WO2012038744A2

WO2012038744A2 - Detecting mutations

Info

Publication number: WO2012038744A2
Application number: PCT/GB2011/051774
Authority: WO
Inventors: Andrew Futreal; Michael Stratton; Bin Tean Teh
Original assignee: Genome Research Limited; Van Andel Research Institute
Priority date: 2010-09-22
Filing date: 2011-09-21
Publication date: 2012-03-29
Also published as: WO2012038744A3

Abstract

In one aspect the present invention provides a method for detecting a mutation associated with renal cancer in a subject, comprising screening a test sample derived from the subject for the presence of one or more mutations in a PBRMl gene or a product thereof.

Description

DETECTING MUTATIONS

FIELD

The present invention relates to the field of oncology, in particular to molecular markers associated with renal and other types of cancer. BACKGROUND

The genetics of renal cancer is dominated by inactivation of the VHL tumour suppressor gene in clear cell carcinoma (ccRCC), the commonest histological subtype¹. A recent large-scale screen of -3500 genes by PCR-based exon re-sequencing identified several new cancer genes in ccRCC including UTX (KDM6A), JARID1C (KDM5C) and SETD2 ²'³. These genes encode enzymes that demethylate (UTX, JARID1C) or methylate (SETD2) key lysine residues of histone H3. Modification of the methylation state of these lysine residues of histone H3 regulates chromatin structure and is implicated in transcriptional control⁴. However, together these mutations are present in fewer than 15% of ccRCC, suggesting the existence of additional, currently unidentified cancer genes. Accordingly, there is a need for additional molecular markers associated with renal cancer, and for methods of diagnosing renal cancer or a predisposition to renal cancer based thereon.

SUMMARY

Accordingly, in one aspect the present invention provides a method for detecting a mutation associated with renal cancer in a subject, comprising screening a test sample derived from the subject for the presence of one or more mutations in a PBRM1 (polybromo-1) gene or a product thereof.

In one embodiment the mutation is a truncation mutation. Preferably the mutation comprises a PBRM1 mutation as defined in Table 2, 4 or 5 herein.

In one embodiment, the test sample comprises a renal tissue sample which is suspected to be cancerous or at risk of cancer, and presence of the mutation is indicative of renal cancer or an increased risk of renal cancer in the subject. Preferably the method further comprises screening a control sample derived from a normal tissue of the subject for the presence of the mutation, wherein presence of the mutation in the test sample and absence of the mutation in the control sample is indicative of a somatic mutation associated with renal cancer or an increased risk of renal cancer in the subject. hi one embodiment, the method comprises obtaining nucleic acids from the sample, and detecting one or more mutations in a polypeptide-encoding nucleic acid sequence of the PBRMl gene. Alternatively, the method comprises screening the sample with a ligand which binds selectively to a mutant polypeptide product of the PBRMl gene.

Preferably the cancer is clear cell renal carcinoma. In one embodiment the method further comprises screening the sample for one or more mutations in a VHL and/or SETD2 gene or a product thereof. In a further aspect, the present invention provides an isolated nucleic acid encoding at least a portion of a PBRMl gene product, wherein the nucleic acid comprises a PBRMl mutation as defined in Table 2, 4 or 5 herein.

In a further aspect, the present invention provides an isolated nucleic acid which is complementary to, or hybridises specifically to, a mutant nucleic acid as defined above. In a further aspect, the present invention provides an isolated nucleic acid primer which directs specific amplification of a mutant nucleic acid as defined above.

In a further aspect, the present invention provides an isolated polypeptide comprising at least a portion of a product of a PBRMl gene, wherein the polypeptide comprises a PBRMl mutation as defined in Table 2, 4 or 5 herein. In a further aspect, the present invention provides a ligand which binds selectively to a mutant polypeptide as defined above. Preferably the ligand is an antibody.

BRIEF DESCRIPTION OF THE DRAWINGS

Figure 1.

PBRMl somatic mutations. Representation of PBRMl transcript with boxes BR1-BR6, BAH1-2 and HMG indicating the positions of the bromodomains 1-6, bromo-adjacent homology domains and high-mobility group domain, respectively. Relative positions of mutations are indicated by symbols. Stars - nonsense, dots - missense, red triangles - frameshift deletions, black triangles - frameshift insertions and green triangles - in-frame deletions. Splice-site mutations are not depicted.

Figure 2.

Analysis of PBRM l missense mutations. Bars represent histogram of the mean score of in silico generated random missense mutations (10,000 sets of three mutations that can be scored) and the red circle denotes the mean score of the somatic mutations that could be scored (T232P Ds = -7.78, A597D Ds = -9.69, H1204P Ds = -2.76). The somatic set is significantly different from the null set (p-value 0.01). They have a higher negative mean score and are thus predicted to be more deleterious on average. Figure 3.

Pbrml is frequently mutated in a mouse model of pancreatic cancer. To identify genes that co-operate with K-Ras in the formation of pancreatic cancer a conditional allele of K- Ras^G12D and Pdxl-Cre were combined with a conditional Sleeping Beauty transposase driver and the T20nc^tg transposon donor allele²⁹. Expression of Cre results in expression of K- Ras^GI2D and transposon mobilization within the epithelial compartment of the pancreas. Isolation of the transposon insertion sites from a panel of 153 pancreatic cancers and preneoplastic lesions generated from this model revealed a common insertion site in Pbrml suggesting that loss of Pbrml co-operates with K-Ras^G12D in pancreatic cancer development.

Statistical analysis was performed as previously described . Transposon insertions in the forward strand of Pbrml are shown in red. Insertions in the reverse orientation are shown in green. Insertions in both directions can disrupt gene function.

Figure 4.

Knockdown f PBRMl expression in RCC cell lines. (A) Verification of PBRM 1 knockdown by quantitative PCR in renal cancer cell lines. (B)Silencing PBRMl increased the proliferation of ACHN and 786-0 with wild type PBRMl, but not A704 with a homozygous PBRMl trancating mutation. Data represent means of triplicate experiments with standard deviation, p<0.0\ . (C) Knockdown of PBRMl enhanced colony formation in SN12C cells. Data represent means of triplicate experiments with standard deviation, jcO.Ol. (D) Knockdown of PBRMl enhanced cell migration in 786-0, SN12C and TK10 cells. Data represent means of triplicate experiments with standard deviation, pO.01. (E) Gene sets that are most significantly deregulated following PBRMl knockdown in three RCC cell lines using curated gene sets obtained from MSigDB (http://www.broadinstitute.org/gsea/msigdb/) and additional curated gene sets obtained from the PGSEA package (see Example for details).

Figure 5 shows the nucleotide sequence of the human PBRMl gene (NM_018313.4, SEQ ID NO:l).

Figure 6 shows the amino acid sequence of the human BAF180 protein (NP_060783.3, SEQ ID NO:2).

DETAILED DESCRIPTION

In one aspect, the present invention relates to detecting mutations in a polybromo-1 {PBRMl) gene or a product thereof. The nucleotide sequence of the human PBRMl gene is given in NCBI database accession no. NM_018313.4, and is shown in SEQ ID NO:l (Fig. 5). The amino acid sequence of the human BAF180 (BRG1 -associated factor 180) protein, which is a product of the human PBRMl gene, is given in NCBI database accession no. NPJ360783.3 and is shown in SEQ ID NO:2 (Fig. 6). Embodiments of the present inventions may involve detecting mutations in any of the above sequences.

The term "PBRMl gene or a product thereof preferably includes nucleic acids or polypeptides which have at least 85%, 90%, 95%, 96%, 97%, 98% or 99% sequence identity to SEQ ID NO:l or SEQ ID NO:2, preferably over at least 20, 50, 100, 500 or 1000 residues of the sequence or over the entire length of the sequence. Homology comparisons can be conducted by eye, or more usually, with the aid of readily available sequence comparison programs. These commercially available computer programs can calculate percentage (%) homology (i.e. sequence identity) between two or more sequences.

Percentage homology can be calculated over contiguous sequences, i.e. one sequence is aligned with the other sequence and each amino acid in one sequence directly compared with the corresponding amino acid in the other sequence, one residue at a time. This is called an "ungapped" alignment. Typically, such ungapped alignments are performed only over a relatively short number of residues (for example less than 50 contiguous amino acids).

Alternatively a sequence comparison method may be used which is designed to produce optimal alignments that take into consideration possible insertions and deletions without penalising unduly the overall homology score. This is achieved by inserting "gaps" in the sequence alignment to try to maximise local homology. The method may assign "gap penalties" to each gap that occurs in the alignment so that, for the same number of identical amino acids, a sequence alignment with as few gaps as possible - reflecting higher relatedness between the two compared sequences - will achieve a higher score than one with many gaps. "Affine gap costs" are typically used that charge a relatively high cost for the existence of a gap and a smaller penalty for each subsequent residue in the gap. This is the most commonly used gap scoring system. High gap penalties will of course produce optimised alignments with fewer gaps. Most alignment programs allow the gap penalties to be modified. However, it is preferred to use the default values when using such software for sequence comparisons. For example when using the GCG Wisconsin Bestfit package (see below) the default gap penalty for amino acid sequences is -12 for a gap and -4 for each extension.

Calculation of maximum % homology therefore firstly requires the production of an optimal alignment, taking into consideration gap penalties. A suitable computer program for carrying out such an alignment is the GCG Wisconsin Bestfit package (University of Wisconsin, U.S.A.; Devereux et al, 1984, Nucleic Acids Research 12:387). Examples of other software than can perform sequence comparisons include, but are not limited to, the BLAST package (see Ausubel et al, 1999 ibid - Chapter 18), FASTA (Atschul et al, 1990, J. Mol. Biol., 403- 410) and the GENEWORKS suite of comparison tools. Both BLAST and FASTA are available for offline and online searching (see Ausubel et al, 1999 ibid, pages 7-58 to 7-60). However it is preferred to use the GCG Bestfit program.

Although the final % homology can be measured in terms of identity, the alignment process itself is typically not based on an all-or-nothing pair comparison. Instead, a scaled similarity score matrix is generally used that assigns scores to each pairwise comparison based on chemical similarity or evolutionary distance. An example of such a matrix commonly used is the BLOSUM62 matrix - the default matrix for the BLAST suite of programs. GCG Wisconsin programs generally use either the public default values or a custom symbol comparison table if supplied (see user manual for further details). It is preferred to use the public default values for the GCG package, or in the case of other software, the default matrix, such as BLOSUM62. Once the software has produced an optimal alignment, it is possible to calculate % homology, preferably % sequence identity. The software typically does this as part of the sequence comparison and generates a numerical result.

The present method may comprise detecting one or more mutations in a PBRMl gene or a product thereof. Mutations include addition, deletion or substitution of one or more nucleotides or amino acid residues, e.g. in the sequence of SEQ ID NO: 1 or 2. In a preferred embodiment, the mutation results in a truncation of the expressed PBRMl gene product (BAF180 protein), i.e. the mutation is a truncating mutation.

In some embodiments, the mutation in PBRMl is a naturally occurring mutation, i.e. the mutation has not been intentionally induced in cell s or tissue by the application of carcinogens or other tumorigenic factors. Thus, the mutations identified herein accurately reflect natural tumorigenesis in human tissues in vivo and are suitable for diagnostic use.

In one embodiment, the mutation is a somatic mutation. By somatic it is meant a mutation which is not transmitted through the germ line of an organism, i.e. the mutation occurs in somatic tissues of the organism. Advantageously, a somatic mutation is one which is determined to be somatic though normal/tumour paired sample analysis. For instance, somatic mutations can be identified as mutations found in a sample derived from a suspected cancer tissue of the subject, but not found in normal tissue from the same subject.

The method may comprise identifying any mutation in a PBRMl gene or a product thereof, including any of those disclosed herein (e.g. a mutation in a PBRMl gene or a PBRMl gene product as disclosed in Table 2, 4 or 5 herein). All amino acid and nucleotide numbering used herein starts from amino acid +1 of the in PBRMl gene product (BAF180 protein) or the first ATG of the nucleotide sequence encoding it.

Thus in one aspect, the present invention relates to isolated nucleic acids and polypeptides comprising a PBRMl mutation as disclosed herein, e.g. as defined in Table 2, 4 or 5. Such isolated nucleic acid and polypeptides may comprise fragments, variants or homologues of a PBRMl sequence (e.g. SEQ ID NO: l or 2). Preferably such isolated nucleic acids and polypeptides show at least 85%, 90%, 95%, 96%, 97%, 98% or 99% sequence identity to SEQ ID NO: l or SEQ ID NO:2, preferably over at least 20, 50, 100, 500 or 1000 residues of the sequence or over the entire length of the sequence. A portion or fragment of a polypeptide in accordance with the invention is a polypeptide fragment which encompasses the mutant amino acid(s) described in accordance with the invention. The fragment can be any length up to the full length of PBRMl (BAF180) polypeptide; it thus encompasses PBRMl (BAF180) polypeptides which have been truncated by a few amino acids, as well as shorter fragments. Preferably the polypeptide comprises at least 10, at least 20, at least 50, at least 100, at least 500 or at least 1000 amino acids of SEQ ID NO:2, provides that the polypeptide comprises a mutation as defined herein. For example, fragments may be between about 5 and about 1580 amino acids in length, e.g. about 10 and about 1550, 10 to 100, 10 to 50, 100 to 1550, 100 to 1000 or 500 to 1000 amino acids in length. In some embodiments, fragments may be useful for immunisation of animals to raise antibodies. Thus, fragments of polypeptides according to the invention advantageously comprise at least one antigenic determinant (epitope) characteristic of mutant PBRMl (BAF180) as described herein. Whether a particular polypeptide fragment retains such antigenic properties can readily be determined by routine methods known in the art. Peptides composed of as few as six amino acid residues ore often found to evoke an immune response.

A "nucleic acid" of the present invention may be, for example, a nucleic acid which encodes a mutant human PBRMl (BAF180) polypeptide as described above. For example the nucleic acid may comprise at least 10, at least 20, at least 50, at least 100, at least 500 or at least 1000 nucleotides of SEQ ID NO: l , provided that the nucleic acid comprises a mutation as described herein. The present invention also provides polynucleotides complementary to a mutant PBRMl (BAF180)-encoding nucleic acid, as well as polynucleotides which hybridise specifically to a mutant PBRMl (BAF180)-encoding nucleic acid. By "hybridise specifically" it is typically meant that the polynucleotide is capable of hybridising to the mutant nucleic acid (i.e. a nucleic acid sequence comprising a PBRMl mutation as defined herein) but not to a non-mutant nucleic acid (e.g. a nucleic acid sequence comprising the sequence of SEQ ID NO:l or a fragment thereof) under the same conditions. For example, the polynucleotide may hybridise specifically to a nucleic acid mutation as defined in Table 2, 4 or 5.

In one embodiment the invention provides polynucleotides capable of hybridising, under stringent hybridisation conditions, to a mutant PBRMl nucleic acid, or the complement thereof. "Stringent hybridisation conditions" refers to an overnight incubation at 42°C in a solution comprising 50% formamide, 5x SSC (750 mM NaCl, 75 mM trisodium citrate), 50 mM sodium phosphate (pH 7.6), 5x Denhardt's solution, 10% dextran sulphate, and 20 pg/ml denatured, sheared salmon sperm DNA, followed by washing the filters in O.l SSC at about 65°C. Although nucleic acids, as referred to herein, are generally natural nucleic acids found in nature, the term can include within its scope modified, artificial nucleic acids having modified backbones or bases, as are known in the art.

An "isolated" polypeptide or nucleic acid, as referred to herein, refers to material removed from its original environment (for example, the natural environment in which it occurs in nature), and thus is altered by the hand of man from its natural state. For example, an isolated polynucleotide could be part of a vector or a composition of matter, or could be contained within a cell, and still be "isolated" because that vector, composition of matter, or particular cell is not the original environment of the polynucleotide.

The methods of the present invention may comprise detecting mutations in PBRM1 at the gene or protein level. Any known methods for detecting specific nucleic acid or polypeptide sequences may be used. Thus the methods of the invention can be based on detection of mutations in genomic DNA, as well as transcripts and proteins. In some embodiments mutations in genomic DNA may be confirmed by analysis of transcripts and/or polypeptides, in order to ensure that the detected mutation is indeed expressed in the subject.

The screening method of the present invention is performed on a test sample. The sample may be any type of sample derived from the subject, provided that it permits the identification of PBRM1 mutations in the subject. Typically the sample comprises DNA derived from the subject, e.g. genomic or cDNA from the subject. For example, the sample may comprise a tissue or cellular sample or a purified DNA preparation from the subject. Alternatively the test sample may comprise a protein sample derived from the subject. Methods for the isolation of genomic DNA or protein, or the preparation of cDNA from tissue samples are well-known in the art. In one embodiment the test sample comprises a tissue sample from the kidney, e.g. a renal tissue sample which is suspected to be cancerous or at risk of cancer.

Mutations in nucleic acids (e.g. in genomic or cDNA) may be detected, for example, using well-known methods such as direct DNA sequencing methods, or by sequence-specific primers or olignucleotide probes. Thus in particular embodiments, the present invention provides nucleic acids (e.g. oligonucleotide primers and probes) which selectively hybridize to a mutant PBRMl polynucleotide sequence. The nucleic acid may be an oligonucleotide primer or probe which comprises a region which is complementary to the mutant sequence. A skilled person can easily design appropriate primers or probes based on a knowledge of the mutant sequence.

In some embodiments, mutant nucleic acid sequences may be detected directly in a DNA sample derived from a subject. In other embodiments, the method involves first enriching the sample for PBRMl gene sequences. For example, the method may involve a step of selectively amplifying a PBRMl gene locus using appropriate primers, followed by a further amplification step using mutation-specific primers or probes. In one embodiment the products of the locus-specific amplification step are purified in a DNA purification step before the mutation- specific detection step.

In one aspect, the present invention provides nucleic acid primers which direct specific amplification of mutant PBRMl sequences. By this it is meant, for example, that the primer is capable of amplifying the mutant nucleic acid (i.e. a nucleic acid sequence comprising a PBRMl mutation as defined herein) but not a non-mutant nucleic acid (e.g. a nucleic acid sequence comprising the sequence of SEQ ID NO:l or a fragment thereof) under the same conditions.

For instance, under particular conditions the primer may hybridize specifically to the mutant nucleic acid. The primer is typically extended (e.g. using known methods such as PCR) only when annealed to the mutant nucleotide sequence (template). For example, in one embodiment the primer comprises a sequence complementary to a mutant PBRMl sequence.

If the primer binds the complementary mutant PBRMl sequence and produces an amplified product, then the PCR product can be detected by standard techniques. If only a non-mutant sequence is present, no PCR product is detected. By constructing an array of PCR primers complementary to the range of PBRMl mutations, it is possible to detect a plurality of mutant sequences simultaneously.

The nature of the primer is not particularly limited, provided that it is capable of specifically hybridising to a mutant PBRMl sequence. The length of the primer is preferably 5 to 50 nucleotides, more preferably 10 to 50 nucleotides, more preferably 15 to 30 nucleotides, e.g. 17 to 23 nucleotides. Suitable primers may be designed according to standard techniques known to those skilled in the art for selecting primers for polymerase reactions, such as for amplification of DNA by the polymerase chain reaction (PCR). For instance in particular embodiments the primer may comprise, or be specifically complementary to, at least 10, at least 15 or at least 20 nucleotides of a mutant PBRM1 sequence, wherein the mutant PBRM1 sequence comprises a mutant of sequence of SEQ ID NO:l as defined in Table 2, 4 or 5 herein.

For example, in one embodiment an aqueous solution of the primer is added to a DNA sample. Hybridisation conditions are then selected so that the primer hybridises selectively to the mutant sequence, according to criteria well known to those skilled in the art. An appropriate temperature and salt content for hybridisation needs to be selected according to the length of the oligonucleotide primer and its G-C content, amongst other things (see Old & Primrose (1994), Principles of Gene Manipulation, Blackwell Science and Maniatis et al. (1992), Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Laboratory, New York). Typically the hybridisation temperature should be close to the melting temperature (T_m) of the primer. Tm is defined as the temperature at which the primer and its target are 50% dissociated. Preferably the hybridisation temperature should be within 2°C of T_m.

For example, in one embodiment the method utilizes a set of primer pairs designed for specifically detecting individual PBRM1 mutations. The PCR reactions accomplished with these primers produce well defined DNA fragments of different length if their respective mutant sequences are present in the sample. Control primers for use as an internal standard (e.g. for amplifying the human globin or human growth hormone gene) may also be included in the reaction. The PCR reaction products may be detected on an electrophoretic gel, e.g. an agarose gel by dyeing the double stranded DNA with ethidium bromide and exposure to ultraviolet light. The gel may be documented by photography and interpreted. According to some embodiments of the present invention, only one primer in a pair is specific for the mutant PBRM1 sequence.

Oligonucleotide probes may be used in combination with well-known hybridisation assays to detect mutant PBRM1 nucleic acid sequences. For example, the oligonucleotide probe may be attached to a solid support. In one embodiment, a plurality of oligonucleotide probes may be attached to a solid support in the form of an array, e.g. a DNA micro-array. Oligonucleotide arrays may be prepared, for example, by in situ combinatorial oligonucleotide synthesis or by conventional synthesis followed by on-chip immobilization of the oligonucleotide onto the solid support. The solid support may be, for example, a glass slide. In an alternative embodiment, different probes may be attached to individual beads or microspheres, e.g. Luminex™ microspheres.

Oligonucleotide probes suitable for immobilization on an array, may be of any suitable length provided that they are specific for a mutant PBRM1 gene sequence. Typically oligonucleotide probes may be 10 to 50, 15 to 30, 17 to 23 or about 20 nucleotides in length. In one embodiment the oligonucleotide probe may comprise, or be specifically complementary to, at least 10, at least 15 or at least 20 nucleotides of a mutant PBRM1 sequence, wherein the mutant PBRM1 sequence comprises a mutant of sequence of SEQ ID NO:l as defined in Table 2, 4 or 5 herein. Preferably an array comprises at least 10, 30, 50, 100, 200, 500, 1000, 10,000 or 100,000 different oligonucleotide probes. A single array may detect a plurality of PBRM1 mutant sequences and/or other nucleic acids, e.g. cancer-related mutations in other genes.

Many alternative methods are known for detecting nucleic acid sequences. For instance, mutations may be detected by techniques based on mobility shift in amplified nucleic acid fragments. Chen et al, Anal Biochem 1996 Jul 15;239(l):61-9, describe the detection of single-base mutations by a competitive mobility shift assay. Moreover, assays based on the technique of Marcelino et al, BioTechniques 26(6): 1134-1148 (June 1999) are available commercially. In one embodiment, capillary heteroduplex analysis may be used to detect the presence of mutations based on mobility shift of duplex nucleic acids in capillary systems as a result of the presence of mismatches.

Generation of nucleic acids for analysis from samples generally requires nucleic acid amplification. Amplification reactions are nucleic acid reactions which result in specific amplification of target nucleic acids over non-target nucleic acids. The polymerase chain reaction (PCR) is a well known amplification reaction. Many amplification methods rely on an enzymatic chain reaction (such as a polymerase chain reaction, a ligase chain reaction, or a self-sustained sequence replication) or from the replication of all or part of the vector into which it has been cloned. Preferably, the amplification according to the invention is an exponential amplification, as exhibited by for example the polymerase chain reaction. Many target and signal amplification methods have been described in the literature, for example, general reviews of these methods in Landegren, U., et al., Science 242:229-237 (1988) and Lewis, R., Genetic Engineering News 10: 1, 54-55 (1990). These amplification methods can be used in the methods of the invention, and include polymerase chain reaction (PCR), PCR in situ, ligase amplification reaction (LAR), ligase hybridisation, Qbeta bacteriophage replicase, transcription-based amplification system (TAS), genomic amplification with transcript sequencing (GAWTS), nucleic acid sequence-based amplification (NASBA) and in situ hybridisation. Primers suitable for use in various amplification techniques can be prepared according to methods known in the art.

PCR is a nucleic acid amplification method described inter alia in U.S. Pat. Nos. 4,683,195 and 4,683,202. PCR consists of repeated cycles of DNA polymerase generated primer extension reactions. The target DNA is heat denatured and two oligonucleotides, which bracket the target sequence on opposite strands of the DNA to be amplified, are hybridised. These oligonucleotides become primers for use with DNA polymerase. The DNA is copied by primer extension to make a second copy of both strands. By repeating the cycle of heat denaturation, primer hybridisation and extension, the target DNA can be amplified a million fold or more in about two to four hours. PCR is a molecular biology tool, which must be used in conjunction with a detection technique to determine the results of amplification. An advantage of PCR is that it increases sensitivity by amplifying the amount of target DNA by 1 million to 1 billion fold in approximately 4 hours. PCR can be used to amplify any known nucleic acid in a diagnostic context (Mok et al., (1994), Gynaecologic Oncology, 52: 247- 252).

Self-sustained sequence replication (3SR) is a variation of TAS, which involves the isothermal amplification of a nucleic acid template via sequential rounds of reverse transcriptase (RT), polymerase and nuclease activities that are mediated by an enzyme cocktail and appropriate oligonucleotide primers (Guatelli et al. (1990) Proc. Natl. Acad. Sci. USA 87:1874). Enzymatic degradation of the RNA of the RNA/DNA heteroduplex is used instead of heat denaturation. RNase H and all other enzymes are added to the reaction and all steps occur at the same temperature and without further reagent additions. Following this process, amplifications of 106 to 109 have been achieved in one hour at 42 °C.

Ligation amplification reaction or ligation amplification system uses DNA ligase and four oligonucleotides, two per target strand. This technique is described by Wu, D. Y. and Wallace, R. B. (1989) Genomics 4:560. The oligonucleotides hybridise to adjacent sequences on the target DNA and are joined by the ligase. The reaction is heat denatured and the cycle repeated.

In the QP replicase technique, RNA replicase for the bacteriophage Qp, which replicates single-stranded RNA, is used to amplify the target DNA, as described by Lizardi et al. (1988) Bio/Technology 6: 1197. First, the target DNA is hybridised to a primer including a T7 promoter and a QP 5' sequence region. Using this primer, reverse transcriptase generates a cDNA connecting the primer to its 5' end in the process. These two steps are similar to the TAS protocol. The resulting heteroduplex is heat denatured. Next, a second primer containing a QP 3' sequence region is used to initiate a second round of cDNA synthesis. This results in a double stranded DNA containing both 5' and 3' ends of the Qp bacteriophage as well as an active T7 RNA polymerase binding site. T7 RNA polymerase then transcribes the double- stranded DNA into new RNA, which mimics the QP. After extensive washing to remove any unhybridised probe, the new RNA is eluted from the target and replicated by QP replicase. The latter reaction creates 107 fold amplification in approximately 20 minutes. Alternative amplification technology can be exploited in the present invention. For example, rolling circle amplification (Lizardi et al, (1998) Nat Genet 19:225) is an amplification technology available commercially (RCAT™) which is driven by DNA polymerase and can replicate circular oligonucleotide probes with either linear or geometric kinetics under isothermal conditions. In the presence of two suitably designed primers, a geometric

12 amplification occurs via DNA strand displacement and hyperbranching to generate 10 or more copies of each circle in 1 hour. If a single primer is used, RCAT generates in a few minutes a linear chain of thousands of tandemly linked DNA copies of a target covalently linked to that target.

A further technique, strand displacement amplification (SDA; Walker et al, (1992) PNAS (USA) 80:392) begins with a specifically defined sequence unique to a specific target. But unlike other techniques which rely on thermal cycling, SDA is an isothermal process that utilises a series of primers, DNA polymerase and a restriction enzyme to exponentially amplify the unique nucleic acid sequence.

SDA comprises both a target generation phase and an exponential amplification phase. In target generation, double-stranded DNA is heat denatured creating two single-stranded copies. A series of specially manufactured primers combine with DNA polymerase (amplification primers for copying the base sequence and bumper primers for displacing the newly created strands) to form altered targets capable of exponential amplification.

The exponential amplification process begins with altered targets (single-stranded partial DNA strands with restricted enzyme recognition sites) from the target generation phase. An amplification primer is bound to each strand at its complementary DNA sequence. DNA polymerase then uses the primer to identify a location to extend the primer from its 3' end, using the altered target as a template for adding individual nucleotides. The extended primer thus forms a double-stranded DNA segment containing a complete restriction enzyme recognition site at each end. A restriction enzyme is then bound to the double stranded DNA segment at its recognition site. The restriction enzyme dissociates from the recognition site after having cleaved only one strand of the double-sided segment, forming a nick. DNA polymerase recognises the nick and extends the strand from the site, displacing the previously created strand. The recognition site is thus repeatedly nicked and restored by the restriction enzyme and DNA polymerase with continuous displacement of DNA strands containing the target segment.

Each displaced strand is then available to anneal with amplification primers as above. The process continues with repeated nicking, extension and displacement of new DNA strands, resulting in exponential amplification of the original DNA target. Once the nucleic acid has been amplified, a number of techniques are available for detection of single base pair mutations. One such technique is Single Stranded Conformational Polymorphism (SSCP). SCCP detection is based on the aberrant migration of single stranded mutated DNA compared to reference DNA during electrophoresis. Mutation produces conformational change in single stranded DNA, resulting in mobility shift. Fluorescent SCCP uses fluorescent-labelled primers to aid detection. Reference and mutant DNA are thus amplified using fluorescent labelled primers. The amplified DNA is denatured and snap-cooled to produce single stranded DNA molecules, which are examined by non-denaturing gel electrophoresis.

Chemical mismatch cleavage (CMC) is based on the recognition and cleavage of DNA mismatched base pairs by a combination of hydroxylamine, osmium tetroxide and piperidine. Thus, both reference DNA and mutant DNA are amplified with fluorescent labelled primers. The amplicons are hybridised and then subjected to cleavage using osmium tetroxide, which binds to an mismatched T base, or hydroxylamine, which binds to mismatched C base, followed by Piperidine which cleaves at the site of a modified base. Cleaved fragments are then detected by electrophoresis.

Techniques based on restriction fragment polymorphisms (RFLPs) can also be used. Although many single nucleotide polymorphisms (SNPs) do not permit conventional RFLP analysis, primer-induced restriction analysis PGR (PIRA-PCR) can be used to introduce restriction sites using PCR primers in a SNP-dependent manner. Primers for PIRA-PCR which introduce suitable restriction sites can be designed by computational analysis, for example as described in Xiaiyi et ah, (2001) Bioinformatics 17:838-839. hi an alternative embodiment, the present invention provides for the detection of PBRMl mutations at the RNA level. Typical assay formats utilising ribonucleic acid hybridisation include nuclear run-on assays, RT-PCR and RNase protection assays (Melton et al, Nuc. Acids Res. 12:7035). Methods for detection which can be employed include radioactive labels, enzyme labels, chemiluminescent labels, fluorescent labels and other suitable labels.

In other embodiments, a polypeptide encoded by a mutant PBRMl gene is detected, e.g. the method involves detecting a mutant BAF180 protein. Proteins can be detected by protein gel assay, antibody binding assay, or other detection methods known in the art.

For example, mutant PBRMl (BAF180) polypeptides can be detected by differential mobility on protein gels, or by other size analysis techniques such as mass spectrometry, in which the presence of mutant amino acids can be determined according to molecular weight. Peptides derived from mutant polypeptides, in particular, as susceptible to differentiation by size analysis.

Advantageously, the detection means is sequence-specific, such that a particular point mutation can accurately be identified in the mutant polypeptide. For example, polypeptide or RNA molecules can be developed which specifically recognise mutant PBRMl (BAF180) polypeptides in vivo or in vitro.

For example, RNA aptamers can be produced by SELEX. SELEX is a method for the in vitro evolution of nucleic acid molecules with highly specific binding to target molecules. It is described, for example, in U.S. patents 5654151, 5503978, 5567588 and 5270163, as well as PCT publication WO 96/38579, each of which is specifically incorporated herein by reference. The SELEX method involves selection of nucleic acid aptamers, single-stranded nucleic acids capable of binding to a desired target, from a library of oligonucleotides. Starting from a library of nucleic acids, preferably comprising a segment of randomised sequence, the SELEX method includes steps of contacting the library with the target under conditions favourable for binding, partitioning unbound nucleic acids from those nucleic acids which have bound specifically to target molecules, dissociating the nucleic acid-target complexes, amplifying the nucleic acids dissociated from the nucleic acid-target complexes to yield a ligand-enriched library of nucleic acids, then reiterating the steps of binding, partitioning, dissociating and amplifying through as many cycles as desired to yield highly specific, high affinity nucleic acid ligands to the target molecule.

SELEX is based on the principle that within a nucleic acid library containing a large number of possible sequences and structures there is a wide range of binding affinities for a given target. A nucleic acid library comprising, for example a 20 nucleotide randomised segment can have 4²⁰ structural possibilities. Those which have the higher affinity constants for the target are considered to be most likely to bind. The process of partitioning, dissociation and amplification generates a second nucleic acid library, enriched for the higher binding affinity candidates. Additional rounds of selection progressively favour the best ligands until the resulting library is predominantly composed of only one or a few sequences. These can then be cloned, sequenced and individually tested for binding affinity as pure ligands. Cycles of selection and amplification are repeated until a desired goal is achieved. In the most general case, selection/amplification is continued until no significant improvement in binding strength is achieved on repetition of the cycle. The iterative selection/amplification method is sensitive enough to allow isolation of a single sequence variant in a library containing at least 10¹⁴ sequences. The method could, in principle, be used to sample as many as about 10 different nucleic acid species. The nucleic acids of the library preferably include a randomised sequence portion as well as conserved sequences necessary for efficient amplification. Nucleic acid sequence variants can be produced in a number of ways including synthesis of randomised nucleic acid sequences and size selection from randomly cleaved cellular nucleic acids. The variable sequence portion can contain fully or partially random sequence; it can also contain subportions of conserved sequence incorporated with randomised sequence. Sequence variation in test nucleic acids can be introduced or increased by mutagenesis before or during the selection/amplification iterations and by specific modification of cloned aptamers.

PBRM1 (BAF180) polypeptides or peptides derived therefrom can be used to generate antibodies for use in the present invention. The PBRM1 (BAF180) peptides used preferably comprise an epitope which is specific for a mutant PBRM1 (BAF180) polypeptide in accordance with the invention. Polypeptide fragments which function as epitopes can be produced by any conventional means (see, for example, US 4,631,211) In the present invention, antigenic epitopes preferably contain a sequence of at least 4, at least 5, at least 6, at least 7, more preferably at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 20, at least 25, at least 30, at least 40, at least 50 and, most preferably, between about 15 to about 30 amino acids. Preferred polypeptides comprising immunogenic or antigenic epitopes are at least 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95 or 100 amino acid residues in length.

Antibodies can be generated using antigenic epitopes of PBRM1 (BAF180) polypeptides according to the invention by immunising animals, such as rabbits or mice, with either free or carrier-coupled peptides, for instance, by intraperitoneal and/or intradermal injection of emulsions containing about 100 g of peptide or carrier protein and Freund's adjuvant or any other adjuvant known for stimulating an immune response. Several booster injections can be needed, for instance, at intervals of about two weeks, to provide a useful titre of anti-peptide antibody which can be detected, for example, by ELISA assay using free peptide adsorbed to a solid surface. The titre of anti-peptide antibodies in serum from an immunised animal can be increased by selection of anti-peptide antibodies, for instance, by adsorption to the peptide on a solid support and elution of the selected antibodies according to methods well known in the art. The PBRMl (BAF180) polypeptides disclosed herein, and immunogenic and/or antigenic epitope fragments thereof can be fused to other polypeptide sequences. For example, the polypeptides can be fused with immunoglobulin domains. Chimeric proteins consisting of the first two domains of the human CD4-polypeptide and various domains of the constant regions of the heavy or light chains of mammalian immunoglobulins have been shown to possess advantageous properties in vivo (see, for example, EP 0394827; Traunecker et al., (1988) Nature, 331 : 84-86). Enhanced delivery of an antigen across the epithelial barrier to the immune system has been demonstrated for antigens (such as insulin) conjugated to an FcRn binding partner such as IgG or Fc fragments (see, for example, WO 96/22024 and WO 99/04813).

Moreover, the mutant polypeptides disclosed herein can be fused to marker sequences, such as a peptide which facilitates purification of the fused polypeptide. In preferred embodiments, the marker amino acid sequence is a hexa-histidine peptide, such as the tag provided in a pQE vector (QIAGEN, Inc., 9259 Eton Avenue, Chatsworth, CA, 91311), among others, many of which are commercially available. As described in Gentz et al., Proc. Natl. Acad. Sci. USA 86: 821-824 (1989), for instance, hexa-histidine provides for convenient purification of the fusion protein. Another peptide tag useful for purification, the "HA" tag, corresponds to an epitope derived from the influenza hemagglutinin protein (Wilson et al., (1984) Cell 37: 767. Thus, any of these above fusions can be engineered using the nucleic acids or the polypeptides disclosed herein.

In a preferred embodiment, the invention provides immunoglobulins (e.g. antibodies) which specifically recognise PBRM1 (BAF180) mutants as described herein. An "immunoglobulin" is one of a family of polypeptides which retain the immunoglobulin fold characteristic of immunoglobulin (antibody) molecules, which contains two β sheets and, usually, a conserved disulphide bond. Members of the immunoglobulin superfamily are involved in many aspects of cellular and non-cellular interactions in vivo, including widespread roles in the immune system (for example, antibodies, T-cell receptor molecules and the like), involvement in cell adhesion (for example the ICAM molecules) and intracellular signalling (for example, receptor molecules, such as the PDGF receptor). The present invention is preferably applicable to antibodies, which are capable of binding to target antigens with high specificity.

Antibodies can be whole antibodies, or antigen-binding fragments thereof. For example, the invention includes fragments such as Fv and Fab, as well as Fab' and F(ab')₂, and antibody variants such as scFv, single domain antibodies, Dab antibodies and other antigen-binding antibody-based molecules.

Antibodies as described herein are especially indicated for diagnostic applications. Accordingly, they can be altered antibodies comprising an effector protein such as a label. Especially preferred are labels which allow the imaging of the distribution of the antibody in vivo. Such labels can be radioactive labels or radioopaque labels, such as metal particles, which are readily visualisable within the body of a patient.

Recombinant DNA technology can be used to improve the antibodies of the invention. Thus, chimeric antibodies can be constructed in order to decrease the iminunogenicity thereof in diagnostic or therapeutic applications. Moreover, immunogenicity can be minimised by humanising the antibodies by CDR grafting [see European Patent Application 0 239 400 (Winter)] and, optionally, framework modification [EP 0 239 400; Riechmann, L. et al., Nature, 332, 323-327, 1988; Verhoeyen M. et al, Science, 239, 1534-1536, 1988; Kettleborough, C. A. et al, Protein Engng., 4, 773-783, 1991; Maeda, H. et al., Human Antibodies and Hybridoma, 2, 124-134, 1991; Gorman S. D. et al., Proc. Natl. Acad. Sci. USA, 88, 4181-4185, 1991; Tempest P. R. et al., Bio/Technology, 9, 266-271 , 1991 ; Co, M. S. et al., Proc. Natl. Acad. Sei. USA, 88, 2869-2873, 1991; Carter, P. et al., Proc. Natl. Acad. Sci. USA, 89, 4285-4289, 1992; Co, M. S. et al., J. Immunol., 148, 1149-1154, 1992; and, Sato, K. et al., Cancer Res., 53, 851-856, 1993]. Antibodies as described herein can be produced in cell culture. Recombinant DNA technology can be used to produce the antibodies according to established procedure, in bacterial or preferably mammalian cell culture. The selected cell culture system optionally secretes the antibody product, although antibody products can be isolated from non-secreting cells. Therefore, the present invention includes a process for the production of an antibody according to the invention comprising culturing a host, e.g. E. coli, an insect cell or a mammalian cell, which has been transformed with a hybrid vector comprising an expression cassette comprising a promoter operably linked to a first DNA sequence encoding a signal peptide linked in the proper reading frame to a second DNA sequence encoding said antibody protein, and isolating said protein.

Multiplication of hybridoma cells or mammalian host cells in vitro is carried out in suitable culture media, which are the customary standard culture media, for example Dulbecco's Modified Eagle Medium (DMEM) or RPMI 1640 medium, optionally replenished by a mammalian serum, e.g. foetal calf serum, or trace elements and growth sustaining supplements, e.g. feeder cells such as normal mouse peritoneal exudate cells, spleen cells, bone marrow macrophages, 2-aminoethanol, insulin, transferrin, low density lipoprotein, oleic acid, or the like. Multiplication of host cells which are bacterial cells or yeast cells is likewise carried out in suitable culture media known in the art, for example for bacteria in medium LB, NZCYM, NZYM, NZM, Terrific Broth, SOB, SOC, 2 x YT, or M9 Minimal Medium, and for yeast in medium YPD, YEPD, Minimal Medium, or Complete Minimal Dropout Medium. In vitro production provides relatively pure antibody preparations and allows scale-up to give large amounts of the desired antibodies. Techniques for bacterial cell, yeast or mammalian cell cultivation are known in the art and include homogeneous suspension culture, e.g. in an airlift reactor or in a continuous stirrer reactor, or immobilised or entrapped cell culture, e.g. in hollow fibres, microcapsules, on agarose microbeads or ceramic cartridges. Large quantities of the desired antibodies can also be obtained by multiplying mammalian cells in vivo. For this purpose, hybridoma cells producing the desired antibodies are injected into histocompatible mammals to cause growth of antibody-producing tumours. Optionally, the animals are primed with a hydrocarbon, especially mineral oils such as pristane (tetramethyl-pentadecane), prior to the injection. After one to three weeks, the antibodies are isolated from the body fluids of those mammals. For example, hybridoma cells obtained by fusion of suitable myeloma cells with antibody-producing spleen cells from Balb/c mice, or transfected cells derived from hybridoma cell line Sp2/0 that produce the desired antibodies are injected intraperitoneally into Balb/c mice optionally pre-treated with pristane, and, after one to two weeks, ascitic fluid is taken from the animals. The foregoing, and other, techniques are discussed in, for example, Kohler and Milstein, (1975) Nature 256:495-497; US 4,376,1 10; Harlow and Lane, Antibodies: a Laboratory Manual, (1988) Cold Spring Harbor, incorporated herein by reference. Techniques for the preparation of recombinant antibody molecules is described in the above references and also in, for example, EP 0623679; EP 0368684 and EP 0436597, which are incorporated herein by reference.

The cell culture supernatants are screened for the desired antibodies, preferentially by an enzyme immunoassay, e.g. a sandwich assay or a dot-assay, or a radioimmunoassay. For isolation of the antibodies, the immunoglobulins in the culture supernatants or in the ascitic fluid can be concentrated, e.g. by precipitation with ammonium sulphate, dialysis against hygroscopic material such as polyethylene glycol, filtration through selective membranes, or the like. If necessary and/or desired, the antibodies are purified by the customary chromatography methods, for example gel filtration, ion-exchange chromatography, chromatography over DEAE-cellulose and/or (immuno-) affinity chromatography, e.g. affinity chromatography with the target antigen, or with Protein-A.

The invention further concerns hybridoma cells secreting the monoclonal antibodies of the invention. The preferred hybridoma cells of the invention are genetically stable, secrete monoclonal antibodies of the invention of the desired specificity and can be activated from deep-frozen cultures by thawing and reclo ing.

The invention, in a preferred embodiment, relates to the production of anti mutant PBRMl (BAF180) antibodies. Thus, the invention also concerns a process for the preparation of a hybridoma cell line secreting monoclonal antibodies according to the invention, characterised in that a suitable mammal, for example a Balb/c mouse, is immunised with a one or more mutant PBRMl (BAF180) polypeptides or antigenic fragments thereof, or an antigenic carrier containing a mutant PBRMl (BAF180) polypeptide; antibody-producing cells of the immunised mammal are fused with cells of a suitable myeloma cell line, the hybrid cells obtained in the fusion are cloned, and cell clones secreting the desired antibodies are selected. For example spleen cells of Balb/c mice immunised with mutant PBRMl (BAF180) are fused with cells of the myeloma cell line PAI or the myeloma cell line Sp2/0-Agl4, the obtained hybrid cells are screened for secretion of the desired antibodies, and positive hybridoma cells are cloned. Preferred is a process for the preparation of a hybridoma cell line, characterised in that Balb/c mice are immunised by injecting subcutaneously and/or intraperitoneally between 1 and lOC^g mutant PBRMl (BAF180) and a suitable adjuvant, such as Freund's adjuvant, several times, e.g. four to six times, over several months, e.g. between two and four months, and spleen cells from the immunised mice are taken two to four days after the last injection and fused with cells of the myeloma cell line PAI in the presence of a fusion promoter, preferably polyethylene glycol. Preferably the myeloma cells are fused with a three- to twentyfold excess of spleen cells from the immunised mice in a solution containing about 30 % to about 50 % polyethylene glycol of a molecular weight around 4000. After the fusion the cells are expanded in suitable culture media as described hereinbefore, supplemented with a selection medium, for example HAT medium, at regular intervals in order to prevent normal myeloma cells from overgrowing the desired hybridoma cells. The invention also concerns recombinant nucleic acids comprising an insert coding for a heavy chain variable domain and/or for a light chain variable domain of antibodies directed to mutant PBRM1 (BAF180) as described hereinbefore. By definition such DNAs comprise coding single stranded DNAs, double stranded DNAs consisting of said coding DNAs and of complementary DNAs thereto, or these complementary (single stranded) DNAs themselves.

Furthermore, DNA encoding a heavy chain variable domain and/or for a light chain variable domain of antibodies directed to mutant PBRM1 (BAF180) can be enzymatically or chemically synthesised DNA having the authentic DNA sequence coding for a heavy chain variable domain and/or for the light chain variable domain, or a mutant thereof. A mutant of the authentic DNA is a DNA encoding a heavy chain variable domain and/or a light chain variable domain of the above-mentioned antibodies in which one or more amino acids are deleted or exchanged with one or more other amino acids. Preferably said modification(s) are outside the CDRs of the heavy chain variable domain and/or of the light chain variable domain of the antibody. Such a mutant DNA is also intended to be a silent mutant wherein one or more nucleotides are replaced by other nucleotides with the new codons coding for the same amino acid(s). Such a mutant sequence is also a degenerated sequence. Degenerated sequences are degenerated within the meaning of the genetic code in that an unlimited number of nucleotides are replaced by other nucleotides without resulting in a change of the amino acid sequence originally encoded. Such degenerated sequences can be useful due to their different restriction sites and/or frequency of particular codons which are preferred by the specific host, particularly E. coli, to obtain an optimal expression of the heavy chain murine variable domain and/or a light chain murine variable domain. In this context, the term mutant is intended to include a DNA mutant obtained by in vitro mutagenesis of the authentic DNA according to methods known in the art. For the assembly of complete tetrameric immunoglobulin molecules and the expression of chimeric antibodies, the recombinant DNA inserts coding for heavy and light chain variable domains are fused with the corresponding DNAs coding for heavy and light chain constant domains, then transferred into appropriate host cells, for example after incorporation into hybrid vectors. The invention therefore also concerns recombinant nucleic acids comprising an insert coding for a heavy chain murine variable domain of an anti mutant PBRM1 (BAF180) antibody fused to a human constant domain γ, for example γΐ, γ2, γ3 or γ4, preferably γΐ or γ4. Likewise the invention concerns recombinant DNAs comprising an insert coding for a light chain murine variable domain of an anti mutant PBRMl (BAF180) antibody directed to mutant PBRM1 (BAF180) fused to a human constant domain κ or λ, preferably κ.

In another embodiment the invention pertains to recombinant DNAs coding for a recombinant polypeptide wherein the heavy chain variable domain and the light chain variable domain are linked by way of a spacer group, optionally comprising a signal sequence facilitating the processing of the antibody in the host cell and/or a DNA coding for a peptide facilitating the purification of the antibody and/or a cleavage site and/or a peptide spacer and/or an effector molecule. Antibodies and antibody fragments according to the invention are useful in diagnosis. Accordingly, the invention provides a composition for diagnosis comprising an antibody according to the invention. In the case of a diagnostic composition, the antibody is preferably provided together with means for detecting the antibody, which can be enzymatic, fluorescent, radioisotopic or other means. The antibody and the detection means can be provided for simultaneous, simultaneous separate or sequential use, in a diagnostic kit intended for diagnosis.

The antibodies of the invention can be assayed for immunospecific binding by any method known in the art. The immunoassays which can be used include but are not limited to competitive and non-competitive assay systems using techniques such as western blots, radioimmunoassays, ELISA, sandwich immunoassays, immunoprecipitation assays, precipitin reactions, gel diffusion precipitin reactions, immunodiffusion assays, agglutination assays, complement-fixation assays, immunoradiometric assays, fluorescent immunoassays and protein A immunoassays. Such assays are routine in the art (see, for example, Ausubel et al, eds, 1994, Current Protocols in Molecular Biology, Vol. 1, John Wiley & Sons, Inc., New York, which is incorporated by reference herein in its entirety). Exemplary immunoassays are described briefly below.

Immunoprecipitation protocols generally comprise lysing a population of cells in a lysis buffer such as RIPA buffer (1% NP-40 or Triton X-100, 1% sodium deoxycholate, 0.1% SDS, 0.15 M NaCl, 0.01 M sodium phosphate at pH 7.2,1% Trasylol) supplemented with protein phosphatase and/or protease inhibitors (e. g., EDTA, PMSF, aprotinin, sodium vanadate), adding the antibody of interest to the cell lysate, incubating for a period of time (e. g., 1-4 hours) at 4 °C, adding protein A and/or protein G sepharose beads to the cell lysate, incubating for about an hour or more at 4 °C, washing the beads in lysis buffer and resuspending the beads in SDS/sample buffer. The ability of the antibody of interest to immunoprecipitate a particular antigen can be assessed by, e. g., western blot analysis. Western blot analysis generally comprises preparing protein samples, electrophoresis of the protein samples in a polyacrylamide gel (e. g., 8%-20% SDS-PAGE depending on the molecular weight of the antigen), transferring the protein sample from the polyacrylamide gel to a membrane such as nitrocellulose, PVDF or nylon, blocking the membrane in blocking solution (e. g., PBS with 3% BSA or non-fat milk), washing the membrane in washing buffer (e. g., PBS-Tween 20), exposing the membrane to a primary antibody (the antibody of interest) diluted in blocking buffer, washing the membrane in washing buffer, exposing the membrane to a secondary antibody (which recognises the primary antibody, e. g., an antihuman antibody) conjugated to an enzymatic substrate (e. g., horseradish peroxidase or alkaline phosphatase) or radioactive molecule (e. g., ³²P or ¹²⁵I) diluted in blocking buffer, washing the membrane in wash buffer, and detecting the presence of the antigen.

ELISAs comprise preparing antigen, coating the well of a 96 well microtitre plate with the antigen, adding the antibody of interest conjugated to a detectable compound such as an enzymatic substrate (e. g., horseradish peroxidase or alkaline phosphatase) to the well and incubating for a period of time, and detecting the presence of the antigen. In ELISAs the antibody of interest does not have to be conjugated to a detectable compound; instead, a second antibody (which recognises the antibody of interest) conjugated to a detectable compound can be added to the well. Further, instead of coating the well with the antigen, the antibody can be coated to the well. In this case, a second antibody conjugated to a detectable compound can be added following the addition of the antigen of interest to the coated well. The binding affinity of an antibody to an antigen and the off-rate of an antibody-antigen interaction can be determined by competitive binding assays. One example of a competitive binding assay is a radioimmunoassay comprising the incubation of labelled antigen (e. g., ³H or I) with the antibody of interest in the presence of increasing amounts of unlabeled antigen, and the detection of the antibody bound to the labelled antigen. The affinity of the antibody of interest for a particular antigen and the binding off-rates can be determined from the data by scatchard plot analysis. Competition with a second antibody can also be determined using radioimmunoassays. In this case, the antigen is incubated with antibody of interest conjugated to a labelled compound (e. g., ³H or ¹²⁵I) in the presence of increasing amounts of an unlabeled second antibody.

The detection of mutant PBRM1 (BAF180) nucleic acids and polypeptides can be employed, in the context of the present invention, to diagnose the presence or predisposition to cellular transformation and cancer. "Cancer" is used herein to refer to neoplastic growth arising from cellular transformation to a neoplastic phenotype. Such cellular transformation often involves genetic mutation. In the context of the present invention, transformation involves genetic mutation by alteration of one or more PBRM1 (BAF180) genes as described herein.

In one embodiment, the cancer is renal cancer, e.g. clear cell renal carcinoma. Alternatively the cancer may be a cancer as defined in Table 5. In specific embodiments, the cancer may be small-cell lung cancer, gall bladder cancer, squamous-cell lung cancer or pancreatic cancer, e.g. pancreatic adenocarcinoma.

Screening for mutant PBRM1 sequences according to the present invention may be combined with detection of additional markers known to be associated with cancer, particularly renal cancer (e.g. clear cell renal carcinoma). For instance, in one embodiment the method comprises further screening for one or more mutations in a VHL, UTX, JARID1C, ARID 1 A, ARID5B and/or SETD2 gene or a product thereof, preferably in a VHL and/or SETD2 gene or a product thereof.

In further aspects, the present invention provides further cancer-associated genes and cancer- associated mutations, i.e. other than in PBRMl. For example, the invention provides further cancer-associated genes and specific mutations therein as defined in Table 2 (somatic mutations). Methods for detecting such mutations, as well as isolated nucleic acids, polypeptides, ligands etc. useful in such methods, are also provided by analogy to the methods and products described herein with respect to PBRMl. Nucleotide and amino acid sequences of, e.g. the human VHL, UTX, JARID1C, ARID 1 A, ARID5B and SETD2 genes and their protein products, are available from publicly-accessible databases, e.g. at http://www.ncbi.nlm.nih.gov/ and http://www.ensembl.org as shown below:

Gene Ensembl accession NCBI nucleotide NCBI protein no. ref. seq. ref. seq.

VHL (von Hippel-Lindau ENST00000256474 NM_000551.2 NPJ)00542.1 tumor suppressor)

UTX (lysine (K)-specific ENST00000377967 M 021 140.2 NP_066963.2 demethylase 6A)

ARID 1 A (AT rich interactive ENST00000457599 NM_006015.4 NP_006006.3 domain 1A)

ARID5B (AT rich interactive ENST00000279873 NMJ)32199.2 NPJ 15575.1 domain 5B)

SETD2 (SET domain ENST00000409792 NM_014159.6 NP_054878.5 containing 2)

The invention will now be described by way of example only with reference to the following non-limiting embodiment.

EXAMPLE Exome sequencing identifies frequent mutation of the SWI/SNF complex gene, PBRMl, in renal carcinoma

In this example, we have sequenced the protein coding exome in a series of primary ccRCC and report the identification of the SWI/SNF chromatin remodeling complex gene PBRMl⁵ as a second major ccRCC cancer gene, with truncating mutations in 42% (95/227) of cases. These data indicate that mutations in PBRMl are associated with renal cancer and can be used in the diagnosis and analysis thereof.

Materials and Methods

Direct Solution Exome Capture and Sequencing and Mapping: Exome design

Five (PD2125, PD2126, PD2144, PD2147, PD3441) of the matched clinical sample ccRCC pairs (normal + tumour) enrichment was performed using the Agilent SureSelect Human Exon Kit (Agilent, G3362) corresponding to the exons annotated within the CCDS database. For the remaining 2 clinical sample matched pairs (PD2126, PD3295), a custom in-house design was submitted and baits synthesized and supplied by Agilent (Agilent Technologies Inc, Santa Clara, CA, USA). The custom design included additional exonic regions over those present in CCDS and comprised a total of 288,654 unique exons from 46,275 transcripts of 20,921 Ensembl protein-coding genes, 33,621 transcripts of 13,772 manually annotated protein-coding genes, and 1635 miRNA genes. Baits for both exomes were provided in a single tube solution format.

Genomic library preparation

Genomic DNA ^g) was fragmented by Adaptive Focused Acoustics on a Covaris El 20 (Covaris Inc, Woburn, MA, USA) for 90 sec with a duty cycle of 20%, intensity of 5 and cycles per burst of 200. The fragmented DNA was purified using a Qiaquick PGR purification column (Qiagen, 28104) and quantified on a Bioanalyser using the Agilent DNA 1000 kit (Agilent, 5067-1504). The resulting DNA ranged in size from ~100-400bp, with a modal fragment size of ~250bp. Genomic libraries were prepared using the Illumina Paired End Sample Prep Kit kit following the manufacturer's instructions (Illumina, San Diego CA, USA). Adapter-ligated DNA was purified using AMPure beads (Agencourt Biosciences Corporation, Beverly, MA, USA) following the manufacturer's protocol, and eluted in 40μ1 of nuclease-free water. The prepared library was used directly in the subsequent enrichment procedure without prior size-selection or PGR amplification. Exon enrichment

The genomic library (500ng) was mixed with 7.5μ£ human C₀tl DNA, lyophilized in a speedvac for 30 min at 45°C and rehydrated in 3.4μ1 of nuclease-free water. Enrichment of the genomic DNA was performed using the Agilent SureSelect kit with minor modifications to the manufacturer's protocol. Briefly, the genomic DNA library (3.4μ1) was combined with 2.5μ1 of Block reagent 1, 2.5μ1 of Block reagent 2 and 0.6μ1 of Block reagent 3 and transferred to a well of a microtitre plate. The sample was denatured by incubating the plate on a thermocycler at 95°C for 5 min then snap-cooled on ice. A hybridization mix was prepared comprising 25 μΐ of Hyb reagent 1, Ι μΐ of Hyb reagent 2, ΙΟμΙ of Hyb reagent 3 and 13μ1 of Hyb reagent 4. A 13μ1 aliqout of this mastermix was added to the denatured DNA, and the sample incubated at 95°C for 5 min, then 65°C for 5 min. In a separate microtitre plate, the baits were prepared by combining 5μ1 of SureSelect capture library with Ι μΐ of nuclease free water and Ιμΐ of RNAse block, and the plate incubated at 65°C for 3 rnin. The pre- warmed DNA (22 μΐ) was transferred to the pre- warmed bait mix and the solution incubated for 24h at 65°C. Following hybridization, the captured DNA was isolated using streptavidin-coated magnetic Dynabeads, (Invitrogen, 653.05) and washed following the standard Agilent SureSelect protocol. The isolated DNA was purified using a Qiagen MinElute purification column, eluted in 15μ1 of elution buffer and PCR-amplified for 14 cycles as previously described^a.

Substitution variant calling:

Mapping of paired-end read data to the human genome (Build 37) was done using BWA^b. An average of 5 gigabases of uniquely mapping and 3.7 gigabases of uniquely mapping reads on target were obtained per sample, with an average of 74% of all reads mapping on target. Sixty-percent of target bases had 20X or greater coverage and 50 percent had 40X or greater coverage.

CaVEMan (Cancer Variants through Expectation Maximisation), a bespoke Java application using a simple expectation maximisation algorithm implementation⁰ was used to call single nucleotide substitutions. Through comparison of reads from both tumour and normal with the reference genome, CaVEMan calculates a probability for each possible genotype per base (given tumour and normal copy number). In order to provide more accurate estimates of sequence error rates within the algorithm, thus aid identification of true variants, variables such as base quality, read position, lane, and read orientation are incorporated into the calculations. Once CaVEMan was run, several post processing filters were applied in order to further increase the specificity of somatic mutation calls.

1. At least 1/3 of mutant alleles in tumour reads are of quality >= 25.

2. At least 1 mutant allele in a tumour read must fall in the middle third of the read, unless the tumour read depth is less than 10, when a mutant allele the first third is acceptable.

3. There is no more than 1 high quality (>= 20) mutant allele in a normal read.

Insertion/Deletion variant calling: A modified version of Pindel^d was used to call insertions and deletions. By modifying the input file generation process we were able to increase sensitivity and increase confidence in events detected by BWA which was used as the initial mapping tool. The accepted approach for generating input for Pindel is to provide all read pairs where one end is unmapped and the other is confidently mapped to the genome, an anchor read. We found that by including readpairs where both ends map to the genome but allowing for one of the pair to have mismatches, insertions or deletions we could greatly increase coverage over smaller events (in some cases both ends are used as an anchor, creating two input records). The majority of these small events are detected by the BWA mapping algorithm, however, this increases confidence that the events are worth investigating. A second modification to the input generation was included to help identify small events close to large scale deletions or repetitive regions. In regions such as these we would not be able to capture any of the smaller events that can be detected within a single end of a read that is confidently mapped but with some form of mismatch, insertion or deletion. In these cases we generated an artificial anchor co-ordinate so that Pindel can attempt a realignment of these reads. Software that can generate input files of this form can be obtained by contacting the authors.

Once Pindel was run several post processing filters were applied. We considered there to be 2 classes of event in our data, large events > 4 b.p. and small events <= 4 b.p. which are detectable by BWA (non-SW). For many of the filters the mapping depths within the BAM file are used to aid filtering of poor confidence calls.

For both classes the following filters were applied to the raw output:

1. Event must occur in tumour reads

2. >3 tumour reads must support call

3. <5% of calls must occur in wildtype 4. When no wildtype coverage in BAM, Pindel must not call event in wildtype For small events these filters were applied:

1. Tumour with BAM depth of < 200 reads must have variant call in >=8% of reads

2. Tumour with BAM depth of >= 200 reads must have variant call in >=4% of reads 3. Wildtype BAM must have >5 reads spanning the region

4. Pindel calls in wildtype reads must be <= 5% of the wildtype BAM depth

5. If the tumour BAM depth > wildtype BAM depth, normalise the Pindel wildtype calls against this, discarding if new value is >= 5% reference 6. Apply poly nucleotide tract filter for events with repetitive region > 9 repeats

7. Wildtype BAM depth must be >=8% of tumour BAM depth

8. Tumour BAM must have <8% BWA reference calls vs BWA variant calls.

Further, for large events no wildtype reads should be called as part of an event by Pindel and exome data results must annotate to coding regions of the genome.. PBRM1 mutation screening.

The coding exons of PBRM1 were sequenced via PCR-based capillary sequencing as previously described. Data were analysed semi-automated mutation detection followed by visual inspection of sequencing traces as previously described⁶. The primer sequences for PBRM1 amplification and sequencing are given in Table 7. Missense mutation analyses

In order to evaluate the functional effects of the found missense mutations we fixed a scoring system using protein domain alignments from Pfam f . The gene PBRM1 contains three kinds of functional domains: six copies of the Bromo domain (Pfam entry PF00439), two copies of the BAH domain (PF01426) and one copy of the HMG-box domain (PF00505). For each domain, we have used the Pfam seed alignment to construct a HMM-profile^g (http://hmmer.org). In the Pfam full alignments all reported observations of this domain are aligned to this HMM-profile. We have extended these full alignments by the (6/2/1) hits within PBRM1 to fix the coordinate system. We denote the counts of amino acid a in the alignment column by n a) and compare this observation to a null distribution po(a) (overall genomic frequencies of amino acids). Taking the log odds ratio of the amino acid frequencies within the alignment column and the null gives a so called position specific score^h. q_t{a)

s^a) = log log

p₀(a) (Νι + Ϊ)ρ₀(α)

(1)

where N₍ is the total number of residues in the column. The above construct of the observed distribution uses pseudo-counts'¹'¹ proportional to po to account for non-observed residues in the finite sample. The two extreme cases are columns that are highly conserved - where the most prevalent letter receives a large positive score and all others large negative ones - and columns that are highly variable and close to neutral - where all letters receive scores close to zero. For similar conservation based scoring schemes for disease related variation see e.g. the recent review" and in the context of cancer mutations¹''¹. For a given missense mutation (falling onto alignment column i), we can now record the score difference between the final and the initial residue :

^_i = s_i{a_final) - s_i{a_iriitia^ ₍₂₎

Out of the 9 missense mutations we could score 3 using the Pfam alignments (T232P As = -7.78, A597D As = -9.69, H1204P As = -2.76). In order to assess if these three somatic mutations differ significantly from random mutations we generated in silico all possible point events in PBRMl (transcript ENST00000337303) that result in a missense mutation which falls onto our scoring system (i.e. mutational opportunity space). From this set we drew 10,000 sets of 3 mutations randomly and evaluated the mean score for each set - the resulting distribution is shown together with the somatic value in Figure 2. Somatic mutations are significantly different from the null set (p-value 0.01). More specifically, the somatic mutation set has a lower mean negative score (i.e. they are predicted to be more deleterious on average) than the null model - thus making them interesting candidates for follow up functional studies.

PBRMl knockdown and functional analyses Cell lines and Transfections

Cell lines tested including ACHN, 786-0, SN12C, U031 A704 Caki-1 and TK10 were cultured in complete medium supplemented with 10% FBS (v/v) under 37°C and 5% C0₂. PBRMl or scrambled control siRNAs (Santa Cruz, CA) were transfected into renal cell lines using Lipofectamine 2000 (Invitrogen, CA) according to the manufacturer's conditions.

Real-time PCR

Total RNA was extracted from 48 hour post-transfected cells using TriPure (Roche, pIN). cDNA synthesis was carried out by using iScript™ cDNA Synthesis Kit (Bio-Rad, CA). Realtime PCR was performed to determine expression level of PBRMl and β-actin by SsoFast EvaGreen Supermix using CFX96™ Real-Time PCR Detection System (Bio-Rad, CA). Primers used for amplification were: PBRMl -F (5 '-GTGTGATGAACCAAGGAGTGGC- 3 '); PBRMl -R (5 '-GATATGGAGGTGGTGCCTGCTG-3 '); β-actin-F (5 '- GATCAGCAAGCAGGAGTATGACG-3 ') and β-actin-R (5 '-

AAGGGTGTAACGCAACTAAGTCATAG-3 '). Relative expression of PBRMl was normalized with β-actin expression level.

Proliferation assay

After 48 hour transfection, 2 ^χ 10³ cells were plated per well in 96-well plate. Growth of PBRMl siR A- and scramble siRNA-transfected cells was determined using the colorimetric 3-(4,5-dimethyltMazol-2yl)-5-(3-carboxyixiethoxyphenyl)-(4-sulfophenyl)-2H-tetrazoluim assay according to the manufacturer's protocol (MTS; Promega, WI). The assay was performed in triplicate.

Migration assay After 48 hour transfection, 2.0 ^χ 10^s cells in serum-free medium were seeded into the upper chamber of BioCoat inserts containing filters with 8 μπι pores for migration assay (BD Pharmingen, CA). The lower chamber was filled with 10% (v/v) serum-containing medium as attractant. Cells that did not migrate through the filters after 22 hours post-incubation were removed with cotton swabs. Cells that traversed through the filter were fixed and stained by Diff-Quik Solution (Dade Behring, DE). After staining, cells were taken photos.

Soft Agar Assay

SN12C cells were cultured in a two-layer agar system to prevent their attachment to the plastic surface. After transfection, cells (4 ^χ 10⁴) were trypsinized to single-cell suspensions, resuspended in 0.4% agar (Sigma, LA), and added to a preset 1% bottom agar layer in six- well plates. The top agar cell layers were covered with culture medium. Cells were incubated in 5% C0₂ at 37°C for 14 days, and colonies were counted under x2.5 object. Experiments were performed in triplicate.

PBRM1 knockdown expression phenotype analyses Gene expression data generation and processing. RNA was isolated from 786-0, SN12C, and TKIO cells that were either transfected with scrambled siRNA or transfected with PBRM1 targeting siRNA. Single color gene expression data was generated using the HG- U133 Plus 2.0 chipset (Affymetrix, Santa Clara, CA) as described¹¹¹ and deposited in the Gene Expresson Omnibus (GE022316). Gene expression analysis was performed using R/BioConductor version 2.0 software¹¹. Summary expression values were computed using the RMA method as implemented in the affy package using updated probe set mappings (hgul33plus2hsentrezgcdf version 12) such that a single probe set is associated with each well measured gene^0,p.

Gene expression analysis. Gene set enrichment analysis was performed using curated gene sets obtained from MSigDB (http://www.broadinstitute.org/gsea/msigdb/) and using additional curated gene sets obtained from the PGSEA package. Log-transformed relative expression values derived from comparision of targeted versus scrambled siRNA were computed for each cell line. For each cell line, gene sets that were significantly enriched in up-regulated genes were identified using the mean-rank method with permuation (n= 10,000) as implimented in the limma package^q . Gene sets that were significantly deregulated (P < 0.05) in all three cell lines were identified and sorted based on the lowest average p-value. Individual genes that were deregulated within specific genes sets were identified using a moderated t-statistic and significance values adjusted to control for multiple testing using the Benjamini & Hochberg approach as implimented in the limma package. Gene expression data generated from renal cell carcinoma samples and non-diseased kidney samples were obtained from the Gene Expression Omnibus (GSE17895) as previously described⁶ . The set of samples that displayed the hypoxic phenotype (n=90) were isolated and correlations between PBRMl expression and other genes computed using Pearson's correlation. Results Exome sequencing based on a solution phase capture approach⁶ was performed on seven cases of ccRCC, three of which carry VHL mutations and matching normal DNAs (see Materials and Methods and Table 1). Captured material was sequenced using 76 basepair paired-end reads on the Illumina GAIIx platform. After read alignment, variant calling was performed using a naive Bayesian classifier algorithm for substitutions and a split-read mapping approach (PinDel⁷ with substantial cancer-aware output filtering) for insertion/deletions (See Materials and Methods for details). These algorithms aim to identify somatically acquired coding and splice-site variants (i.e. present in the tumour but not in the matching normal), and all mutations reported here were confirmed by PCR-based capillary sequencing. 156 somatic mutations were identified, of which 92 were missense, 9 nonsense, 1 canonical splice site, 1 stop codon read-through, 11 frameshift mutations and 42 synonymous. Some of the mutations identified are shown in Table 2.

In four cases truncating mutations were identified in PBRMl. PBRMl maps to chromosome 3p21 and encodes the BAF180 protein, the chromatin targeting subunit of the PBAF SWI/SNF chromatin remodelling complex⁸. The gene is comprised of 6 bromodomains involved in binding acetylated lysine residues on histone tails, 2 bromo-adjacent homology domains important in protein-protein interaction and an HMG DNA binding domain⁵. PBAF complex-mediated chromatin remodelling is implicated in replication, transcription, DNA repair and control of cell proliferation/differentiation⁵'⁸. The SMARCB1 and BRG1 components of this complex have inactivating mutations in rhabdoid tumours⁹'¹⁰ and BRG1 mutations have been reported in multiple tumour types¹¹.

The PBRMl mutations included three frame-shifting insertions and a nonsense mutation; all judged to be homozygous from SNP array and mutant allele read count data. PBRMl was not included in our previous PCR-based sequencing screen² and was the only gene, apart from VHL, with recurrent truncating mutations in the seven cases screened.

We next sequenced PBRMl in a further 257 RCC cases, including 36 cases of papillary, chromophobe and other non-ccRCC cancers. Truncating mutations were identified in a remarkable 85/257 (33%) (Figure 1) of cases, all diagnosed as ccRCC (for full data see Tables 3 and 4). PBRMl mutations were all found in the context of chromosome 3p loss of heterozygosity (38/38) where SNP array data was available (http://www.sanger.ac.uk/cgi- bin/genetics/CGP/cghviewer/CghHome.cgi) . Two in-frame deletion mutations were identified - a predicted 6 amino-acid deletion ( .M1209_E1214delMFYKKE) in the second BAH (bromo-adjacent homology) domain likely involved in protein-protein interactions within the SWI/SNF complex⁵ and deletion of an isoleucine codon (Ile57) in the first bromodomain (Figure 1). Both deletions remove amino acids conserved to C elegans and both were in cases with 3p LOH. The ratio of nine missense to zero silent mutations suggests that a proportion of the missense mutations are likely to be pathogenic. Six of nine missense mutations occur in bromodomains and one in the second BAH domain (Figure 1). The bromodomains of PBRM1 have been shown to have preferential binding to different acetylated lysine configurations of histone tails, suggesting they may contribute to "reading" of the histone code .

The likelihood of the missense mutations having functional impact was assessed using a scoring system calibrated with protein domain alignments from Pfam¹³ (see Materials and Methods). Three missense mutations (p.T232P, p.A597D and p.H1204P) could be scored with these alignments. This set of mutations was predicted to be deleterious, having a significantly lower mean score than a typical null set of in silico generated random missense mutations falling onto the scorable parts of the gene (p-value 0.01 Fi gure 2).

Four PBRM1 truncating mutations have been previously described in breast cancer¹⁴. Although there is frequent 3p21 LOH in small-cell lung cancer, no evidence for PBRM1 inactivation was found¹⁵. To further evaluate the contribution of PBRM1 mutation in human cancer, copy number was evaluated and the coding exons were sequenced through a series of 727 cancer cell lines of various histologies. SNP array copy number analysis¹⁶ (http://www.sanger.ac.uk/cgi-bin/genetics/CGP/cghviewer/CghHome.cgi) identified one homozygous deletion in the HCC-1143 breast cancer cell line, previously described¹⁴. Sequencing analysis identified five homozygous truncating mutations (Table 5). Frame- shifting deletions were identified in the ¾L-mutant A704 renal cancer, NCI-H2196 small- cell lung cancer and TGBC24TKB gall bladder cancer lines. Nonsense mutations were identified in the NCI-H226 squamous-cell lung cancer and PANC- 10-05 pancreatic adenocarcinoma lines. Interestingly, a PBRM1 truncating mutation has been reported in a comprehensive pancreatic cancer mutational screen¹⁷. To obtain further evidence that PBRJV11 can act as a cancer gene, we examined data from several insertional mutagenesis screens in mice. Analyses of transposon insertion sites from a forward genetic screen performed using a conditional Sleeping Beauty transposon system¹⁸ in a mouse pancreatic cancer model¹⁹ revealed a significant enrichment of transposon insertion events in Pbrml (PO.0001, Figure 3). These data suggest that loss of Pbrml cooperates with Kras in driving pancreatic tumour development. Further, these comparative oncogenomic data provide independent support for PBRMl as a cancer gene. Abrogation of PBRMl expression via siRNA knockdown in ccRCC cell lines was investigated to assess possible consequences of PBRMl loss. Greater than 60% knockdown of PBRMl RNA resulted in a significant increase in proliferation 4/5 RCC lines (Figure 4 A, B). No effect was seen, however, in A704 which carries a homozygous truncating PBRMl mutation, confirming the specificity of the assay. Further, knockdown of PBRMl resulted in significantly increased colony formation in soft-agar and increased cell migration (Figure 4C, D), indicative of an increase in transformed phenotype. Taken together, these data support PBRMl having a tumour suppressor role in ccRCC.

Transcriptional profiling before and after PBRMl knockdown was performed using gene expression microarrays. Gene set enrichment analysis following PBRMl knockdown showed that PBRMl activity regulates pathways associated with chromosomal instability and cellular proliferation (Figure 4E, Table 6). Xia et al.¹⁴ reported that PBRMl was a critical transcriptional regulator of p21/CDKNl A in breast cancer cell lines. The PBAF complex has been shown to localise at kinetochores during mitosis²⁰ and SMARCB1 has been implicated in spindle checkpoint control²¹, which would support the loss of PBRMl giving rise to a chromosomal instability/spindle checkpoint expression phenotype.

Previous work has demonstrated that VHL loss alone is insufficient for ccRCC tuHiourigenesis arguing the need for additional genetic events²²'²³ and has further suggested the existence of a 3p21 "gatekeeper" ccRCC mutation based on LOH studies²⁴'²⁵. The data presented here strongly suggest that inactivation of PBRMl comprises this second major mutation in ccRCC development. Nearly all (36/38) PBRMl mutant cases fall into the hypoxia signature group as described previously², including 13/14 cases without demonstrable VHL point mutations where expression data is available - further indicating the importance of PBRMl in typical ccRCC development. The SWI/SNF complex has been implicated in the normal cellular response to hypoxia, with impairment of the complex rendering cells resistant to hypoxia-induced cell cycle arrest²⁶, which would be consistent with selection for frequent loss of PBRMl in ccRCC. Multiple cancers have apparently concomitant VHL, PBRMl and SETD2 mutations, with all three genes mapping to chromosome 3p, suggesting that the mutations are non-redundant functionally. In particular, all 9 cases with a SETD2 mutation have a mutation in either PBRM1 or VHL, with 7 of 9 cases having mutations in all three genes. Physical linkage of these three ccRCC cancer genes together with their potential interaction may be the key driver for the large scale 3p LOH seen in most cases of ccRCC - being particularly parsimonious in requiring only four genetic events to unmask three tumour suppressor genes as opposed to six if the genes were on different chromosomes.

Several other mutated genes of potential interest were identified. In particular, ARID1A encoding the BAF250A subunit of the SWI/SNF complex was found to have two heterozygous missense mutations - p.R1020K,c.3059G>A and p.L1872P,c.5615T>C. Both cases (PD2126, PD2127) have a PBRM1 truncating mutation. Loss of ARID1A expression

97

has been reported in RCC . PD2127 was also found to have a heterozygous truncating mutation in ARID5B, related to ARID1A and recently- implicated in childhood acute lymphoblastic leukaemia susceptibility²⁸.

The identification of a second major cancer gene in ccRCC further defines the genetic and molecular architecture of this tumour type. It is remarkable that PBRMl, like the majority of the other non-VHL mutated cancer genes identified in ccRCC, is involved in chromatin regulation - again at least in part at the level of histone H3 modification and recognition. That this adult epithelial cancer develops with little demonstrable involvement of the more commonly seen mutational activation of canonical growth signalling pathways speaks to its unique biology.

Table 1 - Clinical Samples in exome sequencing

^Λ VHL mutations in PD2126a and PD3441a were not "re-discovered" in exome sequencing due to poor coverage of the highly GC-rich first

Table 2 - Somatic mutations identified in exome sequencing

Annotated Mut

Sample Chromosome Position Gene Transcript WT base Base Mutation Type Protein Annotation cDIMA Annotatio

PD2126a 1 27094351 ARID1A ENST00000457599 G A MISSENSE P.R1020K c.3059G>A

PD2127a 1 27106655 ARID1A ENST00000457599 T C MISSENSE P.L1872P c.5615T>C

PD2127a 10 63850639 ARID5B ENST00000279873 A T NONSENSE p.K473* C.1417A>T

PD3441a 3 52613158 PBRM1 ENST00000394830 c A NONSENSE ο.Γ:1124 - C.3370OA

PD2126a 3 52649441 PBRM1 ENST00000337303 ΐΐΐϊΐϊϊΐΐϊΐΐΐί T FRAMESHIFT p.K621fs*9 c.l862insT

PD2127a 3 52678768 PBRM1 ENST0000O337303 T P!ilfS!tlHjl FRAMESHIFT p.K284fs -lb c.851delA

81 IllllSti§ c.3471_3472del

PD3295a ₃. 52613132 PBRM1 ENST00000337303 GC FRAMESHIFT p.W1157fs*23

PD2126a 3 47164325 SETD2 ENST00000409792 T A NONSENSE p.R601* C.1801T>A c.4161_4162del

PD2147a X 44969479 UTX ENST00000377967 TG FRAMESHIFT p.Y1387fs*l G

PD2144a 3 10191534 VHL ENST00000256474 G - FRAMESHIFT p.Y175* c.525delC

Table 3 - Sample details

PD2177a M 49 2 clear cell

PD2180a F 45 2 clear cell

PD2181a F 71 2 clear cell

PD2183a F 66 1 clear cell

PD2185a F 71 1 clear cell

PD2186a M 50 2 clear cell

PD2187a F 49 2 clear cell

PD2190a F 61 2 clear cell

PD2191a M 68 3 clear cell

PD2192a M 78 3 clear cell

PD2193a M 61 3 clear cell

PD2194a M 74 3 clear cell

PD2198a M 70 3 clear cell

PD2199a M 58 2 clear cell

PD2203a F 60 2 clear cell

PD2207a M 66 2 clear cell

PD2208a F 65 2 clear cell

PD2209a F 69 3 clear cell

PD2213a M 60 4 clear cell

PD2217a M 44 4 clear cell

PD2219a M 47 2 clear cell

PD2222a F 54 N/D clear cell

PD3284a M 56 3 clear cell

PD3285a F 80 3 clear cell

PD3286a F 71 4 clear cell

PD3287a M 61 2 clear cell

PD3290a F 58 2 clear cell

PD3292a M 76 3 papillary

PD3293a M 80 3 clear cell

PD3294a F 60 3 clear cell

M clear cell

PD3296a M 72 3 clear cell

Clear Cell w/ minor granular

PD3306a F 80 2-3 component

PD3307a F 64 4 clear cell

PD3308a M 43 3 clear cell

PD3309a M 67 4 clear cell

PD3312a F 81 3 clear cell

PD3313a F 48 2 clear cell

PD3314a F 58 3 clear cell

PD3316a M 44 3 clear cell

PD3317a M 62 2 clear cell

PD3318a M 74 2 papillary

PD3324a M 51 3 clear cell PD3332a M 65 1-2 Papillary (Chromophil)

PD3334a M 48 2 papillary

PD3336a F 74 2 clear cell

PD3337a F 71 2 clear cell

PD3340a M 49 2 clear cell

PD3342a M 65 3 clear cell

PD3343a M 69 2 papillary 1

PD3348a M 57 2 clear cell

PD3349a F 56 3 clear cell

PD3350a M 51 2 clear cell

PD3351a M 65 3 clear cell

PD3355a F 59 2 clear cell

PD3363a F 72 2 clear cell

PD3364a M 70 3 clear cell

PD3365a F 54 3 chromophobe

PD3368a M 54 3 clear cell

PD3371a F 56 2 clear cell

PD3372a F 67 4 clear cell/Sarcomatoid

PD3375a F 57 2 clear cell

PD3376a F 82 2 clear cell

PD3378a F 52 3 clear cell

PD3379a M 62 2 clear cell

PD3381a M 66 3 clear cell

PD3382a M 56 2 clear cell

PD3385a M 71 4 clear cell

PD3388a F 73 4 clear cell/sarcomatoid

PD3389a M 48 3-4 clear cell

PD3390a F 67 4 clear cell

PD3391a M 54 2 clear cell

PD3392a M 50 2 clear cell

PD3393a F 54 3 clear cell

PD3394a M 61 4 clear cell

Mucinous Tubular and Spindle

PD3395a M 74 Cell Carcinoma

PD3397a 47 1 (focally 2-3) clear cell

PD3399a F 58 1-2 clear cell

PD3400a M 51 3 clear cell

PD3402a M 53 2 clear cell

PD3403a M 63 3 papillary

PD3404a F 55 2 clear cell

PD3405a M 55 4 clear cell

PD3408a F 78 2 clear cell

PD3409a M 69 2 clear cell

PD3410a F 54 4 clear cell PD3411a F 58 3 clear cell

PD3413a F 51 3 clear cell

PD3420a M 58 2 clear cell

PD3421a M 65 3 clear cell

PD3422a M 68 1-2 clear cell

PD3423a M 61 2 papillary 1

PD3424a M 66 3 clear cell

PD3425a M 48 3 clear cell

PD3426a M 51 2 chromophobe

PD3427a M 50 2 clear cell

PD3436a M 38 2 clear cell

PD3437a F 68 2 clear cell

PD3438a M 51 3 clear cell

PD3439a M 59 3 clear cell

PD3440a M 70 2 clear cell

69 rlear ce 1

PD3442a M 73 2 Papillary w/ focal clear cell

PD3443a F 48 4 clear cell

PD3446a M 72 3 NOS

PD3449a M 69 4 Clear Cell

PD3452a M 68 3 Clear Cell

PD3453a F 64 2 clear cell

PD3454a M 70 3 clear cell

PD3455a F 42 4 clear cell/Sarcornatoid

PD3456a M 36 3 clear cell

PD3457a M 39 2 clear cell

PD3458a F 69 3 chromophobe

3 (focal areas of

PD3459a F 52 4) clear cell

PD3467a F 72 2 clear cell

PD3468a M 41 4 #N/A

PD3469a F 85 3 clear cell

PD3470a F 58 3 clear cell

PD3471a F 57 2 clear cell

PD3472a M 66 3 clear cell

PD3473a F 73 2 clear cell

PD3474a M 62 2 papillary 1

PD3475a M 69 4 papillary

PD3476a F 46 2 clear cell

PD3479a M 76 oncocytoma

PD3481a F 80 3 clear cell

PD3483a M 67 2 clear cell

PD3484a M 72 3 clear cell

PD3485a M 69 4 clear cell PD3486a M 70 3 papillary

PD3487a M 44 3 clear cell

PD3488a F 69 2 clear cell

PD3489a F 58 2 clear cell

PD3490a F 59 2 clear cell

PD3491a M 87 3 clear cell

PD3492a M 42 4 clear cell

PD3493a F 78 3 clear cell

PD3494a M 42 2 clear cell

PD3495a M 71 4 clear cell

PD3497a M 63 4 clear cell

PD3499a M 55 2 clear cell

PD3500a M 49 3 clear cell

PD3501a F 83 2 clear cell

PD3502a M 84 4 chromophobe

PD3503a M 60 4 clear cell

PD3504a F 37 2 clear cell

PD3505a M 54 2 clear cell

PD3506a F 62 2 clear cell

PD3507a M 57 2 clear ceil

PD3508a F 71 2 clear cell

PD3509a M 58 4 clear cell

PD3510a F 89 2 clear cell

PD3511a F 58 2 clear cell

PD3512a M 83 3 clear cell

PD3513a M 69 3 clear cell

PD3514a F 43 3 clear cell

PD3515a M 80 2 clear cell

PD3516a F 68 3 clear cell

PD3518a M 74 2 chromophobe

PD3519a F 85 3 NOS

PD3520a M 64 2-3 clear cell

PD3521a M 54 3 clear cell

PD3522a M 64 3 clear cell

PD3523a F 47 3 clear cell

PD3524a M 66 3 clear cell

PD3525a F 74 1 clear cell

PD3526a M 59 papillary

PD3528a F 50 2 clear cell

PD3529a M 56 2 clear cell

PD3530a M 69 3 clear cell

PD3532a M 41 2 clear cell

PD3534a M 55 2 clear cell

PD3536a F 71 3 Clear Cell PD3538a M 73 3 clear cell

PD3539a M 78 3 NOS

PD3540a F 52 2 clear cell

PD3541a M 61 2 clear cell

PD3542a F 59 2 clear cell

PD3543a M 55 2 clear cell

PD3544a F 50 3 papillary

PD3545a M 54 2 chromophobe

PD3546a F 57 2 clear cell

PD3547a F 63 2 papillary

PD3548a M 66 2 clear cell

PD3550a M 44 2 clear cell

PD3552a M 54 2 clear cell

PD3554a F 55 3 clear cell

PD3555a F 66 1 clear cell

PD3556a M 69 2 clear cell

PD3557a F 49 1 clear cell

PD3558a M 55 2 clear cell

PD3559a F 74 2 clear cell

PD3560a F 78 2 clear cell

PD3561a M 72 3-4 clear cell

PD3562a F 73 oncocytoma

PD3563a M 57 3 clear cell

PD3564a F 68 3 clear cell

PD3565a M 65 3 clear cell

PD3566a M 44 3 clear cell

PD3567a M 75 high Papillary Urothelial Carcinoma

PD3568a F 52 N/D Urothelial Carcinoma

PD3569a F N/D 3 clear cell

PD3570a M 51 2 papillary

PD3571a M 72 3 papillary 2

PD3572a F 46 N/D oncocytoma

PD3573a M 65 2 clear cell

PD3574a 38 3 clear cell

inflammatory myofibroblastic

PD3575a F 62 N/D tumor

PD3576a M 69 2 papillary

PD3577a F 53 3 chromophobe

PD3578a 67 2-3 clear cell

PD3581a M 66 3 clear cell

PD3582a M 56 2 clear cell

PD3587a M N/D 2 clear cell

PD3588a F 77 1 clear cell

PD3589a M 91 3 clear cell PD3590a M 43 3 papillary 2

PD3591a M 79 high Urothelial Carcinoma

PD3592a F 49 2 clear cell

PD3594a M 44 2 clear cell

PD3596a M 54 3 Clear Cell

PD3597a M 60 2 clear cell

PD3598a M 70 3 clear cell

Table 4 - PBRM1 somatic mutations ut

Sample Chr Position WT allele Allele Annotated Transcript Protein annotation cDNA annotation Type

PD1580a 3 52662980 T - ENST00000337303 p.N458fs*17 c.l373delA INDEL

PD1590a 3 52712590 AT - ENST00000337303 p.Y54fs*l c.l62_163delTA 1NDEL

PD1754a 3 52712583 GAT - ENST00000337303 p.l57del c.l69_171delATC INFRAME DEL

PD1759a 3 52620608 T A ENST00000337303 P.K1074* c.3220A>T NONSENSE

PD1767a 3 52702550 GCTGG A ENST00000337303 p.Q117fs*56 c.348_352>T INDEL

PD2127a 3 52643913 T A ENST00000337303 P.K661N C.1983A>T MISSENSE

PD2129a 3 52643561 G A ENST00000337303 p.Q779* C.23350T NONSENSE

PD2130a 3 52696193 C - ENST00000337303 p.D162fs*12 c.484delG INDEL

PD2131a 3 52620701 TTAAAGTA - ENST00000337303 p.Y1043fs*9 C. 12/ 3134del l AU 1 I AA INDEL

PD2135a 3 52597493 G A ENST00000337303 P.Q1298* C.38920T NONSENSE

PD2140a 3 52637682 T - ENST00000337303 p.E878fs*37 c.2634deIA INDEL

PD2145a 3 52651277 c T ENST00000337303 Ρ·? Exon 14 +1 G>A ESSENTIAL SPLICE

PD2146a 3 52678784 T - ENST00000337303 p.l279fs*4 c.835delA INDEL

PD2154a 3 52712548 AG - ENST00000337303 p.C69fs*l c.204_205delCT INDEL

PD2155a 3 52668646 T A EN5T00000337303 p.K425* c.l273A>T NONSENSE

PD2163a 3 52678763 C A ENST00000337303 p.E286* c.856G>T NONSENSE

PD2170a 3 52595987 G C ENST00000337303 Ρ·? Exon 25 -3 C>G INTRONIC

PD2172a 3 52584514 G C ENST00000337303 p.51500* C.44990G NONSENSE

PD2174a 3 52651306 G T ENST00000337303 p.A597D C.1790OA MISSENSE

PD2181a 3 52597493 G A ENST00000337303 P.Q1298* c.3892C>T NONSENSE

PD2183a 3 52621485 ATGTTTC - ENST00000337303 p.E1003fs*9 c.3007 3013delGAAACAT INDEL

TTC I 1 1 1 1 I GTAG p.M1209_E1214 c.3625_3642

PD2186a 3 52610623 AACAT ENST00000337303 delMFYKKE delATGTTCTACAAAAAAGAA INFRAME DEL

PD2186a 3 52610637 T G ENST00000337303 P.H1204P c.3611A>C MISSENSE

PD2190a 3 52643742 TGG - ENST00000337303 p.Y718_Q719>* c.2154 2156delCCA INDEL

PD2192a 3 52651294 TCAT AT ENST00000337303 p.N601fs*8 .1802_1805>TA INDEL

PD2193a 3 52696194 A - ENST00000337303 p,D161fs*13, c.483de!T !NDEL

PD2194a 3 52643755 A - ENST00000337303 p.M714fs*17 c.2141delT INDEL

PD2199a 3 52595782 C A ENST00000337303 p.? Exon 25 +1 G>T ESSENTIAL SPLICE

PD2203a 3 52663050 T - ENST00000337303 p.T435fs*3 c.l303delA INDEL

PD2207a 3 52661375 T - ENST00000337303 p.E486fs*14 c.l455delA INDEL

PD2208a 3 52668757 G A ENST00000337303 p.Q388* c.ll62C>T NONSENSE

PD2209a 3 52702591 T - ENST00000337303 p.M103fs*10 c.307delA INDEL

PD2217a 3 52678784 T - ENST00000337303 p.l279fs*4 c.835delA INDEL

PD2219a 3 52651332 T - ENST00000337303 p.D589fs*2 c.l764delA INDEL

PD2222a 3 52685831 A C ENST00000337303 p.? Exon 6 -5 T>G INTRONIC

PD2222a 3 52643941 G C ENST00000337303 p.S652* .1955C>G NONSENSE

GA I 1 1 1 1 1^'GGAG c.l937_1955delGCATTTCTCCT

PD3284a 3 52643959 AAATGC ENST00000337303 p.G646fs*4 AAAAAATC INDEL

PD3290a 3 52643915 T A ENST00000337303 P.K661* .1981A>T NONSENSE

PD3293a 3 52643770 - T ENST00000337303 p.R710fs*13 c.2126_2127insA INDEL

PD3296a 3 52610615 G T ENST00000337303 p.Y1211* .36330A NONSENSE

TGGGCCTTAATC c.4187_4199deITGATTAAGGC

PD3308a 3 52595884 A ENST00000337303 p.V1396fs*32 CCA INDEL

PD3309a 3 52692216 A - ENST00000337303 p.V215fs*9 c.644delT INDEL

PD3312a 3 52685827 C T ENST00000337303 p.? Exon 6 -1 G>A ESSENTIAL_SPLICE

Exon 22 -1

CTTGGGGAGGA del(TTATATA I 1 1 I CCTCCCCAA

PD3313a 3 52610715 AAATATATAA ENST00000337303 p.? G) ESSENTIAL SPLICE

PD3314a 3 52643772 TT - ENST00000337303 p.K708fs* 14 c.2124 2125delAA INDEL

PD3317a 3 52651527 C A ENST00000337303 p.M523l .1569G>T MISSENSE

PD3336a 3 52584493 A T ENST00000337303 P.I1507N c.4520T>A MISSENSE

PD3337a 3 52651476 T G ENST00000337303 P.R540S c.l620A>C MISSENSE

PD3340a 3 52643966 TGCCACTCTT - ENST00000337303 p.K644fs*9 c.1930 1939delAAGAGTGGCA INDEL

PD3349a 3 52712520 CTTCG - EN5T00000337303 p.R78fs*7 c.232_236delCGAAG INDEL

PD3355a 3 52649473 C G ENST00000337303 P.? Exon 15 -1 G>C ESSENTIAL_SPLICE

PD3363a 3 52712514 ACCTTCGCT - EN5T00000337303 p.? Exon 2 +2 del(AGCGAAGgt) ESSENTIAL SPLICE

PD3371a 3 52623178 ACATGGT - ENST00000337303 p.Y958fs*54 c.2873 2879delACCATGT INDEL

PD3372a 3 52668733 A - ENST00000337303 p.C396fs*8 c.ll86delT INDEL

PD3375a 3 52643656 G CATCH - ENST00000337303 p.K747fs*26 c.2240 2246delAAGATGC INDEL

PD3379a 3 52610695 G A ENST00000337303 P.R1185* c.3553C>T NONSENSE

PD3382a 3 52643912 AG - ENST00000337303 p.L662fs*2 c.1984 1985delCT INDEL

PD3385a 3 52597493 G A ENST00000337303 p.Q1298* c.3892C>T NONSENSE

PD3391a 3 52643874 A C ENST00000337303 p.D674E c.2022T>G MISSENSE

PD3400a 3 52702535 TG - ENST00000337303 p.N121fs*7 c.363_364delCA INDEL

PD3402a 3 52702591 T - ENST00000337303 p.M103fs*10 c.307delA INDEL

PD3411a 3 52702511 T A ENST00000337303 p.? Exon 3 +3 A>T INTRONIC

PD3413a 3 52643561 G A ENST00000337303 p.Q779* C.23350T NONSENSE

PD3422a 3 52589246 T - ENST00000337303 p.K1232fs*37 c.3695delA INDEL

AGTGATGC I 1 I C c.lll2_1131delCAGAAGCAGA

PD3437a 3 52668807 TGCTTCTG ENST00000337303 p.S371fs*14 AAGCATCACT INDEL

PD3438a 3 52582134 - A ENST00000337303 p.L1565fs*>19 c.4694_4695insT INDEL

PD3457a 3 52623136 T - ENST00000337303 p.N972fs*42 c.2915delA INDEL

PD3467a 3 52649441 A T ENST00000337303 p.L.617* c.l850T>A NONSENSE

PD3469a 3 52620607 TT - ENST00000337303 p.K1074fs*32 c.3221 3222delAA INDEL

PD3470a 3 52649469 A - ENST00000337303 p.Y608fs*34 c.l822delT INDEL

PD3472a 3 52637691 A - ENST00000337303 p.R876fs*39 c.2625delT INDEL

TATTCAG G AG AA c.388_401deIGATTCTCCTGAA

PD3476a 3 52696289 TC ENST00000337303 p.D130fs*l TA INDEL

PD3487a 3 52620611 T - ENST00000337303 p.U073fs*86 c.3217delA INDEL

PD3490a 3 52712586 - T ENST00000337303 p.T56fs*6 c.l66_167insA INDEL

PD3492a 3 • 52677318 G T ENST00000337303 p.5314* C.9410A NONSENSE

PD3501a 3 52649430 T c ENST00000337303 P.K621E c.l861A>G MISSENSE

PD3506a 3 52712614 c - ENST00000337303 p.? Exon 2 -1 del(G) ESSENTIAL_SPLICE

PD3511a 3 52623085 TTAC - ENST00000337303 p.? Exon 18 +1 del(GTAA) ESSENTIAL_SPLICE

PD3524a 3 52663053 T A ENST00000337303 p.? Exon 12 -2 A>T ESSENTIAL SPLICE

PD3529a 3 52685778 T G ENST00000337303 P.T232P c.694A>C MISSENSE

PD3536a 3 52584541 G - ENST00000337303 p.P1491fs* 14 c.4472delC INDEL

PD3538a 3 52610715 C A ENST00000337303 p.? Exon 22 -1 G>T ESSENTIAL_SPLICE

PD3540a 3 52643510 C - ENST00000337303 p.E796fs*9 c.2386delG INDEL

PD3541a 3 52613210 T - ENST00000337303 p.E1132fs*27 c.3393delA INDEL

PD3543a 3 52582239 T - ENST00000337303 p,D1530fs*17 c.4589delA INDEL

PD3548a 3 52682460 T C ENST00000337303 p.? Exon 7 -2 A>G ESSENTIAL_SPLICE

PD3550a 3 52663035 G A ENST00000337303 p.Q440* C.13180T NONSENSE

PD3554a 3 52597340 G - ENST00000337303 p.L1349fs*35 c.4045delC INDEL

PD3555a 3 52702645 - A ENST00000337303 p.Y85fs*2 c.253_254insT INDEL

GTTTGCAAGCGG c.405_418de!AGCCGCTTGCAA

PD3556a 3 52696272 CT ENST00000337303 p.K135fs*ll AC INDEL

1 1 1 I CA I 1 1 1 1 I A Exon 16 -3

GGAGAAATGCCA del(tagGTAGGAAGAGTGGCAT

PD3559a 3 52643974 CTCTTCCTACCTA ENST00000337303 p.? TTCTCCTAAAAAATCAAAA) ESSENTIAL SPLICE

PD3563a 3 52589125 T - ENST00000337303 p.G1273fs*2 c.3816delA INDEL

PD3573a 3 52712587 A - ENST00000337303 p.N55fs*40 c.l65delT INDEL

PD3587a 3 52651439 T A ENST00000337303 P.K553* c.l657A>T NONSENSE

PD3588a 3 52613142 TCAT - ENST00000337303 p.N1154fs*4 c.3461 3464delATGA INDEL

PD3596a 3 52610766 T - ENST00000337303 p.E1214fs*4 c.3639delA NONSENSE

PD4139a 3 52682412 A G ENST00000337303 p.L254P c.761T>C MISSENSE

PD4145a 3 52589136 T A ENST00000337303 P.K1269* c.3805A>T NONSENSE

PD4150a 3 52682425 T A ENST00000337303 p.K250* c.748A>T NONSENSE

PD4152a 3 52621459 T - ENST00000337303 p.K1011fs*3 c.3033delA INDEL

PD4156a 3 52620629 T - ENST00000337303 p.T1067fs*92 c.3199delA INDEL

TATTCAGGAGAA

PD4164a 3 52643528 TC EN5T00000337303 p.M790fs*5 c.2368_2369delAT INDEL

PD4165a 3 52589087 T C ENST00000337303 P.D1285G c.3854A>G MISSENSE

PD4168a 3 52678719 C - ENST00000337303 Ρ·? Exon 8 +1 del(G) ESSENTIAL_SPLICE

Table 5 - PBRMl variants in cancer cell lines

WT Mut Annotated cDNA Protein

Sample Tissue Histology Zygosity CHr Position allele Allele Transcript Annotation Annotation Typ

NCI-H1793 Lung Adenocarcinoma Hetero- 3 52692313 T A ENST00000337303 c.547A>T P.K183* NO

Serous

micropapiliary

OC-314 Ovary carcinoma Hetero- 3 52678727 G A ENST00000337303 C.8920T P.R298* NO

PANC-10-05 Pancreas Ductal carcinoma Homo- 3 52651496 G A ENST00000337303 C.1600OT p.R534* NO

Carcinosarcoma- malignant

mesodermal

ESS-1 Endometrium mixed tumour Hetero- 3 52643768 G A ENST00000337303 C.21280T P.R710^* NO

Large

intestine,

HCC2998 colon Adenocarcinoma Hetero- 3 52643768 G A ENST00000337303 C.21280T P.R710* NO

Renal cell

ACHN Kidney carcinoma Hetero- 3 52620674 G A ENST00000337303 C.31540T P.R1052* NO

Squamous cell

NCI-H226 Lung carcinoma Homo- 3 52584768 G A ENST00000337303 C.43540T P.Q1452* NO

HaematoLymphoid

poietic and neoplasm, acute

lymphoid lymphoblastic T

TALL-1 tissue cell leukaemia Hetero- 3 52584629 G A ENST00000337303 c.4384C>T P.Q1462* NO

Large

intestine,

CW-2 colon Carcinoma Hetero- 3 52678784 T ENST00000337303 c.835delA p.l279fs^*4 IND

NCI-SNU-1 Stomach Carcinoma Hetero- 3 52678784 T - ENST00000337303 c.835delA p.l279fs^*4 IND

Renal cell C.1713J71

A704 Kidney carcinoma Homo- 3 52651383 AA ENST00000337303 4insTT p.E572fs^*16 IND

Small cell

NCI-H2196 Lung carcinoma Homo- 3 52637580 T ENST00000337303 c.2736delA p.E913fs*2 IND

Biliary tract, c.3489_349

TGBC24TKB bile duct Carcinoma Homo- 3 526131 14 - A ENST00000337303 OinsT p.V1 164fs*17 IND

HaematoLymphoid

poietic and neoplasm, acute

lymphoid lymphoblastic T

SUP-T1 tissue cell leukaemia Hetero- 3 52597340 G ENST00000337303 c.4045delC p.L1349fs^*35 IND

Large

intestine, Exon 28 -4

HCC2998 colon Adenocarcinoma Hetero- 3 52582255 A C ENST00000337303 T>G P.? INT

Small cell Exon 17 +4

NCI-H378 Lung carcinoma Homo- 3 52623082 C T ENST00000337303 G>A P.? INT

Bronchioloalveola

NCI-H650 Lung r adenocarcinoma Hetero- 3 52712607 C G ENST00000337303 c.145G>C p.V49L MIS

Glioma,

Central astrocytoma

nervous Grade IV,

system, glioblastoma

8-MG-BA frontal lobe multiforme Homo- 3 52712586 T C ENST00000337303 c.166A>G Ρ.Τ56Α MIS

Large

intestine,

SW1417 colon Adenocarcinoma Homo- 3 52712556 T C ENST00000337303 c.196A>G P.R66G MIS

Urinary tract, Transitional cell

647-V bladder carcinoma Hetero- 3 52702630 G C ENST00000337303 C.2680G p.Q90E MIS

Malignant

A4-Fuk Skin melanoma Hetero- 3 52696246 T A ENST00000337303 c.431A>T P.Y144F MIS

Malignant

A4-Fuk Skin melanoma Hetero- 3 52696198 T G ENST00000337303 c.479A>C P.E160A MIS

SNG-M Endometrium Adenocarcinoma Hetero- 3 52692256 G A ENST00000337303 C.604OT P.R202C MIS

HaematoHaematopoietic

poietic and neoplasm, acute

lymphoid lymphoblastic

CCRF-CEM tissue leukaemia Hetero- 3 52692244 C T ENST00000337303 c.616G>A P.E206K MIS

HaematoHaematopoietic

poietic and neoplasm, acute

lymphoid myeloid

CTV-1 tissue leukaemia, M5 Hetero- 3 52685795 T C ENST00000337303 c.677A>G P.E226G MIS

MDA-MB- 231 Breast Carcinoma Hetero- 3 52685790 T C ENST00000337303 c.682A>G P.I228V MIS

OS-RC-2 Kidney Renal cell Homo- 3 52685774 A G ENST00000337303 c.698T>C P.I233T MIS

carcinoma

OVCAR-5 Ovary Carcinoma Hetero- 3 52682407 C T ENST00000337303 c.766G>A P.A256T MIS

Malignant

IGR-1 Skin melanoma Homo- 3 52676038 C G ENST00000337303 c.1019G>C P.G340A MIS

A388 NS Carcinoma Hetero- 3 52643864 G A ENST00000337303 c.2032C>T P.R678C MIS

HaematoHaematopoietic

poietic and neoplasm, acute

lymphoid lymphoblastic

LC4-1 tissue leukaemia Hetero- 3 52637638 T C ENST00000337303 c.2678A>G P.Y893C MIS

Small cell

SBC-1 Lung carcinoma Homo- 3 52637638 T C ENST00000337303 c.2678A>G P.Y893C MIS

Hepatocellular

SNU-449 Liver carcinoma Hetero- 3 52637638 T C ENST00000337303 c.2678A>G P.Y893C MIS

Small cell

NCI-H446 Lung carcinoma Hetero- 3 52637633 T A ENST00000337303 c.2683A>T P.T895S MIS

ZR-75-30 Breast Ductal carcinoma Hetero- 3 52637552 c G ENST00000337303 c.2764G>C P.E922Q MIS

Large

intestine,

HCC2998 colon Adenocarcinoma Hetero- 3 52637543 T G ENST00000337303 C.2773A>C P.K925Q MIS

Haematopoietic and Lymphoid

lymphoid neoplasm, hairy

BONNA-12 tissue cell leukaemia Hetero- 3 52620536 c A ENST00000337303 c.3292G>T P.A1098S MIS

Haematopoietic and Haematopoietic

lymphoid neoplasm, acute

RS4-1 1 tissue leukaemia Hetero- 3 52620469 c T ENST00000337303 c.3359G>A P.R1120Q MIS

BFTC-909 Kidney Carcinoma Hetero- 3 52613074 c T ENST00000337303 c.3529G>A P.G1 177S MIS

MDA-MB- 415 Breast Carcinoma Homo- 3 52589082 c G ENST00000337303 c.3859G>C P.E1287Q MIS

Calu-3 Lung Adenocarcinoma Hetero- 3 52595830 c T ENST00000337303 c.4241 G>A P.G1414E MIS

NCI-SNU-1 Stomach Carcinoma Hetero- 3 52588842 c A ENST00000356770 c.4246G>T P.G1416C MIS

HEC-1 Endometrium Adenocarcinoma Hetero- 3 52584763 c A ENST00000337303 c.4359G>T P.Q1453H MIS

EVSA-T Breast Carcinoma Hetero- 3 52582210 G A ENST00000337303 C.46180T P.R1540C MIS

Large

intestine, c.3235 323

RKO colon Carcinoma Hetero- 3 52620593 GG TA ENST00000337303 6COTA p.P1079>Y IND

Upper

aerodigestive

tract,

sinonasal and

nasal cavity, Squamous cell C.3396 339 P.E1 132 D1

HCE-T sinus carcinoma Hetero- 3 52613207 TCT ENST00000337303 8delAGA 133>D

O ^C Table 6. Deregulated Gene Sets in PBRM1 Knockdown Cellines

Significance of enrichment

Gene Set Description^3, 786-0 SN12C TK10

CHROMOSOME_INSTABILITY - PMID: 16921376 0.0001 0.0001 0.0001

ZHAN_MM_CD138_PR_VS_REST 0.0002 0.0004 0.0001

IDX_TSA_UP_CLUSTER3 0.0001 0.0022 0.0001

SERUM_FIBROBLAST_CELLCYCLE 0.0001 0.0301 0.0002

DOX_RESIST_GASTRIC_UP 0.0001 0.0332 0.0003

P21_P53_ANY_DN 0.0054 0.0032 0.0001

CROONQUIST_IL6_STARVE_UP 0.0058 0.0078 0.0001

CROONQUIST_IL6_RAS_DN 0.0025 0.0322 0.0001

DNA_REPLICATION_REACTOME 0.0060 0.0418 0.0002

ADIP_DIFF_CLUSTER4 0.0038 0.0083 0.0016

GAY_YY1_DN 0.0011 0.0297 0.0028

HSA00240_PYRIMIDINE_1 ETABOLISM 0.0015 0.0038 0.0189

LEE_TCELLS3_UP 0.0377 0.0161 0.0002

OLDAGE_DN 0.0001 0.0287 0.0460

PYRIMIDINE_METABOLISM 0.0012 0.0153 0.0196

IGF_VS_PDGF_DN 0.0016 0.0267 0.0295

GOLDRATH_CELLCYCLE 0.0087 0.0262 0.0096

P21_ANY_DN 0.0160 0.0173 0.0098

P21_P53_MIDDLE_DN 0.0043 0.0249 0.0412

GERY CEBP TARGETS 0.0085 0.0190 0.0382 ^aPathways were obtained from the MSigDB with the exception of the

CHROMOSOME_INSTABILITY gene set that was obtained from the BioConductor PGSEA package

Comparisons between PBRM1 targeting and scrambled siRNA

Table 7 - PBRM1 primer sequences

STS Forward Primer Reverse Primer

stCE03- 616895 AAACAAGGAAGTCCAGGGC AAAAAGTG G AG ATG C CTTG C stCE03- 616896 TTGGAAGCGGGATTTGGA GGCACACGTTGTCCAGGAT stCE03- 616897 TTTGTCTGCAGGTTATATTTCACT G I N C AAG C AG G ACTTTGTGT AG stCE03- 616898 CCCTCTAGATCTGAGTTGCCTG ATCCTTCTTGCTCGTTCCAA stCE03- 616899 CCCAAATGTGAC I I I GCTGA AAGAGATTTTCAATTTTGTCTTCCTC stCE03- 616900 AAGTATC I I I I CATGTGTTTAATGGG AAAAAG C AC AAAT AC CT AC CG A stCE03- 616901 CCATATGGACAACAGGTGAGC AAACATGCAAAGAAACTCCAAAC stCE03- 616902 GAAATGTGCCTGGAAATATTCTG TTGAAATAGCTTATTAAAAGTGTCCG stCE03- 616903 AAGTAAGCTTCAAAGTCCATGAAA TAAAAATCATATGAATGTCCAGTCTC stCE03- 616905 GTTGCTGTTTTGAATTAGCTCTACA CAACATCTTCCTTTTGAACTTACTTT stCE03- 616906 ATGGTTCTGATATAATAAATGTGCTG TATAATCAGAAATGTCGGTAACCA stCE03- 616907 TACCTTAATGTAATGGTGCTTTTGC TAATATTACTGCTGAGGGTGGGG stCE03- 616908 TTTTGTCATGCAGGCTTTTG ATGTAGTAGTCA I I I I CATCTGGGTC stCE03- 616909 CATGCAGTACTAAGGGTGCTTTATT CTCTGCCATGTGTGCTGTG stCE03- 616910 TGACTTTACATGTTGTTCATATGTGT AACTAACCTTGAATACTTGAGAGCC stCE03- 616911 GATTGATGGTGTATTTCCTAATTTTG CAGAGTTCCTAA I I I I GTAAACATCG stCE03- 616912 AAACTCTTTCCATGCTGCCT TC ATG G C ACTG AC AAAATCTG stCE03- 616913 GTTCAGC I I I I GTTTGGTTGG TTCCTGTTTGGCTAAGG I I I I G stCE03- 616914 ACTC AGTTGTTTG AAAG GAG AC A AAAAAG CTTC ACTAC AG CTTG ATTA stCE03- 616915 TGAAGATAGATA I I I I GGAAGCTTGT AGACATTTTCTTAAACCTACCTCATTC stCE03- 616916 AGTTGGGGGCATTAAGCTGT CAGCAAATATAAAGGCATTAAGGG stCE03- 616917 TGCTTATAACTTCCAGCATGGTT CTATAAGTACCCCTCTCCCGC stCE03- 616918 GGTTAAACCATCCAAAAAGGA GGAACGTTTATC I I I ATAATGTACTGC stCE03- 616919 CAAACTTCGGAAAGATACTCTTCA TTCCATCTCATTGCGTCTACTC stCE03- 616920 GCATGTTGCAAATGGAATTAAA TGTGACACTTGCCCAATAGGT stCE03- 616921 GTGTTCCTGGCTTCTGAAAAA TCACAGCCCTCATCTCACTG stCE03- TTAAGTACAGAGATAAACTAAGGAGGC GTTTTAAACCAGGATCTGCTAAGT 616922

stCE03- 616923 C AG G ACTTTTGTTAAAAC CTG C CAGAAAAATCAGCAATCTCTTCTT stCE03- 616924 TTGGAATGTAGG I I I ATAATGATGC CTGTCCAGTTGGAACTGCTG stCE03- 616925 CCACAAAGATTCAAGGGCAG TAATGCTGTTGGACTCCGC stCE03- 616926 GTACCAGGTCCTCTGGTCACT AATAAACCATTTGACAACAGATTCTC stCE03- 616995 TTGAGCAGTTAACCAAATGTAATGT I I I I GGAGAAATTTGCAGGG stCE03- 616996 GTAACTATGACCACAGTTTACTCC I I I TGACAGGATATAAACCAGAACCA stCE03- 616997 AAGAAAAGTCTGCTTTCGTTTCTTAC GTGTCACTTCAAA I I I ATGCTAAAGG stCE03- 616998 ATATTTAGTTCAATCTGGAAGGTTGT GGTAATGAACAGTTAAAATTTGAGG

Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art (e.g., in cell culture, molecular genetics, nucleic acid chemistry, hybridisation techniques and biochemistry). Standard techniques are used for molecular, genetic and biochemical methods. See, generally, Sambrook et al, Molecular Cloning: A Laboratory Manual, 2d ed. (1989) Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N. Y. and Ausubel et al. , Short Protocols in Molecular Biology (1999) 4th Ed, John Wiley & Sons, Inc.; as well as Guthrie et al., Guide to Yeast Genetics and Molecular Biology, Methods in Enzymology, Vol. 194, Academic Press, Inc., (1991), PCR Protocols: A Guide to Methods and Applications (Innis, et al. 1990. Academic Press, San Diego, Calif.), McPherson et al., PCR Volume 1, Oxford University Press, (1991), Culture of Animal Cells: A Manual of Basic Technique, 2nd Ed. (R. I. Freshney. 1987. Liss, Inc. New York, N.Y.), and Gene Transfer and Expression Protocols, pp. 109-128, ed. E. J. Murray, The Humana Press Inc., Clifton, N.J.). These documents are incorporated herein by reference.

Each of the applications and patents mentioned in this document, and each document cited or referenced in each of the above applications and patents, including during the prosecution of each of the applications and patents ("application cited documents") and any manufacturer's instructions or catalogues for any products cited or mentioned in each of the applications and patents and in any of the application cited documents, are hereby incorporated herein by reference. Furthermore, all documents cited in this text, and all documents cited or referenced in documents cited in this text, and any manufacturer's instructions or catalogues for any products cited or mentioned in this text, are hereby incorporated herein by reference.

Various modifications and variations of the described methods and system of the invention will be apparent to those skilled in the art without departing from the scope and spirit of the invention. Although the invention has been described in connection with specific preferred embodiments, it should be understood that the invention as claimed should not be unduly limited to such specific embodiments and that many modifications and additions thereto may be made within the scope of the invention. Indeed, various modifications of the described modes for carrying out the invention which are obvious to those skilled in molecular biology or related fields are intended to be within the scope of the claims. Furthermore, various combinations of the features of the following dependent claims can be made with the features of the independent claims without departing from the scope of the present invention. Rini, B.I., Campbell, S.C. & Escudier, B. Renal cell carcinoma. The Lancet 373, 1119- 1132 (2009).

Dalgliesh, G.L. et al. Systematic sequencing of renal carcinoma reveals inactivation of histone modifying genes. Nature 463, 360-363 (2010). van Haaften, G. et al. Somatic mutations of the histone H3K27 demethylase gene UTX in human cancer. Nat Genet. 41, 521-3 (2009).

Kouzarides, T. Chromatin Modifications and Their Function. Cell 128, 693-705 (2007).

Thompson, M. Polybromo-1 : The chromatin targeting subunit of the PBAF complex. Biochimie 91, 309-319 (2009).

Gnirke, A. et al. Solution hybrid selection with ultra-long oligonucleotides for massively parallel targeted sequencing. Nat Biotech 27, 182-189 (2009).

Ye, K., Schulz, M.H., Long, Q., Apweiler, R. & Ning, Z. Pindel: a pattern growth approach to detect break points of large deletions and medium sized insertions from paired-end short reads. Bioinformatics 25, 2865-2871 (2009).

Reisman, D., Glaros, S. & Thompson, E.A. The SWI/SNF complex and cancer. Oncogene 28, 1653-1668 (2009).

Schneppenheim, R. et al. Germline Nonsense Mutation and Somatic Inactivation of SMARCA4/BRG1 in a Family with Rhabdoid Tumor Predisposition Syndrome. The American Journal of Human Genetics 86, 279-284 (2010).

Versteege, I. et al. Truncating mutations of hSNF5/INIl in aggressive paediatric cancer. Nature 394, 203-206 (1998).

Wong, A.K.C. et al. BRG1, a Component of the SWI-SNF Complex, Is Mutated in Multiple Human Tumor Cell Lines. Cancer Res 60, 6171-6177 (2000). 12. Chandrasekaran, R. & Thompson, M. Polybromo-l-bromodomains bind histone H3 at specific acetyl-lysine positions. Biochemical and Biophysical Research Communications 355, 661-666 (2007).

13. Finn, R.D. et al. The Pfam protein families database. Nuc Acids Res 38, D21 1-222 (2010).

14. Xia, W. et al. BAF180 Is a Critical Regulator of p21 Induction and a Tumor Suppressor Mutated in Breast Cancer. Cancer Research 68, 1667-1674 (2008).

15. Sekine, I. et al. The 3p21 candidate tumor suppressor gene BAF180 is normally expressed in human lung cancer. 24, 2735-2738 (2005). 16. Bignell, G.R. et al. Signatures of mutation and selection in the cancer genome. Nature

463, 893-898 (2010).

17. Jones, S. et al. Core Signaling Pathways in Human Pancreatic Cancers Revealed by Global Genomic Analyses. Science 321, 1801-1806 (2008).

18. Keng, V.W. et al. A conditional transposon-based insertional mutagenesis screen for genes associated with mouse hepatocellular carcinoma. Nat Biotech 27, 264-274

(2009).

19. Hingorani, S.R. et al. Preinvasive and invasive ductal pancreatic cancer and its early detection in the mouse. Cancer Cell 4, 437-450 (2003).

20. Xue, Y. et al. The human SWI/SNF-B chromatin-remodeling complex is related to yeast Rsc and localizes at kinetochores of mitotic chromosomes. Proc Natl Acad Sci U

SA 97, 13015-13020 (2000).

21. Vries, R.G.J. et al. Cancer-associated mutations in chromatin remodeler hSNF5 promote chromosomal instability by compromising the mitotic checkpoint. Genes Dev 19, 665-670 (2005). 22. Mandriota, S.J. et al. HIF activation identifies early lesions in VHL kidneys: Evidence for site-specific tumor suppressor function in the nephron. Cancer Cell 1, 459-468 (2002). 23. Young, A.P. et al. VHL loss actuates a HIF-independent senescence programme mediated by Rb and p400. Nat Cell Biol 10, 361-369 (2008).

24. Steven, C.C., Amanda, H.P., Nabeel, A.A., Charles, H.C.M.B. & Eamonn, R.M.

Inactivation of the von Hippel-Lindau {VHL) tumour suppressor gene and allelic losses at chromosome arm 3p in primary renal cell carcinoma: Evidence for a VHL- independent pathway in clear cell renal tumoungenesis. Genes, Chromosomes and Cancer 22, 200-209 (1998).

25. Martinez, A. et al. Role of chromosome 3pl2-p21 tumour suppressor genes in clear cell renal cell carcinoma: analysis of VHL dependent and VHL independent pathways of tumorigenesis. Molecluar Pathology 53, 137- 144 (2000).

26. Kenneth, N.S., Mudie, S., van Uden, P. & Rocha, S. SWI/SNF Regulates the Cellular Response to Hypoxia. Journal of Biological Chemistry 284, 4123-4131 (2009).

27. Wang, X. et al. Expression of p270 (ARID 1 A), a component of human SWI/SNF complexes, in human tumors. Int J Cancer 112, 636-642 (2004). 28. Papaemmanuil, E. et al. Loci on 7pl2.2, 10q21.2 and 14ql 1.2 are associated with risk of childhood acute lymphoblastic leukemia. Nat Genet 41, 1006-1010 (2009).

29. Collier, L.S., Carlson, CM., Ravimohan, S., Dupuy, AJ. & Largaespada, D.A. Cancer gene discovery in solid tumours using transposon-based somatic mutagenesis in the mouse. Nature 436, 272-276 (2005). 30. Uren, A.G. et al. Large-Scale Mutagenesis in pl9ARF- and p53-Deficient Mice Identifies Cancer Genes and Their Collaborative Networks. Cell 133, 727-741 (2008). a. Mamanova, L. et al. Target-enrichment strategies for next-generation sequencing. Nat Meth l, 11 1-1 18. b. Li, H. & Durbin, R. Fast and accurate long-read alignment with Burrows- Wheeler transform. Bioinformatics 26, 589-595 (2010). c. Do, C.B. & Batzoglou, S. What is the expectation maximization algorithm? Nat Biotech 26, 897-899 (2008). d. Ye, K., Schulz, M.H., Long, Q., Apweiler, R. & Ning, Z. Pindel: a pattern growth approach to detect break points of large deletions and medium sized insertions from paired- end short reads. Bioinformatics 25, 2865-2871 (2009). e. Dalgliesh, G.L. et al. Systematic sequencing of renal carcinoma reveals inactivation of histone modifying genes. Nature 463, 360-363 (2010). f. Finn, R.D. et al. The Pfam protein families database. Nuc Acids Res 38, D211-222 (2010). g. Eddy, S.R. Profile hidden Markov models. Bioinformatics 14, 755-763 (1998). h. Durbin, R., Eddy, S., Krogh, A. & Mitchison, G. Biological sequence analysis: probabilistic models of proteins and nucleic acids, (Cambridge University Press, Cambridge

1998). i. Lawrence, C.E. et al. Detecting subtle sequence signals: a Gibbs sampling strategy for multiple alignment. Science 262, 208-214 (1993). j. Jordan, D.M., Ramensky, V.E. & Sunyaev, S.R. Human allelic variation: perspective from protein function, structure, and evolution. Current Opinion in Structural Biology 20, 342-350. k. Dixit, A. et al. Sequence and Structure Signatures of Cancer Mutation Hotspots in Protein Kinases. PLoS ONE 4, e7485 (2009).

1. Yue, P. et al. Inferring the functional effects of mutation through clusters of mutations in homologous proteins. Human Mutation 31, 264-271 (2010). m. Yang, X.J. et al. A molecular classification of papillary renal cell carcinoma. Cancer Res 65, 5628-37 (2005). n. Gentleman, R.C. et al. Bioconductor: open software development for computational biology and bioinformatics. Genome Biol 5, R80 (2004). o. Dai, M. et al. Evolving gene/transcript definitions significantly alter the interpretation of GeneChip data. Nuc Acids Res 33, el 75 (2005). p. Irizarry, R.A. et al. Exploration, normalization, and summaries of high density oligonucleotide array probe level data. Biostatistics 4, 249-64 (2003). q. Smyth, G.K. Linear models and empirical bayes methods for assessing differential expression in microarray experiments. StatAppl Genet Mol Biol 3, Article3 (2004).

Claims

1. A method for detecting a mutation associated with renal cancer in a subject, comprising screening a test sample derived from the subject for the presence of one or more mutations in a PBRM1 gene or a product thereof.

2. A method according to claim 1 , wherein the mutation is a truncation mutation.

3. A method according to claim 1 or claim 2, wherein the cancer is clear cell renal carcinoma.

4. A method according to any preceding claim, wherein the test sample comprises a renal tissue sample which is suspected to be cancerous or at risk of cancer, and presence of the mutation is indicative of renal cancer or an increased risk of renal cancer in the subject.

5. A method according to claim 4, further comprising screening a control sample derived from a normal tissue of the subject for the presence of the mutation, wherein presence of the mutation in the test sample and absence of the mutation in the control sample is indicative of a somatic mutation associated with renal cancer or an increased risk of renal cancer in the subject.

6. A method according to any preceding claim, wherein the method comprises obtaining nucleic acids from the sample, and detecting one or more mutations in a polypeptide- encoding nucleic acid sequence of the PBRM1 gene.

7. A method according to any of claims 1 to 5, wherein the method comprises screening the sample with a ligand which binds selectively to a mutant polypeptide product of the PBRM1 gene.

8. A method according to any preceding claim, wherein the mutation comprises a PBRM1 mutation as defined in Table 2, 4 or 5.

9. A method according to any preceding claim, further comprising screening the sample for one or more mutations in a VHL and/or SETD2 gene or a product thereof.

10. An isolated nucleic acid encoding at least a portion of a PBRMl gene product, wherein the nucleic acid comprises a PBRMl mutation as defined in Table 2, 4 or 5.

11. An isolated nucleic acid which is complementary to, or hybridises specifically to, a mutant nucleic acid as defined in claim 10.

12. An isolated nucleic acid primer which directs specific amplification of a mutant nucleic acid as defined in claim 10.

13. An isolated polypeptide comprising at least a portion of a product of a PBRMl gene, wherem the polypeptide comprises a PBRMl mutation as defined in Table 2, 4 or 5.

14. A ligand which binds selectively to a mutant polypeptide as defined in claim 13.

15. A ligand according to claim 14, comprising an antibody.