WO2012087135A1

WO2012087135A1 - Genetic markers specific for clostridium difficile ribotypes 027 (nap01/b1; rt 027) and 078 (nap7/8; rt 078) and their use

Info

Publication number: WO2012087135A1
Application number: PCT/NL2011/050882
Authority: WO
Inventors: Hans Christiaan VAN LEEUWEN; Jeroen CORVER; Cornelis Willem KNETSCH; Eduard KUIJPER
Original assignee: Academisch Ziekenhuis Leiden H.O.D.N. Lumc
Priority date: 2010-12-22
Filing date: 2011-12-21
Publication date: 2012-06-28

Abstract

The present invention relates to biomarkers unique to a Clostridium difficile hypervirulent ribotypes 027 and 078; a method for detecting, distinguishing, identifying and/or isolating and/or classifying a Clostridium difficile hypervirulent/toxigenic strain using such biomarkers in a sample or product. Primers, probes and kits for detecting Clostridium difficile (hyper) virulent strains, more in particular ribotypes 078 and 027 like (associated) strains are further provided by the invention.

Description

Title: Genetic markers specific for Clostridium difficile ribotypes 027 (NAP01/B1; RT 027) and 078 (NAP7/8; RT 078) and their use

FIELD OF THE INVENTION

The invention is in the field of molecular biology. In particular the invention relates to microbial diagnostics, in particular to the detection and/or

distinguishing and/or identification and/or isolation and/or classification and/or characterization of a Clostridium difficile type; more in particular a [hyper] virulent and/or toxigenic Clostridium difficile type, more in particular a ribotype (RT) 078 strain and/or ribotype (RT) 078- like (associated) strain and/or a Clostridium difficile ribotype (RT) 027 and or and/or ribotype (RT) 027- like (associated) strain using unique type/ribotype/strain specific

(bio)markers more specifically genetic and protein (bio) markers.

BACKGROUND OF THE INVENTION

Clostridium difficile is an anaerobic bacillus that resides in the gut and is rapidly emerging as a leading cause of antibiotic associated diarrheal disease in humans and animals. Antibiotic treatments that spare C. difficile, but suppress growth of the intestinal microbial flora, allow C. difficile to colonize the gut. Upon colonization C. difficile starts to produce toxins that cause intestinal damage, inflammation and clinical disease (Kelly et al., 1994).

Persistence of C. difficile in hospitals is caused by humans shedding highly resistant and infectious spores (Rupnik et al., 2009).

Virulence of C. difficile has been linked to the increased production of two large toxin molecules, TcdA and TcdB, which are encoded within a so called pathogenicity locus (Kuehne et al., 2010). Other virulence characteristics are the presence of a binary toxin, altered antimicrobial resistance patterns and increased sporulation capacity (McDonald et al., 2005). For review about (for a definition of (hyper) virulence) highly virulent strains of C. difficile see

Cookson; Merrigan et al., 2010 (incorporated herein by reference). The terms "virulence" and "hypervirulence" as used herein can be used interchangeably; the difference between the two terms mainly relates to the degree of disease severity and toxicity of the (emerging) strain. As used herein a virulent or hypervirulent C. difficile type/strain/ribotype is able to overcome host defense mechanisms by breaking down the protective mechanisms of the host and is capable of causing disease mainly by producing virulence factor like toxins. In the past decade, the incidence, complications and mortality of Clostridium difficile associated infection (CDI) have increased dramatically due to the emergence of the hypervirulent strains like C. difficile type 078 (NAP7/8)(RT 078) and type 027 (NAPOl; RT 027) (Warny et al, 2005); (Goorhuis et al, 2008). RT 027 is characterized by production of C. difficile toxins A and B and a third toxin (binary toxin), deletions in the regulatory gene tcdC that potentially allow increased toxin A and B production, and resistance to fluoroquinolones. Type 078 and type 027 have similar virulence factors

(positive for toxin A, B and binary toxin, and a dysfunctional toxin regulator gene). One theory for explaining the increased virulence of 027 (NAPOl) is that it is a hyperproducer of both toxins A and B, and that certain antibiotics may actually stimulate the bacteria to hyperproduce.

Closely monitoring of C. difficile epidemiology has shown that C. difficile is not only a health-care associated event but can also be community acquired.

Especially, (hyper) virulent PCR ribotype 078 (NAP7/8) is more frequently found in the community compared to other PCR ribotypes (Goorhuis et al., 2008). Furthermore, the proportion of 078 clinical C. difficile appears to be growing in prevalence and is associated with high levels of recurrence (Burns et al, 2010; Goorhuis et al, 2008).

In the past few years it has become clear that C. difficile has also emerged as an animal pathogen. The PCR ribotype most prominently present in farm animals is RT 078; accounting for more than 90% in porcine and bovine isolates (Keel et al, 2007; Weese et al, 2010; Rupnik et al, 2001). Other ribotypes (RT) circulating in livestock are ribotypes 002, 033, 045, 066, 077 and 126 (Avbersek et al, 2009; Keel et al, 2007; Pirs et al, 2008). Except for ribotypes 002 and 077, all these ribotypes tested positive in our 078-specific PCR representing more than 95% of the species found in this animal population.

Overlap between 078 isolates from animals and humans lead to the hypothesis of a zoonotic transmission route but awaits confirmation (Bakker et al., 2010).

SUMMARY OF THE INVENTION

C. difficile is a heterogeneous species, which can be divided in several groups based on various typing methods such as (PCR) ribotyping, serotyping, repeat - analysis, DNA microarrays and whole bacterial genome length sequencing (Brazier, 2001; Killgore et al., 2008; Stabler et al., 2006; incorporated herein by reference). Several of these typing methods classify individual strains. As used herein strain is defined by organisms that descend from a single organism with minor identifiable differences.

By way of example but not limited to a (new) (PCR) - C. difficile ribotype (identifiable difference: intergenic region of ribosomes) is a strain if it is the only member of this type. However, for the 027 and 078 ribotypes there are several isolates (on basis of sequence differences) comprising several strains (herein also referred to as 027-ribotype/strain-group/clade and/or 078- ribotype/strain-group/clade, likewise 078-ribotype-like (associated)/strain- group/clade and/or 027-ribotype-like (associated)/strain - group/clade) (for explanation see Griffiths et al., 2010, incorporated herein by reference). The terms "Ribotype (RT)" and "PCR-ribotype (PCR-RT)" as used herein can be used interchangeably; the difference between the two terms relates to the method by which the ribotyping is carried out in the art.

Depending on the ability of the typing technique specific

epidemiological/geographical outbreaks can be discriminated. Highly discriminatory methods are particularly useful for tracking C. difficile

transmission at the local level (e.g. MLVA) but can obscure evident strain similarities. In contrast, methods with less discriminatory power (e.g. MLST) are more suited for tracking global genetic lineages. Combining methods can, besides validation, provide genetic relations and allow for tracing and tracking of outbreaks.

Correlation of typing methods, however, can sometimes be problematic.

Several typing methods (Toxinotyping, Ribotyping, MVLA, REA and PFGE) depend on comparison of agorose/acrylamide gel-patterns. For correct interpretation, these patterns often require standardization and computer assisted analysis for comparison. Furthermore, comparison of isolates involves analyzing samples, including reference strains, on the same electrophoresis gel. These requirements often limit interlaboratory reproducibility. Extremely discriminatory techniques of genetic markers (e.g. MLVA) can be hampered by rapid accumulation of variation within these loci (Killgore et al., 2008). This intrinsic feature of repeat based typing methods not only requires

standardization but also assembly of computer databases containing each strain specific pattern. Comparative genome analysis has shown that C.

difficile genomes are conserved -but have acquired many genes which could contribute to distinct phenotypic differences (Stabler et al., 2009). The epidemic C. difficile 027 genome has 50 regions of genetic difference with a total of 234 additional genes compared to PCR ribotype 012 (Stabler et al., 2009). Many of these regions code for conjugative transposons, antibiotic resistance and phage islands. The completion of full length genomes can provide genetic markers for the identification of specific strains, but large scale recombination, reshuffling and horizontal gene transfer makes the

identification of stable strain specific biomarker extremely difficult and challenging.

During the brief history of Clostridium difficile as a pathogen, there have been a remarkable number of diagnostic laboratory testing strategies for disease related to this organism. Tests for diagnosis of C. difficile disease have been based on detection of the organism, its toxins, other cellular antigens, and most recently toxin-specific genes. Current immunoassays for C. difficile detection offered by most laboratories are woefully inadequate in terms of diagnostic sensitivity. PCR is preferred over immunoassay because the immunoassays tend to be less specific when testing isolates, resulting in over diagnosis of toxin-mediated C. difficile disease. A testing protocol that includes immunoassays and polymerase chain reaction (PCR) for the rapid detection of both toxins A and B is the current standard of practice.

The clinical significance of toxin A-negative/toxin B-positive variants has warranted the use of immunoassays for both toxins. Screening tests that rely on only one of the toxins or on antigens other than toxins are not adequate. Second, the emergence of strains with enhanced virulence demands attention from laboratorians to enhance clinicians' ability to diagnose C. difficile disease. The organism's pathogenic properties have shifted more than once with respect to toxin production, altering the clinical features and diagnostic requirements for C. difficile disease. It is now known that some strains produce a third toxin (binary toxin) and those certain strains may produce all three toxins or an unregulated quantity of toxin. Thus there is clearly a need for a method of diagnosis of a virulent or hypervirulent C. difficile strain which is stable/reliable/constant which does not rely solely on the organisms pathogenic properties/characteristics (like toxin production, cytotoxin gene detection) which are prone to adaption and which can be variable as a means for detection.

The invention solves this problem by providing a novel stable/constant (bio) marker for example but not limited to genetic/nucleic acid and corresponding protein marker inserts specific to virulent more specifically hyper virulent C. difficile types, more in particular 027 /078- PCR ribotype. This allows the rapid, stable and precise designation of a sample as comprising a (hyper) virulent C. difficile type/ribotype/strain.

Since hypervirulent C. difficile strains are more pathogenic than other strains, it is important to know which strain is causing an outbreak (for example in C. difficile hospital acquired infections) and to be able to have a reliable easy method of C. difficile typing. It is also an object of the present invention to use these novel stable biomarkers in a C. difficile typing method to classify C. difficile (hyper) virulent types/ribotypes/strains, more in particular C. difficile 027/078 types/ribotypes/strains.

Strikingly, C. difficile (hyper) virulent strains positive for the 078

marker/biomarker of the present invention have similar PCR ribotype patterns and strains positive for the 027 marker/biomarker of the present invention have similar PCR ribotype patterns and each cluster into distinct phylogenetic groups. Thus RT 027/078 -specific genetic/nucleic acid biomarkers of the present invention recognize C. difficile virulent/hypervirulent PCR-ribotypes that can be grouped into distinct phylogenetic groups and that are genetically related. This is a novel and pioneering and rapid method for typing virulent more specifically hypervirulent C. difficile strains.

It is an object of the present invention to provide a RT 027 or RT 078 stable/constant type specific biomarker, more specifically a unique nucleic acid marker, more specifically a unique protein marker to isolate and/or recognize and/or distinguish and/or detect and/or classify distinct C. difficile types, more specifically virulence types, even more specifically hyper virulence types, sharing characteristic features, more specifically but not limited to

pathogenicity associated features, for example (hyper) virulence factors, in a simple and highly reproducible manner using a (typing) method, an assay, a kit or kit of parts as disclosed herein the invention.

Another object of the present invention is to provide RT 027/078 - stable/constant type specific biomarker (s), more specifically unique

genetic/nucleic acid marker(s) (type/strain/specific unique RT 027/078 inserts as disclosed herein the invention), and their gene product unique protein (bio) marker (s), to establish and determine the virulence potential of a C. difficile strain. This rapid and accurate identification of (hyper) virulent C. difficile strains will enable, for example hospitals, product manufactures (food, agricultural, veterinary, medicinal etc.) but not limited to these, to perform the appropriate measures for controlling the spread of (hyper) excessively virulent (toxigenic) C difficile strains. Hypervirulent isolates produced significantly more spores, and this increased sporulation, potentially in synergy with robust toxin production, may contribute to the widespread diseases associated with hypervirulent C. difficile strains.

In hospitals it will for certain affect/influence therapeutic intervention. Typing of C. difficile is essential as it can lead to change in antibiotic regime for treatment of the underlying disease. Furthermore, typing can also influence the interventions made to prevent spreading of C. difficile in hospitals. The (hyper) virulent 027/NAP01/BI strain is associated with increased spore production (Saxton et al., 2009), and can therefore spread faster amongst patients. Administration of fluoroquinolones has been identified as a major risk factor for Clostridium difficile infection (CDI) caused by the hypervirulent strain RT 027/NAP01/BI (Warny et al, 2005). Resistance to fluoroquinolones has been described not only in the hypervirulent strain 027, but also in other important PCR ribotypes circulating in hospital settings. Consequently, prevention of the spread of this hypervirulent strain might require rapid isolation of patients with high suspicion of CDI combined with strict cleaning of the patient environment.

It is an object of the present invention to overcome these above mentioned molecular typing difficulties by providing novel stable type specific (bio) markers, more specifically unique genetic/nucleic acid marker(s)

(type/strain/specific RT 027/078 inserts as disclosed herein the invention), and their gene product/protein (bio) marker (s) as disclosed herein the invention that can detect and/or distinguish and/or identify and/or classify a virulent, more specifically a hyper virulent and/or toxigenic C. difficile ribotype in a simple and highly reproducible manner. More in particular a Clostridium difficile ribotype 078 strain and/or a Clostridium difficile ribotype 078 -like (associated) strain. More in particular a Clostridium difficile ribotype 027 strain and/or a Clostridium difficile ribotype 027 -like (associated) strain. "Associated" as used herein is for example but not limited to phylogenetically related to, sharing characteristic genetic features more specifically virulence features and the like.

It is also an object of the present invention to use novel stable strain specific (bio) marker(s); more specifically RT027 and RT078 specific biomarkers as disclosed herein; to at least but not limited to the following:

a) Identify/detect/classify a (hyper) virulent (toxigenic) Clostridium difficile strain comprising a (bio) maker of the present invention, for example but not limited to genetic/nucleic acid biomarker, a novel RT027 and RT078 DNA insert sequence, or a part or modification thereof; b) Identify/detect/classify a (hyper) virulent Clostridium difficile strain comprising the nucleotide sequence as a shown in SEQ ID NO: 1 or a nucleotide sequence derived therefrom by substitution, addition, deletion or insertion of one or several nucleotides; c) Identify/detect/classify a (hyper) virulent Clostridium difficile strain comprising the nucleotide sequence as a shown in SEQ ID NO: 2 or a nucleotide sequence derived therefrom by substitution, addition, deletion or insertion of one or several nucleotides; d) Identify/detect/classify a (hyper) virulent Clostridium difficile -like strain related to RT 027; RT 078; e) Distinguish between Clostridium difficile RT 027 and RT 078 types and RT 027 and RT 078 like types. f) Determine the virulence potential of a detected/identified/isolated

Clostridium difficile-strain; g) Determine the presence or absence of a virulent/hypervirulent C.

difficile strain in a sample; and the like in a simple and highly reproducible manner.

DETAILED DESCRIPTION OF THE INVENTION

In a preferred embodiment the invention provides a (bio) marker capable of detecting and/or distinguishing and/or identifying and/or classifying and/or characterizing a virulent more specifically a hypervirulent Clostridium difficile type, preferably a 078 or 027 type or like type comprising the nucleotide sequence as a shown in SEQ ID NO: 1 or SEQ: ID: 2 or a nucleotide sequence derived therefrom by substitution, addition, deletion or insertion of one or several nucleotides. In the context of the invention the terms C. difficile type, (PCR) - ribotype, strain, group and clade can be used interchangeably but they can have different meanings, clearly defined in the art.

In another preferred embodiment the invention provides a (bio) marker capable of detecting and/or distinguishing and/or identifying and/or classifying and/or characterizing a virulent more specifically a hypervirulent Clostridium difficile type, preferably a 078 or 027 type or like type comprising the amino acid sequence as a shown in SEQ ID NO: 7-9 or SEQ: ID: 10-13 or a

modification thereof. Methods for producing modified proteins based on the amino acid sequences as disclosed herein the invention are well known in the art.

078-like ribotypes are presently also referred to as C. difficile clade 5 strains. 027-like ribotypes are presently also referred to as C. difficile clade 2 strains. These terms can be used interchangeably.

In a preferred embodiment using the unique type specific (bio) marker of the present invention; more specifically genetic/nucleic acid marker(s)

(type/strain/specific unique RT 027/078 DNA/nucleic acid inserts) and their gene product unique protein (bio)marker (s) as disclosed herein the invention; is provided a method for the detection and/or distinguishing and/or

identification and/or isolation and/or classification and/or characterization of a virulent Clostridium difficile type; more in particular a hyper virulent and/or toxigenic Clostridium difficile type, more in particular a PCR ribotype 078 strain and/or PCR ribotype 078- like (associated) strain and/or a Clostridium difficile PCR ribotype 027 and or and/or PCR ribotype 027- like (associated) strain.

A "(bio)marker" as used herein is "a characteristic that is objectively measured and evaluated as an indicator of normal biologic processes, pathogenic processes, or pharmacologic responses to a therapeutic intervention" but not limited to as such. Biomarkers provide insight into disease progression, prognosis, and response to therapy.

Biomarkers include tools and technologies that can aid in understanding the prediction, cause, diagnosis, progression, regression, or outcome of treatment of a C. difficile disease. In addition to delineating the events between exposure and disease, biomarkers have the potential to identify the earliest events in the natural history, reducing the degree of misclassification of both disease and exposure, opening a window to potential mechanisms related to the disease pathogenesis, accounting for some of the variability and effect modification of risk prediction.

A unique marker "(bio) marker" of the present invention is any molecule derived from (by techniques known in the art) or at least based on the unique C. difficile type/ribotype/strain specific nucleic acid marker RT 078/RT 027 inserts as disclosed herein the invention, for example but not limited to nucleic acids - DNA, RNA, (synthetic markers e.g. PNA), protein (proteinaceous markers) and the like. Preferably said C. difficile type is a virulent type, even more preferable a hypervirulent type.

In a preferred embodiment said biomarker is a genetic/nucleic acid/DNA marker, preferably a marker based on and/or comprising the nucleotide sequence as shown in SEQ: ID: NO 1 [RT 078] and/or nucleotide sequence as shown in SEQ: ID:N02 [RT 027] or a part or modification thereof. Methods for producing modified nucleic acid are known in the art and include but are not limited to chemical modification, threose nucleic acid (TNA) and the like. In another preferred embodiment said biomarker is a protein marker comprising or based on the amino acid sequence as shown in SEQ: ID 7-9 (RT 078; see table 1) or SEQ: ID: 10- 13 (RT 027; see Table 1) or a modification thereof. Methods for producing modified protein markers are known in the art through protein engineering techniques such as but not limited to adding a chemical moiety to a target molecule (see for example US2010273978 incorporated herein by reference).

Molecular detection/diagnostic methods arising from advances in genomics, proteomics, molecular imaging technologies capable of using (applicable for) a unique C. difficile disease (bio) marker or synthetic derived marker of the present invention are known in the art and disclosed herein (below). More specifically molecular diagnostic technologies at least capable of

detecting/identify/a virulent/hyper virulent and/or toxigenic Clostridium difficile type, more in particular a ribotype 078 strain and/or ribotype 078- like (associated) strain and/or a Clostridium difficile ribotype 027 and or and/or ribotype 027- like (associated) strain using a unique type specific biomarkers; genetic/nucleic acid and protein marker(s) as disclosed herein the invention. Molecular biology diagnostic/detection technologies based on nucleic acid (DNA, RNA), Protein and the like and systems are known in the art and include but are not limited to; several (novel) polymerase chain reaction (PCR)- based technologies as mentioned herein, gene-based diagnostics through RCAT, fluorescent in situ hybridization (FISH), modifications of FISH, direct visual in-situ hybridization, direct labeled Satellite FISH probes, primed in- situ labeling, Interphase FISH, multicolor FISH, RNA diagnostics, branched- chain DNA assay for measurement of RNA, cycling probe technology, Invader RNA assays, Linear RNA amplification, Nucleic acid sequence-based amplification, Loop-mediated isothermal amplification of DNA (LAMP)

[Notomi et at., 2000; Nucleic acid research; Vol 28; No 12: incorporated herein by reference], Q Beta replicase system, RNAScope, Solid Phase Transcription Chain Reaction, transcriptome analysis, visualization of mRNA expression in- vivo, MAUI (MicroArray User Interface) hybridization, universal DNA microarray combining PCR and ligase detection reaction, Serial analysis of gene expression (SAGE), Single-cell gene expression analysis, Ziplex™ system, Fast PCR biochip, Scorpions™ technology, Biochips and (bio)chip technologies and biosensor technologies, Microfluidic chips, FISH-on-chip, lab-on-a-chip, TaqMan® OpenArray® Digital PCR, Digital PCR on a SlipChip, biosensor immunoarrays, Biosensors, and Molecular Labels, peptide nucleic acids (PNA) and biosensors, PNA-FISH for diagnosis, electrochemical detection of DNA, branched DNA test, direct detection of dsDNA, RCAT-immunodiagnostics, RCAT-biochips, RCAT-pharmacogenomics, Invader assays, Hybrid Capture technology, Multiplex assays, nanotechnology, nanopore technology, nanosensors, DNA nanomachines, DNA nanobarcodes technology, Qdot nanobarcode for multiplexed gene expression profiling, Proteomic

Technologies, ELISA with exponential signal amplification, diagnostics based on designed repeat proteins, Differential Peptide Display, Light-switching excimer probes, MALDI-TOF MS, Molecular beacon assay, Real-time PCR for protein quantification, Protein biochip technologies, ProteinChip, LabChip for protein analysis, TRINECTIN proteome chip, Protein chips for antigen- antibody interactions molecular diagnostics, Microfluidic devices for

proteomics-based diagnostics, Nanotechnology-based protein

biochips/microarrays, Nanoparticle protein chip, Protein nanobiochip, Protein biochips based on fluorescence planar wave guide technology, Antibody microarrays, Multiplexed Protein Profiling on Microarrays, LCM combined with microrarray technology, Suppression subtractive hybridization, PCR- CTPP (confronting two-pair primers), NASBA, SmartGene platform for identifying pathogens based on genetic sequences, Tessera array technology, Cell-based methods, Rapid point-of-care diagnosis, QIAplex PCR multiplex technology, eTag assay system for biomarkers, Antibody-based diagnosis, Monoclonal antibodies, Recombinant antibodies, Combined immunological and nucleic acid tests, Combination of MAbs and RT-PCR, Immunobead RT-PCR and the like known and described in the art.

Accordingly, the present invention provides a stable/constant type specific (bio) marker unique to a Clostridium difficile ribotype 078 strain; a Clostridium difficile ribotype 027 strain, a method for selecting a (hyper) virulent and/or toxigenic Clostridium difficile ribotype; more in particular a RT 078 strain and/or a RT 078-like (associated) strain; a RT 027 strain and/or a RT 027 like (associated) strain using said type/strain specific (bio) markers, and a kit used for the method.

In one aspect the invention provides a biomarker a nucleic acid or protein marker capable of detecting and/or distinguishing and/or identifying and/or classifying a virulent Clostridium difficile type, comprising a nucleotide sequence of the invention. More in particular a ribotype 078 strain and/or ribotype 078- like (associated) strain comprising the nucleotide sequence as a shown in SEQ ID NO: 1 or a nucleotide sequence derived therefrom by substitution, addition, deletion or insertion of one or several nucleotides. In a preferred embodiment said Clostridium difficile strain is a (hyper) virulent and/ or toxigenic strain.

Said nucleic acid/DNA marker of the present invention, SEQ ID NO: 1 is a strain specific insert unique to the Clostridium difficile ribotype 078 strain (NAP7/8; RT 078) M120 strain, or Clostridium difficile ribotype 078-like (associated) strains; ribotype 033 strain, Clostridium difficile ribotype 045 strain, Clostridium difficile ribotype 066 strain and Clostridium difficile ribotype 066 strain but not limited to.

The present invention also provides the use of a bio marker comprising the nucleotide sequence as a shown in SEQ ID NO: 1; or a nucleotide sequence derived therefrom by substitution, addition, deletion or insertion of one or several nucleotides; for the detection and/or distinguishing and/or

identification and/or isolation and/or classification of a C. difficile ribotype strain phylogenetically related to, sharing characteristic feature of (for example but not limited to virulence factors) a Clostridium difficile ribotype 078 strain, wherein said associated or like strain is a hypervirulent and/or toxigenic strain.

Methods for detection/distinguishing/identification/isolation/classification of a bacterial type are well known in the art and incorporated herein. Phylogenetic comparative methods (PCMs) are also well known in the art [see for example Griffiths et at., 2010; incorporated herein by reference].

It is understood that a person skilled in the art using methods known in the art could isolate a unique insert/DNA marker RT 078 sequence of the present invention from each Clostridium difficile ribotype member of the subgroups detected/identified using said DNA marker/insert sequence, for example RT 033, RT 045 strain and RT 066 strain; and through comparison studies known in the art prepare strain specific markers. Comparison of the unique insert/DNA marker sequence of each Clostridium difficile ribotype member identified of the subgroups may be used to identify sequence motifs pertaining to a Clostridium difficile (hyper) virulent and/or toxigenic subgroup using techniques known in the art.

In yet another aspect the invention provides a biomarker a nucleic acid or protein marker capable capable of detecting and/or distinguishing and/or identifying and/or classifying a Clostridium difficile (hyper) excessively virulent (for example increased spore forming) and/or toxigenic type. More in particular a ribotype 027 and/or a Clostridium difficile ribotype 027- like (associated) strain, comprising the nucleotide sequence as a shown in SEQ ID NO: 2; or a nucleotide sequence derived therefrom by substitution, addition, deletion or insertion of one or several nucleotides. In a preferred aspect said Clostridium difficile ribotype 027 and or and/or ribotype 027-like (associated) strain is Clostridium difficile (hyper) virulent and/or toxigenic like strain. Said nucleic acid/DNA marker of the present invention, SEQ ID NO: 2 is a strain specific unique insert unique to the Clostridium difficile ribotype 027 (NAP01)(R20291;B11,CD196;2007855 strains) or Clostridium difficile ribotype 027- like (associated) strains; Clostridium difficile ribotype 016 strain,

Clostridium difficile ribotype 036 strain, Clostridium difficile ribotype 075 strain, Clostridium difficile ribotype 122 strain and Clostridium difficile ribotype 153 strain.

The present invention provides the use of a (bio) marker of the present invention comprising/derived from the nucleotide sequence as a shown in SEQ ID NO: 2 or a nucleotide sequence derived therefrom by substitution, addition, deletion or insertion of one or several nucleotides for the

detection/distinguishing/identification/isolation/classification of a (hyper) excessively virulent (increased spore forming) and/or toxigenic strain. More in particular a C. difficile type/ribotype/strain phylogenetically related to, sharing characteristic feature of (for example but not limited to virulence factors) a Clostridium difficile ribotype 027 type/ribotype/strain (RT 027). Methods of detection of nucleic acids are well known in the art and described herein but not limited to.

It is understood that a person skilled in the art using methods known in the art could isolate a unique insert/DNA marker RT 027 sequence of the present invention from each Clostridium difficile ribotype member of the subgroups detected using said DNA marker/insert sequence, for example RT 016 strain, RT 036 strain, RT 075 strain, RT 122 strain and RT 153 strain; and through comparison studies known in the art prepare strain specific markers.

Comparison of the unique insert/DNA marker sequence of each Clostridium difficile ribotype member identified of the subgroups may be used to identify motifs pertaining to the RT 027 hypervirulent/toxigenic subgroup using techniques known in the art.

Thus in a preferred embodiment the invention relates to a method for the detection/distinguishing/identification/isolation/classification of a Clostridium difficile type/ribotype/strain in a sample, for example but not limited to a biological sample, by way of example a DNA or RNA sample derived from a test organism, more in particular a Clostridium difficile ribotype 078 strain and/or ribotype 078-like (associated) strain and/or a Clostridium difficile ribotype 027 and/or ribotype 027-like (associated) strain using a

stable/constant biomarker DNA marker of the invention. Preferably said Clostridium difficile ribotype strain or Clostridium difficile ribotype like (associated) strain is a hypervirulent strain. The invention thus provides a straight forward simple pioneering method for the detection and/or

distinguishing and/or identification and/or isolation and/or classification and/or characterization of a virulent Clostridium difficile type/ribotype/strain, more in particular a virulent (hypervirulent) Clostridium difficile ribotype 078 strain and/or ribotype 078- like strain and/or a Clostridium difficile ribotype 027 and/or ribotype 027- like strain in a sample (biological sample), entity, product but not limited to.

Furthermore a method of the invention allows designation of a sample as comprising a virulent more in particular a hypervirulent Clostridium difficile type/ribotype/strain. It allows the classification/scoring of a sample as a ribotype 027 strain or a ribotype 027-like strain and/or ribotype 078 or a ribotype 078-like strain. So in a method of the invention a number of virulent, more in particular hypervirulent and/or toxigenic Clostridium difficile type/ribotype/strain designations can be made.

For example said (hyper) virulent strain of the invention is a toxigenic C.

difficile strain wherein said produced toxin (e.g. a virulence factor gene produced toxin) comprises toxin A (TcdA) and/or Toxin B (TcdB) and/or binary toxin or a functional equivalent thereof. Said hypervirulent strain can also be in part differentiated/distinguished from a non hypervirulent C. difficile strains through increased spore and/or increased toxin production, for example through a dysfunctional toxin regulator gene. Said hypervirulent strain can also be in part differentiated/distinguished from a non hypervirulent C.

difficile strains through cellular antigens. In a preferred embodiment said hypervirulent strain is a pathogenic strain. Said pathogenic strain is at least capable of causing a disease or infection in a test organism. Said pathogenic strain is characterized by the presence of at least one virulence factor gene or a dys regulation in a virulence regulator gene or by cellular antigens.

In a preferred embodiment said test organism is a eukaryotic organism, a eukaryote. In another preferred embodiment said eukaryotic organism is human, animal (porcine, bovine) but not limited to. In another preferred embodiment said organism, more in particular a eukaryotic organism has disease symptoms, such as intestinal damage and/or inflammation and/or signs of an infection. More in particular said disease is a C. difficile related disease, for example but not limited to a C. difficile associated infection (CDI). In another preferred embodiment said infection is a nosocomical infection. For example, a hospital-acquired infection and/or healthcare-associated infection. More in particular said nosocomical infection is characterized by increased antibody resistance. In another preferred embodiment said infection is a community acquired infection (infectious disease).

In a preferred embodiment a Clostridium difficile virulent/hypervirulent and/or toxigenic type is characterized by a nucleotide sequence SEQ ID NO: 1, or a part or a modification (insertion, substitution, addition, deletion) thereof. In another preferred embodiment said Clostridium difficile

virulent/hypervirulent type is characterized by a difference in the nucleotide sequence of the 16s rRNA gene, more in particular a single base change in the 16S rRNA gene, a single base change (transition of T to C) at position 145 (Rupnik et at. (2001); incorporated herein as reference). In yet another preferred embodiment said Clostridium difficile virulent/hypervirulent type is further characterized by the nucleotide sequence as a shown in SEQ ID NO: 1 or part thereof inserted in the intergenic region between GuA synthase and nucleotidase CD0198 and CD0199 with reference to the Clostridium difficile ribotype wild type strain 012. For example but not limited to a Clostridium difficile ribotype 078 strain and/or ribotype 078-like (associated) strain.

In a preferred embodiment a Clostridium difficile (hyper) virulent and/or toxigenic strain is characterized by a nucleotide sequence SEQ ID NO: 2, or a part or a modification (insertion, substitution, addition, deletion) thereof In another preferred embodiment said Clostridium difficile virulent/hypervirulent type is characterized by the nucleotide sequence as a shown in SEQ ID NO: 2, a part or modification thereof, inserted within the ThyX gene (flavin

dependent thymidylate synthase).

In another aspect of the invention said (hyper) virulent type/strain is a variant Clostridium difficile (hyper) virulent type/strain; for example a toxin gene- variant strain of 078 Clostridium difficile comprising the nucleotide sequence as a shown in SEQ ID NO: 1, a part or modification thereof or 027 comprising a nucleotide sequence as a shown in SEQ ID NO: 2, a part or modification thereof. Said gene-variant strain or mutant strain may contain a genetic alteration in a virulence gene, which increases it

pathogenicity/toxicity/virulence and/or spore shedding ability. For example a C. difficile (hyper) virulent strain can be a strain comprising SEQ ID NO: 1 or a part thereof, with a nucleotide substitution in, deletion in, addition in or insertion in, said SEQ ID NO: 1, and/or with a variation in one or more toxin genes, or toxin regulator genes compared with a C. difficile ribotype 078 strain making it more resistant to fluoroquinolones.

In a preferred embodiment said (hyper) virulent strain is phylogenetically related; sharing at least one virulence feature common to the hypervirulent C. difficile PCR-ribotype 078 comprising the nucleic acid/DNA SEQ: ID: 1, a modification of, or a part thereof; or to the hypervirulent C. difficile PCR- ribotype 027 comprising the DNA SEQ: ID: 2, a modification of, or a part thereof. In a preferred embodiment said (hyper) virulent strain forms part of (associates with) a C. difficile ribotype subgroup to which wild-type C. difficile ribotype 078 or 027 belongs. This strain may have been originally classified as a non virulent non toxigenic strain which has subsequently developed/evolved into a virulent/hypervirulent and/or toxigenic C. difficile strain via genetic alterations, recombination, gene shuffling, horizontal gene transfer or the like and/or through zoonotic transmission. Phylogenetic detection methods to detect C. difficile (hypervirulent) subgroups using a nucleic acid/DNA marker(s) of the present invention and comparative methods (PCMs) are well known in the art.

In still another aspect, the invention provides for methods of detecting the presence or absence of a (hyper) virulent C. difficile type/ribotype/strain in a sample/specimen, preferably a biological sample/specimen. "Sample" as used herein means a quantity of material from a biological, environmental, medical, or patient source or the like in which detection or measurement of a (bio) marker of the invention, for example a target nucleic acid but not limited to is sought. On the one hand it is meant to include a specimen or culture (e.g., microbiological cultures). On the other hand, it is meant to include both biological and environmental samples. A sample may include a specimen of synthetic origin.

Representative biological samples that can be used in practicing the methods of the invention may be animal, including human, fluid, solid (e.g., stool) or tissue, as well as liquid and solid food, feed products and ingredients such as dairy items, vegetables, meat and meat by-products, and waste. Biological samples may include materials taken from a patient including, but not limited to cultures, blood, buccal swabs and saliva, cerebral spinal fluid, pleural fluid, semen, urine, needle aspirates, patient biopsies peri-anal samples, or rectal samples and the like. A sample/specimen as used herein encompasses synthetic and man-made products and the like. All

samples/specimens/products/entities and the like suspected of comprising (or contacted with) a C. difficile strain, more in particular a (hyper) virulent C. difficile strain are encompassed by the present invention.

Biological samples may be obtained from all of the various families of domestic animals, as well as feral or wild animals, including, but not limited to, such animals as ungulates, bear, fish, rodents, etc. Environmental samples include environmental material such as surface matter, soil, water and industrial samples, as well as samples obtained from food and dairy processing instruments, apparatus, equipment, utensils, disposable and non-disposable items. These examples are not to be construed as limiting the sample types applicable to the present invention. The terms "sample" and "specimen" can be used interchangeably. All samples suspected of (or contacted with) comprising a C. difficile strain, more in particular a (hyper) virulent C. difficile

type/ribotype/strain are encompassed by the present invention. For example a DNA, RNA or protein sample extracted from a test organism, preferably a eukaryotic organism, preferably human or animal. Collection and storage methods of biological samples are known to those of skill in the art.

In still another aspect, the invention provides for methods of detecting the presence or absence of a (hyper) virulent C. difficile type/ribotype/strain in a product and/or entity. A "product" herein includes but is not limited to a man made product, a product of manufacture, a surgical product, a food product, a dairy product, a veterinary product, a medicinal product, an agricultural or environmental product. An entity as used herein includes include all materials, substances, compositions, matter/body, unit, article, creature, being which may have come in contact with a virulent, preferably a hypervirulent and and/or toxigenic C. difficile type/ribotype/strain.

In yet another aspect the invention provides for a method of detecting the presence or absence of a (hyper) virulent C. difficile in a DNA sample, wherein said detecting Clostridium difficile is carried out via PCR amplification of the sample with the use of a set of primers capable of specifically amplifying a biomarker more specifically a DNA marker/insert of the present invention or a part thereof, followed by detecting and/or analyzing the PCR amplification product.

A "primer" as used herein refers to an oligonucleotide comprising a sequence that is complementary to a nucleic acid to be transcribed ("template"). During replication polymerases attach nucleotides to the 3' end of the primer complementary to the respective nucleotides of the template. In a particular embodiments of the invention the polymerase used for quantitative real-time PCR is a polymerase from a thermophile organism or a thermostable polymerase or is selected from the group consisting of Thermus thermophilics (Tth) DNA polymerase, Thermus acquaticus (T aq) DNA polymerase,

Thermotoga maritima (Tma) DNA polymerase, Thermococcus litoralis (Tli) DNA polymerase, Pyrococcus furiosus (Pfu) DNA polymerase, Pyrococcus woesei (Pwo) DNA polymerase, Pyrococcus kodakaraensis KOD DNA

polymerase, Thermus filiformis (Tfi) DNA polymerase, Sulfolobus solfataricus Dpo4 DNA polymerase, Thermus pacificus (Tpac) DNA polymerase, Thermus eggertssonii (Teg) DNA polymerase, Thermus brockianus (Tbr) and Thermus flavus (Tfi) DNA polymerase.

Particularly, the fluorescently labelled probes are labelled with a dye selected from the group consisting of FAM, VIC, NED, Fluorescein, FITC, IRD-700/800, CY3, CY5, CY3.5, CY5.5, HEX, TET, TAMRA, JOE, ROX, BODIPY TMR, Oregon Green, Rhodamine Green, Rhodamine Red, Texas Red, Yakima Yellow, Alexa Fluor and PET.

In particular, the hybridization probe is a LightCycler probe (Roche) or the hydrolysis probe is a TaqMan probe (Roche). In other embodiments the hairpin probe is selected from the group consisting of molecular beacon, Scorpion primer, Sunrise primer, LUX primer and Amplifluor primer. The TaqMan probes are preferred.

A "probe" as used herein can be a nucleic-acid fragment that is complementary to another nucleic-acid sequence and thus, when labeled in some manner, as with a radioisotope, can be used to identify complementary segments present in the nucleic-acid sequences of various microorganisms. A probe as used herein can be a proteinaceous probe, a synthetic probe, a chemical probe or the like. The term "probe" is well known in the art.

Gene transfer between different species allows bacteria to acquire new traits potentially conferring evolutionary adaptations to encountered selective conditions. The present invention exploits both existing and acquired genes by developing type/strain-specific detection methods, more in particular PCRs, preferably real time PCR for the identification of a (hyper) virulent C. difficile strain. More in particular a C. difficile (hyper) virulent strain 027 or 078 and like (associated) strains.

Methods of the invention can be used with a wide variety of samples and targets. In preferred embodiments the method is performed: on a biological sample from a human or animal subject; to diagnose an individual for a Clostridium difficile infection or predisposition to a Clostridium difficile infection. Methods of PCR amplification are well known in the art, including real time PCR, real time reverse transcriptase PCR (RT-PCR) and the like. "Polymerase chain reaction" or "PCR" means a reaction for the in vitro amplification of specific DNA sequences by the simultaneous primer extension of complementary strands of DNA. In other words, PCR is a reaction for making multiple copies or replicates of a target nucleic acid flanked by primer binding sites, such reaction comprising one or more repetitions of the following steps: (i) denaturing the target nucleic acid, (ii) annealing primers to the primer binding sites, and (iii) extending the primers by a nucleic acid polymerase in the presence of nucleoside triphosphates. Usually, the reaction is cycled through different temperatures optimized for each step in a thermal cycler instrument. Particular temperatures, durations at each step, and rates of change between steps depend on many factors well-known to those of ordinary skill in the art, e.g. exemplified by the references: McPherson et al, editors, PCR: A Practical Approach and PCR2: A Practical Approach (IRL Press, Oxford, 1991 and 1995, respectively). For example, in a conventional PCR using Taq DNA polymerase, a double stranded target nucleic acid may be denatured at a temperature >90[deg.]C, primers annealed at a temperature in the range 50-75<0>C, and primers extended at a temperature in the range 72- 78[deg.]C.

As used herein, "amplifying" refers to the process of synthesizing nucleic acid molecules that are complementary to one or both strands of a template nucleic acid molecule (e. g., C. difficile biomarker more specifically a DNA markers of the present invention). Amplifying a nucleic acid molecule typically includes denaturing the template nucleic acid, annealing primers to the template nucleic acid at a temperature that is below the melting temperatures of the primers, and enzymatically elongating from the primers to generate an amplification product. Amplification typically requires the presence of deoxyribonucleoside triphosphates, a DNA polymerase enzyme and an appropriate buffer and/or co-factors for optimal activity of the polymerase enzyme. Preferably the amplification products in the multiplex PCR assay are between 60 and 200 bp in size.

The term "PCR" encompasses derivative forms of the reaction, including but not limited to, real-time PCR, nested PCR, quantitative PCR, multiplexed PCR, Fast PCR biochip, Scorpions™ technology and the like. Reaction volumes range from a few hundred nanoliters, e.g. 200 nl, to a few hundred micro litres. Herein, preferred volumes are 10-50 microliter more preferably about 25 microliters per reaction chamber.

Preferably, the multiplex PCR amplification is quantitative real-time PCR. "Real-time PCR" means a PCR for which the amount of reaction product, i.e. amplicon, is monitored as the reaction proceeds. In real time PCR a two temperature stage reaction may also be used in which the polymerisation temperature equals the annealing temperature, even for typical hybridization probes like Scorpion primers or Pleiades probes. Detection methods exploiting type/strain specific bio markers as disclosed herein the invention are well known in the art and also disclosed herein.

The real-time PCR (also designated herein as quantitative PCR or quantitative real-time PCR (qPCR)) is a method to simultaneously amplify and quantify nucleic acids using a polymerase chain reaction (PCR). There are many forms of real-time PCR that differ mainly in the detection chemistries used for monitoring the reaction product, e.g. Gelfand et al, U.S. patent 5,210,015 ("taqman"); Wittwer et al, U.S. patents 6, 174,670 and 6, 569,627 (intercalating dyes); Tyagi et al, U.S. patent 5,925,517 (molecular beacons). Detection chemistries for real-time PCR are reviewed in Mackay et al, Nucleic Acids Research, 30: 1292- 1305 (2002). Included but not limited are PCR based method like PCR BioCube, QIAsymphony, CAST-PCR, Combined PCR-ELISA, Digital PCR, Emulsion PCR, ExCyto PCR, Long and accurate PCR,

(commercially available) Real-time PCR systems, LightCycler PCR system, READ™ real-time PCR, ViiA™ 7 real-time PCR, real-time Q-PCR, Reverse transcriptase (RT)-PCR, Standardized reverse transcriptase PCR, Single cell PCR, LATE-PCR, COLD-PCR and non PCR nucleic acid amplification methods like linked Linear Amplification, Multiplex Ligation-Dependent Probe

Amplification, transcription mediated amplification, Rapid analysis of gene expression, WAVE nucleic acid fragment analysis system, DNA probes with conjugated minor groove binder, Rolling circle amplification technology. Other technologies include circle-to-circle amplification, ramification amplification method, single Primer Isothermal Amplification, Isothermal reaction for amplification of oligonucleotides, ICAN (Isothermal and Chimeric primer- initiated Amplification of Nucleic Acids, technologies for signal amplification, DNA dendrimer signal amplification, hybridization signal amplification method, Signal mediated amplification of RNA technology. Methods to implement the above and other diagnostic methods cited are well known in the art and are contemplated by the invention employing the novel unique C. difficile type specific (bio) marker(s) of the present invention.

Quantitative real-time reverse transcription PCR (RT- qPCR) is a quantitative real-time PCR method further comprising a reverse transcription of RNA into DNA, e.g. mRNA into cDNA. In qPCR methods, the amplified nucleic acid is quantified as it accumulates. Typically, fluorescent dyes that intercalate with double-stranded DNA (e.g. ethidiumbromide or SYBR(R) Green I) or modified nucleic acid probes ("reporter probes") that fluoresce when hybridized with a complementary nucleic acid (e.g. the accumulating DNA) are used for quantification in qPCR based methods. Particularly, fluorogenic primers, hybridization probes (e.g. LightCycler probes (Roche)), hydrolysis probes (e.g. TaqMan probes (Roche)), or hairpin probes, such as molecular beacons, Scorpion primers (DxS), Sunrise primers (Oncor), LUX primers (Invitrogen), Amplifluor primers (Intergen) or the like can be used as reporter probes. In accordance with the present invention, fluorogenic primers or probes may for example be primers or probes to which fluorescence dyes have been attached, e. g. covalently attached. Such fluorescence dyes may for example be FAM (5-or 6-carboxyfluorescein), VIC, NED, Fluorescein, FITC, IRD- 700/800, CY3, CY5, CY3.5, CY5.5, HEX, TET, TAMRA, JOE, ROX, BODIPY TMR, Oregon Green, Rhodamine Green, Rhodamine Red, Texas Red, Yakima Yellow, Alexa Fluor, PET Biosearch Blue(TM), Marina Blue(R), Bothell Blue(R), CAL Fluor(R) Gold, CAL Fluor(R) Red 610, Quasar(TM) 670, LightCycler Red640(R), Quasar(TM) 705, LightCycler Red705(R) and the like. Particular reporter probes may additionally comprise fluorescence quenchers.

For the embodiments of the present invention selective primers based on the C. difficile type specific unique (bio) marker(s), more in particular a nucleic acid/DNA cDNA marker(s) of the present invention can be used in quantitative real-time multiplex PCR. "Multiplexed PCR" means a PCR wherein multiple target sequences (or a single target sequence and one or more reference sequences) are simultaneously carried out in the same reaction mixture, e.g. Bernard et al, Anal. Biochem., 273: 221-228 (1999) (two- color real-time PCR). Usually, distinct sets of primers are employed for each sequence being amplified. Typically, the number of target sequences in a multiplex PCR is in the range of from 2 to 10, or from 2 to 8, or more typically, from 3 to 6. The preferred number is 2-6 for the present invention.

For example but not limited to the multiplex amplification reaction can be performed in a "closed system" in the presence of fluorescent indicators in the reaction mixture(s), the fluorescent indicators being capable of generating an optical signal related to a presence and/or quantity of each amplicon in the amplification reaction and monitoring the optical signal of the fluorescent indicators in the amplification reaction. The closed system gives an optical output for the user, indicating a scoring assignment outlined above (A suitable "closed system" is disclosed for example in WO 2006/047777; WO 2010/116290; incorporated herein by reference).

Quantitative PCR" means a PCR designed to measure the abundance of one or more specific target sequences in a sample or specimen. Quantitative PCR includes both absolute quantitation and relative quantitation of such target sequences. Quantitative measurements are made using one or more reference sequences that may be assayed separately or together with a target sequence. The reference sequence may be endogenous or exogenous to a sample or specimen, and in the latter case, may comprise one or more competitor templates. Typical endogenous reference sequences include segments of transcripts of the following genes: pactin, GAPDH, microglobulin, ribosomal RNA, and the like. Techniques for quantitative PCR are well-known to those of ordinary skill in the art, as exemplified in the following references: Freeman et al, Biotechniques, 26: 112-126 15(1999); Becker-Andre et al, Nucleic Acids

Research, 17: 9437-9447 (1989); Zimmerman et al, Biotechniques, 21 : 268-279 (1996); Diviacco et al, Gene, 122: 3013-3020 (1992); BeckerAndre et al, Nucleic Acids Research, 17: 9437-9446 (1989); and the like.

"Primer" means an oligonucleotide, either natural or synthetic that is capable, upon forming a duplex with a polynucleotide template, of acting as a point of initiation of nucleic acid synthesis and being extended from its 3' end along the template so that an extended duplex is formed. Extension of a primer is usually carried out with a nucleic acid polymerase, such as a DNA or RNA polymerase. The sequence of nucleotides added in the extension process is determined by the sequence of the template polynucleotide. Usually primers are extended by a DNA polymerase. Primers usually have a length in the range of from 14 to 40 nucleotides, or in the range of from 18 to 36 nucleotides. Primers are employed in a variety of nucleic amplification reactions, for example, linear amplification reactions using a single primer, or polymerase chain reactions, employing two or more primers. Guidance for selecting the lengths and sequences of primers for particular applications is well known to those of ordinary skill in the art, as evidenced by the following references: Dieffenbach, editor, PCR Primer: A Laboratory Manual, 2nd Edition (Cold Spring Harbor Press, New York, 2003).

In a preferred embodiment said set of primers is selected from the group consisting of: a set of primers consisting of the primer consisting of the nucleotide as shown in SEQ: ID: 3 and the primer consisting of the nucleotide sequence as shown in SEQ: ID: 4 or a derivative thereof capable of amplifying the amplification product comprising wholly or in part the Clostridium difficile ribotype 078 strain and/or ribotype 078- like strain nucleic acid insert/DNA marker (SEQ: ID: 1) of the present invention.

In another preferred embodiment said set of primers is selected from the group consisting of: a set of primers consisting of the primer consisting of the nucleotide as shown in SEQ: ID: 5 and the primer consisting of the nucleotide sequence as shown in SEQ: ID: 6 or a derivative thereof, capable of amplifying the amplification product comprising the Clostridium difficile ribotype 027 strain and/or ribotype 027- like strain insert/DNA marker (SEQ: ID: 2) of the present invention.

Biological samples can be processed (e.g., by nucleic acid extraction methods and/or kits known in the art) to release C. difficile nucleic acid or in some cases, the biological sample can be contacted directly with the PCR reaction components and the appropriate primers based on the unique PCR ribotype groups 027 and 078 specific inserts (nucleic acid/DNA (bio) markers) of the present invention. Methods for preparing appropriate primers or probes (and their definitions thereof) based on a C. difficile type specific DNA marker insert nucleotide sequence of the present invention, preferably SEQ: ID: No 1 and SEQ: ID: 2 are known in the art.

The "amplification" methods provided by the invention avoid problems of sample contamination, false negatives, and false positives. The methods can be used to detect the presence or absence of a virulent/hypervirulent C. difficile in a sample, to determine whether or not a patient is in need of treatment for C. difficile. If positive, the patient can be administered an appropriate medication (e. g., metronidazole or vancomycin) in a timely manner. Said method of the present invention is capable of to the detection and/or distinguishing and/or identification and/or isolation and/or classification and/or characterization a Clostridium difficile virulent/hypervirulent C. difficile type, more specifically a ribotype 078 strain and/or ribotype 078- like strain from a Clostridium difficile ribotype 027 and or and/or ribotype 027- like strain.

In a preferred embodiment of the present invention said detecting is performed in real time. The invention provides for a method of identifying/classifying a Clostridium difficile (hyper) virulent type, more in particular a ribotype 078 and/or ribotype 078 - like hypervirulent strain and/or Clostridium difficile ribotype 027 and or and/or ribotype 027- like strain Clostridium difficile nucleic acid/marker by real-time polymerase chain reaction (PCR) in a sample, preferably a biological sample. Primers and probes for detecting/differentiating a C. difficile strain are provided by the invention, as are kits containing such primers and probes. Methods of the invention can be used to rapidly identify the unique nucleic acid/DNA sequence/regions/inserts pertaining to C. difficile RT 027 and C. difficile RT 078 from samples/specimens/products/materials to detect the presence of a C. difficile hypervirulent strain comprising the unique marker SEQ: ID: 1 of the present invention pertaining to the Clostridium difficile ribotype 078 strain (NAP7/8) M120 strain, Clostridium difficile ribotype 033 strain, Clostridium difficile ribotype 045 strain, Clostridium difficile ribotype 066 strain and Clostridium difficile ribotype 066 strain and/or the unique marker SEQ: ID: 2 of the present invention pertaining to the Clostridium difficile ribotype 027 (NAP01)(R20291;BI 1, CD 196;2007855 strains) or Clostridium difficile ribotype 027 -like (associated) strains;

Clostridium difficile ribotype 016 strain, Clostridium difficile ribotype 036 strain, Clostridium difficile ribotype 075 strain, Clostridium difficile ribotype 122 strain and Clostridium difficile ribotype 153 strain. In particular the invention provides the means and method to confirm the presence or absence of a Clostridium difficile ribotype 078 strain and/or ribotype 078- like

(associated) strain and/or a Clostridium difficile ribotype 027 and/or ribotype 027- like (associated) strain.

In a preferred embodiment the invention provides a kit and/or assay for to the detection and/or distinguishing and/or identification and/or isolation and/or classification and/or characterization of a C. difficile (hyper) virulent type/ribotype/strain, more in particular a Clostridium difficile RT 078 and/or RT 027 and/or RT 078 and/or RT 027-like (associated) strain comprising a means for specifically detecting a unique (bio) marker, more specifically unique genetic/nucleic acid marker(s) (type/strain/specific unique RT 027/078 inserts), and their gene product unique protein (bio) marker (s), or parts or

modifications thereof as disclosed herein the invention or a part thereof.

Methods and means for producing a suitable kit, for suitable assays and diagnostic techniques are well known in the art and also disclosed herein.

According to the method or kit or assay of the present invention, Clostridium difficile ribotype 078 strain and/or ribotype 078- like (associated) strain and/or a Clostridium difficile ribotype 027 and/or ribotype 027- like (associated) strain can be selected in a simple, stable, constant and highly reproducible manner.

In another preferred embodiment the invention provides a kit and/or assay for detecting and/or distinguishing and/or identifying a Clostridium difficile (hyper) virulent type/ribotype/strain, more in particular a Clostridium difficile RT 078 and/or RT 027 and/or RT 078 and/or RT 027-like (associated) strain wherein the means for detecting/distinguishing/identifying is a set of primers capable of specifically amplifying the biomarker preferable a nucleic acid/DNA marker /insert, or a part thereof according to the invention. The invention also relates to a kit for performing the methods of the invention, comprising primers and or probes based on the unique C. difficile type specific genetic markers of the present invention for amplifying and/or detecting a [hyper] virulent and/or toxigenic Clostridium difficile type, more in particular a ribotype 078 strain and/or ribotype 078- like (associated) strain and/or a Clostridium difficile ribotype 027 and or and/or ribotype 027- like (associated) strain. All necessary enzymes, buffers, ingredients and the like of a kit of the invention are well known in the art.

Preferably said kit and/or assay comprises at least one of: a set of primers consisting of a primer consisting of the nucleotide as shown in SEQ: ID: 3 and the primer consisting of the nucleotide sequence as shown in SEQ: ID: 4; a set of primers consisting of the primer consisting of the nucleotide as shown in SEQ: ID: 5 and the primer consisting of the nucleotide sequence as shown in SEQ: ID: 6.

In another preferred embodiment the invention provides a kit and/or assay for the detection and/or distinguishing and/or identification and/or isolation and/or classification and/or characterization of a Clostridium difficile

virulent/hypervirulent type, more in particular a Clostridium difficile RT 078 and/or RT 027 and/or RT 078 and/or RT 027-like (associated) strain wherein the means for detecting/distinguishing/identifying is at least one nucleic acid probe having a nucleotide sequence complementary to a unique nucleic acid/DNA marker/insert sequence of the invention and/or a probe comprising a modified nucleic acid/DNA marker/insert sequence of the invention, such as a modification of the insert sequence by substitution, addition, deletion, or insertion of one or several nucleotides. Means to modify a (bio) marker nucleic acid/DNA/insert sequence of the invention are known in the art. Included are (modified) synthetic forms.

The invention relates to an assay and/or kit for the isolation and/or detection and/or distinguishing and/or identification and/or classification and/or characterization of a virulent/hypervirulent and/or toxinogenic Clostridium difficile type/ribotype/strain in a sample, wherein the following steps are performed, (a) a sample is provided for, (b) in a multiplex PCR assay [see Mc Millin et al., 1992; incorporated herein by reference], (c) the sample is analyzed with respect to the presence or absence of a (bio)marker for example a DNA marker insert or a part thereof of the present invention; optionally, the sample is additionally analyzed with respect to the following (d) the sample is analyzed with respect to the presence or absence of one or more virulence markers, for example but not limited to virulence markers tcdA, tcdB, cdtA, and cdtB [by way of example but not limited to see MacCannell et al., 2006; incorporated herein by reference] and/or a dysfunctional toxin regulator gene icdC-negative toxin regulator gene [by way of example but not limited to see MacCannell et al., 2006; Spigaglia and Mastrantonio, 2002; incorporated herein by reference]. Type 078 and type 027 have similar virulence factors, positive for toxin A, B and binary toxin, and a dysfunctional toxin regulator gene] and/ or cellular antigens for example but not limited to glutamate dehydrogenase antigen (Ag-EIA) (Ticehurst et al., 2006, incorporated herein by reference). Preferably, the sample is additionally analyzed with respect e ) detecting a disruption in the Thy X gene and/or the intergenic region between GuA synthase and nucleotidase CD0198 and/or CD0199, for example but not limited to said disruption in the Thy X gene is an exchange of ThyX for Thy A and DHFR or a functional equivalent thereof.

In a preferred embodiment of the present invention is a kit of parts comprising a) a means for specifically detecting the DNA marker/insert sequence of the invention or a part thereof; and/or (b) means for detecting a hypervirulent strain virulence factor, for example but not limited to, C. difficile toxins A and/or toxin B and/or binary toxin or functional equivalents; c) means for detecting a dysfunctional toxin regulator gene or gene product; d) means for detecting glutamate dehydrogenase (GDH). The glutamate dehydrogenase of C. difficile is highly conserved and can be used as in combination with a) and b) and c) as a diagnostic marker for the presence of C. difficile in biological samples/specimens. Methods and means for detecting C. difficile virulence factors, for example toxins, dysfunction in toxin regulator genes, increased spore production and GDH are known in the art and also disclosed herein. In a further embodiment said kit of part comprises a means for detecting a disruption in the Thy X gene and/or the intergenic region between GuA synthase and nucleotidase CD0198 and/or CD0199. Preferably but not limited to, said disruption in the Thy X gene is an exchange of ThyX for Thy A [for example; see Table 1; CDR20291_0043; SEQ ID: 10] and DHFR [for example Table 1. CDR20291_0044; SEQ: ID 11] or a functional equivalent of. A functional equivalent as used herein is a gene encoding a product capable of performing a function like or similar to the ThyX gene in a C. difficile strain. The invention further provides the use of a kit and/or assay according to the invention and/or a kit of parts for detecting and/or distinguishing and/or identifying and/or isolating a Clostridium difficile virulent/hypervirulent and/or toxigenic type/ribotype/strain. The present invention also provides the use of a biomarker as disclosed herein, for example but not limited to a C. difficile type specific nucleic acid/DNA marker/protein marker and/or method and/or a kit and/or a kit of parts of the present invention for detecting and/or distinguishing and/or identifying and/or isolating a Clostridium difficile RT

078- like (associated) strain, preferably ribotype 033 strain and/or Clostridium difficile ribotype 045 strain and/or Clostridium difficile ribotype 066 strain and/or Clostridium difficile ribotype 066 strain but not limited to.

The present invention also provides the use of a stable/constant biomarker as disclosed herein, for example a C. difficile type specific nucleic

acid/DNA/protein marker and/or method of and/or a kit of the present invention for detecting and/or distinguishing and/or identifying and/or isolating a ribotype RT 027 like strain; Clostridium difficile ribotype (RT) 016 strain and/or Clostridium difficile ribotype 036 strain and/or Clostridium difficile ribotype 075 strain and/or Clostridium difficile ribotype 122 strain and/or and Clostridium difficile ribotype 153 strain.

The invention further provides the use of a method and/or kit and/or assay according to the invention and/or a kit of parts for the for detecting and/or distinguishing and/or identifying and/or isolating a Clostridium difficile virulent/hypervirulent and/or toxigenic type/ribotype/strain, more in particular a virulent/hypervirulent and/or toxigenic RT 078 and/or RT 027 type ribotype/strain.

The invention further provides the use of a stable/constant biomarker as disclosed herein, for example a C. difficile type specific nucleic

acid/DNA/protein marker and/or method of and/or a kit and/or assay and/or a kit of parts of the present invention to determine/establish the virulence potential/pathogenicity of a Clostridium difficile type/ribotype/strain. The invention further provides a 027, 078 specific biomarker, more specifically but not limited to the type specific nucleic acid insert(s) and/or method and/or kit and/or assay of the present invention to distinguish between C. difficile strains based on their virulence potential/pathogenicity.

The invention further provides a Clostridium difficile type/ribotype/strain; preferably a virulent, even more preferable a hypervirulent and/or toxigenic type detected and/or identified and/or isolated and/or classified using a biomarker; more specifically a nucleic acid marker and/or a protein marker according to the invention and/or a method and/or a kit and/or assay and/or a kit of parts according to the invention.

MATERIALS AND METHODS COMPARATIVE GENOMICS.

The whole genomes of RT027 and RT078 were compared with RT 012 genome using the NCBI blast application. For this purpose a C. difficile protein database was selected containing gene -identifier information together with the corresponding protein sequences. We discarded proteins that are either abundantly present in the genome (NOT ribosomal[text] NOT rDNA[text] NOT tRNA[text] NOT polymerase [text] NOT rRNA[text] NOT

transporter[text]) or proteins that are likely to transfer to other genomes (NOT gyrase[text] NOT tetracycline [definition] NOT transposon[text] NOT phage[text] NOT recombinase[text] NOT translocase[text] NOT conjugation[text]). The genomes of our interest (RT 027 and RT 078) were translated by BlastX and compared with the C. difficile protein database. Whenever a hit in protein sequence was found, the corresponding gene- identifier was maintained. This procedure was also performed for the reference strain genome [RT012], which resulted in a second set of gene-identifiers. Differences between both sets of gene identifiers were selected as potential markers for hypervirulent strains. Next was analyzed the genomic region of the potential markers for the presence of genes that are associated with mobile elements. The presence of such-genes in the vicinity of markers could indicate that they are not stably present. The remaining markers were screened for their uniqueness by performing a blastn- and a blastp- homology search of the selected region against all other sequenced genomes. Finally markers with no significant homology to the selected strains were considered as the most promising, genome views were produced using the xBASE genome database (Chaudhuri et al., 2008, incorporated herein by reference).

PCR AMPLIFICATION

The inserts were amplified by PCR using 20 pmol of Forward and Reverse primers, 1 unit of GoTaq DNA polymerase (Promega) in 25 μΐ of lxGreen GoTaq Flexi Buffer PCR buffer (Promega), 0.2 mM dNTPs, 3 mM MgC12. The amplification was performed at 94°C for 2 min, 30 cycles of 95°C for 30 s, 50°C for 30 s, and 72°C for 30 s, followed by a final extension at 72°C for 10 min. Primers that were used for amplifying the 078 marker insert were SEQ: ID 3 & SEQ: ID: 4. Primers that were used for amplifying the 027 marker insert were SEQ: ID 5 & SEQ: ID:6. The PCR products were subjected to

electrophoresis on agarose gel (1.5%).

RIBOTYPING

PCR-ribotying is a technique that gives specific multiple bands by use of a single primer set. It is based on the amplification of spacer regions between 16s and 23s RNA ribosomal genes. The variability in length and number of copies provide means for classification of strains (Catwright CP et.al.1995. PCR amplification of rRNA intergenic spacer regions as a method for epidemiologic typing of Clostridium difficile. J Clin, Microbiol. Jan; 33(1): 184-7. The term "ribotype" indicates patterns obtained by hybridization with 16/23S RNA probes, whereas PCR-ribotyping uses amplification of ITS between 16/23 S DNA genes. Other methods of ribotyping are well known in the art, for example digestions, southern and the like. GENETIC SIMILARITY ANALYSIS

Dendrograms of PCR ribotype amplification profiles were performed with Bionumerics software version 6.01 (Applied Maths NV, Sint-Martens-Latem, Belgium) using similarity-based clustering: unweighted pair- grouping.

EXAMPLES

EXAMPLE 1.

GENOME SEQUENCING OF C.dlFFICILE RIBOTYPE 078 AND 027 SPECIFIC INSERT.

Whole genome sequencing of various PCR ribotypes (He et al., 2010;

incorporated herein by reference) revealed 4.1 to 4.3 Mb chromosomes with a mosaic of mobile elements. Matching up the genome of reference strain 630 (PCR ribotype 012) with ribotype 027 and 078 strains revealed several potential distinctive inserts (see materials and methods). These include (parts of) transposable elements (Sebaihia et al., 2006; incorporated herein by reference), phage-islands (defined by blast hits in Clostridium phages) and CRISPR (Clustered Regularly Interspaced Short Palindromic Repeats) associated proteins (annotated in 078 strain C. difficile QCD- 23m63). These and several other inserts coding for genes in recombinational pathways were discarded for selection of established genes.

After applying these criteria the most promising regions were selected (Figure la and Table 1). Figure 1 b shows a Blast nucleotide database search of the selected 027 and 078 regions including flanking regions. The flanking regions show a good alignment with all full-length sequenced PCR ribotypes, whereas the unique inserts are only found in the corresponding ribotype, 078 (M120 strain) and 027 (R20291; BIl; CD196;2007855 strains), respectively. In order to validate the presence of the 027/078-specific inserts, a PCR with a primer pair amplifying part of the insert was established (see Materials and Methods). 68 representative strains from a PCR ribotype library

(Leeds/Leiden) were analyzed for the presence of the 078 and 027 specific inserts. Surprisingly, while 63 tested negative for the presence of the 078- specific region, 4 other ribotypes showed a PCR amplification product (Figure 2a). Positive for the 078 insert were PCR ribotypes 033, 045, 066, 078 and 126. In order to confirm these results we selected additional isolates for these respective ribotypes obtained from different geographical location and outbreaks. In total seven ribotypes RT033, eleven RT045, one RT066, thirty- two RT078 and nine RT126 were tested. All these isolates tested positive for the presence of the 078- specific region (Figure2c and data not shown).

Similar for the 078-specific insert we tested our PCR ribotype library for the presence of the 027-specific region. As shown in figure 2b besides RT027, ribotypes 016, 036, 075, 122 and 153 showed a PCR amplification product. The presence of the 027-specific region in these ribotypes was partially confirmed by testing additional isolates. In total four ribotypes RT016, three RT036, four RT075, six RT122, three RT153 and twenty-four RT027 were tested. All these additional isolates, with the exception of the six RT122, tested positive for the presence of the 027-specific insertion (Figure 2d and data not shown). The frequencies of the ribotypes that are present in the identified clusters were analysed. A collection of approximately 1500 isolates, obtained between January 2009 and August 2010, was used to determine the ribotype frequencies. The frequencies show that the hypervirulent strains 078 and 027 are the most prevalent ones in the clusters (Figure 3). EXAMPLE 2

RT 078 SPECIFIC INSERT

The unique insert region selected for RT 078; SEQ: ID: 1 is 1675 bp long and contains three open reading frames. Besides RT078, strains RT 033, 045, 066 and 126 contain this insert. Clearly the presence of a unique insert within these ribotypes suggests that they share a common ancestor, which is confirmed by the fact that these seemingly diverse PCR ribotypes form a group with similar ribotype patterns (Figure 3). Sequence analysis of the 16S rRNA genes of strains 033, 045, 066 and 078 showed that these contain a unique base change a single base change (transition of T to C) at position 145 (Rupnik et al. (2001); incorporated herein by reference) compared to other strains suggesting that these represent a well defined subpopulation within C. difficile. The ribotype most prominently present in farm animals is 078, accounting for more than 90% in porcine and bovine isolates. Other RT circulating in livestock are ribotypes 002, 033, 045, 066, 077 and 126 (Avbersek et al, 2009; Keel et al., 2007; Pirs et al., 2008; incorporated herein by reference). Besides ribotypes 002 and 077, all these ribotypes tested positive in the 078-specific PCR of the present invention representing more than 95% of the species found in this animal population.

The insertion of the 078 locus is precisely in the intergenic region between GuA (GMP synthase) and a putative nucleotidase (CD0198 and RT0199 respectively, annotation according to reference strain 630). Homology searches in the NCBI protein database revealed that the first predicted open-reading- frame (ORF) of the 078-insert/DNA marker (ZP_05399691; Figure la, table 1; SEQ: ID:NO 7), has high sequence identity to proteins encoded by a sulphate- reducing bacteria, Desulfovibrwfructosovorans (E-value 3e-37). Profile analysis of an alignment of protein sequences producing significant hits (Soding, 2005; incorporated herein by reference)) showed that ZP_05399691 (SEQ: ID: 7) belongs to a family of antibiotic biosynthesis monooxygenase (PFAM03992), involved in the biosynthesis of several antibiotics (Sciara et al., 2003;

incorporated herein by reference). It is understood by the present that this transferred gene 078-insert/DNA marker (ZP_05399691 (Figure la; SEQ: ID: 7) could confer a competitive advantage to RT078. It is understood that a person skilled in the art can through methods known in the art, for example mutagenesis studies and testing of mutants can clearly establish a precise role for the 078-insert/DNA marker. EXAMPLE 3

RT 027 SPECIFIC INSERT

The RT027 specific insert is 4156 basepair long and contains four open reading frames. In addition to RT027, strains 016, 036, 075, 122 and 153 contain the insert. Clustering of ribotypes confirmed that all these ribotypes, except

RT122, are closely related to each other indicating that the insert is obtained from a common ancestor. RT122 did not group together with the 027-cluster, which indicates that this ribotype is probably not closely related to the types present in the 027-cluster. Unlike the 078-insert insertion of the 027-specific region causes disruption of the Thymidylate synthetase gene (ThyX, see Figure la). This is suprising since ThyX is an essential gene required for biosynthesis of the DNA base thymine (dTMP). Its important role in microbial DNA replication and presence in several pathogenic bacteria makes it an attractive target for antibiotic drug development (Esra et al., 2008; Koehn et al., 2009; incorporated herein by reference). Surprisingly, the 027-insert replaces ThyX by a different, although functionally equivalent, enzyme Thymidylate synthetase A (ThyA) [see Table 1; CDR20291_0043; SEQ ID: 10]. Both

Thymidylate synthetases share no structure or sequence homology and use different mechanisms in the biosynthesis of dTMP (Koehn et al., 2009;

incorporated herein by reference). In contrast to ThyX, which catalysis results in formation of tetrahydrofolate (THF), used in dTMP cycling, ThyA produces dihydrofolate (DHF) and requires an additional enzyme dihydrofolate reductase (DHFR) to produce THF (Koehn and Kohen, 2010; incorporated herein by reference).

Interestingly, the 027-insert contains a DHFR gene next to the ThyA gene (Table 1. CDR20291_0044; SEQ: ID 11), suggesting that these enzymes are coacting. It is known that the ThyA enzyme is catalytically more efficient than the ThyX enzyme (Escartin et al., 2008; incorporated herein by

reference), and consequently microbes that contain the highly active ThyA have a growth advantage. This could explain the exchange of ThyX for ThyA plus DHFR in RT027. Furthermore, if anticipated antimicrobial drugs directed against the thyX encoded enzyme become available C. difficile 027 has already found its way out. Interestingly, the 027 genetic marker is mentioned in a paper Marsden et al., 2010 (incorporated herein by reference), where they report that this insert of four genes is present in RT001, RT027 and RT078. Our results and in silico genome comparisons (Figure lb) clearly show that the insert is unique to RT027 and not present in PCR ribotypes 001 and 078, thus showing the sensitivity of the novel and pioneering typing method of the present invention.

EXAMPLE 4

RT 027- RT 078 PHYLOGENETICALLY RELATED

The presence of the 027 and 078 markers in several PCR ribotypes suggests that a common ancestor obtained these respective inserts. Potential

relationships among these strains were examined through cluster analysis of the PCR-ribotypes and generated patterns are presented in a dendrogram (Figure 3). Strikingly and surprisingly, strains positive for the 078 marker had similar PCR ribotype patterns and cluster together in a distinct group (boxed in figure3). Strains positive for the 027 marker were also grouped together in a single cluster (boxed in figure 3) with the exception of ribotype 122. Thus, the bio marker inserts more specifically DNA marker(s)/insert(s) of the present invention for 027 and 078 recognize PCR ribotypes that are grouped in distinct groups and genetically closely related, phylogenetically related, demonstrating the effectiveness/precision of the use of unique 027- and 078- inserts/ DNA markers of the present invention to distinguish C .difficile - 027 or 078 -like strains.

Both the 027 and 078 insertions are not part of a module involved in

conjugation or excision (Sebaihia et al., 2006; incorporated herein by reference) and are probably stably integrated, as is exemplified by their presence in 027/078-strains collected from different outbreak throughout the world (14 European countries and Australia) over a period of four years (between 2006 and 2010). We suggest that both clades containing the described insert (figure 3) correspond to a phylogenic coherent group derived from a single progenitor. PCR analysis of the 027/078-loci provides an easy way to selectively type these strains, irrespective of host and geographic location. Direct identification of 027 and 078 strains suggests that a typing method of the present invention can be used to distinguish virulence potential. Genes were also sequenced next to the 027-insert (NusG) and 027 marker mutations were found confirming a common ancestor (Figure la). Also the 078-clade have the same characteristic 39 bp deletion in TcdC (regulator) [see Curry et al., J Clin Microbiol. 2007 Jan;45(l):215-21. Epub 2006 Oct 11; incorporated herein by reference] (see also table 2 figure and legend) thus confirming the specificity of the pioneering typing method for the detection/characterization of (hyper) virulent C. difficile type/ribotype/strain. In addition other factors influencing disease severity TcdA, TcdB and binary toxins can be confirmed in a multiplex assay. The present invention provides unique stable/constant DNA marker(s) - 027 and 078 inserts and a method of the present to identify (hyper) virulent C. difficile strains, more in particular to detect/identify 027-and 078-like (associated) type/strains in a simple and reproducible manner.

EXAMPLE 5

Methods

Comparison of full length genomes

Whole genomes of PCR ribotype 078 and 027 were compared with the PCR ribotype 012 genome using the NCBI BLAST application. The genomes of interest (PCR ribotype 078 and PCR ribotype 027) were translated by BlastX and compared with a C. difficile protein database. This protein database, containing gene-identifier information for each ribotype together with corresponding protein sequences, was created by using the Choose Search Set functionality of BlastX. By selecting C. difficile NAP08 (taxid: 525259) and C. difficile R20291 (taxid: 645463) the Blast search was restricted to the sequences in the database from the organism that we selected. To discard genes that were abundantly present in the genome, we entered the following query into the Entrez query syntax: (NOT ribosomal[text] NOT rDNA[text] NOT tRNA[text] NOT polymerase [text] NOT rRNA[text] NOT

transporter[text]). For genes that were likely to transfer to other genomes the following query was entered into the Entrez query syntax: (NOT gyrase[text] NOT tetracycline [definition] NOT transposon[text] NOT phage [text] NOT recombinase[text] NOT translocase[text] NOT conjugation[text]). A cut-off value of le-06 (E-value) was used to indicate a positive hit. Whenever a hit in protein sequence was found, the corresponding gene-identifier was

maintained. Next, we translated the genome of C. difficile 630 (PCR ribotype 012) with BlastX using C. difficile NAP08 (taxid: 525259) or C. difficile R20291 (taxid: 645463) annotation. This was done to circumvent the problem of differences in gene annotation between C. difficile strains. This resulted in a second set of gene-identifiers with similar annotation as used for generating the first set. Both sets were compared and differences selected as potential markers for the specific strains. An additional manual screen was performed on the markers found in order to discard genes that were not excluded by the initial query but still were likely to transfer to other genomes, for example any antibiotic resistance gene. Then, we analyzed the genomic region of the potential markers for the presence of genes associated with mobile elements. The presence of such genes in the vicinity of markers could indicate that they are not stably present and therefore, potential markers associated to such genes were discarded. The remaining markers were screened for their uniqueness by performing a blastN- and a blastP- homology search of the selected region against all other sequenced C. difficile genomes (630- AM180355.1; CD196-FN538970.1; R20291-FN545816.1; 2007855-FN665654.1; BI 1-FN668941.1; M120-FN665653.1; BI9-FN668944.1; M68-FN668375.1; CF5- FN665652.1). Markers with no significant homology other than to the selected strain were considered the most promising. Finally, genome views were produced using the xBASE genome database (Chaudhuri et al., 2008).

PCR amplification

Purification of genomic DNA was performed by using the QIAamp DNA Blood Mini Kit (Qiagen, the Netherlands) according to manufactures' protocol. Part of the markers were amplified by PCR using 20 pmol of Forward and Reverse primers (table 3), 1 unit of GoTaq DNA polymerase (Promega) in 25 μΐ of lxGreen GoTaq Flexi Buffer PCR buffer (Promega), 0.2 mM dNTPs, 3 mM

MgC-2. The amplification was performed at 94°C for 2 min, 30 cycles of 95°C for 30 s, 50°C for 30 s, and 72°C for 30 s, followed by a final extension at 72°C for 10 min. The PCR products were visualized by electrophoresis on agarose gel (1.5%) containing ethidium bromide.

Validation of PCR ribotype 078 and PCR ribotype 027 specific markers

The presence of the specific markers was validated by screening thirty-six 078 and twenty-four 027 clinical isolates originating from various geographical locations and times. In addition, a library of 68 unique representative PCR ribotypes (Leeds-Leiden collection), including the 20 most frequently found PCR ribotypes in the Netherlands, was screened for presence of the genetic markers. This library was validated (i.e. confirmation of the PCR ribotype) by several specialized laboratories in Europe and Canada. If other PCR ribotypes were found positive for the insert, additional strains from these PCR ribotypes were screened. PCR products obtained from several PCR ribotypes were sequenced to confirm amplification of the intended regions.

Genetic Similarity Analysis

AFLP was performed as previously described (Killgore et al., 2008). Briefly, whole genomic DNA was restricted with two enzymes (Pstl and Msel), followed by ligation of two corresponding adapters (Pstl- and Msel-adaptor) to the restriction sites. Then, the Pst-0 primer and Mse-C primer (table 3) were used to amplify the Pstl and Msel tagged fragments. One selective nucleotide (Mse- C) was introduced to reduce the complexity of the amplified AFLP pattern. Pst-0 was fluorescently labeled with carboxyfluorescein (Eurogentec,

Maastricht, the Netherlands). Analysis of the amplification was done on an ABI Prism 3130 capillary sequencer. The resulting DNA patterns were compared using the Bionumerics software package, version 3.0 (Applied

Maths, Sint-Martens-Latem, Belgium). Similarity coefficients were calculated with Pearson correlation and dendrograms were created by the unweighted pair group method using arithmetic averages (upgma) clustering.

PCR ribotyping was performed as previously described (Bidet et al., 1999). Dendrograms of PCR ribotype amplification profiles were used to analyze genetic similarity. Similarity coefficients were calculated with Pearson correlation and dendrograms were created with Bionumerics software version 6.01 (Applied Maths NV, Sint-Martens-Latem, Belgium) using curve based clustering. The presence of the genes tcdA, tcdB, cdtA and possible deletions in the tcdC gene were detected through PCR as previously described and used to study genetic similarity (Alonso et al., 1999;Kato et al., 1999;Spigaglia & Mastrantonio, 2002).

Incidence data and patient characteristics

The prevalence of various PCR ribotypes was determined using the database of the Dutch Reference Laboratory. All isolates submitted (n=4383) to this laboratory between January 2005 and December 2010 were included in the database and were derived from patients with diarrhoea. To investigate the type-specific course of CDI with sufficient power, we used the dataset of a recent pan-European study (Bauer et al., 2011) combined with the dataset of a three-year lasting incidence study in which all patients with diarrhoea and a positive toxin test from 13 hospitals in the Netherlands were included

(unpublished). Three months after the diagnosis, the survival status was determined (total n=1026 patients). We compared the 90-day mortality rate between patients with CDI due to PCR ribotype 078, 078-like, 027, 027-like strains and other PCR ribotypes by means of the Fisher's exact test. PASW 17.0.2 (SPSS Inc., Chicago) statistical software was used for our analyses.

Results

Identification of inserts specific for C. difficile PCR ribotypes

078 and 027

Whole genome sequencing of various PCR ribotypes revealed 4.1 to 4.3 Mb chromosomes with a mosaic of mobile elements (He et al., 2010). Matching up the genome of reference strain 630 (PCR ribotype 012) with PCR ribotype 078 and 027 strains (see materials and methods) revealed several potential distinctive markers, including (parts of) transposable elements (Sebaihia et al., 2006), sequences of phage-origin (defined by blast hits in Clostridium phages) and CRISPRs (Clustered Regularly Interspaced Short Palindromic Repeats) associated proteins (annotated in 078 strain C. difficile QCD-23m63). The above mentioned markers and several other inserts coding for genes involved in recombination were discarded for further analysis. Of the remaining markers, we selected the regions with no significant homology other than to the strain of interest (PCR ribotype 078 and 027 strains) as the most promising markers. As a result, we identified two potentially unique inserts, one present in PCR ribotype 078 and the other present in PCR ribotype 027. Fig. 4(a) shows a Blast nucleotide database search of the selected 078 and 027 regions including flanking regions. The flanking regions show a good alignment with all full-length sequenced C. difficile strains, whereas the unique inserts are only found in the corresponding ribotype, 078 (M120 strain) and 027 (R20291;BI1;CD196;2007855 strains), respectively.

Characterization of PCR ribotype 078 and 027 specific inserts The region selected for PCR ribotype 078 is 1675 basepairs long and contains three open reading frames (ORFs) (see fig. 4(b), table 4). The insertion of the 078 locus is precisely in the intergenic region between guaA (GMP synthase) and a putative nucleotidase (CD0198 and CD0199 respectively, annotation according to reference strain 630). Homology searches in the NCBI protein database revealed that the first predicted ORF of the 078-insert, ZP_05399691, has high sequence identity to proteins encoded by a Gram-negative sulphate- reducing bacteria, Desulfovibrio fructosovorans (E-value 3e-37 and data not shown). Profile analysis of protein sequences (Soding, 2005) showed that ZP_05399691 belongs to a family of antibiotic biosynthesis monooxygenases (E-value 0.0019; PFAM03992), involved in the biosynthesis of several antibiotics (Sciara et al., 2003). Profile analysis of the predicted ORF

ZP_05399692 did not produce significant hits (data not shown), whereas blastP analysis of the ORF ZP_05399693 resulted in a GCN5-acetyltransferase as the closest homologue. It should be noted that an isolated transposase-like protein B is situated at 1.4 kb downstream of the 078 insert, which is not part of the insert itself.

The PCR ribotype 027-insert is 4156 basepairs long and contains four ORFs (see fig. 4(b), table 4). Unlike the 078-insert, the 027-insertion disrupts the thyX gene (flavin dependent thymidylate synthase) in which it has inserted (see fig. 4(b)). The first two ORFs CDR20291_0043 and CDR20291_0044) of the 027-insert encode for the enzymes thymidylate synthetase A (Thy A) and dihydrofolate reductase (DHFR), which are both involved in the biosynthesis of DNA base thymine (dTMP). The third ORF (CDR20291_0045) has homology to the Sir2 family of protein deacetylases (2.2e-26). The last ORF encodes for the thiamine biosynthesis protein ThiC (CDR20291_0046).

The insertion of the 027-region into the gene encoding ThyX resulted in a nonfunctional thyX gene, which is subjected to accumulation of mutations. The relative age of this non-functional gene is reflected in its number of

accumulated mutations. Compared to PCR ribotype 012, containing a functional thyX, a total of 38 mutations has occurred in this gene (540 nt). With an estimated synonymous mutation rate of 0.0002 per genome/per generation in C. difficile (note: including functional ORFs) (He et al., 2010), it is clear that the 027-insertion has occurred early in the Clostridium lineage and is present since.

Validation of PCR ribotype 078 and 027 specific inserts

In order to confirm the uniqueness of the 078/027-specific inserts, we developed a PCR with a primer pair amplifying part of the insert (see

Materials and Methods). Sixty-eight representative strains from a validated PCR ribotype library (collaboration of University of Leeds and University of Leiden) were analyzed for the presence of the 078 and 027 specific inserts. Surprisingly, while 63 tested negative for the presence of the 078-specific region, 4 other PCR ribotypes showed a PCR amplification product (see fig. 5(a)). Positive for the 078 insert were PCR ribotypes 033, 045, 066, 078 and 126. In order to confirm these results we used the database of the reference laboratory of the Leiden University Medical Center for C. difficile to select additional isolates for these respective ribotypes obtained from various geographical locations and outbreaks. In total seven strains PCR ribotype 033, eleven PCR ribotype 045, one PCR ribotype 066, thirty-two PCR ribotype 078 and nine PCR ribotype 126 were tested. In addition, we included a strain belonging to PCR ribotype 127 to our analysis since this ribotype has a similar banding pattern as PCR ribotype 078 (see fig. 7). All these isolates, including several animal strains, tested positive for the presence of the 078-marker (see fig. 5(c) and data not shown).

We also tested our PCR ribotype library for the presence of ribotypes containing the 027-region. As shown in fig. 5(b), besides PCR ribotype 027, PCR ribotypes 016, 036, 075, 122 and 153 contained the 027-specific region, as evidenced by the presence of a PCR amplicon. The presence of the 027-region in these PCR ribotypes was confirmed by testing additional isolates. In total four strains PCR ribotype 016, three PCR ribotype 036, four PCR ribotype 075, four PCR ribotype 153, one PCR ribotype 122 and twenty-four PCR ribotype 027 were tested. In addition, we supplemented our collection with strains belonging to PCR ribotype 019, 111 and 156 since two recent studies have indicated that these types are closely related to PCR ribotype 027 (Griffiths et al., 2010;Zaiss et al., 2009). Furthermore, we included three strains belonging to PCR ribotypes 176, 208 and 273, which have similar PCR ribotype patterns as PCR ribotype 027 (see fig. 7). All these strains tested positive in our PCR for the presence of the 027-marker (see fig. 5(d), and data not shown). In summary, after screening a large collection of different PCR ribotypes, we found that the 078- and 027-insert are also present in several other PCR ribotypes.

Comparative analyses of strains containing the genetic marker The presence of the 078- and 027-markers in several PCR ribotypes suggests that a common ancestor obtained these respective inserts. Potential

relationships among these strains were examined through cluster analysis (see material and methods) of AFLP patterns and PCR ribotype banding patterns. The generated AFLP patterns are presented in a dendrogram (see fig. 6).

Strains positive for the 078-marker and the 027-marker had similar profiles and evidently cluster together into distinct groups with a relative similarity of approximately 85% (see fig. 6, blue for 027-group, green for 078-group) corresponding to the cut-off value used for identical strains (Killgore et al., 2008). Similar as for the AFLP patterns, we presented the generated ribotype banding patterns in a dendrogram (see fig. 7). Strains positive for the 078- marker clustered together in a distinct group (relative similarity > 85%).

Strains positive for the 027-marker also clustered together in a single group with only PCR ribotype 156 showing a divergent pattern. Thus, our markers for 078 and 027 recognize PCR ribotypes that are clustered in distinct and genetically related groups, supporting the use of these inserts to identify these '078-like' and '027-like' types.

To further study potential relationships among the 078-like and 027-like strains, we analyzed the toxin profiles (see table 5). All strains in the 078-like group, with the exception of the strain belonging to PCR ribotype 033, were positive for toxin A (tcdA), toxin B (tcdB) and binary toxin (cdtA). The PCR ribotype 033 strain was negative for tcdB. Others have shown that PCR ribotype 033 can also be positive for tcdB (Pituch et al., 2006). In addition, all strains in the 078-like group possessed the 39bp tcdC deletion, which is a distinct marker for PCR ribotype 078 (Goorhuis et al., 2008), supporting the notion that these strains are highly related. All strains in the 027-like group were positive for tcdA, tcdB and cdtA with the exception of a PCR ribotype 208 strain, which was negative for cdtA. Furthermore, we observed heterogeneity for the presence of the 18bp tcdC deletion within the 027-like group as previously reported by another group (Janvilisri et al., 2009).

Next, we analyzed the prevalence of PCR ribotypes that were positive for the 078/027-insert. Hypervirulent strains 078 and 027 comprise 10% and 11% of the total number of samples (n=4383) submitted to the Dutch National Reference Laboratory, respectively (see fig. 7, right panel/ frequency). All other types tested were less frequently found (< 1.3%). Although 078-like and 027- like strains are only found sporadically, we analyzed whether these strains were as hypervirulent as their counterparts, considering the number of deaths after 90 days. Patients with CDI due to PCR ribotype 078 and 078-like died in 26% (28/104) and 27% (7/26) respectively after 90 days, which was more often than patients who suffered from CDI due to other types (20% (166/812). This difference, however, was statistically not significant (p=0.13 and p=0.46, respectively). Patients with CDI due to type 027 and 027-like died in 34% (24/70) and 29% (4/14) after 90 days. The difference in mortality in patients with CDI due to PCR ribotype 027 was significantly higher than mortality in patients with CDI due to other types (p=0.01). 027-like patients also died more often than patients with CDI due to other types, however, the p-value was Discussion

Gene transfer between different species allows bacteria to acquire new traits potentially conferring evolutionary adaptations to encountered selective conditions. We have exploited these genes aiming to develop specific PCRs for identification of the two C. difficile hypervirulent PCR ribotypes 078 and 027. In this study we have identified genetic markers for these hypervirulent PCR ribotypes and closely related PCR ribotypes. Both the 078 and 027 insertions are not part of a module involved in conjugation or excision (Sebaihia et al., 2006) and are probably stably integrated, as is exemplified by their presence in 078/027-strains collected from different outbreaks throughout the world (14 European countries and Australia) over a period of four years (between 2006 and 2010).

Comparative analyses show that the PCR ribotypes with the 078-insert (033, 045, 066, 078, 126 and 127) form a phylogenic coherent group, which is reflected by similarities in AFLP patterns, similarities in ribotype patterns, presence of the binary toxin gene cdtA and the presence of the characteristic tcdC deletion (39bp). Similarly, the PCR ribotypes with the 027-insert (016, 019, 027, 036, 075, 111, 122, 153, 156, 176, 208 and 273) are also closely related to each other, which is confirmed by clustering of the AFLP patterns into a distinct group, similarities in ribotype patterns and the presence oi cdtA. Both PCR ribotypes 078 and 027 are the most prevalent types in their cluster, while the 078-like and 027-like strains are found in low numbers among humans (see fig. 7). 078-like strains are presently classified as clade 5; 027-like strains are presently classified as clade 2 (fig. 8).

Clearly, the presence of a unique insert within seemingly diverse PCR ribotypes suggests that they share a common ancestor. Complementary to our comparative analysis, sequence analysis of the 16S rRNA genes of ribotypes 033, 045, 066 and 078 has shown that these all contain a unique base change compared to other strains confirming that they represent a well defined subpopulation within the C. difficile species (Rupnik et al., 2001). In the past few years it has become clear that C. difficile has also emerged as an animal pathogen. The PCR ribotype most prominently present in farm animals is 078, accounting for more than 90% in porcine and bovine isolates (Keel et al.,

2007;Weese et al., 2010). Overlap between 078 isolates from animals and humans lead to the hypothesis of a zoonotic transmission route but awaits confirmation (Bakker et al., 2010). Other ribotypes circulating in livestock are ribotypes 002, 033, 045, 066, 077 and 126 (Avbersek et al, 2009;Keel et al, 2007;Pirs et al, 2008). Except for ribotypes 002 and 077, all these ribotypes tested positive in our 078-PCR representing more than 95% of the species found in livestock. This indicates that the 078-marker can be used for typing 078 and 078-like strains.

The comparative analysis performed in this study shows that the PCR ribotypes with the 027-marker are highly related to each other. Clustering of the PCR ribotype group 027 was partially confirmed by two other research groups (see table 5). Griffiths et al. identified a phylogenetic coherent group of C. difficile strains using Multi locus sequence typing. This group, which was marked as hypervirulent, consist of PCR ribotypes 027, 019, 036 and 153 (Griffiths et al., 2010). In addition, Zaiss et al. performed typing of C. difficile based on tandem repeat sequences (Zaiss et al., 2009). In this study the PCR ribotype 027 was clustered together with ribotypes 019, 111 and 156 into a distinct group. These data, which correlate with our data, confirm that the 027-marker identified in this study can be used to recognize PCR ribotype 027 and 027-like strains. Finally, the 027 genetic marker is noted in a microarray study done by Marsden et al. (Marsden et al., 2010), where it was reported that this insert of four genes is present in PCR ribotype 001, PCR ribotype 027, PCR ribotype 078 and PCR ribotype 106. Our results and in silico genome comparisons (see fig. 4a and 5) clearly show that the insert is present in PCR ribotype 027 and not present in PCR ribotypes 001, 078 and 106.

Rapid and reliable identification of C. difficile types is necessary for controlling CDI. A novel typing method based on the in this paper described markers has some limitations when compared to other typing methods such as PCR ribotyping. The presence of the markers in strains other than the

hypervirulent PCR ribotypes 078 and 027 reduces its discriminatory power. Nevertheless, the markers can be useful in a rapid pre-screen for detecting potential hypervirulent strains. Especially when considering that the hypervirulent strains are the most prevalent strains of their lineages and the other strains are much less frequently found. The result of the newly proposed pre-screen is easy to interpret, i.e. marker present or not present, therefore no expertise nor software and databases are required to perform it. This makes it very suitable for every clinical lab to perform. In addition, the usage of the markers can provide the user with additional information on relatedness between strains since it is capable of identifying hypervirulent PCR ribotypes 078 and 027 and closely related ribotypes with possibly similar virulence potential. This additional information can be of interest especially when taking into account how new PCR ribotypes can arise. New PCR ribotypes are assigned when a ribotype pattern is found which differs by at least one band from already defined types. Recently, it has been published that mechanisms such as homologous recombination (Dingle et al., 2011) or slipped-strand mispairing during DNA replication can be responsible for variation in the intergenic spacer region (Indra et al., 2010). Such events make it plausible that newly identified PCR ribotypes will arise from hypervirulent C. difficile strains, and may share virulence potential and clinical manifestations.

Analysis of the genes that are located on the 078- and 027-insert could elucidate the potential impact of the insert on the phenotype. One of the ORFs present on the 078-insert belongs to a family of genes that are involved in biosynthesis of several antibiotics, which might confer a competitive advantage to PCR ribotype 078.

Insertion of the 027-marker in thyX causes disruption of this gene (see fig. 4(b)). At first this seems puzzling since thyX is an essential gene required for biosynthesis of dTMP. Its important role in microbial DNA replication and presence in several pathogenic bacteria makes it an attractive potential target for antibiotic drug development (Esra et al., 2008;Koehn et al., 2009).

Remarkably, the 027-insert replaces ThyX by a different, although functionally equivalent, enzyme thymidylate synthetase A (ThyA) together with an additional enzyme dihydrofolate reductase (DHFR) (see table 4). Both thymidylate synthetases use different mechanisms in the biosynthesis of dTMP (Koehn et al, 2009). In contrast to ThyX, which produces

tetrahydrofolate (THF), ThyA forms dihydrofolate (DHF) and requires DHFR to produce THF (Koehn & Kohen, 2010). It has been shown that the ThyA enzyme is catalytically more efficient than the ThyX enzyme (Escartin et al., 2008), and consequently microbes that contain the highly active ThyA could have a growth advantage. Experiments such as performing a growth curve with isogenic strains containing either gene (thyX or thyA together with DHFR) should clarify whether there is a difference in growth rate.

This study provides a comprehensive overview of the genetic lineages of C. difficile that are related to hypervirulent PCR ribotypes 078 and 027. PCR analysis of the genetic markers provides a rapid and easy way to type the hypervirulent PCR ribotypes 078, 027 and closely related PCR ribotypes, irrespective of hosts and geographic location.

Acknowledgements

This work was supported by ZonMw grant 50-50800-98-079 from the

Netherlands Organization for Scientific Research (NWO) and HYPERDIFF- The Physiological Basis of Hypervirulence in Clostridium difficile: a

Prerequisite for Effective Infection Control (Health-F3-2008-223585). Legend of the figures Figure 1.

IN SILICO IDENTIFICATION OF UNIQUE INSERTS FOR CLOSTRIDIUM DIFFICILE RIBOTYPES 027 AND 078.

A. Pairwise comparisons are made between PCR ribotype 012 and 078 (top) and 012 with 027 (bottom). Shown are diagrammatic representation of the genes surrounding the inserts using the web based database Xbase (color based on percentage G+C content). Dashed box indicates the inserted region.

B Result of BLASTn homology search of region 249237-250912 of

Clostridium difficile ribotype 078 strain M120 (accession nr. FN665653.1) and region 80832-84988 of Clostridium difficile ribotype 027 strain R20291 (accession nr. FN545816.1) including 300-500 nucleotides flanking region.

Shown is the resulting graphic summary.

Figure 2.

PRESENCE OF 027 AND 078 SPECIFIC REGIONS IN A LARGE PCR RIBOTYPE STRAIN COLLECTION.

A, B. Results from PCR amplification reactions of the 078 specific insert (A) and the 027 specific insert (B) performed on isolates representing various PCR ribotypes as indicated by numbers above the lanes.

C. Diverse isolates both from human and animals belonging to PCR ribotypes 033, 045, 078 and 126 were tested for the 078 specific insert. Two letters indicate country code followed by the year of isolation. Small numbers above the isolation year indicate different isolation source than humans i.e. calve (1), horse (2) and pig (3).

D. Diverse isolates belonging to PCR ribotypes 016, 036, 075 and 176 were tested for the 027 specific insert. Lane identification by numbers refers to ribotype number. Lanes identified as "M" contain a 100 bp size marker (Roche diagnostic). PCR products were separated on a 1,5% (w/v) agarose gel. Figure 3.

DENDROGRAM OF 68 CLOSTRIDIUM DIFFICILE STRAINS BASED ON PCR RIBOTYPE ILLUSTRATING THE CLUSTERING OF STRAINS POSITIVE FOR THE 027- AND 078-TYPE SPECIFIC MARKERS.

Hierarchical clustering of genotypes was established by the Bionumeric software package (Applied Maths) using unweighted pair-grouping (see materials and methods). The frequencies, belonging to the strains positive for our markers, were calculated over a total of 1552 ribotypes that were gathered in a period between the beginning of 2009 and august 2010.

Figure 4.

IN SILICO IDENTIFICATION OF UNIQUE INSERTS FOR C.

DIFFICILE PCR RIBOTYPES 078 AND 027.

A. Result of BLASTn homology search of region 249237-250912 of

Clostridium difficile ribotype 078 strain M120 (accession nr. FN665653.1) and region 80832-84988 of Clostridium difficile ribotype 027 strain R20291

(accession nr. FN545816.1) including 300-500 nucleotides flanking region. Shown is the resulting graphic summary.

B Pairwise comparisons are made between PCR ribotype 012 (630) and 078 (top) and 012 with 027 (bottom). Shown are diagrammatic representations of the genes surrounding the inserts using the web based database xBASE (color based on percentage G+C content). Blue dashed box indicates the inserted region, arrows indicate the PCR primers used for amplification and scale bar indicates the size of a lkb region. Figure 5.

PRESENCE OF 078- AND 027-MARKERS IN A LARGE PCR RIBOTYPE STRAIN COLLECTION.

A, B. Results from PCR amplification reactions of the 078 insert (A) and the 027 insert (B) performed on isolates representing various PCR ribotypes as indicated by numbers above the lanes.

C. Diverse isolates both from human and animals belonging to PCR ribotypes 033, 045, 126 and 078 were tested for the 078 insert. Two-letter country codes, followed by the year of isolation, were used to indicate the geographical location of the clinical isolate). Small numbers above the isolation year indicate isolation source other than humans i.e. cow (1), horse (2) and pig (3).

D. Diverse isolates belonging to PCR ribotypes 027, 016, 036, 075 and 153 were tested for the 027 insert.

Lane identification by numbers refers to ribotype number. First lanes contain a 100 bp size marker (Roche diagnostic). PCR products were separated on a 1, 5% (w/v) agarose gel.

Figure 6.

DENDROGRAM OF C. DIFFICILE STRAINS BASED ON AFLP

PATTERNS ILLUSTRATING THE CLUSTERING OF STRAINS POSITIVE FOR THE 078- (GREEN) AND 027-MARKERS (BLUE).

Hierarchical clustering of AFLP types was established by the Bionumeric software package (Applied Maths) using unweighted pair- grouping (see materials and methods). The cut off value for identical strains was set at

85% relative similarity. C. perfringens was included as a control at species level. Figure 7.

DENDROGRAM OF C. DIFFICILE STRAINS BASED ON PCR

RIBOTYPE ILLUSTRATING THE CLUSTERING OF STRAINS POSITIVE FOR THE 078- AND 027-MARKERS.

Hierarchical clustering of PCR ribotypes was established by the

Bionumeric software package (Applied Maths) using curve based clustering (see materials and methods). The prevalence, belonging to the strains positive for our markers, were calculated over a total of 1552 strains that were collected in a period between the beginning of 2009 and august 2010. Similar colors were used to illustrate clustering according to

AFLP patterns. The cut off value for identifying clusters was set at 80% relative similarity.

Figure 8.

C. DIFFICILE CLADES.

A ribotype 078-like strain is a strain of clade 5. A ribotype 027-like strain is a strain of clade 2.

Table. 1 PCR ribotype 027-078 specific open reading frames

Table 2.

PCR ribotypes tested positive for the 027 DNA marker (027-group) or 078 DNA marker (078-group) were tested for the presence (+) or absence (-) of toxin genes using specific primers (1-4; as disclosed herein see below). For TcdC the size of the deletion is indicated in basepairs (bp). Nt not tested. 1. Toxin A

Deletions in the repeating sequences of the toxin A gene of toxin A- negative, toxin B-positive Clostridium difficile strains. Kato H, Kato N, Katow S, Maegawa T, Nakamura S, Lyerly DM. Ferns Microbiology Letters. Volume 175, Issue 2, pages 197-203, June 1999.

Toxin B

Rapid detection of toxigenic Clostridium difficile from stool samples by a nested PCR of toxin B gene. Alonso R, Muiioz C, Gros S, Garcia de Viedma D, Pelaez T, Bouza E. J Hosp Infect. 1999 Feb;41(2): 145- CdtA

FEMS Microbiol Lett. 2000 May 15; 186(2):307-12. Production of actin- specific ADP-ribosyltransferase (binary toxin) by strains of Clostridium difficile. Stubbs S, Rupnik M, Gibert M, Brazier J, Duerden B, Popoff M. TcdC

Molecular analysis of the pathogenicity locus and polymorphism in the putative negative regulator of toxin production (TcdC) among Clostridium difficile clinical isolates. Spigaglia P, Mastrantonio P. J Clin Microbiol. 2002 Sep; 40(9):3470-5.

Table 3. Primers used for developed PCRs and AFLP.

PCR Product size Target Primer sequence (5'-^ 3')

(nt)

078_insert 707 ZP 05399691 , ZP 05399692, fw - AAAGGAACAGCCTAGGGAAC

ZP_05399693 rv - TGGGACTGGAGATTATGG

027_insert 691 CDR20291_0045 fw - TGGCTCAGAGGTAGTTGCTGCG rv - TGGGCAGTGTAGCAGATACGAAAGG

Pst-0 (AFLP) - Pstl adaptor - GACTGCGTACATGCAG

Mse-C (AFLP) - Msel adaptor - GATGAGTCCTGAGTAAC

Table 4. General description of the 078-insert and 027-insert.

Ribotype Other ribotypes Site of insertion Open Reading Frames Putative function

Inserted region Recognized by PCR Reference strain 630

078 033, 045, 066, 126, CD0198-CD0199 ZP_05399691 Antibiotic biosynthesis

Strain M120 127^* 258403 monooxygenase

249237-250812 ZP_05399692 Unknown

ZP_05399693 GCN5-acetyltransferase

027 016, 019, 036, 075, CD0054 CDR20291_0043 Thymidylate synthetase

Strain R20291 111 , 122, 153, 156, 81006-81576 (ThyA)

176, 208, 273^*

80849-84987 CDR20291_0044 Dihydrofolate reductase

(DHFR)

CDR20291_0045 Sir2 family of protein deacetylases CDR20291 0046 Thiamine synthetase

Open reading frames of the ribotype 078 and 027 insert described in this paper (078 strains M120 and C. difficile QCD-23m63; 027 strain R20291).

able S. Molecular characterization of the C. difficile lineages 078 (top) and

REFERENCE LIST

Alonso, R., Munoz, C, Gros, S., Garcia, d., V, Pelaez, T. & Bouza, E. (1999). Rapid detection of toxigenic Clostridium difficile from stool samples by a nested PCR of toxin B gene. J Hosp Infect 41, 145-149.

Avbersek,J., Janezic,S., Pate,M., Rupnik,M., Zidaric,V., Logar,K.,

Vengust,M., Zemljic,M., Pirs,T., and Ocepek,M. (2009). Diversity of

Clostridium difficile in pigs and other animals in Slovenia. Anaerobe. 15, 252-255.

Bakker,D., Corver,J., Harmanus,C, Goorhuis,A., Keessen,E.C,

Fawley,W.N., Wilcox, M.H., and Kuijper,E.J. (2010). Relatedness of human and animal Clostridium difficile PCR Ribotype 078 isolates based on Multi Locus Variable number of tandem repeat Analysis and tetracycline resistance. J. Clin. Microbiol.

Bauer, M. P., Notermans, D. W., van Benthem, B. H., Brazier, J. S., Wilcox, M. H., Rupnik, M., Monnet, D. L., van Dissel, J. T. & Kuijper, E. J. (2011). Clostridium difficile infection in Europe: a hospital-based survey. Lancet 377, 63-73.

Bidet, P., Barbut, F., Lalande, V., Burghoffer, B. & Petit, J. C. (1999).

Development of a new PCR-ribotyping method for Clostridium difficile based on ribosomal RNA gene sequencing. FEMS Microbiol Lett 175, 261- 266.

Brazier, J.S. (2001). Typing of Clostridium difficile. Clin. Microbiol. Infect. 7, 428-431. Burns,K., Morris-Downes,M., Fawley,W.N., Smyth,E.,

Wilcox,M.H., and Fitzpatrick,F. (2010). Infection due to C. difficile ribotype 078: first report of cases in the Republic of Ireland. J. Hosp. Infect. 75, 287- 291.

Chaudhuri,R.R., Loman,N.J., Snyder,L.A., Bailey,C.M., StekeLD.J., and Pallen,M.J. (2008). xBASE2: a comprehensive resource for comparative bacterial genomics. Nucleic Acids Res. 36, D543-D546. Barry Cookson. Hypervirulent strains of Clostridium difficile. Postgrad Med J 2007;83:291-295 doi:10.1136/pgmj.2006.056143

Dingle, K. E., Griffiths, D., Didelot, X., Evans, J., Vaughan, A.,

Kachrimanidou, M., Stoesser, N., Jolley, K. A., Golubchik, T. & other authors (2011). Clinical Clostridium difficile: Clonality and Pathogenicity Locus Diversity. PLoS One 6, e 19993.

Escartin,F, Skouloubris,S, Liebl,U, and Myllykallio,H. (2008). Flavin- dependent thymidylate synthase X limits chromosomal DNA replication. Proc. Natl. Acad. Sci. U. S. A 105, 9948-9952.

Esra, O.F., Boum,Y., Jacquement, C, Spanedda,M.V., Jaber,N.,

Scherman,D., Myllykallio,H., and Herscovici, J. (2008). Design, synthesis and evaluation of potent thymidylate synthase X inhibitors. Bioorg. Med. Chem. Lett. 18, 3628-3631.

Goorhuis,A., Bakker,D., Corver,J., Debast,S.B., Harmanus,C,

Notermans,D.W., Bergwerff,A.A., Dekker,F.W., and Kuijper,E.J. (2008).

Emergence of Clostridium difficile infection due to a new hypervirulent strain, polymerase chain reaction ribotype 078. Clin. Infect. Dis. 47, 1162- 1170.

Goncalves, C, D. Deere, F. Barbut, B. Burghoffer, and J. C. Petit. 2004. Prevalence and characterization of a binary toxin (actin-specific ADP- ribosyltransferase) from Clostridium difficile. J. Clin. Microbiol. 42:1933- 1939.

Griffiths et al. 2010. Multilocus Sequence Typing of Clostridium difficile. Journal of Clinical Microbiology , March 2010, p. 770-778, Vol. 48, No. 3. He,M, Sebaihia,M., Lawley,T.D, Stabler,R.A, Dawson,L.F, Martin,M.J, Holt,K.E., Seth-Smith,H.M., QuaiLM.A, Rance,R., Brooks, , Churcher, C, Harris,D., Bentley,S.D., Burrows,C, Clark,L., Corton,C, Murray, V., Rose, G., Thurston,S., van,T.A., Walker,D., Wren,B.W., Dougan,G., and Parkhill,J. (2010). Evolutionary dynamics of Clostridium difficile over short and long time scales. Proc. Natl. Acad. Sci. U. S. A 107, 7527-7532. Indra, A., Blaschitz, M., Kernbichler, S., Reischl, U., Wewalka, G. &

Allerberger, F. (2010). Mechanisms behind variation in the Clostridium difficile 16S-23S rRNA intergenic spacer region. J Med Microbiol 59, 1317- 1323.

Janvilisri, T., Scaria, J., Thompson, A. D., Nicholson, A., Limbago, B. M.,

Arroyo, L. G, Songer, J. G, Grohn, Y. T. & Chang, Y. F. (2009). Microarray identification of Clostridium difficile core components and divergent regions associated with host origin. J Bacteriol 191, 3881-3891.

Kato, H., Kato, N., Katow, S., Maegawa, T., Nakamura, S. & Lyerly, D. M. (1999). Deletions in the repeating sequences of the toxin A gene of toxin A- negative, toxin B-positive Clostridium difficile strains. FEMS Microbiol Lett 175, 197-203.

KeeLK, Brazier,J.S., Post,K.W., Weese,S., and Songer,J.G. (2007).

Prevalence of PCR ribotypes among Clostridium difficile isolates from pigs, calves, and other species. J. Clin. Microbiol. 45, 1963-1964.

Kelly, CP., Pothoulakis,C, and LaMont,J.T. (1994). Clostridium difficile colitis. N. Engl. J. Med. 330, 257-262. Killgore,G., Thompson,A., Johnson,S., Brazier,J., Kuijper,E., Pepin,J., Frost,E.H., SavelkouLP., Nicholson,B., van den Berg,R.J., Kato,H., Sambol,S.P., Zukowski,W., Woods,C, Limbago,B., Gerding,D.N., and McDonald, L.C (2008). Comparison of seven techniques for typing international epidemic strains of Clostridium difficile: restriction endonuclease analysis, pulsed-field gel electrophoresis, PCR-ribotyping, multilocus sequence typing, multilocus variable-number tandem-repeat analysis, amplified fragment length polymorphism, and surface layer protein A gene sequence typing. J. Clin. Microbiol. 46, 431-437.

Killgore, G. Thompson, A., Johnson, S., Brazier, J., Kuijper, E., Pepin, J., Frost, E.H., Savelkoul, P., Nicholson, B. & other authors (2008).

Comparison of seven techniques for typing international epidemic strains of Clostridium difficile: restriction endonuclease analysis, pused-field gel elecrophoresis, PCR-ribotyping, multilocus sequence typing, multilocus varable-number tandem-repeat analysis, amplified fragment length polymorphism, and surface layer protein A gene sequence typing. J Clin Mirobiol 46, 431-437

Koehn, E.M., Fleischmann,T., Conrad,J.A., Palfey,B.A., Lesley,S.A.,

Mathews, 1.1., and Kohen,A. (2009). An unusual mechanism of thymidylate biosynthesis in organisms containing the thyX gene. Nature 458, 919-923. Koehn, E.M. and Kohen,A. (2010). Flavin-dependent thymidylate synthase: a novel pathway towards thymine. Arch. Biochem. Biophys. 493, 96-102. Kuehne,S.A., Cartman,S.T., Heap,J.T., Kelly,M.L., Cockayne,A., and Minton,N.P. (2010). The role of toxin A and toxin B in Clostridium difficile infection. Nature 467, 711-713.

Marsden, G.L., Davis,I.J., Wright, V. J., Sebaihia,M., Kuijper, E.J., and Minton,N.P. (2010). Array comparative hybridisation reveals a high degree of similarity between UK and European clinical isolates of hypervirulent Clostridium difficile. BMC. Genomics 11, 389.

Duncan R. MacCannell et al., 2006. Molecular Analysis of Clostridium difficile PCR Ribotype 027 Isolates from Eastern and Western Canada. Journal of Clinical Microbiology, June 2006, p. 2147-2152, Vol. 44, No. 6 McMillin, D. E., L. L. Muldrow, and S. J. Laggette. 1992. Simultaneous detection of toxin A and toxin B genetic determinants of Clostridium difficile using the multiplex polymerase chain reaction. Can. J. Microbiol. 38:81-83.

McDonald, L. C., Killgore, G.E., Thompson,A., Owens,R.C, Jr.,

Kazakova,S.V., SamboLS.P., Johnson,S., and Gerding,D.N. (2005). An epidemic, toxin gene-variant strain of Clostridium difficile. N. Engl. J. Med.

353, 2433-2441.

McMillin, D. E., L. L. Muldrow, and S. J. Laggette. 1992. Simultaneous detection of toxin A and toxin B genetic determinants of Clostridium difficile using the multiplex polymerase chain reaction. Can. J. Microbiol. 38:81-83. Merrigan M et al., 2010. Human hypervirulent Clostridium difficile strains exhibit increased sporulation as well as robust toxin production. J

Bacteriol, 2010 Oct; 192(19):4904-11. Pirs,T., Ocepek,M., and Rupnik,M. (2008). Isolation of Clostridium difficile from food animals in Slovenia. J. Med. Microbiol. 57, 790-792.

Rupnik,M., Brazier, J.S., Duerden,B.L, Grabnar,M., and Stubbs,S.L. (2001). Comparison of toxinotyping and PCR ribotyping of Clostridium difficile strains and description of novel toxinotypes. Microbiology 147, 439-447. Rupnik,M., Wilcox,M.H., and Gerding,D.N. (2009). Clostridium difficile infection: new developments in epidemiology and pathogenesis. Nat. Rev. Microbiol. 7, 526-536.

Pituch, H., Brazier, J. S., Obuch-Woszczatynski, P., Wultanska, D., Meisel- Mikolajczyk, F. & Luczak, M. (2006). Prevalence and association of PCR ribotypes of Clostridium difficile isolated from symptomatic patients from Warsaw with macrolide-lincosamide-streptogramin B (MLSB) type resistance. J Med Microbiol 55, 207-213.

Saxton,K., Baines,S.D., Freeman,J., 0'Connor,R., and Wilcox,M.H. (2009). Effects of exposure of Clostridium difficile PCR ribotypes 027 and 001 to fluoroquinolones in a human gut model. Antimicrob. Agents Chemother. 53, 412-420.

Sciara,G., Kendrew,S.G., Miele,A.E., Marsh,N.G., Federici,L., Malatesta,F., Schimperna,G., Savino,C, and Vallone,B. (2003). The structure of ActVA- Orf6, a novel type of monooxygenase involved in actinorhodin biosynthesis. EMBO J. 22, 205-215.

Sebaihia,M., Wren,B.W., Mullany,P., Fairweather,N.F., Minton,N.,

Stabler,R., Thomson,N.R., Roberts, A.P., Cerdeno-Tarraga,A.M., Wang,H., Holden,M.T.,Wright,A, Churcher,C, Quail,M.A, Baker,S, Bason,N., Brooks,K.,

Chillingworth,T., Cronin,A., Davis,P., Dowd,L., Fraser,A., Feltwell,T., Hance,Z., Holroyd,S., Jagels,K., Moule,S., Mungall,K., Price, C, Rabbinowitsch, E., Sharp, S., Simmonds,M., Stevens,K., Unwin,L.,

Whithead,S., Dupuy, B., Dougan, G., Barrell,B., and Parkhill,J. (2006). The multidrug-resistant human pathogen Clostridium difficile has a highly mobile, mosaic genome. Nat. Genet. 38, 779-786.

Spigaglia, P., and P. Mastrantonio. 2002. Molecular analysis of the pathogenicity locus and polymorphism in the putative negative regulator of toxin production (TcdC) among Clostridium difficile clinical isolates. J. Clin. Microbiol. 40:3470-3475.

Soding, J. (2005). Protein homology detection by HMM-HMM comparison. Bioinformatics. 21, 951-960.

Stabler,R.A., Gerding,D.N., Songer,J. G., Drudy,D., Brazier,J.S., Trinh,H.T., Witney,A.A., Hinds, J., and Wren, B.W. (2006). Comparative phylogenomics of Clostridium difficile reveals clade specificity and microevolution of hypervirulent strains. J. Bacteriol. 188, 7297-7305.

Stabler,R.A., He,M., Dawson,L., Martin,M., Valiente, E., Corton, C.,

Lawley,T.D., Sebaihia,M., Quail,M.A., Rose,G., Gerding, D.N., Gibert,M., Popoff,M.R, Parkhill,J, Dougan, G, and Wren, B.W. (2009). Comparative genome and phenotypic analysis of Clostridium difficile 027 strains provides insight into the evolution of a Hypervirulent bacterium. Genome Biol. 10, R102.

John R. Ticehurst, Deborah Z. Aird, Lisa M. Dam, Anita P. Borek, John T. Hargrove, and Karen C. Carroll. Effective Detection of Toxigenic

Clostridium difficile by a Two-Step Algorithm Including Tests for Antigen and Cytotoxin. Journal of Clinical Microbiology, March 2006, p. 1145- 1149, Vol. 44, No. 3

Warny,M., Pepin,J., Fang,A., Killgore, G., Thompson,A., Brazier,J., Frost,E., and McDonald, L. C. (2005). Toxin production by an emerging strain of Clostridium difficile associated with outbreaks of severe disease in North America and Europe. Lancet 366, 1079- 1084. Weese,J.S., Wakeford,T., Reid-Smith,R., Rousseau, J., and Friendship, R. (2010). Longitudinal investigation of Clostridium difficile shedding in piglets, anaerobe.

Zaiss, N. H., Rupnik, M., Kuijper, E. J., Harmanus, C, Michielsen, D., Janssens, K. & Nubel, U. (2009). Typing Clostridium difficile strains based on tandem repeat sequences. BMC Microbiol 9, 6

Claims

1. A nucleic acid marker capable of detecting and/or distinguishing and/or identifying and/or classifying a virulent Clostridium difficile ribotype 078 strain and/or ribotype 078- like strain comprising the nucleotide sequence as a shown in SEQ ID NO: 1 or a nucleotide sequence derived therefrom by substitution, addition, deletion or insertion of one or several nucleotides.

2. A nucleic acid marker capable of detecting and/or distinguishing and/or identifying a and/or classifying a virulent Clostridium difficile ribotype 027 and/or ribotype 027- like strain, comprising the nucleotide sequence as a shown in SEQ ID NO: 2 or a nucleotide sequence derived therefrom by substitution, addition, deletion or insertion of one or several nucleotides.

3. A protein marker capable of detecting and/or distinguishing and/or identifying and/or classifying a virulent Clostridium difficile ribotype 078 strain and/or ribotype 078- like strain comprising the amino acid sequence as a shown in SEQ ID NO: 7 and/or SEQ ID NO 8 and/or SEQ ID NO 9 or a modification thereof.

4. A protein marker capable of detecting and/or distinguishing and/or identifying and/or classifying a virulent Clostridium difficile ribotype 027 strain and/or ribotype 027- like strain comprising the amino acid sequence as a shown in SEQ ID NO: 10 and/or SEQ ID NO: 11 and/or SEQ ID NO: 12 and/or SEQ ID NO: 13 or a modification thereof.

5. A nucleic acid marker according to claim 1 or 2, or a protein marker according to claim 3 or 4, wherein said strain of Clostridium difficile is a hypervirulent and/or toxigenic strain.

6. A method for detecting and/or distinguishing and/or identifying and/or classifying a Clostridium difficile strain comprising detecting the nucleic acid marker according to any one of claims 1, 2 or 5 and/or detecting a protein marker according to any one of claims 3, 4 or 5 in a sample derived from a test organism.

7. A method according to claim 6 wherein said test organism is a eukaryotic test organism.

8. A method for detecting and/or distinguishing and/or identifying and/or classifying a Clostridium difficile strain comprising detecting the nucleic acid marker according to any one of claims 1, 2 or 5 and/or detecting a protein marker according to any one of claims 3, 4 or 5 in a sample derived from a product.

9. A method according to claim 8, wherein said product is a food product.

10. A method according to claim 8, wherein said product is a veterinary product.

11. A method according to claim 8, wherein said product is an agricultural product.

12. A method according to claim 8, wherein said product is a medicinal product.

13. A method according to any of claims 6-12, wherein said detecting and/or distinguishing and/or identifying and/or classifying a Clostridium difficile strain is carried out via PCR amplification of the sample with the use of a set of primers capable of specifically amplifying the nucleic acid marker according to any of claims 1, 2 or 5, or a part thereof, followed by detecting and/or analyzing the PCR amplification product.

14. A method according to claim 13, wherein the set of primers is selected from the group consisting of: a set of primers consisting of the primer consisting of the nucleotide as shown in SEQ: ID: 3 and the primer consisting of the nucleotide sequence as shown in SEQ: ID: 4.

15. A method according to claim 14, wherein said set of primers is capable detecting and/or distinguishing and/or identifying and/or classifying a

Clostridium difficile ribotype 078 strain and/or ribotype 078- like strain.

16. A method according to claim 13, wherein the set of primers is selected from the group consisting of: a set of primers consisting of the primer consisting of the nucleotide as shown in SEQ: ID: 5 and the primer consisting of the nucleotide sequence as shown in SEQ: ID: 6.

17. A method according to claim 16, wherein said set of primers is capable of detecting and/or distinguishing and/or identifying and/or classifying a Clostridium difficile ribotype 027 and or and/or ribotype 027- like strain.

18. A method according to any of claims 13-17, wherein said detecting is performed in real time.

19. A method according to claim 18, wherein said detecting confirms the presence or absence of a Clostridium difficile ribotype 078 strain and/or ribotype 078- like strain and/or a Clostridium difficile ribotype 027 and/or ribotype 027- like strain.

20. A kit for detecting and/or distinguishing and/or identifying a

Clostridium difficile strain comprising a means for specifically detecting the nucleic acid marker according to any one of the claims 1, 2 or 5, or a part thereof.

21. A kit according to claim 20, wherein the means is a set of primers capable of specifically amplifying the nucleic acid marker according to any one of claims 1, 2 or 5, or a part thereof.

22. A kit according to claim 21, which comprises at least one of: a set of primers consisting of a primer consisting of the nucleotide as shown in SEQ:

ID: 3 and the primer consisting of the nucleotide sequence as shown in SEQ: ID: 4; a set of primers consisting of the primer consisting of the nucleotide as shown in SEQ: ID: 5 and the primer consisting of the nucleotide sequence as shown in SEQ: ID: 6.

23. A kit according to any of claims 20-22, wherein the means is at least one nucleic acid probe having a nucleotide sequence complementary to the nucleic acid marker according to any one of claims 1, 2 or 5 or a nucleic acid sequence derived therefrom by substitution, addition, deletion, or insertion of one or several nucleotides.

24. An assay for detecting and/or distinguishing and/or identifying a Clostridium difficile strain wherein the following steps are performed, (a) a sample is provided for, (b) in a multiplex PCR assay (c) the sample is analyzed with respect to the presence or absence of a nucleic acid marker according to any of claims 1,2 or 5; optionally, the sample is additionally analyzed with respect to the following (d) the sample is analyzed with respect to the presence or absence of one or more virulence markers; e) the sample is analyzed for the presence of a dysfunctional toxin regulator gene; f) the sample is analyzed for the presence of one or more cellular antigens; g) the sample is analyzed for the presence of a single base change (transition of T to C) at position 145 in the 16S rRNA gene.

25. An assay according to claim 24 whereby the sample is further analyzed with respect to detecting a disruption in the Thy X gene and/or the intergenic region between GuA synthase and nucleotidase CD0198 and/or CD0199.

26. An assay according to claim 25, wherein the disruption in the Thy X gene is an exchange of ThyX for Thy A and DHFR or a functional equivalent thereof.

27. A kit of parts comprising a) a means for specifically detecting the nucleic acid marker according to any one of the claims 1, 2 or 5 or a part thereof and/or an protein marker according to any of claims 3-5 or part thereof; optionally a means for detecting (b) toxins A and/or toxin B and/or binary toxin or a functional equivalent; and/or c) a dysfunctional toxin regulator and/or d) GDH.

28. A kit of parts according to claim 27, further comprising a means for detecting a disruption in the Thy X gene and/or the intergenic region between GuA synthase and nucleotidase CD0198 and/or CD0199.

29. A kit of parts according to claim 28 wherein said disruption in the Thy X gene is an exchange of ThyX for Thy A and DHFR or a functional equivalent thereof.

30. An kit according to any of claims 20-23, or an assay according to any one of claims 24-26, or a kit of parts according to any one of claims 27-29, wherein said strain of Clostridium difficile is a virulent strain preferably a hypervirulent and/or toxigenic strain.

31. The use of a kit according to any of claims 20-23, and/or assay according to any one of claims 24-26, and/or a kit of parts according to any one of claims 27-29, for detecting and/or distinguishing and/or identifying and/or isolating and/or classifying a Clostridium difficile strain.

32. The use according to claim 31, wherein said strain of Clostridium difficile is a virulent preferably a hypervirulent and/or toxigenic strain.

33. A Clostridium difficile strain detected and/or identified and/or isolated and/or classified using a nucleic acid marker according to any of claims 1, 2 or 5 and/or a protein marker according to claims 3, 4 or 5 and/or a method according to any one of claims 6-19, and/or a kit according to any of claims 20- 24, or 30 and/or assay according to any of claims 24-26, or 30 and/or a kit of parts according to any one of claims 27-29 or 30.