid is isolated in the presence of a carrier RNA. In embodiments, the methods involve contacting the ribonucleic acid with a 5'-NNNNNV-3' random hexameric primer (SEQ ID NO: 1), or a composition thereof, thereby forming a mixture. In related embodiments, the methods involve incubating the mixture under conditions whereby a population of amplified DNA molecules that are complementary to all or a portion of the ribonucleic acid is synthesized by reverse transcription. In further related embodiments, the methods involve detecting the amplified DNA molecules in the mixture, wherein detection of the amplified DNA molecules indicates the presence of the infectious agent in the subject. In embodiments, the methods involve sequencing the amplified DNA molecules to determine the identity of the infectious agent. In embodiments, the subject is human.

Polypeptides and Polynucleotides

The present invention relates to a novel virus identified in subjects having

seronegative hepatitis.

Viral hepatitis is caused primarily by hepatotropic viruses such as hepatitis A virus (HAV) (Cohen, J. I., Hepatol. 9:889-895 (1989)), hepatitis B virus (HBV) (Theilmann, L., K. et al, Hepatogastroenterology 35: 147-150 (1988)), hepatitis C virus (HCV) (Choo, Q. L. et al , Br. Med. Bull. 46:423-441 (1990)), hepatitis delta virus (HDV) (Rizzetto, M. et al , Gut 18:997-1003 (1977)) and hepatitis E virus (HEV) (Reyes, G. R. et al , Science 247: 1335-1339 (1990)), but they are not the only viral agents able to infect the liver. Other hepatitis associated viruses, including cytomegalovirus (CMV) (Lemonovich, T. L. et al , Curr. Infect. Dis. Rep. 14:33-40 (2012)); Epstein-Barr virus (EBV) (Crum, N. F., South. Med. J. 99:544- 547 (2006)); herpes simplex virus (HSV) (Riediger, C. et al , Clin. Transplant. 23:37-41 (2009)); varicella-zoster virus; human herpesvirus 6, 7, and 8 (Razonable, R. R. et αΙ. , Αηι. J. Transplant. 9:S100-S103 (2009)); human parvovirus B 19 (B 19V) (Young, N. S. et al, N. Engl. J. Med. 350:586-597 (2004)); and adenoviruses (Lynch, J. P. et al. , Semin. Respir. Crit Care Med. 32:494-511 (2011)) may cause hepatic injury that can range from mild and transient elevation of aminotransferases to acute hepatitis and occasionally acute liver failure. The clinical presentation may be indistinguishable from that associated with classic hepatotropic viruses. Despite these hepatitis viruses and hepatitis associated viruses, previous reports, especially from European and Asia, indicated that the etiology cannot be determined in up to 20% of acute hepatitis (Alter, H. J. et al., Semin. Liver Dis. 15: 110-120 (1995); and Alter, M. J. et al , N. Engl. J. Med. 327: 1899-1905 (1992)), 30% of cases of cryptogenic chronic liver diseases (Kodali, V. P. et al. , Am. J. Gastroenterol. 89: 1836-1839 (1994)), most instance of hepatitis-associated aplastic anemia (HAA) (Brown, K. E. et al., N. Engl. J. Med. 336: 1059-1064 (1997); and Hibbs, J. R. et al, J. Am. Med. Assoc. 267:2051- 2054 (1992)), and a large proportion of cases of acute liver failure (Ferraz, M. L. et al , Liver Transpl. Surg. 2:60-66 (1996)). The seronegative hepatitis or so called non-A-E hepatitis is poorly characterized but strongly associated with serious complications, especially aplastic anemia and fulminant hepatitis of childhood. Such evidence supports the existence of additional hepatitis agents and has driven the search towards the discovery of such agents.

Parvoviruses are small (18-26 nm) non-enveloped, icosahedral viruses. They have a linear single- stranded DNA genome with hairpin sequences at each end. The length of the DNA is between 4500 and 5500 nucleotides. The Parvoviridae family consists of two subfamilies, the densovirinae and the parovovirinae: the densovirinae are all viruses of insects, while the parovovirunae are viruses of vertebrates. The parovovirinae is further subdivided into five genera based on replication pattern, transcription map and sequence homology (Tijssen, P., M. et al , Family Parvoviridae, pp. 405-425. in King, A.M.Q. et al.

(eds.), Virus Taxonomy, Ninth Report of the International Committee on Taxonomy of Viruses (Elsevier Academic Press, San Diego, CA, 2011)). Most of the parvoviruses have a relatively simple genome with two large open reading frames (ORF) encoding two capsid proteins (VPl and VP2) and two regulatory non- structural proteins (NSl and NS2). Several members in parvovirinae have been shown to cause human infection, including human parvovirus B19 (B 19V) (Young, N. S. et al, N. Engl. J. Med. 350:586-597 (2004)), human bocavirus (HBoV) (Jartti, T., K. et al, Rev. Med. Virol. 22:46-64 (2012)) and human parvovirus 4 (Parv4) (Jones, M. S. et al , J. Virol. 79:8230-8236 (2005)). Some studies suggested that B19V might play a role in liver diseases, especially fulminant liver failure (Drago, F., M. et al. , Br. J. Dermatol. 141: 160-161 (1999); and Sokal, E. M. et al , Lancet 352: 1739-1741 (1998)).

The Circoviridae family consists of a group of diverse non-enveloped, icosahedral shaped viruses with diameters between 16 and 26 nm. They have single- stranded, close- circular genomes that are replicated via double-stranded intermediates. The length of the DNA is about 1700 to 2300 nucleotides. The Circoviridae is divided in two genera:

Gyrovirus and Circovirus (Biagini, P., M. et al. , Family Circoviridae, p. 343-349. in King, A.M.Q. et al. , (eds.), Virus Taxonomy, Ninth Report of the International Committee on Taxonomy of Viruses (Elsevier Academic Press, San Diego, CA 2011)). Members of the genus Circovirus have ambisense genomes and both virion and complementary strands code for viral proteins. The intergenic region contains the origin of replication with a stem loop structure that includes a nonanucleotide sequence flanked by palindromes, and is bordered by two ORFs. ORF1 is located on the positive strand and encodes the Rep, which is involved in replication initiation. ORF2 is located on the negative strand of replicating double- stranded genome and encodes the capsid protein, which comprises the capsid of the virus. Members of the genus gyrovirus, chicken anemia virus (Schat, K. A., Curr. Top. Microbiol. Immunol. 331 : 151-183 (2009)) and newly reported human gyrovirus (Sauvage, V., J. et al. , J. Virol. 85:7948-7950 (2011)) have negative- sense genomes. Only the complementary plus-strand codes for viral proteins, which contains three partially overlapping ORFs encoding three proteins, VP1, VP2 and VP3. It has been reported that coinfections of porcine circovirus 2 and porcine parvovirus have a synergistic effect enhancing the severity of post- warning multisystemic wasting syndrome in swine (Ellis, J.A. et al. , J. Vet. Diagn. Invest. 12:21-27 (2000); and Krakowka, S. et al. , Vet. Pathol. 37:254-263 (2000)). In addition, horizontal gene transfer is not uncommon among the small single- stranded DNA viruses, as well as with their eukaryotic hosts (Liu, H. et al. , BMC Evol. Biol. 11 :276 (2011).).

Next-generation sequencing (NGS) technology is having a growing impact on biological research and clinical diagnosis by providing rapid and high resolution access to genome-scale information. As described in detail herein, an experimental and analytic procedure has been established for identifying infectious agents in a variety of human specimens based on high-throughput sequencing. When the method was applied to screen for potential viral infection in human specimens, a novel human virus (a parvovirus-like virus) was discovered in patients with non A-E hepatitis. Analysis of genome organization and phylogeny revealed that the novel virus is evolutionally at the interface of parvovirus and circovirus. Serological and real-time PCR analysis demonstrates that this novel parvovirus was highly prevalent in cohorts of patients with non A-E hepatitis.

In aspects, the invention features the nucleic acid sequence of the novel virus. In embodiments, the invention provides a polynucleotide having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% sequence identity to the nucleotide sequence set forth in SEQ ID NO: 3, 4, 5, 6, 8, 10, 12, 14, 16, 18, 19, 20, 21, 23, 25, 27, 29, or 31. In related

embodiments, the polynucleotide is isolated. In related embodiments, the polynucleotide is substantially pure.

In embodiments, the present invention provides a polynucleotide encoding a polypeptide having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% sequence identity to the amino acid sequence set forth in SEQ ID NO: 9, 11, 13, 15, 17, 24, 26, 28, 30, or 32. In related embodiments, the polynucleotide is isolated. In related embodiments, the polynucleotide is substantially pure.

In aspects, the invention features the amino acid sequence of the novel virus. In embodiments, the present invention provides a polypeptide having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% sequence identity to the amino acid sequence set forth in SEQ ID NO: 9, 11, 13, 15, 17, 24, 26, 28, 30, or 32. In related embodiments, the polypeptide is isolated. In related embodiments, the polynucleotide is substantially pure.

In aspects, the invention features the nucleic acid sequence of the VP1 capsid protein for the novel virus. In embodiments, the invention provides a polynucleotide having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% sequence identity to the nucleotide sequence set forth in SEQ ID NO: 8 or 23. In related embodiments, the polynucleotide is isolated. In related embodiments, the polynucleotide is substantially pure.

In embodiments, the present invention provides a polynucleotide encoding a polypeptide having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% sequence identity to the amino acid sequence set forth in SEQ ID NO: 9 or 24. In related embodiments, the polynucleotide is isolated. In related embodiments, the polynucleotide is substantially pure.

In aspects, the invention features the amino acid sequence of the VP1 capsid protein for the novel virus. In embodiments, the present invention provides a polypeptide having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% sequence identity to the amino acid sequence set forth in SEQ ID NO: 9 or 24. In related embodiments, the polypeptide is isolated. In related embodiments, the polynucleotide is polypeptide pure.

In aspects, the invention features the nucleic acid sequence of the VP2 capsid protein for the novel virus. In embodiments, the invention provides a polynucleotide having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% sequence identity to the nucleotide sequence set forth in SEQ ID NO: 10 or 25. In related embodiments, the polynucleotide is isolated. In related embodiments, the polynucleotide is substantially pure.

In embodiments, the present invention provides a polynucleotide encoding a polypeptide having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% sequence identity to the amino acid sequence set forth in SEQ ID NO: 11 or 26. In related embodiments, the polynucleotide is isolated. In related embodiments, the polynucleotide is substantially pure.

In aspects, the invention features the amino acid sequence of the VP2 capsid protein for the novel virus. In embodiments, the present invention provides a polypeptide having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% sequence identity to the amino acid sequence set forth in SEQ ID NO: 11 or 26. In related embodiments, the polypeptide is isolated. In related embodiments, the polynucleotide is polypeptide pure.

In aspects, the invention features the nucleic acid sequence of the VP3 capsid protein for the novel virus. In embodiments, the invention provides a polynucleotide having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% sequence identity to the nucleotide sequence set forth in SEQ ID NO: 12 or 27. In related embodiments, the polynucleotide is isolated. In related embodiments, the polynucleotide is substantially pure.

In embodiments, the present invention provides a polynucleotide encoding a polypeptide having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% sequence identity to the amino acid sequence set forth in SEQ ID NO: 13 or 28. In related embodiments, the polynucleotide is isolated. In related embodiments, the polynucleotide is substantially pure.

In aspects, the invention features the amino acid sequence of the VP3 capsid protein for the novel virus. In embodiments, the present invention provides a polypeptide having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% sequence identity to the amino acid sequence set forth in SEQ ID NO: 13 or 28. In related embodiments, the polypeptide is isolated. In related embodiments, the polynucleotide is polypeptide pure.

In aspects, the invention features the nucleic acid sequence of the NS capsid protein for the novel virus. In embodiments, the invention provides a polynucleotide having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% sequence identity to the nucleotide sequence set forth in SEQ ID NO: 14 or 29. In related embodiments, the polynucleotide is isolated. In related embodiments, the polynucleotide is substantially pure.

In embodiments, the present invention provides a polynucleotide encoding a polypeptide having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% sequence identity to the amino acid sequence set forth in SEQ ID NO: 15 or 30. In related embodiments, the polynucleotide is isolated. In related embodiments, the polynucleotide is substantially pure.

In aspects, the invention features the amino acid sequence of the NS capsid protein for the novel virus. In embodiments, the present invention provides a polypeptide having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% sequence identity to the amino acid sequence set forth in SEQ ID NO: 15 or 30. In related embodiments, the polypeptide is isolated. In related embodiments, the polynucleotide is polypeptide pure.

In aspects, the invention features the nucleic acid sequence of the 15 kDa protein for the novel virus. In embodiments, the invention provides a polynucleotide having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% sequence identity to the nucleotide sequence set forth in SEQ ID NO: 16. In related embodiments, the polynucleotide is isolated. In related embodiments, the polynucleotide is substantially pure.

In embodiments, the present invention provides a polynucleotide encoding a polypeptide having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% sequence identity to the amino acid sequence set forth in SEQ ID NO: 17. In related embodiments, the polynucleotide is isolated. In related embodiments, the polynucleotide is substantially pure.

In aspects, the invention features the amino acid sequence of the 15 kDa protein for the novel virus. In embodiments, the present invention provides a polypeptide having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% sequence identity to the amino acid sequence set forth in SEQ ID NO: 17. In related embodiments, the polypeptide is isolated. In related embodiments, the polynucleotide is polypeptide pure.

In aspects, the invention features the nucleic acid sequence of the 17 kDa protein for the novel virus. In embodiments, the invention provides a polynucleotide having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% sequence identity to the nucleotide sequence set forth in SEQ ID NO: 31. In related embodiments, the polynucleotide is isolated. In related embodiments, the polynucleotide is substantially pure.

In embodiments, the present invention provides a polynucleotide encoding a polypeptide having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% sequence identity to the amino acid sequence set forth in SEQ ID NO: 32. In related embodiments, the polynucleotide is isolated. In related embodiments, the polynucleotide is substantially pure.

In aspects, the invention features the amino acid sequence of the 17 kDa protein for the novel virus. In embodiments, the present invention provides a polypeptide having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% sequence identity to the amino acid sequence set forth in SEQ ID NO: 32. In related embodiments, the polypeptide is isolated. In related embodiments, the polynucleotide is polypeptide pure.

The viral polypeptides described herein can be produced by any suitable method well- known in the art. Such methods range from direct protein synthetic methods to constructing a DNA sequence encoding isolated polypeptide sequences and expressing those sequences in a suitable transformed host. In embodiments, a DNA sequence is constructed using recombinant technology by isolating or synthesizing a DNA sequence encoding the polypeptide of interest.

In embodiments, a DNA sequence encoding a viral polypeptide is constructed by chemical synthesis using an oligonucleotide synthesizer. Such oligonucleotides can be designed based on the amino acid sequence of the desired polypeptide and selecting those codons that are favored in the host cell in which the recombinant polypeptide of interest will be produced. Standard methods can be applied to synthesize an isolated polynucleotide sequence encoding an isolated polypeptide of interest. For example, a complete amino acid sequence can be used to construct a back-translated gene. Further, a DNA oligomer containing a nucleotide sequence coding for the particular isolated polypeptide can be synthesized. For example, several small oligonucleotides coding for portions of the desired polypeptide can be synthesized and then ligated. The individual oligonucleotides typically contain 5' or 3' overhangs for complementary assembly.

In embodiments, the polynucleotides comprise the coding sequence for the polypeptide of interest fused in the same reading frame to nucleotides that aid, for example, in expression and secretion of the polypeptide from a host cell (e.g., a leader sequence that functions as a secretory sequence for controlling transport of a polypeptide from the cell). The resultant protein product has a leader sequence that can be cleaved by the host cell to yield the polypeptide of interest.

In embodiments, the polynucleotides comprise the coding sequence for the polypeptide of interest fused in the same reading frame to a marker sequence that allows for purification of the encoded polypeptide. Marker sequences useful for protein purification are known in the art. For example, in a bacterial host, the marker sequence can be a hexahistidine tag (SEQ ID NO: 34). In a mammalian host, the marker sequence can be a hemagglutinin (HA) tag derived from the influenza hemagglutinin protein.

In aspects of the invention, the viral polynucleotides are codon optimized for expression in a host cell. In embodiments, the viral polynucleotides are codon optimized for expression in a nonpermissive or semipermissive cell type (e.g., a nonerythroid lineage cell). Such codon optimized nucleic acid molecules need not be optimized in their entirety. For example, a codon optimized nucleic acid molecule may comprise at least about 50%- 100% (e.g., 50%, 75%, 85%) optimized codons. In embodiments, a nucleic acid molecule includes a sufficient number of optimized codons to permit expression of a viral capsid or other structural protein in a nonpermissive or semipermissive cell type (e.g., a nonerythroid lineage cell). Methods for codon optimizing viral polynucleotides are described in International Publication No. WO 2011/100330, which is hereby incorporated by reference in its entirety.

The nucleotides can be sequenced to ensure that the correct coding regions were cloned and do not contain any unwanted mutations. The nucleotides can be subcloned into an expression vector (e.g. pIRES) for expression in any cell.

As indicated above, a polynucleotide of the invention can be an isolated nucleic acid molecule. Such an isolated nucleic acid molecule can be manipulated by recombinant DNA techniques well-known in the art. Thus, a nucleotide sequence contained in a vector in which 5 ' and 3 ' restriction sites are known, or for which polymerase chain reaction (PCR) primer sequences have been disclosed, is considered isolated, but a nucleic acid sequence existing in its native state in its natural host is not. The vector may further comprise a CMV or B19 p6 promoter.

An isolated nucleic acid may be substantially purified, but need not be. For example, a nucleic acid that is isolated within a cloning or expression vector is not pure in that it may comprise only a tiny percentage of the material in the cell in which it resides. Such a nucleic acid is isolated, as the term is used herein, because it is readily manipulatable by standard techniques known to those of ordinary skill in the art.

Vectors and Host Cells

The present invention also relates to recombinant expression vectors that comprise the isolated nucleic acid molecules of the present invention, host cells that are genetically engineered with the recombinant vectors, and production of polypeptides of the present invention by recombinant techniques.

Recombinant expression vectors are replicable DNA constructs that have synthetic or cDNA-derived fragments encoding a polypeptide of the present invention, operatively linked to suitable transcriptional or translational regulatory elements derived from mammalian, microbial, viral or insect genes. A transcriptional unit generally comprises an assembly of (1) a genetic element or elements having a regulatory role in gene expression, for example, transcriptional promoters or enhancers, (2) a structural or coding sequence that is transcribed into mRNA and translated into protein, and (3) appropriate transcription and translation initiation and termination sequences. Such regulatory elements can include an operator sequence to control transcription. The ability to replicate in a host, usually conferred by an origin of replication, and a selection gene to facilitate recognition of transformants can additionally be incorporated. DNA regions are operatively linked when they are functionally related to each other. For example, DNA for a signal peptide (secretory leader) is operatively linked to DNA for a polypeptide if it is expressed as a precursor that participates in the secretion of the polypeptide; a promoter is operatively linked to a coding sequence if it controls the transcription of the sequence; or a ribosome binding site is operatively linked to a coding sequence if it is positioned so as to permit translation. Structural elements intended for use in yeast expression systems include a leader sequence enabling extracellular secretion of translated protein by a host cell. Alternatively, where recombinant protein is expressed without a leader or transport sequence, it can include an N-terminal methionine residue. This residue can optionally be subsequently cleaved from the expressed recombinant protein to provide a final product.

The choice of expression control sequence and expression vector will depend upon the choice of host. A wide variety of expression host/vector combinations are known in the art. For example, nonlimiting examples of useful expression vectors for eukaryotic hosts include vectors comprising expression control sequences from SV40, bovine papilloma virus, adenovirus, cytomegalovirus, or the B19 p6 promoter. Nonlimiting examples of useful expression vectors for bacterial hosts include known bacterial plasmids, such as pCR 1, pBR322, pMB9, and their derivatives, and wider host range plasmids, such as M13 and filamentous single-stranded DNA phages.

Suitable host cells for expression of the polypeptides described herein include prokaryotes, yeast, insect, or higher eukaryotic cells under the control of appropriate promoters. Prokaryotes include gram negative or gram positive organisms, for example E. coli or bacilli. Higher eukaryotic cells include established cell lines of mammalian origin as described below. Cell-free translation systems could also be employed. Appropriate cloning and expression vectors for use with bacterial, fungal, yeast, and mammalian cellular hosts are known in the art.

Various mammalian or insect cell culture systems are also advantageously employed to express recombinant protein. Expression of recombinant proteins in mammalian cells can be performed because such proteins are generally correctly folded, appropriately modified and completely functional. Nonlimiting examples of suitable mammalian host cell lines include the COS-7 lines of monkey kidney cells, L cells, C127, 3T3, Chinese hamster ovary (CHO), HeLa, and BHK cell lines. Mammalian expression vectors can comprise

nontranscribed elements such as an origin of replication, a suitable promoter and enhancer linked to the gene to be expressed, and other 5' or 3' flanking nontranscribed sequences, and 5' or 3' nontranslated sequences, such as necessary ribosome binding sites, a polyadenylation site, splice donor and acceptor sites, and transcriptional termination sequences. Baculovirus systems for production of heterologous proteins in insect cells are also known in the art.

Also suitable for use in the present invention are erythroid and non-erythroid progenitor cells. Materials and methods for expressing virus in these cells lines are described in detail in U.S. Pat. Nos. 5,508,186; 5,827,647; 5,916,563; 6,001,371 ; 6,132,732; 6,558,676; and International Publication No. WO 2011/100330, each of which is hereby incorporated by reference in its entirety.

The proteins produced by a transformed host can be purified according to any suitable method. Standard methods include chromatography {e.g., ion exchange, affinity, and sizing column chromatography), centrifugation, differential solubility, or by any other standard technique for protein purification. Affinity tags such as hexahistidine (SEQ ID NO: 34), maltose binding domain, influenza coat sequence, glutathione-S-transferase, and the like can be attached to the protein to allow easy purification by passage over an appropriate affinity column. Isolated proteins can also be physically characterized using such techniques as proteolysis, spectroscopy (e.g., nuclear magnetic resonance), x-ray crystallography, gel electrophoresis, and the like.

Viral VLP Production

The invention also provides constructs comprising a codon optimized nucleic acid molecule and methods for producing a VLP comprising viral polypeptides, or fragments thereof. In embodiments, the VLPs are produced in a nonpermissive or semipermissive cell type. In various embodiments, the codon optimized nucleic acid molecules are useful for in vitro or in vivo expression (i.e., expression in a human or canine subject having or at risk of developing a viral infection). For example, the use of a p6 promoter or portions thereof in an expression vector comprising a codon optimized nucleic acid molecule of the invention, can improve the efficiency of viral protein production in a cell. In another example, a 3' UTR is included in the expression vector. A variety of expression systems exist for the production of the polypeptides of the invention. Expression vectors useful for producing such polypeptides include, without limitation, chromosomal, episomal, and virus-derived vectors, e.g., vectors derived from bacterial plasmids, from bacteriophage, from transposons, from yeast episomes, from insertion elements, from yeast chromosomal elements, from viruses such as

baculoviruses, papova viruses, such as SV40, vaccinia viruses, adenoviruses, fowl pox viruses, pseudorabies viruses and retroviruses, and vectors derived from combinations thereof.

Constructs and/or vectors provided herein comprise codon optimized viral polynucleotides that encode structural polypeptides, or portions thereof as described herein. The vector may be, for example, a phage, plasmid, viral, or retroviral vector. The constructs and/or vectors that comprise the nucleotides should be operatively linked to an appropriate promoter, such as the CMV promoter, phage lambda PL promoter, the E. coli lac, phoA and tac promoters, the SV40 early and late promoters, and promoters of retroviral LTRs are non- limiting examples. In one embodiment, the promoter is a parvovirus B19 p6 promoter. The constructs and/or vectors that comprise the nucleotides may also be operatively linked to an inducible promoter. The inducible promoter can be selected from any inducible promoter that is known in the art, including a tetracycline inducible promoter, e.g., T-REX™

(Invitrogen, Carlsbad, CA). Other suitable promoters will be known to the skilled artisan depending on the host cell and/or the rate of expression desired. The expression constructs will further contain sites for transcription initiation, termination, and, in the transcribed region, a ribosome-binding site for translation. The coding portion of the transcripts expressed by the constructs may include a translation initiating codon at the beginning and a termination codon appropriately positioned at the end of the polypeptide to be translated. If desired, the vector further comprises a 3' UTR, such as a parvovirus B 19 3' UTR.

Expression vectors will typically include at least one selectable marker. Such markers include dihydrofolate reductase, G418 or neomycin resistance for eukaryotic cell culture and tetracycline, kanamycin or ampicillin resistance genes for culturing in E. coli and other bacteria. Exemplary vectors include virus vectors, such as baculovirus, poxvirus (e.g., vaccinia virus, avipox virus, canarypox virus, fowlpox virus, raccoonpox virus, swinepox virus, etc.), adenovirus (e.g., canine adenovirus), herpesvirus, and retrovirus. Other vectors that can be used with the invention comprise vectors for use in bacteria, which comprise pQE70, pQE60 and pQE-9, pBluescript vectors, Phagescript vectors, pNH8A, pNH16a, pNH18A, pNH46A, ptrc99a, pKK223-3, pKK233-3, pDR540, pRIT5. Exemplary eukaryotic vectors include, but are not limited to, pFastBacl pWINEO, pSV2CAT, pOG44, pXTl and pSG, pSVK3, pBPV, pMSG, and pSVL. In particular embodiments, the vector is a bicistronic vector (e.g., pIRES). Other suitable vectors will be readily apparent to the skilled artisan.

Recombinant constructs can be prepared and used to transfect, infect, or transform and can express viral proteins, including those described herein, into eukaryotic cells and/or prokaryotic cells. Thus, the invention provides for host cells which comprise a vector (or vectors) that contain nucleic acids which code for viral structural proteins in a host cell under conditions which allow the formation of VLPs.

The introduction of the recombinant constructs into the eukaryotic cells and/or prokaryotic cells can be a transient transfection, stable transfection, or can be a locus-specific insertion of the vector. Transient and stable transfection of the vectors into the host cell can be effected by any method known in the art, including, but not limited to, calcium phosphate transfection, DEAE-dextran mediated transfection, cationic lipid-mediated transfection, electroporation, transduction, and infection. Such methods are described in many standard laboratory manuals, such as Davis et al, Basic Methods in Molecular Biology (1986); Keown et al, 1990, Methods Enzymol. 185: 527-37; Sambrook et al, 2001, Molecular Cloning, A Laboratory Manual, Third Edition, Cold Spring Harbor Laboratory Press, N.Y., which are hereby incorporated by reference.

In another embodiment, the vector and/or host cell comprise nucleotides that encode viral proteins, or portions thereof as described herein. In another embodiment, the vector encodes a protein that consists essentially of the viral proteins VP1 and/or VP2, or portions thereof as described herein.

Once a recombinant polypeptide of the invention is expressed, it is isolated, e.g., using affinity chromatography. In one example, an antibody (e.g., produced as described herein) raised against a polypeptide of the invention may be attached to a column and used to isolate the recombinant polypeptide. Lysis and fractionation of polypeptide-harboring cells prior to affinity chromatography may be performed by standard methods.

Once isolated, the recombinant protein can, if desired, be further purified, e.g., by high performance liquid chromatography (see, e.g., Fisher, Laboratory Techniques In Biochemistry and Molecular Biology, eds., Work and Burdon, Elsevier, 1980, which is hereby incorporated by reference in its entirety). Polypeptides of the invention, particularly short peptide fragments, can also be produced by chemical synthesis (e.g., by the methods described in Solid Phase Peptide Synthesis, 2nd ed., 1984 The Pierce Chemical Co., Rockford, 111., which is hereby incorporated by reference in its entirety). These general techniques of polypeptide expression and purification can also be used to produce and isolate useful peptide fragments or analogs.

Methods to grow cells that produce VLPs of the invention include, but are not limited to, batch, batch-fed, continuous and perfusion cell culture techniques. In one embodiment, a cell comprising a codon optimized viral nucleic acid molecule is grown in a bioreactor or fermentation chamber where cells propagate and express protein (e.g., recombinant proteins) for purification and isolation. Typically, cell culture is performed under sterile, controlled temperature and atmospheric conditions. A bioreactor is a chamber used to culture cells in which environmental conditions such as temperature, atmosphere, agitation and/or pH can be monitored. In one embodiment, the bioreactor is a stainless steel chamber. In another embodiment, the bioreactor is a pre-sterilized plastic bag (e.g., Cellbag^™, Wave Biotech, Bridgewater, N.J.). In other embodiment, the pre-sterilized plastic bags are about 50 L to 1000 L bags.

The VLPs are isolated using methods that preserve the integrity thereof, such as by gradient centrifugation, e.g., cesium chloride, sucrose and iodixanol, as well as standard purification techniques including, e.g., ion exchange and gel filtration chromatography.

Viral Polypeptides and Analogs

The invention further includes analogs of any naturally-occurring polypeptide of the invention. Analogs can differ from the naturally-occurring the polypeptide of the invention by amino acid sequence differences, by post-translational modifications, or by both. Analogs of the invention will generally exhibit at least 80% 85%, 90%, 95%, or even 96%, 97%, 98%, or 99% identity with all or part of a naturally-occurring amino, acid sequence of the invention. The length of sequence comparison is at least 10, 13, 15 amino acid residues, at least 25 amino acid residues, or more than 35 amino acid residues.

Alterations of a viral polypeptide or polynucleotide include but are not limited to site- directed, random point mutagenesis, homologous recombination (DNA shuffling), mutagenesis using uracil containing templates, oligonucleotide-directed mutagenesis, phosphorothioate-modified DNA mutagenesis, mutagenesis using gapped duplex DNA or the like. Additional suitable methods include point mismatch repair, mutagenesis using repair- deficient host strains, restriction-selection and restriction-purification, deletion mutagenesis, mutagenesis by total gene synthesis, double-strand break repair, and the like. Mutagenesis is also included in the present invention. In one embodiment, mutagenesis can be guided by known information of the naturally occurring molecule or altered or mutated naturally occurring molecule, e.g., sequence, sequence comparisons, physical properties, crystal structure or the like.

In one embodiment, the invention provides polypeptide variants that differ from a reference polypeptide. The term "variant" refers to an amino acid sequence that is altered by one or more amino acids with respect to a reference sequence. The variant can have

"conservative" changes, wherein a substituted amino acid has similar structural or chemical properties, e.g., replacement of leucine with isoleucine. Alternatively, a variant can have "nonconservative" changes, e.g., replacement of a glycine with a tryptophan. Analogous minor variations can also include amino acid deletion or insertion, or both. The

polynucleotides encoding such variants comprises a codon optimized sequence. In embodiments, a viral nucleic acid molecule of the invention includes at least about 50%, 60%, 75%, 80%, 90%, 95% or even 100% optimized codons. Guidance in determining which amino acid residues can be substituted, inserted, or deleted without eliminating biological or immunological activity can be found using computer programs well known in the art, for example, DNASTAR software. Desirably, variants show substantial biological activity. In one embodiment, a protein variant forms a VLP and elicits an antibody response when administered to a subject.

Natural variants can occur due to mutations in the proteins. These mutations may lead to antigenic variability within individual groups of infectious agents, for example the novel virus. Thus, a person infected with a particular strain develops antibody against that virus, as newer virus strains appear, the antibodies against the older strains no longer recognize the newer virus and reinfection can occur. The invention encompasses all antigenic and genetic variability of proteins from infectious agents for making VLPs.

Again, in an exemplary approach to determining the degree of identity, a BLAST program may be used, with a probability score between e^"3 and e^"100 indicating a closely related sequence. Modifications include in vivo and in vitro chemical derivatization of polypeptides, e.g., acetylation, carboxylation, phosphorylation, or glycosylation; such modifications may occur during polypeptide synthesis or processing or following treatment with isolated modifying enzymes. Analogs can also differ from the naturally-occurring polypeptides of the invention by alterations in primary sequence. These include genetic variants, both natural and induced (for example, resulting from random mutagenesis by irradiation or exposure to ethanemethylsulfate or by site-specific mutagenesis as described in Sambrook, Fritsch and Maniatis, Molecular Cloning: A Laboratory Manual (2d ed.), CSH Press, 1989, or Ausubel et al., supra). Also included are cyclized peptides, molecules, and analogs which contain residues other than L-amino acids, e.g., D-amino acids or non- naturally occurring or synthetic amino acids, e.g., .beta, or gamma amino acids.

In addition to full-length polypeptides, the invention also includes fragments of any one of the polypeptides of the invention. As used herein, the term "a fragment" means at least 5, 10, 13, or 15. In other embodiments a fragment is at least 20 contiguous amino acids, at least 30 contiguous amino acids, or at least 50 contiguous amino acids, and in other embodiments at least 60 to 80 or more contiguous amino acids. Fragments of the invention can be generated by methods known to those skilled in the art or may result from normal protein processing (e.g., removal of amino acids from the nascent polypeptide that are not required for biological activity or removal of amino acids by alternative mRNA splicing or alternative protein processing events).

Non-protein analogs having a chemical structure designed to mimic viral VLPs or one or more viral polypeptides functional activity can be administered according to methods of the invention. Viral polypeptide analogs may exceed the physiological activity (e.g., immunogenicity) of native virus. Methods of analog design are well known in the art, and synthesis of analogs can be carried out according to such methods by modifying the chemical structures such that the resultant analogs exhibit the immunomodulatory activity of a native viral polypeptide. These chemical modifications include, but are not limited to, substituting alternative R groups and varying the degree of saturation at specific carbon atoms of the native viral molecule. In embodiments, the analogs are relatively resistant to in vivo degradation, resulting in a more prolonged therapeutic effect upon administration. Assays for measuring functional activity include, but are not limited to, those described in the Examples below. Viral Antibodies

The invention relates to antibodies that specifically bind to any of the viral polynucleotides and polypeptides described herein. The invention also features comprising these antibodies or fragments thereof.

The term "antibody" encompasses full-sized antibodies as well as antigen-binding fragments, variants, analogs, or derivatives of such antibodies, e.g., naturally occurring antibody or immunoglobulin molecules or engineered antibody molecules or fragments that bind antigen in a manner similar to antibody molecules.

An antibody comprises at least the variable domain of a heavy chain, and normally comprises at least the variable domains of a heavy chain and a light chain. Basic immunoglobulin structures in vertebrate systems are well understood. See, e.g., Harlow et al., Antibodies: A Laboratory Manual, (Cold Spring Harbor Laboratory Press, 2nd ed. 1988), which is hereby incorporated by reference in its entirety.

Antibodies or antigen-binding fragments, variants, or derivatives thereof of the invention include, but are not limited to, human, humanized, primatized, or chimeric antibodies, single chain antibodies, epitope -binding fragments, e.g., Fab, Fab' and F(ab')2, Fd, Fvs, single-chain Fvs (scFv), single-chain antibodies, disulfide-linked Fvs (sdFv), fragments comprising either a VL or VH domain, fragments produced by a Fab expression library, and anti-idiotypic (anti-Id) antibodies. ScFv molecules are known in the art and are described, e.g., in US patent 5,892,019. Immunoglobulin or antibody molecules of the invention can be of any type (e.g., IgG, IgE, IgM, IgD, IgA, and IgY), class (e.g., IgGl, IgG2, IgG3, IgG4, IgAl and IgA2) or subclass of immunoglobulin molecule.

Antigen-binding molecules, e.g., antibodies, or antigen-binding fragments, variants, or derivatives thereof may be described or specified in terms of the epitope(s) or portion(s) of an antigen, e.g., a target polypeptide that they recognize or specifically bind. The portion of a target polypeptide which specifically interacts with the antigen binding domain of an antibody is an "epitope," or an "antigenic determinant." A target polypeptide may comprise a single epitope, but typically comprises at least two epitopes, and can include any number of epitopes, depending on the size, conformation, and type of antigen. Furthermore, it should be noted that an "epitope" on a target polypeptide may be or include non-polypeptide elements, e.g., an epitope may include a carbohydrate side chain.

The antibodies can be polyclonal or monoclonal.

Polyclonal antibodies can be prepared by any known method. Polyclonal antibodies are raised by immunizing an animal (e.g. a rabbit, rat, mouse, donkey, and the like) by multiple subcutaneous or intraperitoneal injections of the relevant antigen (a purified peptide fragment, full-length recombinant protein, fusion protein, and the like) optionally conjugated to keyhole limpet hemocyanin (KLH), serum albumin, and the like, diluted in sterile saline and combined with an adjuvant (e.g., Complete or Incomplete Freund's Adjuvant) to form a stable emulsion. The polyclonal antibody is then recovered from blood, ascites and the like, of an animal so immunized. Collected blood is clotted, and the serum decanted, clarified by centrifugation, and assayed for antibody titer. The polyclonal antibodies can be purified from serum or ascites according to standard methods in the art including affinity chromatography, ion-exchange chromatography, gel electrophoresis, dialysis, and the like. Monoclonal antibodies can be prepared using hybridoma methods, such as those described by Kohler and Milstein (1975) Nature 256:495, which is hereby incorporated by reference in its entirety. Using the hybridoma method, a mouse, hamster, or other appropriate host animal, is immunized as described above to elicit the production by lymphocytes of antibodies that will specifically bind to an immunizing antigen. Lymphocytes can also be immunized in vitro. Following immunization, the lymphocytes are isolated and fused with a suitable myeloma cell line using, for example, polyethylene glycol, to form hybridoma cells that can then be selected away from unfused lymphocytes and myeloma cells. Hybridomas that produce monoclonal antibodies directed specifically against a chosen antigen as determined by immunoprecipitation, immunoblotting, or by an in vitro binding assay (e.g., radioimmunoassay (RIA) and enzyme-linked immunosorbent assay (ELISA)) can then be propagated either in vitro culture using standard methods (Goding, Monoclonal Antibodies: Principles and Practice, Academic Press, 1986, which is hereby incorporated by reference in its entirety) or in vivo as ascites tumors in an animal. The monoclonal antibodies can then be purified from the culture medium or ascites fluid as described for polyclonal antibodies above.

Alternatively monoclonal antibodies can also be made using recombinant DNA methods as described in U.S. Patent 4,816,567, which is hereby incorporated by reference in its entirety. The polynucleotides encoding a monoclonal antibody are isolated from mature B-cells or hybridoma cell, such as by RT-PCR using oligonucleotide primers that specifically amplify the genes encoding the heavy and light chains of the antibody, and their sequence is determined using conventional procedures. The isolated polynucleotides encoding the heavy and light chains are then cloned into suitable expression vectors, which when transfected into host cells such as E. coli cells, simian COS cells, Chinese hamster ovary (CHO) cells, or myeloma cells that do not otherwise produce immunoglobulin protein, monoclonal antibodies are generated by the host cells. Also, recombinant monoclonal antibodies or fragments thereof of the desired species can be isolated from phage display libraries expressing CDRs of the desired species as described (McCafferty et al., 1990, Nature, 348:552-554; Clackson et al., 1991, Nature, 352:624-628; and Marks et al., 1991, J. Mol. Biol., 222:581-597, each of which is hereby incorporated by reference in its entirety).

The polynucleotides encoding a monoclonal antibody can further be modified in a number of different manners using recombinant DNA technology to generate alternative antibodies. In some embodiments, the constant domains of the light and heavy chains of, for example, a mouse monoclonal antibody can be substituted 1) for those regions of, for example, a human antibody to generate a chimeric antibody or 2) for a non-immunoglobulin polypeptide to generate a fusion antibody. In some embodiments, the constant regions are truncated or removed to generate the desired antibody fragment of a monoclonal antibody. Site-directed or high-density mutagenesis of the variable region can be used to optimize specificity, affinity, and the like, of a monoclonal antibody.

Thus, in embodiments, the antibodies are humanized antibodies. In embodiments, the antibodies are chimeric antibodies.

Human antibodies can be directly prepared using various techniques known in the art. Immortalized human B lymphocytes immunized in vitro or isolated from an immunized individual that produce an antibody directed against a target antigen can be generated (See, e.g., Cole et al., Monoclonal Antibodies and Cancer Therapy, Alan R. Liss, p. 77 (1985); Boemer et al., 1991, J. Immunol., 147 (l):86-95; and U.S. Patent 5,750,373, each of which is hereby incorporated by reference in its entirety). Also, the human antibody can be selected from a phage library, where that phage library expresses human antibodies, as described, for example, in Vaughan et al., 1996, Nat. Biotech., 14:309-314, Sheets et al., 1998, Proc. Nat'l. Acad. Sci., 95:6157-6162, Hoogenboom and Winter, 1991, J. Mol. Biol., 227:381, and Marks et al., 1991, J. Mol. Biol., 222:581, each of which is hereby incorporated by reference in its entirety. Techniques for the generation and use of antibody phage libraries are also described in U.S. Patent Nos. 5,969,108, 6,172,197, 5,885,793, 6,521,404; 6,544,731 ; 6,555,313;

6,582,915; 6,593,081; 6,300,064; 6,653,068; 6,706,484; and 7,264,963; and Rothe et al., 2007, J. Mol. Bio., doi: 10.1016/j.jmb.2007.12.018, each of which is incorporated by reference in its entirety. Affinity maturation strategies, such as chain shuffling (Marks et al., 1992, Bio/Technology 10:779-783, incorporated by reference in its entirety), are known in the art and may be employed to generate high affinity human antibodies.

Humanized antibodies can also be made in transgenic mice containing human immunoglobulin loci that are capable upon immunization of producing the full repertoire of human antibodies in the absence of endogenous immunoglobulin production. This approach is described in U.S. Patents 5,545,807; 5,545,806; 5,569,825; 5,625,126; 5,633,425; and 5,661,016, each of which is hereby incorporated by reference in its entirety.

This invention also encompasses bispecific antibodies. Bispecific antibodies are antibodies that are capable of specifically recognizing and binding at least two different epitopes. The different epitopes can either be within the same molecule (e.g. the

polynucleotide or polypeptide) or on different molecules such that both. Bispecific antibodies can be intact antibodies or antibody fragments. According to the present invention, techniques can be adapted for the production of single-chain antibodies specific to one or more human frizzled receptors (see U.S. Pat. No. 4,946,778, which is hereby incorporated by reference in its entirety). In addition, methods can be adapted for the construction of Fab expression libraries (Huse, et al., Science

246: 1275-1281 (1989), which is hereby incorporated by reference in its entirety) to allow rapid and effective identification of monoclonal Fab fragments with the desired specificity, or derivatives, fragments, analogs or homologs thereof. Antibody fragments may be produced by techniques in the art including, but not limited to: (a) a F(ab')2 fragment produced by pepsin digestion of an antibody molecule; (b) a Fab fragment generated by reducing the disulfide bridges of an F(ab')2 fragment, (c) a Fab fragment generated by the treatment of the antibody molecule with papain and a reducing agent, and (d) Fv fragments.

It can further be desirable, especially in the case of antibody fragments, to modify an antibody in order to increase its serum half-life. This can be achieved, for example, by incorporation of a salvage receptor binding epitope into the antibody fragment by mutation of the appropriate region in the antibody fragment or by incorporating the epitope into a peptide tag that is then fused to the antibody fragment at either end or in the middle (e.g., by DNA or peptide synthesis).

Heteroconjugate antibodies are also within the scope of the present invention.

Heteroconjugate antibodies are composed of two covalently joined antibodies. Such antibodies have, for example, been proposed to target immune cells to unwanted cells (U.S. Pat. No. 4,676,980, which is hereby incorporated by reference in its entirety). It is contemplated that the antibodies can be prepared in vitro using known methods in synthetic protein chemistry, including those involving crosslinking agents. For example,

immunotoxins can be constructed using a disulfide exchange reaction or by forming a thioether bond. Examples of suitable reagents for this purpose include iminothiolate and methyl-4-mercaptobutyrimidate.

For the purposes of the present invention, it should be appreciated that modified antibodies can comprise any type of variable region that provides for the association of the antibody with the viral antigen. In this regard, the variable region may comprise or be derived from any type of mammal that can be induced to mount a humoral response and generate immunoglobulins against the desired tumor associated antigen. As such, the variable region of the modified antibodies can be, for example, of human, murine, non- human primate (e.g., cynomolgus monkeys, macaques, etc.) or lupine origin. In some embodiments both the variable and constant regions of the modified immunoglobulins are human. In other embodiments the variable regions of compatible antibodies (usually derived from a non-human source) can be engineered or specifically tailored to improve the binding properties or reduce the immunogenicity of the molecule. In this respect, variable regions useful in the present invention can be humanized or otherwise altered through the inclusion of imported amino acid sequences.

In certain embodiments, the variable domains in both the heavy and light chains are altered by at least partial replacement of one or more CDRs and, if necessary, by partial framework region replacement and sequence changing. Although the CDRs may be derived from an antibody of the same class or even subclass as the antibody from which the framework regions are derived, it is envisaged that the CDRs will be derived from an antibody of different class and from an antibody from a different species. It may not be necessary to replace all of the CDRs with the complete CDRs from the donor variable region to transfer the antigen binding capacity of one variable domain to another. Rather, it may only be necessary to transfer those residues that are necessary to maintain the activity of the antigen binding site. Given the explanations set forth in U.S. Pat. Nos. 5,585,089, 5,693,761 and 5,693,762, it will be well within the competence of those skilled in the art, either by carrying out routine experimentation or by trial and error testing to obtain a functional antibody with reduced immunogenicity.

Alterations to the variable region notwithstanding, those skilled in the art will appreciate that the modified antibodies of this invention will comprise antibodies (e.g., full- length antibodies or immunoreactive fragments thereof) in which at least a fraction of one or more of the constant region domains has been deleted or otherwise altered so as to provide desired biochemical characteristics such as increased tumor localization or reduced serum half-life when compared with an antibody of approximately the same immunogenicity comprising a native or unaltered constant region. In some embodiments, the constant region of the modified antibodies will comprise a human constant region. Modifications to the constant region compatible with this invention comprise additions, deletions or substitutions of one or more amino acids in one or more domains. That is, the modified antibodies disclosed herein may comprise alterations or modifications to one or more of the three heavy chain constant domains (CHI, CH2 or CH3) and/or to the light chain constant domain (CL). In some embodiments, modified constant regions wherein one or more domains are partially or entirely deleted are contemplated. In some embodiments, the modified antibodies will comprise domain deleted constructs or variants wherein the entire CH2 domain has been removed (ACH2 constructs). In some embodiments, the omitted constant region domain will be replaced by a short amino acid spacer (e.g. 10 residues) that provides some of the molecular flexibility typically imparted by the absent constant region.

Besides their configuration, it is known in the art that the constant region mediates several effector functions. For example, binding of the CI component of complement to antibodies activates the complement system. Activation of complement is important in the opsonisation and lysis of cell pathogens. The activation of complement also stimulates the inflammatory response and can also be involved in autoimmune hypersensitivity. Further, antibodies bind to cells via the Fc region, with a Fc receptor site on the antibody Fc region binding to a Fc receptor (FcR) on a cell. There are a number of Fc receptors which are specific for different classes of antibody, including IgG (gamma receptors), IgE (eta receptors), IgA (alpha receptors) and IgM (mu receptors). Binding of antibody to Fc receptors on cell surfaces triggers a number of important and diverse biological responses including engulfment and destruction of antibody-coated particles, clearance of immune complexes, lysis of antibody-coated target cells by killer cells (called antibody-dependent cell-mediated cytotoxicity, or ADCC), release of inflammatory mediators, placental transfer and control of immunoglobulin production.

In certain embodiments, the antibodies provide for altered effector functions that, in turn, affect the biological profile of the administered antibody. For example, the deletion or inactivation (through point mutations or other means) of a constant region domain may reduce Fc receptor binding of the circulating modified antibody thereby increasing tumor localization. In other cases it may be that constant region modifications, consistent with this invention, moderate complement binding and thus reduce the serum half life and nonspecific association of a conjugated cytotoxin. Yet other modifications of the constant region may be used to eliminate disulfide linkages or oligosaccharide moieties that allow for enhanced localization due to increased antigen specificity or antibody flexibility. Similarly, modifications to the constant region in accordance with this invention may easily be made using well known biochemical or molecular engineering techniques well within the purview of the skilled artisan.

In certain embodiments, the antibody does not have one or more effector functions. For instance, in some embodiments, the antibody has no antibody-dependent cellular cytoxicity (ADCC) activity and/or no complement-dependent cytoxicity (CDC) activity. In certain embodiments, the antibody does not bind to an Fc receptor and/or complement factors. In certain embodiments, the antibody has no effector function. It will be noted that in certain embodiments, the modified antibodies may be engineered to fuse the CH3 domain directly to the hinge region of the respective modified antibodies. In other constructs it may be desirable to provide a peptide spacer between the hinge region and the modified CH2 and/or CH3 domains. For example, compatible constructs could be expressed wherein the CH2 domain has been deleted and the remaining CH3 domain (modified or unmodified) is joined to the hinge region with a 5-20 amino acid spacer. Such a spacer may be added, for instance, to ensure that the regulatory elements of the constant domain remain free and accessible or that the hinge region remains flexible. However, it should be noted that amino acid spacers can, in some cases, prove to be immunogenic and elicit an unwanted immune response against the construct. Accordingly, in certain embodiments, any spacer added to the construct will be relatively non-immunogenic, or even omitted altogether, so as to maintain the desired biochemical qualities of the modified antibodies.

Besides the deletion of whole constant region domains, it will be appreciated that the antibodies of the present invention may be provided by the partial deletion or substitution of a few or even a single amino acid. For example, the mutation of a single amino acid in selected areas of the CH2 domain may be enough to substantially reduce Fc binding and thereby increase tumor localization. Similarly, it may be desirable to simply delete that part of one or more constant region domains that control the effector function (e.g., complement CLQ binding) to be modulated. Such partial deletions of the constant regions may improve selected characteristics of the antibody (serum half-life) while leaving other desirable functions associated with the subject constant region domain intact. Moreover, as alluded to above, the constant regions of the disclosed antibodies may be modified through the mutation or substitution of one or more amino acids that enhances the profile of the resulting construct. In this respect it may be possible to disrupt the activity provided by a conserved binding site (e.g., Fc binding) while substantially maintaining the configuration and immunogenic profile of the modified antibody. Certain embodiments can comprise the addition of one or more amino acids to the constant region to enhance desirable characteristics such as decreasing or increasing effector function or provide for more cytotoxin or carbohydrate attachment. In such embodiments it can be desirable to insert or replicate specific sequences derived from selected constant region domains.

The present invention further embraces variants and equivalents which are substantially homologous to the chimeric, humanized and human antibodies, or antibody fragments thereof, set forth herein. These can contain, for example, conservative substitution mutations, i.e., the substitution of one or more amino acids by similar amino acids. For example, conservative substitution refers to the substitution of an amino acid with another within the same general class such as, for example, one acidic amino acid with another acidic amino acid, one basic amino acid with another basic amino acid or one neutral amino acid by another neutral amino acid. What is intended by a conservative amino acid substitution is well known in the art.

The antibodies described herein can be used in any method described herein. In aspects of the invention, the antibodies are used as a diagnostic reagent to detect the presence of a viral polynucleotide or polypeptide. In aspects, the antibodies are administered to a subject as a composition (e.g., immunogenic composition) to elicit or modulate an immune response in the subject. In embodiments, the antibodies are administered to a subject to treat or prevent a viral infection.

Immunogenic Compositions

The invention provides compositions and methods for inducing an immunological response in a subject, e.g., a human. The compositions comprise one or more of the viral polynucleotides, polypeptides, VLPs, antibodies, or fragments thereof. In aspects of the invention, the compositions involve eliciting or modulating an immune response in a subject. In embodiments, an immune response protects the subject from a viral infection. In embodiments, an immune response treats the subject from a viral infection. The

administration of this immunological composition may be used either therapeutically in subjects already experiencing a viral infection, or may be used prophylactically to prevent a viral infection.

The preparation of immunogenic compositions (e.g., vaccines) is known to one skilled in the art. In embodiments, the immunogenic compositions include a viral polynucleotide, polypeptide, VLP, antibody, or fragment thereof (i.e., viral antigens). In embodiments, the invention provides an expression vector encoding one or more viral polypeptides or fragments thereof or variants thereof. Such an immunogenic composition is delivered in vivo in order to induce or enhance an immunological response in a subject, such as a humoral response.

In aspects, the immunogenic compositions are prepared in an injectable form, either as a liquid solution or as a suspension. Solid forms suitable for injection may also be prepared as emulsions, or with the polypeptides encapsulated in liposomes. Viral antigens can be combined with a pharmaceutically acceptable carrier, which includes any carrier that does not induce the production of antibodies harmful to the subject receiving the carrier. Suitable carriers typically comprise large macromolecules that are slowly metabolized, such as proteins, polysaccharides, polylactic acids, polyglycolic acids, polymeric amino acids, amino acid copolymers, lipid aggregates, and inactive virus particles. Such carriers are well known to those skilled in the art. These carriers may also function as adjuvants.

The viral antigens may be administered in combination with an adjuvant. Adjuvants are immunostimulating agents that enhance vaccine effectiveness. If desired, the viral antigens are administered in combination with an adjuvant that enhances the effectiveness of the immune response generated against the antigen of interest. Effective adjuvants include, but are not limited to, aluminum salts such as aluminum hydroxide and aluminum phosphate, muramyl peptides, bacterial cell wall components, saponin adjuvants, and other substances that act as immunostimulating agents to enhance the effectiveness of the composition.

Immunogenic compositions can also contain diluents, such as water, saline, glycerol, ethanol. Auxiliary substances may also be present, such as wetting or emulsifying agents, pH buffering substances, and the like. Proteins may be formulated into the vaccine as neutral or salt forms. The immunogenic compositions can be administered parenterally, by injection; such injection may be either subcutaneously or intramuscularly. Additional formulations are suitable for other forms of administration, such as by suppository or orally. Oral

compositions may be administered as a solution, suspension, tablet, pill, capsule, or sustained release formulation.

Immunogenic compositions are administered in a manner compatible with the dose formulation. The immunogenic composition comprises an immunologically effective amount of the viral antigen and other previously mentioned components. By an immunologically effective amount is meant a single dose, or a composition administered in a multiple dose schedule, that is effective for the treatment or prevention of an infection. The dose administered will vary, depending on the subject to be treated, the subject's health and physical condition, the capacity of the subject's immune system to produce antibodies, the degree of protection desired, and other relevant factors. Precise amounts of the active ingredient required will depend on the judgment of the practitioner, but typically range between 5μg to 250μg of antigen per dose.

The invention provides immunogenic compositions for use in treating or preventing a viral infection. In particular, the present invention provides methods of treating viral diseases and/or disorders or symptoms thereof which comprise administering a therapeutically effective amount of a viral antigen to a subject (e.g., a mammal such as a human). Thus, one embodiment is a method of treating a subject suffering from or susceptible to a viral infection, viral disease or disorder or symptom thereof. The method includes the step of administering to the mammal a therapeutic or prophylactic amount of an amount of a compound herein sufficient to treat the disease or disorder or symptom thereof, under conditions such that the disease or disorder is prevented or treated.

The methods herein include administering to the subject (including a subject identified as in need of such treatment) an effective amount of a compound described herein, or a composition described herein to produce such effect. Identifying a subject in need of such treatment can be in the judgment of a subject or a health care professional and can be subjective (e.g. opinion) or objective (e.g. measurable by a test or diagnostic method).

The therapeutic methods of the invention (which include prophylactic treatment) in general comprise administration of a therapeutically effective amount of the agents herein to a subject (e.g., animal, human) in need thereof, including a mammal, particularly a human. Such treatment will be suitably administered to subjects, particularly humans, suffering from, having, susceptible to, or at risk for a disease, disorder, or symptom thereof. Determination of those subjects "at risk" can be made by any objective or subjective determination by a diagnostic test or opinion of a subject or health care provider (e.g., genetic test, enzyme or protein marker, Marker (as defined herein), family history, and the like). The agents herein may be also used in the treatment of any other disorders in which a virus may be implicated.

In embodiments, the invention provides a method of monitoring treatment progress.

The method includes the step of determining a diagnostic measurement (e.g., screen, assay) in a subject suffering from or susceptible to a disorder or symptoms thereof associated with viral infection, in which the subject has been administered a therapeutic amount of a compound herein sufficient to treat the disease or symptoms thereof. The level determined in the method can be compared to known levels of the diagnostic marker in either healthy normal controls or in other afflicted patients to establish the subject's disease status.

Pharmaceutical Compositions and Administration

The invention features pharmaceutical compositions that comprise a viral antigen described herein. The pharmaceutical compositions useful herein contain a pharmaceutically acceptable carrier, including any suitable diluent or excipient, which includes any pharmaceutical agent that does not itself induce the production of an immune response harmful to the vertebrate receiving the composition, and which may be administered without undue toxicity in combination with a viral antigen. As used herein, the term "pharmaceutically acceptable" means being approved by a regulatory agency of the Federal or a state government or listed in the U.S. Pharmacopia, European Pharmacopia or other generally recognized pharmacopia for use in mammals, and more particularly in humans. These compositions can be useful as a vaccine and/or antigenic compositions for inducing a protective immune response in a vertebrate.

In particular embodiments, the invention encompasses an antigenic formulation comprising viral polynucleotides, polypeptides, VLPs, antibodies, or fragments thereof. In embodiments, the pharmaceutical composition comprises a viral antigen and a

pharmaceutically acceptable carrier. In embodiments, the pharmaceutical composition comprises a viral antigen, an adjuvant, and a pharmaceutically acceptable carrier.

Pharmaceutically acceptable carriers include but are not limited to saline, buffered saline, dextrose, water, glycerol, sterile isotonic aqueous buffer, and combinations thereof. A thorough discussion of pharmaceutically acceptable carriers, diluents, and other excipients is presented in Remington's Pharmaceutical Sciences (Mack Pub. Co. N.J. current edition), which is hereby incorporated by reference in its entirety. The formulation should suit the mode of administration. In embodiments, the formulation is suitable for administration to humans, preferably is sterile, non-particulate and/or non-pyrogenic.

The composition, if desired, can also contain minor amounts of wetting or emulsifying agents, or pH buffering agents. The composition can be a solid form, such as a lyophilized powder suitable for reconstitution, a liquid solution, suspension, emulsion, tablet, pill, capsule, sustained release formulation, or powder. Oral formulation can include standard carriers such as pharmaceutical grades of mannitol, lactose, starch, magnesium stearate, sodium saccharine, cellulose, magnesium carbonate, and the like.

In embodiments, the composition is supplied in liquid form, for example in a sealed container indicating the quantity and concentration of the composition. In related

embodiments, the liquid form of the viral antigen composition is supplied in a hermetically sealed container at least about 50 μg/ml, at least about 100 μg/ml, at least about 200 μg/ml, at least 500 μg/ml, or at least 1 mg/ml.

Generally, immunogenic compositions of the invention are administered in an effective amount or quantity sufficient to stimulate an immune response against one or more strains of a virus as described here, for example, the novel virus described herein. In embodiments, administration of the immunogenic composition elicits immunity against a virus. Typically, the dose can be adjusted within this range based on, e.g., age, physical condition, body weight, sex, diet, time of administration, and other clinical factors. The prophylactic vaccine formulation can be systemically administered, e.g., by subcutaneous or intramuscular injection using a needle and syringe, or a needle-less injection device.

Alternatively, the vaccine formulation is administered intranasally, either by drops, large particle aerosol (greater than about 10 microns), or spray into the upper respiratory tract or small particle aerosol (less than 10 microns) or spray into the lower respiratory tract.

Thus, the invention also comprises a method of formulating a vaccine or antigenic composition that induces immunity to an infection or at least one symptom thereof to a mammal, comprising adding to the formulation an effective dose of a viral antigen.

In certain cases, stimulation of immunity with a single dose is preferred, however additional dosages can be also be administered, by the same or different route, to achieve the desired effect. In neonates and infants, for example, multiple administrations may be required to elicit sufficient levels of immunity. Administration can continue at intervals throughout childhood, as necessary to maintain sufficient levels of protection against infections. Similarly, adults who are particularly susceptible to repeated or serious infections, such as, for example, health care workers, day care workers, family members of young children, the elderly, and individuals with compromised cardiopulmonary function or immune systems may require multiple immunizations to establish and/or maintain protective immune responses. Levels of induced immunity can be monitored, for example, by measuring amounts of neutralizing secretory and serum antibodies, and dosages adjusted or vaccinations repeated as necessary to elicit and maintain desired levels of protection.

Prime Boost

The present methods also include a variety of prime-boost regimens. In these methods, one or more priming immunizations is followed by one or more boosting immunizations. The actual immunogenic composition can be the same or different for each immunization and the route, and formulation of the immunogens can also be varied. For example, the prime-boost regimen can include administration of an immunogenic

composition comprising a VLP encoded by a polynucleotide of the invention alone or in combination with a codon optimized nucleic acid molecule of the invention. Vaccines and/or antigenic formulations of the invention may also be administered on a dosage schedule, for example, an initial administration of the vaccine composition with subsequent booster administrations. In particular embodiments, a second dose of the composition is administered anywhere from two weeks to one year, for example, from about 1, about 2, about 3, about 4, about 5 to about 6 months, after the initial administration. Additionally, a third dose may be administered after the second dose and from about three months to about two years, or even longer, for example, from about 4, about 5, or about 6 months, or about 7 months to about one year after the initial administration. The third dose may be optionally administered when no or low levels of specific immunoglobulins are detected in the serum and/or urine or mucosal secretions of the subject after the second dose.

The dosage of the pharmaceutical formulation can be determined readily by the skilled artisan, for example, by first identifying doses effective to elicit a prophylactic or therapeutic immune response, e.g., by measuring the serum titer of virus specific

immunoglobulins or by measuring the inhibitory ratio of antibodies in serum samples, or urine samples, or mucosal secretions. The dosages can be determined from animal studies. A non-limiting list of animals used to study the efficacy of vaccines include the guinea pig, hamster, ferrets, chinchilla, mouse and cotton rat, and non-human primates. Most animals are not natural hosts to infectious agents but can still serve in studies of various aspects of the disease. For example, any of the above animals can be dosed with a vaccine candidate, e.g. viral antigen of the invention, to partially characterize the immune response induced, and/or to determine if any neutralizing antibodies have been produced. In addition, human clinical studies can be performed to determine the preferred effective dose for humans by a skilled artisan. Such clinical studies are routine and well known in the art. The precise dose to be employed will also depend on the route of administration. Effective doses may be extrapolated from dose-response curves derived from in vitro or animal test systems.

The immunogenic compositions of the invention can also be formulated with

"immune stimulators." These are the body's own chemical messengers (cytokines) to increase the immune system' s response. Immune stimulators include, but not limited to, various cytokines, lymphokines and chemokines with immunostimulatory,

immunopotentiating, and pro-inflammatory activities, such as interleukins (e.g., IL-1, IL-2, IL-3, IL-4, IL-12, IL-13); growth factors (e.g., granulocyte-macrophage (GM)-colony stimulating factor (CSF)); and other immunostimulatory molecules, such as macrophage inflammatory factor and the like. The immunostimulatory molecules can be administered in the same formulation as the viral antigens, or can be administered separately. Either the protein or an expression vector encoding the protein can be administered to produce an immunostimulatory effect. Thus in one embodiment, the invention comprises antigenic and vaccine formulations comprising an adjuvant and/or an immune stimulator. Methods of Delivery

The viral polynucleotides, polypeptides, VLPs, antibodies, or fragments thereof described herein are useful for preparing compositions that stimulate an immune response. Such compositions are useful for the treatment or prevention or a viral infection (e.g., a viral infection). Both mucosal and cellular immunity may contribute to immunity to infectious agents and disease. In embodiments, the invention encompasses a method of inducing immunity to a viral infection, for example infection by the novel virus in a subject, by administering to the subject an antigen of the novel virus.

The invention also provides a method to induce immunity to viral infection or at least one symptom thereof in a subject, comprising administering at least one effective dose of a viral antigen. In embodiments, the methods comprise inducing immunity to a viral infection, e.g. infection by the novel virus or at least one symptom thereof by administering the formulation in multiple doses.

Viral antigens of the invention can induce substantial immunity in a vertebrate (e.g. a human) when administered to the vertebrate. The substantial immunity results from an immune response against a viral antigen and protects or ameliorates infection or at least reduces a symptom of infection in the vertebrate. In some instances, if the vertebrate is infected, the infection will be asymptomatic. The response may be not a fully protective response. In this case, if the vertebrate is infected with an infectious agent, the vertebrate will experience reduced symptoms or a shorter duration of symptoms compared to a non- immunized vertebrate.

In one embodiment, the invention comprises a method of inducing substantial immunity to viral infection or at least one symptom thereof in a subject, comprising administering at least one effective dose of a viral antigen of the invention. In particular embodiments, the infection is the novel virus and the viral antigen is a polynucleotide (e.g., codon optimized nucleic acid molecule) encoding a VLP that comprises one or more envelope protein from the novel virus as described herein. In another embodiment, the invention comprises a method of vaccinating a mammal against the novel virus comprising administering to the mammal a protection-inducing amount of a polynucleotide of the invention (e.g., codon optimized nucleic acid molecule) alone or in combination with a polypeptide of the invention (e.g., VLP comprising at least one viral protein).

As mentioned above, the viral antigens prevent or reduce at least one symptom of an infection in a subject. A reduction in a symptom may be determined subjectively or objectively, e.g., self assessment by a subject, by a clinician's assessment or by conducting an appropriate assay or measurement (e.g. body temperature), including, e.g., a quality of life assessment, a slowed progression of viral infection or additional symptoms, a reduced severity of viral symptoms or a suitable assays (e.g. antibody titer and/or T-cell activation assay). The objective assessment comprises both animal and human assessments.

KITS

The invention also provides for a pharmaceutical pack or kit comprising one or more containers filled with one or more of the ingredients of the viral polynucleotides,

polypeptides, VLPs, antibodies, or fragments thereof as described herein. In embodiments, the kit comprises two or more containers, one containing a viral polynucleotide, polypeptide, VLP, antibody, or fragment thereof as described herein and another containing an adjuvant. Associated with such container(s) can be a notice in the form prescribed by a governmental agency regulating the manufacture, use or sale of pharmaceuticals or biological products, which notice reflects approval by the agency of manufacture, use or sale for human administration.

The invention also provides that the viral polynucleotide, polypeptide, VLP, antibody, or fragment thereof as described herein and/or compositions thereof can be packaged in a hermetically sealed container such as an ampoule or sachet indicating the quantity of composition. In embodiments, the viral polynucleotide, polypeptide, VLP, antibody, or fragment thereof is supplied as a liquid, in another embodiment, as a dry sterilized lyophilized powder or water free concentrate in a hermetically sealed container and can be reconstituted, e.g., with water or saline to the appropriate concentration for administration to a subject.

The invention also features a kit comprising a viral polynucleotide, polypeptide, VLP, antibody, or fragment thereof and/or composition thereof and instructions for use in at least one of the methods delineated herein (e.g., methods of treatment, detection,

immunization/vaccination, and the like).

In aspects, the kit is used to perform one of the methods described herein.

The following examples are offered by way of illustration, not by way of limitation. While specific examples have been provided, the above description is illustrative and not restrictive. Any one or more of the features of the previously described embodiments can be combined in any manner with one or more features of any other embodiments in the present invention. Furthermore, many variations of the invention will become apparent to those skilled in the art upon review of the specification. The scope of the invention should, therefore, be determined not with reference to the above description, but instead should be determined with reference to the appended claims along with their full scope of equivalents.

The practice of the present invention employs, unless otherwise indicated, conventional techniques of molecular biology (including recombinant techniques), microbiology, cell biology, biochemistry and immunology, which are well within the purview of the skilled artisan. Such techniques are explained fully in the literature, such as,

"Molecular Cloning: A Laboratory Manual", second edition (Sambrook, 1989);

"Oligonucleotide Synthesis" (Gait, 1984); "Animal Cell Culture" (Freshney, 1987);

"Methods in Enzymology" "Handbook of Experimental Immunology" (Weir, 1996); "Gene Transfer Vectors for Mammalian Cells" (Miller and Calos, 1987); "Current Protocols in Molecular Biology" (Ausubel, 1987); "PCR: The Polymerase Chain Reaction", (Mullis, 1994); "Current Protocols in Immunology" (Coligan, 1991). These techniques are applicable to the production of the polynucleotides and polypeptides of the invention, and, as such, may be considered in making and practicing the invention. Particularly useful techniques for particular embodiments will be discussed in the sections that follow.

The following examples are put forth so as to provide those of ordinary skill in the art with a complete disclosure and description of how to make and use the assay, screening, and therapeutic methods of the invention, and are not intended to limit the scope of what the inventors regard as their invention.

EXAMPLES

Example 1: Use of non-poly A random hexamers enhances the sensitivity of DNA sequencing reactions

Carrier RNA (e.g., synthetic poly A RNA) added into samples for improving the recovery of viral nucleic acids at the step of purification dramatically increases the burden for subsequent sample analysis (e.g., sequence analysis). In order to overcome this problem, a non-poly A random hexamer, 5'-NNNNNV-3' (N is selected from A, C, G, and T; and V is selected from A, C, and G) (SEQ ID NO:l) was employed. As shown in Figures 3 and 4, use of the non-poly A random hexamer reduced the background for both cDNA synthesis and Solexa-PCR amplification as compared with regular random hexamers. In addition, the efficiency of cDNA synthesis with RNA and DNA viruses was similar for both random hexamers. At three different levels of viral input, there were no significant differences in the copy number of synthesized cDNA between non-poly A random hexamers and regular random hexamers (Figure 5). With non-poly A random hexamers, redundant sequence tags that were derived from carrier RNA (e.g., synthetic poly A) were reduced to a level of < 0.001%. Taking into consideration the capacity of the Solexa GIIX Genome Analyzer, the procedure will allow mutiplex sequencing of at least 70 individual simples per sequencing run.

Example 2: Detection of novel parvovirus in patients with non-A-E hepatitis

Ten pooled samples derived from 92 serum specimens from patients with non-A-E hepatitis (i.e., patients having seronegative hepatitis) were screened for potential viral infection by Solexa deep sequencing. After filter sterilization, the samples were digested with DNase and RNase to eliminate host nucleotide contamination. The remaining nucleic acids were extracted with carrier RNA (synthetic polyA). cDNA was then synthesized from the extracted viral nucleic acids with non-polyA random hexamers, which were designed for specific blocking of the reverse transcription of the carrier RNA. After double- stranded cDNA synthesis and fragmentation, multiplex adapters were ligated to each sample. With non-polyA random hexamers, redundant sequence tags derived from the carrier RNA were reduced to a level of < 0.001%. The high capacity of Solexa sequencing allowed multiplex sequencing of over 70 individual samples in a single sequencing run. In fact, by using serial dilutions of known DNA and RNA viruses "spiked" into the normal serum specimens, as few as -100 viral particles could be detected by the assay (data not shown). The short DNA sequences were filtered at the nucleotide level to eliminate potential DNA contamination from human, mouse, and known bacteria. With a focus on discovering novel virus, the short sequences were further filtered against known viruses at the nucleotide level and then were subjected to de novo assembly. The resultant contigs were searched against non-redundant (NR) protein databases by tBlastx. Specifically, the resultant contigs were compared with clusters contigs from different samples based on protein similarities, and contigs with the highest similarity score obtained from a kingdom of viruses were identified as candidate contigs. The contigs for each cluster were subjected to multiple alignments to define a consensus contig for later data analysis and experimental validation.

By applying this pipeline to ten-pooled samples, a 3780-bp contig that yielded tBLASTx E scores of 0.003 to 1.5 against parvoviruses was identified. Further analysis revealed that the 3780-bp contig contains three major ORFs (Figures 6 and 7). Protein Blast (Blastp) searches showed that ORF1 encodes a 45-kDa protein that contains a conserved phosphate-binding loop (P-loop) domain (GxxxxGK[T/S]) that is conserved among different DNA viruses (Table 1), and is homologous to the replication-associated protein (Rep) of Bat circo virus and the non- structural protein of Aleutian mink disease virus, with E values of 4e- 04 and 2.4, respectively.

Table 1. Sequence Alignment of P-loop in Rep of NIH-CQV with Representative DNA Viruses (SEQ ID NOS: 35-52, respectively, in order of appearance)

Viruses Protein A site B site

NIH-CQV Rep

PCV Rep ¾s¾:Psl§: ,s;,c

BCV Rep

B19V NS1

AAV Rep

AOV NS1

SV40

HPV E

HSV UL5

Consensus

ORF2 encodes a 55-kDa protein having homology to coat protein VP1 of porcine parvovirus and goose parvovirus with E scores of 7e-06. The putative CP protein encoded by ORF2 contains a phospholipase A2 (PLA₂)-like motif that is conserved among members of the Parvoviridae family (Table 2).

Table 2. Sequence Alignment of PLA2 Motif in CP of NIH-CQV with Some

Representative Parvoviruses (SEQ ID NOS 53-56, respectively, in order of appearance)

Consensus _{. .} __{. .} _ _Hn,

ORF3 is located in the left end of the genome. A 15-kDa protein with unknown function is encoded on the viral minus-strand.

The sequence analysis also revealed that the left and the right end of viral genome consist of identical inverted repeats (Figure 6). The inverted terminal repeat is 156 nt long: the first 75 nucleotides are complementary to nucleotides 82 to 156, thereby forming the stem of the hairpin. Nucleotides from 76 to 81 are mismatched and form a loop structure. It is worthy to note that there was no homology at all on the level of nucleic acid between the 3780-bp contig and known viruses in the database. The new virus is temporally designated as NIH-CQ virus (NIH-CQV) because it was isolated from the samples that were collected i the hospital at Chongqing, China and the work was done at the NIH.

The nucleic acid and amino acid sequences of the new virus are shown in Figures and 8, respectively.

Example 3: Characterization of novel human virus genome

To confirm the sequences of the de novo assembled 3780-bp contig, six pairs of primers (Table 3) were designed based on the sequence of 3780-bp contig and used to amplify overlapping DNA fragments from the patient samples.

Table 3. Primer Sequences

P300F

5' CGACACTCACGCTGGTATCC 3' (SEQ ID NO : 57)

P788R

5' GAGACGAGAACGTACTTGAA 3' (SEQ ID NO: 58) p650F

5' CACATTCGTTCCTTTCCACC

P1257

5 ' AGGATCTCCTTTGCTCTTGA

P1132F

5' TCATCGAGGAAGGCCGTGAA 3' (SEQ ID NO : 61)

pl698R

5' GGTTACCCGCCTTCTTGAGT 3' (SEQ ID NO: 62) pl595F

5' TCAACGTCGATTTTGGCAGG 3' (SEQ ID NO: 63)

p2254R

5' CCTCTTTTTGCCCGATATAT 3' (SEQ ID NO: 64) pl985F

5' GTGGATCAAGATGGAAAAGA 3' (SEQ ID NO: 65)

p2661R

5' CCAGCATAATAATCCCACCA 3' (SEQ ID NO : 66)

P2478F

5 ' ATGAAGGGGGCGCGTATAGT 3' (SEQ ID NO: 67)

P3577R

5 ' ACTGAGCTCACTTCATATAC 3' (SEQ ID NO : 68) After amplification and TA cloning, the PCR products were sequenced using universal primers of the vector. Six DNA fragments were amplified with the expected sizes (Figure 9). The sequences could be assembled into a large fragment (3277 bp) that completely matched with the 3780-bp contig, indicating the 3780-bp contig contains a nearly complete new virus genome. The results also confirm that the 3780-bp contig was present in the patient samples rather than artificially generated by miss-assembling. As another way to exclude the possibility of mis-assembly, it was observed that the NGS tag densities for ORFl and ORF2 are linearly correlated across different samples with a ratio approaching 1 : 1 (Figure 10).

Since ORFl of NIH-CQV encoding the putative Rep protein was homologous to circovirus Rep, it was hypothesized that the virus might have a circular genome. In order to test this hypothesis, inverse PCR was performed with a primer pair (Table 3) that oriented outwardly with respected to each other. Amplification with the inverted-primer pair (pl76R/p3541F) generated an amplicon that was 116 bp in length from multiple patient samples. Sequencing and alignment of the inverse PCR product showed the amplification of the junction region sequence between the 5' and 3' termini (head-to-tail orientation). In comparison with the liner genome of NIH-CQV, a 419-bp region containing both the 5' and 3' ITRs found in the linear virus genome was missed in the inverse PCR product (Figure 11), indicating a 3361 bp closed circular form of the virus genome was present in the patient samples (Figure 12). Interestingly, circularization of the viral genome resulted in an extension of the ORF3 at the left end of the genome, from 369 bp to 434 bp, encoding a 17 kDa protein (Figure 11). The circular form of NIH-CQV is designated as NIH-CQV-Co. Sequence analysis of the intergenic region between ORFl and ORF3 revealed multiple direct repeats and a TATA box (Figure 11). Commutating promoter prediction showed that consensus sequences of bidirectional eukaryote promoter are present in this region

(http://www.fruitfly.org/seq_tools/promoter.html), suggesting that the NIH-CQV has an ambisense genome. Taken together, on the base of genome size, ITRs, ORF structure, and homology to parvovirus and its human host, NIH-CQV was classified as a novel member of the Parvoviridae family.

Example 4: Phylogenetic and evolution analysis of NIH-CQV

Since ORFl and ORF2 of NIH-CQV revealed a homology to different viral families, phylogenetic analysis of the two ORFs were performed separately with members of the Circoviridae and Parvoviridae families, respectively. Although Blastp searches showed that the amino acid sequences encoded by ORFl is homologous to the Rep of Bat circovirus, gene tree analysis revealed that NIH-CQV was not closely related to any known cicoviruses (Figure 14A). In the case of ORF2, the amino acid similarity between NIH-CQV and other parvoviruses was below 20%. Because of low homology, only the first 87 amino acid residues encoded by ORF2 could be reliably aligned to the VP1 of Porcine parvovirus and Goose parvovirus. In this region, the amino acid identities are -31% between the putative CP of NIH-CQV and VP1 of Porcine parvovirus and Goose parvovirus. The analysis indicated that NIH-CQV was not closely related to any known parvoviruses and represent a deeply rooted lineage between two groups: (i) human and animal parvoviruses and (ii) parvoviruses identified in arthropods (Figure 14B). In order to further confirm the phylogenetic location of NIH-CQV, a whole-proteome phylogeny analysis of NIH-CQ virus with 16 circoviruses and 20 prototypes of parvoviruses was conducted using dynamic language model (Yu, Z.G. et ah , BMC Evol. Biol. 10: 192 (2010)). The analysis correctly divided the 36 selected viruses into two families: Parvoviridae and Circoviridae, and placed NIH-CQV at the interface of Parvoviridae and Circoviridae (Figure 15).

Homology and phylogenetic analysis revealed that NIH-CQV may be a "hybrid" because its Rep protein and CP proteins were homologous to circovirus and parvovirus, respectively. Moreover, single nucleotide polymorphism (SNP) analysis based on the high- throughput sequencing data showed that NIH-CQ virus exhibited a high mutation rate that can not be fully explained by sequencing errors (Figure 15).

Based on the above observations, it was hypothesized that NIH-CQV is actively undergoing an adaptive evolution. To test the hypothesis, the ratios of nonsynonymous versus synonymous substitution (Ka and Ks) were measured across all rep and cp (Figure 16). A higher level of Ks than Ka was observed across the cp gene, suggesting purifying selection acting on this particular gene. However, there were three regions in cp, ranging from 2378 to 2509^th nt, 2606 to 2746^th nt, and 2999 to 3091^th nt of the NIH-CQV genome, in which significant high levels of Ka over Ks (p<0.05) were observed, suggesting that positive selection is acting on specific regions in cp. In contrast, in the case of cp, Ka and Ks are on top of each other, suggesting a neutral selection.

Example 5: Prevalence of the NIH-CQ virus in clinical specimens

To investigate the prevalence of NIH-CQV in patients with non-A-E hepatitis (i.e., seronegative hepatitis), real-time PCR targeting the rep region of NIH-CQV were performed on serum samples from patients. Specifically, screening of 91 serum specimens from patients and 45 serum specimens from normal blood donors were conducted. 76 out of 91 (83.5%) patient sample were positive, but all of the 45 normal blood donors tested were negative. The average virus titer in the patient specimens was 1.28 E4 copies/ul, and the highest one was 3.2 E4 copies/ul (Figure 17). Standard curve was generated using a synthetic DNA fragment consisting of the rep region of NIH-CQV. The sensitivity of the assay for detection was <10 copies.

Example 6: Detection of specific antibody against NIH-CQ virus in seronegative hepatitis patients

In order to investigate immune response against NIH-CQV, the N-terminal part of the cp gene was cloned into an expression vector pET45b. Recombinant CP (rCP) was affinity- purified and was used for serological studies. Cross reactivity of NIH-CQV between other human parvoviruses, including B 19V, Parv4, HBoV, and AAV2, were tested by immunoblot analysis. As shown in Figure 18A, no cross reactivity was detected between the capsid protein of NIH-CQV and other major human parvoviruses. The immunoreactions of the rCP with a total of 92 human serum specimens were examined. Immunoblot analysis revealed that 82% (75/92) of the patients were tested positive for NIH-CQV IgG, and 34% (31/92) of them were positive for IgM, indicating an acute infection caused by NIH-CQV in the patients. In contrast, seventy-eight percent (35/45) of healthy controls were positive for IgG, and all negative for IgM, indicating that NIH-CQV infection is common in the population studied (Figure 18B; and Table 1).

Table 4. Summary of the results of real-time PCR and immunoblot analysis

Seronegative hepatitis patients Healthy controls m IgM

+ +

* 27% 41.3% 67% 0 0 0 0

0 (¾ 92)

(25/92) (38/925 (63/92) (0/45) (0/45) (0/45) (0/45)

4% 27% 16% 15% 0% 100% 79% 21 %

(4 92) (15/92) (1 *92) (0/45) {45/43} (35/45) {10/45}

31.5% 69% 85% 15% 0% 100% 79% 21%

Totai

(29/92) (63/92) (78/92) (1 /92) (0/45) {45/43} (33/45) {10/45}

The above-described results relate to novel methods for identifying infectious agents in a sample. Use of the random hexamers described herein enhances the sensitivity of DNA sequencing protocols and allows for the detection of nucleic acid materials that are not identified using conventional methods. Indeed, use of these methods resulted in the identification of a novel parvovirus-like virus (NIH-CQV) from a cohort of human patients with clinical symptoms of hepatitis. The virus was designated as NIH-CQV because it was identified in the lab at the National Institute of Health (NIH) and the patient specimens were collected at Chongqing, China. Phylogenic analysis showed that NIH-CQV is a novel parvovirus that is at the interface of parvovirus and circovirus. At the nucleotide level, the genome of NIH-CQV has no homology to any known virus in the database. Although, comparative analysis revealed that the Rep and CP proteins of NIH-CQV have limited homologies with circovirus and parvovirus, respectively, the overall genome organization of NIH-CQV demonstrates basic characteristics associated with viruses in the Parvoviridae family.

The NIH-CQV has a small, compacted linear DNA genome with tandemly arranged two major ORFs encoding Rep and CP proteins, respectively, and a pair of terminal inverted repeats at the left and right ends of the genome. Amino acid sequence analysis showed that the CP protein of NIH-CQV is homologous to porcine parvovirus coat protein VP1. The homologues region is mainly located in the N-termini of CP, contains a conserved PLA₂-like motif. The PLA₂-like motif has also been identified in the N-terminal extension of the VP1 unique region of members of the Parvoviridae family (Zadori, Z. et ah , Dev. Cell 1 :291-302 (2001)). Phylogenetic trees constructed using amino acid sequences of capsid proteins of NIH-CQV and VP1 of other representative viruses in the Parvoviridae family showed that NIH-CQV displays a deeply rooted linage between two groups: (i) human and animal parvoviruses and (ii) parvoviruses identified in arthropods. However, NIH-CQV indeed retained some features that were shared by the members of Cicoviridae family. First, blastp search revealed homology between the Rep proteins of NIH-CQV and bat circovirus.

Second, NIH-CQV appears to have an ambisense genome because i) there is a putative bidirectional promoter in the intergenic region between rep and 15-kDa protein; and ii) the rep and the 15-kDa protein are arranged head-to-head flank in the intergenic region, which is a feature of circoviruses. Although some parvoviruses, such as those in the densovirinae subfamily, also have ambisense genomes, the overall genome organizations are quite different (Tijssen, P., M. et ah, Family Parvoviridae, pp. 405-425. in King, A.M.Q. et al. (eds.), Virus Taxonomy, Ninth Report of the International Committee on Taxonomy of Viruses (Elsevier Academic Press, San Diego, CA, 2011)). In densovirus, the ORFs encoding Rep and CP proteins are tail-to-tail arranged on opposite strands, and expression of rep and cp are regulated by different promoters located at the left and right end of the genomes, respectively. Finally, sequencing and alignment of the inverse PCR products indicated the existence of a circular NIH-CQV genome in the human samples, in which the ITR regions at both the left and right ends of the viral genome were excised. The circularization of the viral genome resulted in an extension of the ORF encoding the 15-kDa protein to 17 kDa. Therefore, NIH- CQV appears to be a "hybrid" virus that may have formed through a recombination between a parvovirus and a circovirus. This notion is supported by the results of a whole-proteome phylogenetic analysis, which showed that NIH-CQV is at the interface of parvoviruses and circoviruses.

For many viruses, recombination allows the acquisition of multiple genetic changes in a single step and can combine genetic information to produce advantage genotype or remove deleterious mutations. This process is a critical drive force in viral evolution and leads to host switching, which often results in disease outbreaks. For example, recombination between viruses from different primate hosts have been associated with human HIV emergence (Keele, B. F. et al , Science 313:523-526 (2006)). SARS CoV appears to have arisen from a recombination of bat CoV and another virus before infecting human and carnivore hosts (Li, W. et al. , /. Virol. 80:4211-4219 (2006)). It has also been reported that recombination can occur between different types (RNA and DNA) of viruses that infect hosts from different kingdoms (plant and vertebrate) (Gibbs, M. J. et al. , Proc. Natl. Acad. Sci. U.S.A 96:8022-8027 (1999)). As described above, NIH-CQV likely arose from a recombination of an avian circovirus and a parvovirus that is close to porcine and/or goose parvoviruses. The viruses in the family of Circoviridae cause infection in a variety of species, including plants, vertebrates and mammals, but rarely reported for human infection. Although some parvoviruses, such as human parvovirus B19, human bocavirus, human parvovirus 4 and adenovirus associated virus, are able to infect humans, NIH-CQV exhibits no homology at these human parvoviruses. Thereby, the recombination event may have happened first in an animal before infecting humans. Similar to other emergent parvoviruses (Norja, P. et al , J. Virol. 82:6427-6433 (2008); and Shackelton, L. A. et al , Proc. Natl. Acad. Sci. U.S.A. 102:379-384 (2005)), NIH-CQV exhibits a high substitution mutation rate throughout the virus genome. Measurement of Ka/Ks across all cp and rep genes indicates that selective pressure on the genes of NIH-CQV is dominated by purifying selection since the Ka/Ks ratios for cp and rep were relatively low (0.56 and 0.91, respectively). However, the cp gene contained three regions in which the Ka/Ks ratio exceeded 1, indicating positive selection was acting on the cp gene. These results demonstrate that a high rate of adaptive evolution is associated with the NIH-CQV genome. Interestingly, the Ka/Ks ratios for the regions encoding the PLA₂ motif in the CP protein or the P-loop NTPase in the Rep protein are significantly lower in comparison with other regions, indicating a strong purifying selection and implying a functional importance of these motifs in viral replication.

Despite the technological advances in molecular biology, etiology cannot be determined in up to 20% of hepatitis cases. Moreover, no causative agent can be defined in a significant proportion of patients with chronic liver disease and cirrhosis (i.e., cryptogenic cases). Such evidence supports the existence of additional hepatitis agents. In past decades, several human viruses, such as GB virus C (GBV-C) (Linnen, J. et al, Science 271:505-508 (1996); and Simons, J. N. et al, Nat. Med. 1:564-569 (1995)), Torque Teno Virus (TTV) (Nishizawa, T. et al, Biochem. Biophys. Res. Commun. 241:92-97 (1997)) and SEN virus (SENV) (Tanaka, Y. et al, J. Infect. Dis. 183:359-367 (2001)),were originally identified as hepatitis viruses. However, subsequent investigations revealed no conclusive association between these viruses and human hepatitis. Therefore the etiology of non A-E hepatitis remains to be problematic.

As described herein, a novel next generation sequencing method was applied to discover a novel parvovirus-like virus in serum samples collected from a cohort of patients with hepatitis. NIH-CQV DNA was detected in the serum samples from 76 (83.5%) of 92 patients by virus-specific real-time PCR, while all 45 healthy controls were negative.

Immunoblot analysis revealed that 32% (29/92) of the patients were positive for IgM and 85% (78/92) of them were positive for IgG. In contrast, none of the healthy controls were positive for IgM, while 78% (35/45) were positive for IgG. These results indicate that the patients had NIH-CQV infections, and that infection is also common in the population studied. The patients having NIH-CQV infections suffered from symptoms of hepatitis with a wide range of liver dysfunction, including acute and chronic hepatitis. Despite a significant difference between healthy controls and patients, there was no difference between the patients with acute hepatitis and chronic hepatitis with respect to the detection of NIH-CQV DNA (p value) or IgM (p value). NIH-CQV appears to be highly prevalent in the cohort of hepatitis patients.

Accordingly, the invention features novel methods for identifying infectious agents in a sample, as well as nucleic acids and polypeptides of a novel parvovirus, expression systems for producing the novel parvovirus, diagnostic and clinical reagents for the novel parvovirus, immunogenic compositions comprising the novel parvovirus, and methods of using such compositions for the treatment or prevention of a parvovirus infection The results reported herein were obtained using the following methods and materials.

Study subjects.

A total of 92 samples from patients with non-A-E hepatitis, who were admitted to the Institute of Infectious Disease of Southwest Hospital, Third Military Medical University (TMMU), China, between 1999 and 2007, were studied. Twenty- seven patients were diagnosed as having acute hepatitis on a clinical and biochemical basis. Sixty-five patients had biopsy-proven chronic aggressive hepatitis, and ten of them had cirrhosis. Eght outpatients with chronic persistent hepatitis did not have liver biopsies performed. The patients had a median age of 43 y (interquartile range, 12-73 y,among of them, 55 male from 92 patients had a median age of 47 years (12, 73 y), 37 female from 92 patients had a median age of 40 y (15, 71y)). On admission, the mean liver function test values were as fellow: total bilirubin level were 133 + 146 μιηοΙ/L (range 14-735 μιηοΙ/L) and alanine

aminotransferase (ALT) level was 494 + 600IU/L (range 5-3150 IU/L). Serology for hepatitis A, B, C, serology for HIV, HIV viral load testing (RNA), hepatitis C RNA testing, serology for EBV IgM and CMV IgM were all negative. Additional tests for antinuclear antibody, rheumatoid factor, anti-mitochondrial antibody, as well as blood culture, urine culture and throat swab for bacteria were also negative. The research protocol was approved by the human bioethics committee of the Third Military Medical University, and all participants provided written informed consent.

Solexa high-throughput sequencing. The patient sera were clarified by centrifugation at 14,000 x g at 4°C for 2 min, and the supernatants were then passed through Ultrafree-MC HV 0.45 μιη sterile filter (Millipore, Billerica, MA). In order to remove host nucleic acid contamination, the 110 μΐ of clarified supernatant was digested with 14U Turbo DNase (Ambion, Austin, TX), 3U Baseline-Zero™ DNase (Epicentre, Madison, WI) and 75U

Benzonase Nuclease (Novagen, Rockland, MA) and 3μg RNase A (Roche), at 37°C for 1.5 hours. Viral nucleic acid was extracted using QIAamp MinElute Virus Kit (Qiagen,

Valencia, CA) following manufacturer's instructions. In order to enhance binding of viral nucleic acid to the QIAamp column membrane, carrier RNA (synthetic poly A RNA) was added to the supernatant at a final concentration of 10μg/ml. Reverse transcription was initiated with ΙΟμΙ extracted viral nucleic acid and 100 pmol non-poly A random hexamers, which was designed for specifically blocking the reverse transcription of poly A carrier RNA. After incubation at 72°C for 2 min, the viral RNA was reversed transcribed in a reaction mixture including 0.5-mM deoxynuceloside triphophate (dNTP), 10 U/μΕ M-MuLV Reverse Transcriptase (New England Biolabs, Beverly, MA, 3 mM MgC^), and 4 L 5 x Superscript first strand buffer (Invitrogen, Carlsbad, CA) at 42°C for 50 min. The synthesis of second- strand cDNA, as well as a complementary strand of viral DNA, were performed in a reaction mixture, including 24 iL of the first-strand cDNA mix, 0.5 mM dNTP, 15U RNase H, 5 U Klenow fragment (exo-) (New England Biolabs, Beverly, MA) at 37 °C for 90 min. After purification using QIAquick PCR purification kit (Qiagen, Valencia, CA), cDNA samples were sheared by using Covaris S2 sonicator (Covaris, Woburn, MA) and the fragmented cDNAs ranging from 200-500 bp were purified using QIAquick PCR purification kit (Qiagen, Valencia, CA). The sheared cDNAs were end blunted using End- It™ DNA End- Repair Kit (Epicentre, Madison, WI) following manufacture's instructions. A 3' end A- tailing was performed in a reaction mixture, including 40 μΐ end-blunt cDNA,10 nmol dATP and 12.5 U Taq DNA polymerase (Invitrogen, Carlsbad, CA) at 70 °C for 30 min. Following ligation of barcode adaptors to the repaired ends, the viral DNA was amplified using the adapter primers for 17 cycles and the fragments around 220 bp isolated from agarose gel. The purified DNA was used directly for cluster generation and sequencing analysis using Solexa GIIX Genome Analyzer following manufacturer protocols.

Data analysis. Virus discovery based on NGS: after removing sequences from amplification primer and highly repetitive sequences, the short sequence alignment tool Bowtie

(Langmead, B. et ah , Genome Biol. 10:R25 (2009)) was utilized to exclude sequences mapped to human, mouse and known bacteria to minimize contaminations from the host. To screen for novel virus, any sequences mapped to virus with whole genome sequences available from RefSeq were further excluded. The remaining sequences from each sample were then subjected to de novo assembling using SSAKE and the resultant contigs (>100 bps) were blasted against the NR database. A computational procedure was then implemented to cluster the contigs based on their similarities. Briefly, a contig from a cluster should show nucleotide level similarity to at least one member from the same cluster. Since the main purpose is for virus discovery, the results were narrowed down to clusters that 1) contain at least one member such that the top 1 protein level similarity hit is from virus and 2) contain no member that shows a high protein level similarity to proteins from kingdoms other than virus (identity >80%). Contigs from the same cluster were then subject to multiple alignments to define a consensus contigs. As a result, 31 clusters were identified, with the majority (26) exhibiting members that show similarities to proteins from TTV. In this project, the non-TTV cluster that contained the longest consensus contig (3780 bp) was selected for downstream data analysis and experimental validation and characterization.

Phylogenetic and evolution analysis. All sequences were downloaded from RefSeq. The clustalw and NJ modules from MEGA (Tamura, K. et al , Mol. Biol. Evol. 28:2731-2739 (2011)) were utilized to reconstruct and visualize the protein- similarity based phylogeny of NIH-CQ virus and other representative members in Parvoviridae and Circoviridae. Whole - proteome phylogenetic analysis was performed by a composition vector method described in (Yu, Z.G. et al , BMC Evol. Biol. 10: 192 (2010)) with default settings. The output matrix was supplied to the neighbor and drawtree modules from PHYLIP (Cladistics 5: 164-166 (1989)) to output a neighbor-joining phylogeny. To estimate Ka and Ks, an Expectation- Maximization based algorithm was implemented to infer phylogeny for a large amount of short reads. Briefly, it divides all short reads on a node into two daughter nodes in an iterative manner based on an evolutionary principle that the partition resembling the branching structure from the real tree would yield the most consistency in the subsets. After the tree is determined, sequences in internal nodes are estimated with the maximum- parsimony method (Systematic Zoology 20: 406-416 (1971)). Then, the numbers of synonymous (5s) and nonsynonymous (5A) substitutions on each branch and the number of synonymous (Ns) and nonsynonymous (NA) sites (weighted by branch lengths) were derived based on counting. Finally, Ka and Ks for a particular coding region (for example from amino acid position i toj) read "sum of (5¾)/ sum of (NsQ" and "sum of (5A*)/ sum of (ΝΜΪ', respectively, where k = i toj.

Overlapping PCR and reverse PCR. In order to verify the sequence of the viral genome assembled from the solexa data, six sets of overlapping primer pairs were designed (Table 3). The viral DNA was extracted from patient serum samples as described above for the Solexa high-throughput sequencing. Extracted DNA (5 μΕ) was used as template for the PCR. The 50-μ1 reaction mix consisted of lx GeneAmp PCR buffer II (Applied Biosystems, Foster City, CA), 2.5 mM MgCl₂, each dNTP at 0.2 mM, and 20 pmol each of the primers. After 2 min at 94°C, 35 cycles of amplification (94°C for 1 min, 54°C for 1 min, and 72°C for 1 min) were performed. To detect the circularized viral DNA, inverse PCR with a primer pair (Table 3) that oriented outwardly with respected to each other was used for amplification. The PCRs were performed as described above and amplified products were visualized on an agarose gel and all PCR products were sequenced. Diagnostic real-time PCR. The experiments were performed in a diagnostic laboratory setting, ensuring that necessary precautions to avoid contamination were taken. DNA was extracted by QIAamp DNA Blood Mini Kit (Qiagen, Valencia, CA). For real-time PCR, DNA was extracted using the QIAamp DNA Mini kit (Qiagen, Valencia, CA) and 5 μΐ of the resulting DNA was used for analysis. One set of NIH-CQV rep primers was used for realtime PCR: NIH-CQV-Rep-F (5 ' -CCACGAAACCACCTAACGTATG-3 ' (SEQ ID NO: 69)) and NIH-CQV-Rep-R (5 ' -CGGTTCTCC ACGTTCTTGTTG-3 ' (SEQ ID NO: 70)). The NIH-CQV-Rep-probe (5'-6-carboxyfluorescein-TGGAAACCCTGGATCCGGCAAGTC- blackhole quencher 1-3' (SEQ ID NO: 71)) was also used. All reactions were performed using the Chromo4 real-time detector (Bio-Rad, Hercules, CA). The reaction started with an activation of the polymerase at 95°C for 15 min, followed by 45 cycles of 15 sec at 94°C and 1 min at 60°C. Amplicon quantitation was performed by interpolation with the standard curve to the synthesized rep gene (ORF1) with serial dilutions.

Immunoblot analysis. In attempts to improve the viral capsid gene expression, the entire ORF of putative VP3 was codon optimized for better expression in E. coli and synthesized by Genscript (Piscataway, NJ). The full-length optimized VP3 was cloned into an expression vector pET45b (Novagen, Rockland, MA) between BamHl and Sail sites, and the recombinant plasmid was designated pETNIH-CQV-VP3. The purification and induction of the recombinant protein were performed by using the His -Bind buffer kit (Novagen,

Rockland, MA) in accordance with the manufacturer' s instruction. Rabbit anti-NIH-CQ virus rCP3 immune serum was produced using a standard 70-day prime-boost regimen. The p5TRPARV4 plasmid, which contained the PARV4 sequence flanked by AAV5 ITRs at two ends, SSV9 plasmid, which contained a full-length AAV2 genome, and pHBoVl plasmid, which contained incomplete HBoVl genomes (5299 nts), were previously described in Chen, A.Y. et ah , J. Virol. 403: 145-154 (2010). To prepare antigen for immunoblot analysis, these plasmids were transfected with respective helper plasmids and whole cell lysates were prepared using M-PRE Mammalian Protein Extraction Reagent (Pierce, Rockford, IL) supplemented with Complete Protease Inhibitor Cocktail (Roche). Human serum against Parv4 was previously described in Fryer, J.F. et ah , Emerg. Infect. Dis. 12: 151-154 (2006), and rabbit anti-AAV2 VPl is available from MyBioSource, San Diego, CA. For immunoblot analysis, the proteins were separated by 10% sodium dodecyl sulfate-polyacrylamide gel electrophoresis, and subsequently transferred to nitrocellulose membrane. The membrane was blocked by immersion in TBS buffer (150 mM NaCl, 50 mM Tris-HCl [pH 7.4]) containing 5% milk and 0.05% Tween 20 at room temperature for 2 h to saturate protein- binding sites. Antigens were detected by incubation of the membrane with specific antibodies (1: 1,000 dilution), followed by incubation with horseradish peroxidase-conjugated anti- human or anti-rabbit antibody (1:10,000 dilutions) (BD Biosciences Clontech, Palo Alto, CA). Bands were visualized with enhanced chemiluminescence by incubating the membrane with SuperSignal chemiluminescent reagent (Pierce, Rockford, IL) and exposing it to X-ray film. The densities of detected bands were analyzed with a Phosphorlmager (Molecular Dynamics, Sunnyvale, CA). Other Embodiments

From the foregoing description, it will be apparent that variations and modifications may be made to the invention described herein to adopt it to various usages and conditions. Such embodiments are also within the scope of the following claims.

The recitation of a listing of elements in any definition of a variable herein includes definitions of that variable as any single element or combination (or subcombination) of listed elements. The recitation of an embodiment herein includes that embodiment as any single embodiment or in combination with any other embodiments or portions thereof.

All patents and publications mentioned in this specification are herein incorporated by reference to the same extent as if each independent patent and publication was specifically and individually indicated to be incorporated by reference.

Claims

What is claimed is:

1. A nucleic acid molecule comprising:

a. a nucleic acid encoding NIH-CQV or fragment thereof;

b. a nucleic acid encoding NIH-CQV-Co or fragment thereof;

c. a nucleic acid encoding NIH-CQV VP1, NIH-CQV-Co VP1, or fragment thereof;

d. a nucleic acid encoding NIH-CQV VP2, NIH-CQV-Co VP2, or fragment thereof;

e. a nucleic acid encoding NIH-CQV VP3, NIH-CQV-Co VP3, or fragment thereof;

f. a nucleic acid encoding NIH-CQV NS, NIH-CQV-Co NS, or fragment

thereof;

g. a nucleic acid encoding an NIH-CQV 15 kDa protein or fragment thereof; h. a nucleic acid encoding an NIH-CQV-Co 17 kDa protein or fragment thereof; or

i. a nucleic acid encoding a polypeptide having at least 85%, 90%, 95%, or 99% sequence identity to the amino acid sequence set forth in SEQ ID NO: 9, 11, 13, 15, 17, 24, 26, 28, 30, or 32.

2. A nucleic acid molecule having at least 85%, 90%, 95%, or 99% sequence identity to the nucleotide sequence set forth in SEQ ID NO: 3, 4, 5, 6, 8, 10, 12, 14, 16, 18, 19, 20, 21, 23, 25, 27, 29, or 31.

3. A vector comprising the nucleic acid of claim 1 or 2.

4. The vector of claim 3, wherein the vector is an expression vector.

5. The vector of claim 4, wherein the vector further comprises a promoter capable of directing expression of a coding sequence in a cell.

6. The vector of claim 5, wherein the promoter is operably linked with the nucleic acid.

7. A host cell comprising the vector of any one of claims 4 to 6.

8. The host cell of claim 7, wherein the host cell is a bacterial, mammalian, insect, or yeast cell.

9. The host cell of claim 8, wherein the host cell is a human cell.

10. The host cell of any one of claims 7 to 9, wherein the host cell expresses a viral

polypeptide or fragment thereof at a level sufficient to modulate an immune response in a subject comprising the host cell.

11. A viral polypeptide or fragment thereof produced from the host cell of any one of claims 7 to 10.

12. A polypeptide comprising:

a. NIH-CQV or a fragment thereof;

b. NIH-CQV-Co or a fragment thereof;

c. NIH-CQV VP1, NIH-CQV-Co VP1, or a fragment thereof;

d. NIH-CQV VP2, NIH-CQV-Co VP2, or a fragment thereof;

e. NIH-CQV VP3 , NIH-CQV-Co VP3 , or a fragment thereof;

f. NIH-CQV NS, NIH-CQV-Co NS, or a fragment thereof;

g. an NIH-CQV 15 kDa protein or a fragment thereof;

h. an NIH-CQV-Co 17 kDa protein or a fragment thereof; or

i. a polypeptide having at least 85%, 90%, 95%, or 99% sequence identity to the amino acid sequence set forth in SEQ ID NO: 9, 11, 13, 15, 17, 24, 26, 28, 30, or 32.

13. A composition comprising: i) the nucleic acid molecule of claim 1 or 2; ii) the vector of any one of claims 3 to 6; iii) the host cell of any one of claims 7 to 10; or iv) the polypeptide of claim 11 or 12 or a fragment thereof.

14. An immunogenic composition comprising: i) the nucleic acid molecule of claim 1 or 2; ii) the vector of any one of claims 3 to 6; iii) the host cell of any one of claims 7 to 10; or iv) the polypeptide of claim 11 or 12 or a fragment thereof, wherein the immunogenic composition is capable of eliciting or modulating an immune response.

15. A nucleic acid molecule encoding a viral VP1 protein, wherein i) the nucleic acid has at least 85%, 90%, 95%, or 99% sequence identity to the nucleotide sequence set forth in SEQ ID NO: 8 or 23; or ii) the nucleic acid encodes a polypeptide having at least 85%, 90%, 95%, or 99% sequence identity to the amino acid sequence set forth in SEQ ID NO: 9 or 24.

16. The nucleic acid molecule of claim 15, wherein at least about 50-100% of the nucleic acid molecule's codons are optimized for expression in a nonpermissive or semipermissive mammalian cell.

17. A nucleic acid molecule encoding a viral VP2 protein, wherein i) the nucleic acid has at least 85%, 90%, 95%, or 99% sequence identity to the nucleotide sequence set forth in SEQ ID NO: 10 or 25; or ii) the nucleic acid encodes a polypeptide having at least 85%, 90%, 95%, or 99% sequence identity to the amino acid sequence set forth in SEQ ID NO: 11 or 26.

18. The nucleic acid molecule of claim 17, wherein at least about 50-100% of the nucleic acid molecule's codons are optimized for expression in a nonpermissive or semipermissive mammalian cell.

19. A nucleic acid molecule encoding a viral VP3 protein, wherein i) the nucleic acid has at least 85%, 90%, 95%, or 99% sequence identity to the nucleotide sequence set forth in SEQ ID NO: 12 or 27; or ii) the nucleic acid encodes a polypeptide having at least 85%, 90%, 95%, or 99% sequence identity to the amino acid sequence set forth in SEQ ID NO: 13 or 28.

20. The nucleic acid molecule of claim 19, wherein at least about 50-100% of the nucleic acid molecule's codons are optimized for expression in a nonpermissive or semipermissive mammalian cell.

21. A nucleic acid molecule encoding a viral NS protein, wherein i) the nucleic acid has at least 85%, 90%, 95%, or 99% sequence identity to the nucleotide sequence set forth in SEQ ID NO: 14 or 29; or ii) the nucleic acid encodes a polypeptide having at least 85%, 90%, 95%, or 99% sequence identity to the amino acid sequence set forth in SEQ ID NO: 15 or 30.

22. The nucleic acid molecule of claim 21, wherein at least about 50-100% of the nucleic acid molecule's codons are optimized for expression in a nonpermissive or semipermissive mammalian cell.

23. A nucleic acid molecule encoding an NIH-CQV 15 kDa protein, wherein i) the

nucleic acid has at least 85%, 90%, 95%, or 99% sequence identity to the nucleotide sequence set forth in SEQ ID NO: 16; or ii) the nucleic acid encodes a polypeptide having at least 85%, 90%, 95%, or 99% sequence identity to the amino acid sequence set forth in SEQ ID NO: 17.

24. The nucleic acid molecule of claim 23, wherein at least about 50-100% of the nucleic acid molecule's codons are optimized for expression in a nonpermissive or semipermissive mammalian cell.

25. A nucleic acid molecule encoding an NIH-CQV 17 kDa protein, wherein i) the

nucleic acid has at least 85%, 90%, 95%, or 99% sequence identity to the nucleotide sequence set forth in SEQ ID NO: 31; or ii) the nucleic acid encodes a polypeptide having at least 85%, 90%, 95%, or 99% sequence identity to the amino acid sequence set forth in SEQ ID NO: 32.

26. The nucleic acid molecule of claim 25, wherein at least about 50-100% of the nucleic acid molecule's codons are optimized for expression in a nonpermissive or semipermissive mammalian cell.

27. The nucleic acid molecule of any one of claims 16, 18, 20, 22, 24, or 26 wherein the nonpermissive or semipermissive mammalian cell is a non-erythroid progenitor cell.

28. The nucleic acid molecule of claim 27, wherein the nonpermissive or semipermissive mammalian cell is selected from the group consisting of 293T cells, COS cells, HeLa cells and UT7/Epo-Sl cells.

29. A vector comprising the nucleic acid of any one of claims 15 to 28.

30. The vector of claim 29, wherein the vector is an expression vector. 31. The vector of claim 30, wherein the vector further comprises a promoter capable of directing expression of a coding sequence in a cell.

32. The vector of claim 31, wherein the promoter is a viral promoter, a parvovirus promoter, a mammalian cell promoter, or an insect cell promoter.

33. The vector of claim 32, wherein the promoter is p6, CMV, or SV40.

34. The vector of any one of claims 29 to 33, wherein the promoter is operably linked with the nucleic acid.

35. A host cell comprising the vector of any one of claims 29 to 34.

36. The host cell of claim 35, wherein the host cell is a bacterial, mammalian, insect, or yeast cell.

37. The host cell of claim 36, wherein the host cell is nonpermissive or semipermissive for expression of a viral protein or is a nonerythroid lineage cell.

38. The host cell of claim 37, wherein the host cell is selected from the group consisting of 293T cells, COS cells, HeLa cells and UT7/Epo-Sl cells.

39. The host cell of any one of claims 35 to 38, wherein the host cell expresses a viral VP1 protein, VP2 protein, VP3 protein, NS protein, or a fragment thereof at a level sufficient to modulate an immune response in a subject comprising the host cell.

40. A viral VP1 protein, VP2 protein, VP3 protein, NS protein, 15 kDa protein, 17 kDa protein, or a fragment thereof produced from the host cell of any one of claims 35 to 39.

41. A polypeptide selected from the group consisting of:

a. NIH-CQV or a fragment thereof;

b. NIH-CQV-Co or a fragment thereof;

c. NIH-CQV VP1 , NIH-CQV-Co VP1 , or a fragment thereof;

d. NIH-CQV VP2, NIH-CQV-Co VP2, or a fragment thereof;

e. NIH-CQV VP3 , NIH-CQV-Co VP3 , or a fragment thereof;

f . NIH-CQV NS , NIH-CQV-Co NS , or a fragment thereof;

g. an NIH-CQV 15 kDa protein or a fragment thereof;

h. an NIH-CQV-Co 17 kDa protein or a fragment thereof;

i. a polypeptide having at least 85%, 90%, 95%, or 99% sequence identity to the amino acid sequence set forth in SEQ ID NO: 9 or 24;

j. a polypeptide having at least 85%, 90%, 95%, or 99% sequence identity to the amino acid set sequence forth in SEQ ID NO: 11 or 26;

k. a polypeptide having at least 85%, 90%, 95%, or 99% sequence identity to the amino acid set sequence forth in SEQ ID NO: 13 or 28;

1. a polypeptide having at least 85%, 90%, 95%, or 99% sequence identity to the amino acid set sequence forth in SEQ ID NO: 15 or 30;

m. a polypeptide having at least 85%, 90%, 95%, or 99% sequence identity to the amino acid sequence set forth in SEQ ID NO: 17; or

n. a polypeptide having at least 85%, 90%, 95%, or 99% sequence identity to the amino acid sequence set forth in SEQ ID NO: 32.

42. A composition comprising: i) the nucleic acid molecule of any one of claims 15 to 28; ii) the vector of any one of claims 29 to 34; iii) the host cell of any one of claims 35 to 39; or iv) the polypeptide of claim 40 or 41 or a fragment thereof.

43. An immunogenic composition comprising: i) the nucleic acid molecule of any one of claims 15 to 28; ii) the vector of any one of claims 29 to 34; iii) the host cell of any one of claims 35 to 39; or iv) the polypeptide of claim 40 or 41 or a fragment thereof., wherein the immunogenic composition is capable of eliciting or modulating an immune response.

A method of producing a virus like particle (VLP), wherein the method comprises the steps of: a) introducing into a host cell the nucleic acid molecule of claim 15 or 16, wherein the nucleic acid molecule encodes a viral VP1 protein; b) introducing into the host cell the nucleic acid molecule of claim 17 or 18, wherein the nucleic acid molecule encodes a viral VP2 protein; and c) culturing the cells under conditions such that the viral VP1 and VP2 proteins are produced and self assemble to form a viral capsid, thereby producing a VLP.

45. The method of claim 44, wherein the method further comprises isolating the VLP.

46. The method of claim 44 or 45, wherein the nucleic acid molecules in steps a) and b) are introduced into the host cell as recombinant nucleic acid molecules.

47. The method of any one of claims 44 to 46, wherein the host cell is an insect cell, and wherein steps a) and b) comprise infecting the insect cell with a recombinant baculovirus encoding the nucleic acid molecules.

48. The method of any one of claims 44 to 46, wherein the host cell is a nonpermissive, semipermissive, or non-erythroid mammalian cell.

49. A virus like particle (VLP) produced by the method of any one of claims 44 to 48.

50. A virus like particle (VLP) comprising: i) a viral VP1 protein having at least 85%, 90%, 95%, or 99% sequence identity to the amino acid sequence set forth in SEQ ID NO: 9 or 24; and ii) a viral VP2 protein having at least 85%, 90%, 95%, or 99% sequence identity to the amino acid sequence set forth in SEQ ID NO: 11 or 26.

51. A composition comprising the VLP of claim 49 or 50. 52. The composition of any one of claims 13, 14, 42, 43, or 51, wherein the composition further comprises an adjuvant.

53. A method of eliciting an immune response in a subject, wherein the method comprises administering the composition of any one of claims 13, 14, 42, 43, 51, or 52.

54. A method of modulating an immune response in a subject, wherein the method comprises administering the composition of claims 13, 14, 42, 43, 51, or 52.

55. The method of claim 53 or 54, wherein the method prevents or treats a viral infection.

56. A method for treating or preventing a viral infection in a subject, wherein the method comprises i) administering to the subject an effective amount of the composition of any of 13, 14, 42, 43, 51, or 52; and ii) generating an immune response in the subject, wherein the immune response prevents or treats a viral infection.

57. The method of any one of claims 53 to 56, wherein the subject is a mammal.

58. The method of claim 57, wherein the subject is a human.

59. The method of any one of claims 53 to 58, wherein the immune response comprises production of neutralizing antibodies.

60. The method of any one of claims 53 to 59, wherein the composition is administered as a prime boost regimen.

61. The method of any one of claims 53 to 60, wherein the composition further comprises a pharmaceutically acceptable excipient, carrier, or diluent.

62. A method for producing antibodies to a virus, wherein the method comprises the steps of:

a) immunizing an animal with i) the nucleic acid of any one of claims 1, 2, and 15-28; ii) the polypeptide or VLP of any one of 11, 12, 40, 41, 49, and 50; or iii) the composition of any one of claims 13, 14, 41, 42, 43, 51, and 52; and b) isolating the antibodies produced in the mammal.

63. An antibody produced by the method of claim 62.

64. An antibody that specifically binds to the i) nucleic acid of any one of claims 1, 2, and 15-28; or ii) the polypeptide or VLP of any one of 11, 12, 40, 41, 49, and 50.

65. A method for detecting a viral antibody in a sample, wherein the method comprises the steps of:

a) contacting the sample with the VLP of claim 49 or 50; and

b) detecting the formation of a complex between the viral antibody and the VLP.

66. A method for detecting a viral infection in a subject, wherein the method comprises the steps of:

a) obtaining a sample from a subject;

b) contacting the sample with the VLP of claim 49 or 50; and

c) detecting the formation of a complex between the viral antibody and the VLP, wherein detection of the complex indicates that the subject has a viral infection.

67. A method for detecting a viral infection in a subject, wherein the method comprises the steps of:

a) obtaining a sample from a subject;

b) contacting the sample with the antibody of claim 63 or 64; and

c) detecting the formation of a complex between the viral antibody and a viral polynucleotide or viral polypeptide, wherein detection of the complex indicates that the subject has a viral infection.

68. The method of any one of claims 65 or 67, wherein the complex is detected by

immunoassay, spectroscopy, or gel electrophoresis.

69. A method for detecting a viral infection in a subject, wherein the method comprises the steps of:

a) obtaining a sample from a subject; and

b) detecting the presence of the i) nucleic acid of any one of claims 1, 2, and 15- 28; or ii) the polypeptide of any one of claims 11, 12, 40, and 41, wherein detection of the nucleic acid or the polypeptide indicates that the subject has a viral infection.

70. The method of claim 69, wherein the nucleic acid or the polypeptide is detected by DNA sequencing, immunoassay, spectroscopy, or gel electrophoresis. 71. The method of claim 69, wherein the nucleic acid or the polypeptide is detected by the antibody of claim 63 or 64.

72. The method of any one of claims 65 to 71, wherein the VLP or antibody is labeled. 73. The method of claim 72, wherein the label is a fluorescent label, a moiety that binds another reporter ion, a magnetic particle, a heavy ion, a gold particle, or a quantum dot.

74. The method of any one of claims 65 to 73, wherein the sample is a biological sample.

75. The method of any one of claims 65 to 74, wherein the sample is tissue, a tissue

homogenate, a tissue slice, a cell, a biopsy sample, bodily fluid, blood, plasma, serum, urine, semen, saliva, or stool. 76. The method of any one of claims 65 to 75, wherein the subject is a mammal.

77. The method of claim 76, wherein the subject is a human.

78. The method of any one of claims 65 to 77, wherein the subject is at risk of developing a viral infection or is suspected of having a viral infection.

79. The method of any one of claims 65 to 78, wherein the subject has been diagnosed with seronegative hepatitis. 80. A random hexameric primer having the nucleic acid sequence set forth in SEQ ID NO:l (NNNNNV).

81. A composition comprising the random hexameric primer of claim 80. A method for amplifying a target nucleic acid, wherein the method comprises the steps of:

a) contacting a ribonucleic acid with the random hexameric primer of claim 80 or the composition of claim 81, thereby forming a mixture; and

b) incubating the mixture under conditions whereby a population of amplified DNA molecules that are complementary to all or a portion of the ribonucleic acid is synthesized, thereby amplifying a target nucleic acid.

A method for detecting a target nucleic acid in a sample, wherein the method comprises the steps of:

a) obtaining a sample comprising a ribonucleic acid;

b) contacting the sample with the random hexameric primer claim of 80 or the composition of claim 81, thereby forming a mixture;

c) incubating the mixture under conditions whereby a population of amplified DNA molecules that are complementary to all or a portion of the ribonucleic acid is synthesized, thereby amplifying a target nucleic acid; and

d) detecting the amplified DNA molecules in the mixture.

A method for identifying an infectious agent in a sample, wherein the method comprises the steps of:

a) isolating a ribonucleic acid from an infectious agent in a sample;

b) contacting the ribonucleic acid with the random hexameric primer of claim 80 or the composition of claim 81, thereby forming a mixture;

c) incubating the mixture under conditions whereby a population of amplified DNA molecules that are complementary to all or a portion of the ribonucleic acid is synthesized; and

d) detecting the amplified DNA molecules in the mixture, wherein detection of the amplified DNA molecules indicates the presence of the infectious agent in the sample.

A method for identifying an infectious agent in a subject, wherein the method comprises the steps of:

a) obtaining a sample from a subject;

b) isolating a ribonucleic acid from an infectious agent in the sample; b) contacting the ribonucleic acid with the random hexameric primer of claim 80 or the composition of claim 81, thereby forming a mixture;

detecting the amplified DNA molecules in the mixture, wherein detection of the amplified DNA molecules indicates the presence of the infectious agent in the subject.

The method of any one of claims 82 to 85, wherein the sample is a biological sample. The method of claim 86, wherein the biological sample is tissue, a tissue homogenate, a tissue slice, a cell, a biopsy sample, bodily fluid, blood, plasma, serum, urine, semen, saliva, or stool.

88. The method of any one of claims 82 to 87, wherein the amplified DNA molecules are detected by nucleic acid sequencing, immunoassay, spectroscopy, or gel

electrophoresis. 89. The method of claim 88, wherein the nucleic acid sequencing is Sanger sequencing, single nucleotide addition, or sequencing by synthesis.

90. The method of claim 88 or 89, wherein the nucleic acid sequencing is sequencing by synthesis.

The method of any one of claims 82 to 90, wherein the subject is a mammal.

92. The method of claim 91, wherein the subject is a human.

The method of claim 91 or 92, wherein the subject is at risk of developing an infection or is suspected of having an infection.

The method of any one of claims 91 to 93, wherein the subject has been diagnosed with seronegative hepatitis.

95. The method of any one of claims 84 to 94, wherein the infectious agent is a virus, bacteria, fungus, or parasite.

96. The method of claim 95, wherein the infectious agent is a virus.

97. The method of claim 96, wherein the ribonucleic acid is viral ribonucleic acid.

98. The method of claim 96 or 97, wherein the virus is a parvovirus, papovirus,

adenovirus, herpesvirus, poxvirus, reovirus, picornavirus, togavirus, rhabovirus, paramyxovirus, orthomyxovirus, retrovirus, circovirus, hepadnavirus, NIH-CQV, or NIH-CQV-Co.

99. The method of claim 95, wherein the infectious agent is a bacteria.

100. The method of claim 99, wherein the ribonucleic acid is bacterial ribonucleic acid.

101. The method of claim 99 or 100, wherein the bacteria is a Legionella pneumophila, Listeria monocytogenes, Campylobacter jejuni, Staphylococcus aureus, Escherichia coli, Borrelia burgdorferi, Helicobacter pylori, Ehrlichia chajfeensis, Coxiella burnetii, Clostridium difficile, Vibrio cholerae, Salmonella enterica, Bartonella henselae, Streptococcus pyogenes, Chlamydia pneumoniae, Clostridium botulinum, Vibrio vulnificus, Parachlamydia, Corynebacterium amycolatum, Klebsiella pneumoniae, Acinetobacter baumannii, Enterococcus faecium, or Enterococcus faecalis.

102. The method of any one of claims 82 to 101, wherein the ribonucleic acid is isolated in the presence of a carrier RNA.

103. The method of claim 102, wherein the carrier RNA is synthetic poly A RNA.

104. The method of any one of claims 82 to 103, wherein the amplified DNA molecules are synthesized by reverse transcription.

105. A method for identifying an infectious agent in a subject diagnosed with seronegative hepatitis, wherein the method comprises the steps of:

a) obtaining a sample from the subject;

b) isolating a ribonucleic acid from an infectious agent in the sample, wherein the ribonucleic acid is isolated in the presence of a carrier RNA;

c) contacting the ribonucleic acid with the random hexameric primer of claim 80 or the composition of claim 81, thereby forming a mixture;

d) incubating the mixture under conditions whereby a population of amplified DNA molecules that are complementary to all or a portion of the viral ribonucleic acid is synthesized by reverse transcription; and

e) detecting the amplified DNA molecules in the mixture, wherein detection of the amplified DNA molecules indicates the presence of the infectious agent in the subject.

106. The method of claim 105, wherein the method further comprises sequencing the

amplified DNA molecules to determine the identity of the infectious agent.

107. The method of claim 105 or 106, wherein the subject is human.

108. A kit comprising i) the nucleic acid of any one of claims 1, 2, and 15-28; ii) the vector of any one of claims 3-6 and 29-34; iii) the cell of any one of claims 7-10 and 35-39; iv) the polypeptide of any one of claims 11, 12, 40, and 41 ; v) the VLP of claim 49 or 50; vi) the antibody of claim 63 or 64; or vii) the composition of any one of claims 13, 14, 42, 43, 51, and 52.

109. The kit of claim 108, wherein the kit is used for in vitro or in vivo expression of a virus, a viral protein, or a fragment thereof.

110. The kit of claim 108, wherein the kit is used for the method of any one of claims 53- 62, 65-79, and 82-107.

111. The kit of claim 108, wherein the kit further comprises instructions for using the kit in the method of any one of claims 53-62, 65-79, and 82-107.