WO2012032510A1

WO2012032510A1 - Primers for amplifying dna and methods of selecting same

Info

Publication number: WO2012032510A1
Application number: PCT/IL2011/000709
Authority: WO
Inventors: Danny Zeevi; Eran Segal
Original assignee: Yeda Research And Development Co. Ltd.
Priority date: 2010-09-07
Filing date: 2011-09-06
Publication date: 2012-03-15

Abstract

A method of amplifying a target nucleic acid sequence in a nucleic acid sample is disclosed. The method comprises: (a) contacting the nucleic acid sample with a forward and reverse oligonucleotide primer under conditions which allow hybridization of the forward and reverse oligonucleotide primer to the target nucleic acid sequence, wherein the forward and reverse primer are each covalently attached at their 5' end to a oligonucleotide tail having a nucleic acid sequence that is not complementary to the target nucleic acid sequence, wherein at least 70 % of the tail consists of two bases that do not complement each other; and wherein the oligonucleotide tail is no longer than 80 bases. (b) amplifying the target nucleic acid sequence, thereby amplifying the target nucleic acid sequence.

Description

PRIMERS FOR AMPLIFYING DNA AND METHODS OF SELECTING SAME

FIELD AND BACKGROUND OF THE INVENTION

The present invention, in some embodiments thereof, relates to primers for DNA amplification and methods of selecting same.

Polymerase Chain Reaction (PCR) is one of the most fundamental techniques in molecular biology, whereby virtually any DNA sequence can be selectively amplified. The method involves using paired sets of oligonucleotides of predetermined sequence that hybridize to opposite strands of DNA and define the limits of the sequence to be amplified. The oligonucleotides prime multiple sequential rounds of DNA synthesis catalyzed by a thermostable DNA polymerase. Each round of synthesis is typically separated by a melting and re-annealing step, allowing a given DNA sequence to be amplified several hundred-fold in less than an hour.

The simplicity and reproducibility of these reactions has given PCR broad applicability. For example, PCR has gained widespread use for the diagnosis of inherited disorders and susceptibility to disease. Typically, the genomic region of interest is amplified from either genomic DNA or from a source of specific cDNA encoding the cognate gene product. Mutations or polymorphisms are then identified by subjecting the amplified DNA to analytical techniques such as DNA sequencing, hybridization with allele specific oligonucleotides, restriction endonuclease cleavage or single-strand conformational polymorphism (SSCP) analysis.

Although widely used for decades, the sensitivity, specificity and efficiency of PCR still needs much improvement. Common problems of PCR include complete failure of the reaction, low yields of products, non-specific products (amplifications of undesired regions from the template DNA), self amplification of the primers and primer-dimers. The common cause of most of these PCR problems and the most critical parameter for successful PCR is optimal primer design. Although several algortithms have been developed to aid in primer design, there still remains a need to further optimize the PCR protocol.

The length of the primers is a critical factor for the success of PCR reactions. Longer primers recognize and bind more bases in the template, resulting in a shorter annealing time, higher melting temperature (TM) and therefore higher efficiency and specificity.

However, the length of the primer is limited for several reasons: First, longer primers have more options for creating secondary structures which inhibit binding to the template. Second, longer primers have more possible regions for self and inter-primers complementary, leading in turn to primer-dimers. To avoid secondary structures, it was suggested to limit the G/C content of the primer, and to choose primers that are deficient in one of the four bases. However, such an approach is problematic since it greatly limits the location on the template from which primers can be chosen from. Third, it is difficult to locate long stretches on the template for primers lacking nucleotide repeats. Such repeats are very abundant in genomes, and if included in the primer sequence could lead to ambiguous binding of primers to their target site. Finally, longer primers have a higher probability of including sequences homologous to other locations in the genome, which can lead to inhibition or non-specific products. The problems above are further enhanced when amplification must take place between precise locations. In such cases, the user is forced to design sub-optimal primers that suffer from many of the above problems.

A method to improve the specificity of PCR through increasing primer lengths was suggested almost two decades ago [F. Weighardt, G. Biamonti, and S. Riva, PCR methods and applications, vol. 3, 1993, pp. 77-80]. The researches added tails to the original primers, with sequences that were unrelated to the template DNA. The tails were comprised of all four bases. In such a reaction, during the first few PCR cycles only the complementary part of the primer binds to the template. Afterwards, products with the tails at their ends start to form, allowing the full primers (including the tail) to bind these products and amplify them. The annealing temperature of the reaction was raised to increase the specificity.

U.S. Patent No. 5,882,856 teaches addition of a specific tail to a plurality of primers for use in a multiplex reaction, the tail comprising all four bases.

U.S. Patent Application No. 20090311672 teaches addition of tails to primers, the tails comprising all four bases. Afonin et al., [BioTechniques, Vol. 43, No. 6, December 2007, pp. 770-774] teaches addition of tails to primers, the tails being enriched in bases that complement each other (A and T).

SUMMARY OF THE INVENTION

According to an aspect of some embodiments of the present invention there is provided a method of amplifying a target nucleic acid sequence comprised in a nucleic acid sample, the method comprising:

(a) contacting the nucleic acid sample with a forward and reverse oligonucleotide primer under conditions which allow hybridization of the forward and reverse oligonucleotide primer to the target nucleic acid sequence, wherein the forward and reverse primer are each covalently attached at their 5' end to a oligonucleotide tail having a nucleic acid sequence that is not complementary to the target nucleic acid sequence, wherein at least 70 % of the tail consists of two bases that do not complement each other; and wherein the oligonucleotide tail is no longer than 80 bases.

(b) amplifying the target nucleic acid sequence, thereby amplifying the target nucleic acid sequence.

According to an aspect of some embodiments of the present invention there is provided a primer pair comprising a forward and reverse primer for amplifying a target nucleic acid sequence, wherein the forward and reverse primer are each covalently attached at their 5' end to a oligonucleotide tail having a nucleic acid sequence that is not complementary to the target nucleic acid sequence, wherein at least 70 % of the tail consists of two bases that do not complement each other; and wherein the oligonucleotide is no longer than 30 bases.

According to an aspect of some embodiments of the present invention there is provided a kit comprising the primer pair of the present invention.

According to an aspect of some embodiments of the present invention there is provided a computing platform for identifying a sequence of a primer suitable for amplifying a target nucleic acid sequence, the computing platform comprising:

(a) a user interface for specifying a target;

(b) software for computing the sequence of the primer, the primer being selected to have an oligonucleotide tail at its 5' end, wherein the tail has a nucleic acid sequence that is not complementary to the target nucleic acid sequence, wherein at least 70 % of the tail consists of two bases that do not complement each other; and

(c) a processing unit for outputting the nucleic acid sequence of the primer. According to some embodiments of the invention, the forward and reverse oligonucleotide primer are each between 18-30 bases.

According to some embodiments of the invention, the oligonucleotide tail is between 10-25 bases.

According to some embodiments of the invention, the oligonucleotide tail consists of two bases that do not complement each other.

According to some embodiments of the invention, the oligonucleotide tail consists of three bases, wherein at least 70 % of the tail consists of two bases of the three bases that do not complement each other.

According to some embodiments of the invention, the oligonucleotide tail is devoid of a sequence which repeats consecutively more than four times.

According to some embodiments of the invention, a 5' end of the oligonucleotide tail has a C or G base.

According to some embodiments of the invention, the oligonucleotide tail does not encode a restriction site.

According to some embodiments of the invention, the oligonucleotide tail is attached to the forward and/or reverse primer via an additional oligonucleotide encoding a restriction site.

According to some embodiments of the invention, the nucleic acid sequence of the oligonucleotide tail attached to the forward primer is non-identical to a nucleic acid sequence of the oligonucleotide tail attached to the reverse primer.

According to some embodiments of the invention, the amplifying is effected in a presence of a double stranded DNA detecting molecule.

According to some embodiments of the invention, the double stranded detecting molecule is a double stranded DNA intercalating detecting molecule.

According to some embodiments of the invention, the double stranded DNA intercalating detecting molecule is selected from the group consisting of ethidium bromide, YO-PRO-1, Hoechst 33258, SYBR Gold, and SYBR Green I. According to some embodiments of the invention, the double stranded DNA detecting molecule is a primer-based double stranded DNA detecting molecule.

According to some embodiments of the invention, the primer-based double stranded DNA detecting molecule is selected from the group consisting of fluorescein, FAM, JOE, HEX, TET, Alexa Fluor 594, ROX, TAMRA, rhodamine and BODIPY-FI.

According to some embodiments of the invention, the primer-based double stranded DNA detecting molecule has a nucleic acid sequence identical to the nucleic acid sequence of the oligonucleotide tail of the forward primer or the reverse primer.

According to some embodiments of the invention, the computing platform further comprises software for computing a sequence of a pair to the primer.

According to some embodiments of the invention, the kit further comprises a thermostable DNA polymerase.

According to some embodiments of the invention, the kit further comprises at least one dNTP.

Unless otherwise defined, all technical and/or scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which the invention pertains. Although methods and materials similar or equivalent to those described herein can be used in the practice or testing of embodiments of the invention, exemplary methods and/or materials are described below. In case of conflict, the patent specification, including definitions, will control. In addition, the materials, methods, and examples are illustrative only and are not intended to be necessarily limiting.

Implementation of the method and/or system of embodiments of the invention can involve performing or completing selected tasks manually, automatically, or a combination thereof. Moreover, according to actual instrumentation and equipment of embodiments of the method and/or system of the invention, several selected tasks could be implemented by hardware, by software or by firmware or by a combination thereof using an operating system.

For example, hardware for performing selected tasks according to embodiments of the invention could be implemented as a chip or a circuit. As software, selected tasks according to embodiments of the invention could be implemented as a plurality of software instructions being executed by a computer using any suitable operating system. In an exemplary embodiment of the invention, one or more tasks according to exemplary embodiments of method and/or system as described herein are performed by a data processor, such as a computing platform for executing a plurality of instructions. Optionally, the data processor includes a volatile memory for storing instructions and/or data and/or a non-volatile storage, for example, a magnetic hard-disk and/or removable media, for storing instructions and/or data. Optionally, a network connection is provided as well. A display and/or a user input device such as a keyboard or mouse are optionally provided as well.

BRIEF DESCRIPTION OF THE DRAWINGS

Some embodiments of the invention are herein described, by way of example only, with reference to the accompanying images. With specific reference now to the drawings in detail, it is stressed that the particulars shown are by way of example and for purposes of illustrative discussion of embodiments of the invention. In this regard, the description taken with the drawings makes apparent to those skilled in the art how embodiments of the invention may be practiced.

In the drawings:

FIG. 1 is a photograph of an ethidium bromide stained gel illustrating the reaction products produced using tailed primers according to embodiments of the present invention as compared to non-tailed primers.

FIG. 2 is a photograph of an ethidium bromide stained gel illustrating the reaction products produced using tailed primers according to embodiments of the present invention as compared to non-tailed primers.

DESCRIPTION OF SPECIFIC EMBODIMENTS OF THE INVENTION

Before explaining at least one embodiment of the invention in detail, it is to be understood that the invention is not necessarily limited in its application to the details set forth in the following description or exemplified by the Examples. The invention is capable of other embodiments or of being practiced or carried out in various ways.

The polymerase chain reaction (PCR) is a method to selectively amplify DNA. The method uses paired sets of oligonucleotide primers that hybridize to opposite strands of DNA and define the limits of the sequence that is amplified. The oligonucleotide primers prime multiple sequential rounds of DNA synthesis catalyzed by a thermostable DNA polymerase. Each round of synthesis is normally preceded by a melting and re- annealing step. The method can rapidly amplify virtually any DNA sequence (including genomic DNA, viral DNA, or from cDNA reverse transcribed from RNA).

In common with other assays, PCR is subject to both "false negative" and false positive" results. False negative results are due to reaction failure. False positive results may be caused by primers annealing to sequences other than the true recognition sequence (i.e. non-specificity) leading to amplification of spurious products, or by primers annealing to the true recognition sequence present in contaminating DNA derived from a source other than the sample being diagnosed.

In order to limit occurrence of non-specific binding of primers to their target sequence and improve efficiency of the PCR reaction, the present inventors have devised novel primers which are attached to oligonucleotide tails which are unrelated to the target DNA. During the first few cycles of the amplification reaction, only the complementary part of the primer binds to the target sequence. Later, products with the tails at their ends start to form, allowing the full primers (including the tail) to bind these products and amplify them.

In order to further enhance the specificity of the PCR reaction, the present inventors have set forth optimal sequences for the oligonucleotide tails - specifically at least 70 % of the tail should consist only of two bases that do not complement each other.

The present inventors showed that primers and tails generated according the above described specifications were more efficient at amplifying a sequence than the corresponding primers without the tails (Figures 1 and 2).

Thus, according to one aspect of the present invention, there is provided a method of amplifying a target nucleic acid comprised in a nucleic acid sample, the method comprising:

(a) contacting the nucleic acid sample with a forward and reverse oligonucleotide primer under conditions which allow hybridization of the forward and reverse oligonucleotide primer to the target nucleic acid, wherein the forward and reverse primer are each covalently attached at their 5' end to a oligonucleotide tail having a nucleic acid sequence that is not complementary to the target nucleic acid, wherein at least 70 % of the tail consists of two bases that do not complement each other; and wherein the oligonucleotide tail is no longer than 80 bases.

(b) amplifying the target nucleic acid, thereby amplifying the target nucleic acid.

As used herein, the term "amplifying" refers to the process in which multiple copies are made of the target nucleic acid sequence.

According to this aspect of the present invention, the amplifying may be effected using techniques such as polymerase chain reaction (PCR), which includes, but is not limited to Allele-specific PCR, Assembly PCR or Polymerase Cycling Assembly (PCA), Asymmetric PCR, Helicase-dependent amplification, Hot-start PCR, Intersequence- specific PCR (ISSR), Inverse PCR, Ligation-mediated PCR, Methylation-specific PCR (MSP), Miniprimer PCR, Multiplex Ligation-dependent Probe Amplification, Multiplex-PCR,Nested PCR, Overlap-extension PCR, Quantitative PCR (Q-PCR), Reverse Transcription PCR (RT-PCR), Solid Phase PCR: encompasses multiple meanings, including Polony Amplification (where PCR colonies are derived in a gel matrix, for example), Bridge PCR (primers are covalently linked to a solid-support surface), conventional Solid Phase PCR (where Asymmetric PCR is applied in the presence of solid support bearing primer with sequence matching one of the aqueous primers) and Enhanced Solid Phase PCR (where conventional Solid Phase PCR can be improved by employing high Tm and nested solid support primer with optional application of a thermal 'step' to favour solid support priming), Thermal asymmetric interlaced PCR (TAIL-PCR), Touchdown PCR (Step-down PCR), PAN-AC and Universal Fast Walking.

The target nucleic acid sequence is typically amplified from genomic DNA, viral

DNA, cDNA reverse transcribed from RNA, or from a product of a previous PCR reaction. Typically, the target nucleic acid which is amplified (i.e. amplicon) has a length of about 100 bp (for quantitative PCR) and for standard PCR, it may be up to 500 bp, 1000 bp, 2000 bp or even more.

According to one embodiment, the target nucleic acid which is amplified is close to the 3' end of a gene (as this end is known with greater confidence and hence preferred most frequently). Preferably, the target nucleic acid is selected as one which does not form stable secondary structures during the amplification reaction.

The nucleic acid sample of this aspect of the present invention may be any sample which comprises nucleic acids (e.g. DNA), in particular biomedical samples. DNA may be extracted directly from a cell or nuclear extract or may be reverse transcribed from an RNA extract thereof. Alternatively, the sample may be a cellular sample, and the amplification reaction may take place in situ (e.g. on slides). The sample upon which the method is performed may comprise less than 100 copies, such as less than 50 or less than 20 copies of the DNA to be amplified.

The sample upon which the method is performed is typically derived from an organism (e.g. a disease causing organism), such as a virus, eukaryote, prokaryote, plant, animal, bird, mammal or human. The sample typically comprises a body fluid or part of an organism. The sample may be a blood, urine, saliva, bone, semen, skin, cheek cell or hair root sample. The sample may be a food sample. The sample is typically processed before the method is carried out, for example DNA extraction and/or purification may be carried out. The DNA in the sample may be cleaved either physically or chemically (e.g. using a suitable enzyme).

The term "primer" as used herein, refers to an oligonucleotide that is capable of hybridizing (also termed "annealing") with a nucleic acid and serving as an initiation site for nucleotide (RNA or DNA) polymerization under appropriate conditions (i.e., in the presence of four different nucleoside triphosphates and an agent for polymerization, such as DNA or RNA polymerase or reverse transcriptase) in an appropriate buffer and at a suitable temperature. The appropriate length of a primer depends on the intended use of the primer, but primers are typically at least 7 nucleotides long and, more typically range from 10 to 30 nucleotides, or even more typically from 18 to 30 nucleotides, in length. It will be appreciated that the primer need not reflect the exact sequence of the target nucleic acid but must be sufficiently complementary to hybridize with the target nucleic acid. Accordingly, the sequence of the primer typically has at least 70 % homology, preferably at least 80 %, 90 %, 95 %, 97 % or 99 % homology, for example over a region of at least 15 or more contiguous nucleotides with the target nucleic acid. The homology may be calculated on the basis of nucleotide identity (sometimes referred to as "hard homology"). The term "primer site" or "primer binding site" refers to the segment of the target nucleic acid to which a primer hybridizes.

The primers used in the present invention could be chemically modified by means well known to those skilled in the art, including but not exclusively by (i) conjugation to a label or other moiety, such fluorophores, biotin, enzymes, a quencher, digoxigenin, proteins such as minor groove binders etc., (ii) introduction of non-standard DNA bases e.g. a 3' terminal ribose residue or dUTP.

The design of the primers should take into account all the considerations known in the art including, but not limited to melting temperature (T_m; the temperature at which one half of the DNA duplex will dissociate to become single stranded and indicates the duplex stability; primer annealing temperature (T_a; the primer melting temperature is the estimate of the DNA-DNA hybrid stability and critical in determining the annealing temperature - too high T_a will produce insufficient primer-template hybridization resulting in low PCR product yield. Too low T_a may possibly lead to non-specific products caused by a high number of base pair mismatches); the GC content (the number of G's and C's in the primer as a percentage of the total bases) of primer should be 40-60 %; primer secondary structure (presence of the primer secondary structures produced by intermolecular or intramolecular interactions can lead to poor or no yield of the product).

As used herein, the phrase "primer pair" refers to a set of primers including a 5' "upstream primer" or "forward primer" that hybridizes with the complement of the 5' end of the DNA sequence to be amplified and a 3' "downstream primer" or "reverse primer" that hybridizes with the 3' end of the sequence to be amplified. As will be recognized by those of skill in the art, the terms "upstream" and "downstream" or "forward" and "reverse" are not intended to be limiting, but rather provide illustrative orientation in particular embodiments.

The primers of this aspect of the present invention are covalently attached at their 5' end to an oligonucleotide tail having a nucleic acid sequence that is not complementary to the target nucleic acid. The tail is preferably no longer than 80 bases, more preferably no longer than 70 bases, more preferably no longer than 60 bases, more preferably no longer than 50 bases, more preferably no longer than 40 bases, more preferably no longer than 30 bases and even more preferably is no longer than 25 bases. At its minimum, the tail is greater than 5 bases and more preferably greater than 10 bases. Thus, according to a preferred embodiment, the tail is between 10-25 bases long.

The primers together with their tails form a continuous oligonucleotide, the primer part hybridizing with the target nucleic acid, and the tail part not capable of hybridizing to the target nucleic acid. The primer may be attached directly to the olionucleotide tail or alternatively an intervening nucleic acid sequence (e.g. a restriction site or a promoter such as a T7 promoter) may be inserted between the primer and the tail.

According to a particular embodiment of this aspect of the present invention, the tail is designed to yield the highest thermodynamic free energy primer. Accordingly, the present inventors predict that at least 70 % of the tail should consist of two bases that do not complement each other. It will be appreciated that both tails consist of the same two bases. Thus for example, according to one embodiment, at least 70 % of both tails consists of cytosine (C) and adenosine (A), C and thymine (T), A and guanine (G), or T and G.

According to another embodiment, at least 80 % of both tails consists of an identical two bases that do not complement each other. According to another embodiment, at least 90 % of both tails consist of an identical two bases that do not complement each other. According to still another embodiment, at least 95 % of both tails consist of an identical two bases that do not complement each other. According to yet another embodiment, both tails consist entirely of an identical two bases that do not complement each other (e.g. C and A).

According to a specific embodiment, both oligonucleotide tails consists of three bases, wherein at least 70 % of both tails consists of an identical two bases that do not complement each other.

Since C and G create stronger bonds than A or T and therefore will contribute to "locking" the tail to the target nucleic acid, the 5' end of the oligonucleotide tail may be capped with a C or G base.

In order to enhance specificity of the primer, the oligonucleotide tail may be designed such that it is devoid of a sequence which repeats consecutively more than three times, four times, five times, six times seven times or even eight times. The repeating sequence may comprise a single base, two bases or three bases. Thus for example the olignoucleotide tail is designed such that it is devoid of a two base sequence (e.g. ACACACAC), a single base sequence (e.g. AAAA), a three base sequence (e.g. ACTACTACTACT) etc.

Preferably the nucleic acid sequence of the oligonucleotide tail does not encode a restriction site or a promoter.

It will be appreciated that design of a primer and its tail also takes into consideration the sequence of the primer and tail of its corresponding pair.

Thus, for example, it is preferably that the forward oligonucleotide primer attached to its oligonucleotide tail has a similar melting temperature (Tm) as the reverse oligonucleotide primer attached to its oligonucleotide tail (for example no more than about a 10 % difference).

In addition, it is preferable that the nucleic acid sequence of the oligonucleotide tail attached to the forward primer is non-identical to the nucleic acid sequence of the oligonucleotide tail attached to the reverse primer.

Selection of a primer and its corresponding olignonucleotide tails may be effected manually or alternatively by calculated using a computer. Thus, according to another aspect of the present invention there is provided a computing platform for identifying a sequence of a primer suitable for amplifying a target nucleic acid sequence, the computing platform comprising:

(a) a user interface for specifying a target;

(c) a processing unit for outputting the nucleic acid sequence of the primer. The software may also be capable of determining optimal primer pairs.

The primers with their tails designed according to the teachings of the present invention can be generated according to any oligonucleotide synthesis method known in the art such as enzymatic synthesis or solid phase synthesis. Equipment and reagents for executing solid-phase synthesis are commercially available from, for example, Applied Biosystems. Any other means for such synthesis may also be employed; the actual synthesis of the oligonucleotides is well within the capabilities of one skilled in the art and can be accomplished via established methodologies as detailed in, for example, "Molecular Cloning: A laboratory Manual" Sambrook et al., (1989); "Current Protocols in Molecular Biology" Volumes I-III Ausubel, R. M., ed. (1994); Ausubel et al., "Current Protocols in Molecular Biology", John Wiley and Sons, Baltimore, Maryland (1989); Perbal, "A Practical Guide to Molecular Cloning", John Wiley & Sons, New York (1988) and "Oligonucleotide Synthesis" Gait, M. J., ed. (1984) utilizing solid phase chemistry, e.g. cyanoethyl phosphoramidite followed by deprotection, desalting and purification by for example, an automated trityl-on method or HPLC.

The primers with their corresponding tails may be provided in a kit. Such a kit if desired, may be presented in a pack which may contain one or more units of the kit of the present invention. The pack may be accompanied by instructions for using the kit. The pack may also be accommodated by a notice associated with the container in a form prescribed by a governmental agency regulating the manufacture, use or sale of laboratory supplements, which notice is reflective of approval by the agency of the form of the compositions.

According to one aspect, the kit comprises, preferably in separate packaging, a thermostable DNA polymerase, such as, but not limited to, Taq polymerase and the primer pairs. In addition, the kit may comprise a set of deoxynucleotide triphosphates, buffer and/or control template DNA. The kit may also comprise double stranded DNA detecting molecules as further described herein below. The components of the kit may be packaged separately or in any combination.

As mentioned, the primers of this aspect of the present invention are used to amplify a target nucleic acid sequence.

The PCR cycles can be performed in any way known in the art, such as, but not limited to, the PCR cycles disclosed in U.S. Patent Nos. 4,683,195, 4,683,202, 4,800,159, 4,965,188, 5,512,462, 6,007,231, 6,150,094, 6,214,557, 6,231,812, 6,391,559, 6,740,510 and International Patent application No. WO/9911823.

An exemplary amplification process involves the following steps:

1. Initialization step (optional): This step consists of heating the reaction to a temperature of 94-96 °C (or 98 °C if extremely thermostable polymerases are used), which is held for 1-9 minutes. It is only required for DNA polymerases that require heat activation by hot-start PCR.

2. Denaturation step: This step is the first regular cycling event and consists of heating the reaction to 94-98 °C for 20-30 seconds. It causes DNA melting of the DNA template by disrupting the hydrogen bonds between complementary bases, yielding single-stranded DNA molecules.

Annealing step: The reaction temperature is lowered to 50-65 °C for 20-40 seconds allowing annealing of the primers to the single-stranded DNA template. Typically the annealing temperature is about 3-5 degrees Celsius below the Tm of the primers used. Stable DNA-DNA hydrogen bonds are only formed when the primer sequence very closely matches the template sequence. The polymerase binds to the primer-template hybrid and begins DNA synthesis. An exemplary polymerase that may be used is Taq polymerase.

Extension/elongation step: The temperature at this step depends on the DNA polymerase used; Taq polymerase has its optimum activity temperature at 75-80 °C, and commonly a temperature of 72 °C is used with this enzyme. At this step the DNA polymerase synthesizes a new DNA strand complementary to the DNA template strand by adding dNTPs that are complementary to the template in 5' to 3' direction, condensing the 5 '-phosphate group of the dNTPs with the 3'-hydroxyl group at the end of the nascent (extending) DNA strand. The extension time depends both on the DNA polymerase used and on the length of the DNA fragment to be amplified. As a rule-of-thumb, at its optimum temperature, the DNA polymerase will polymerize a thousand bases per minute. Under optimum conditions, i.e., if there are no limitations due to limiting substrates or reagents, at each extension step, the amount of DNA target is doubled, leading to exponential (geometric) amplification of the specific DNA fragment.

Final elongation: This single step is occasionally performed at a temperature of 70-74 °C for 5-15 minutes after the last PCR cycle to ensure that any remaining single- stranded DNA is fully extended.

The amplification reaction may take place in a manual or automatic thermal cycling device. According to another embodiment, the amplification reaction takes place in individualized tubes (e.g. eppendorf tubes), a microtiter plate or a matrix-type microfluidic device. As mentioned, herein above, the primers of this aspect of the present invention may be used for quantitative PCR (q-PCR). This type of PCR is used to measure the quantity of a PCR product. It quantitatively measures starting amounts of DNA, cDNA or RNA.

qPCR is typically performed by comparing transcript quantity of the target nucleic acid with a housekeeping gene, i.e. one whose level of transcription remains constant). Since the housekeeping gene and the target gene are amplified with a different primer pair, the measurement is sensitive to different efficiencies of the different pairs. Accordingly, the present inventors contemplate adding identical tails to each of the primer pairs. In this way, the efficiency after the first cycles becomes much more similar for the different gene amplifications, allowing for a more reliable and accurate measurement. A design for such mutual tails with a higher TM than the primers themselves should lower the effect of the variable part of the different primers even further. Such a method therefore has the potential of improving the reliability and accuracy of biological measurements.

According to one embodiment the qPCR is effected in real time (qRT-PCR). Typically, QRT-PCR methods use double stranded DNA detecting molecules to measure the amount of amplified product in real time.

As used herein the phrase "double stranded DNA detecting molecule" refers to a double stranded DNA interacting molecule that produces a quantifiable signal (e.g., fluorescent signal). For example such a double stranded DNA detecting molecule can be a fluorescent dye that (1) interacts with a fragment of DNA or an amplicon and (2) emits at a different wavelength in the presence of an amplicon in duplex formation than in the presence of the amplicon in separation. A double stranded DNA detecting molecule can be a double stranded DNA intercalating detecting molecule or a primer-based double stranded DNA detecting molecule.

A double stranded DNA intercalating detecting molecule is not covalently linked to a primer, an amplicon or a nucleic acid template. The detecting molecule increases its emission in the presence of double stranded DNA and decreases its emission when duplex DNA unwinds. Examples include, but are not limited to, ethidium bromide, YO- PRO-1, Hoechst 33258, SYBR Gold, and SYBR Green I. Ethidium bromide is a fluorescent chemical that intercalates between base pairs in a double stranded DNA fragment and is commonly used to detect DNA following gel electrophoresis. When excited by ultraviolet light between 254 nm and 366 nm, it emits fluorescent light at 590 nm. The DNA-ethidium bromide complex produces about 50 times more fluorescence than ethidium bromide in the presence of single stranded DNA. SYBR Green I is excited at 497 nm and emits at 520 nm. The fluorescence intensity of SYBR Green I increases over 100 fold upon binding to double stranded DNA against single stranded DNA. An alternative to SYBR Green I is SYBR Gold introduced by Molecular Probes Inc. Similar to SYBR Green I, the fluorescence emission of SYBR Gold enhances in the presence of DNA in duplex and decreases when double stranded DNA unwinds. However, SYBR Gold's excitation peak is at 495 nm and the emission peak is at 537 nm. SYBR Gold reportedly appears more stable than SYBR Green I. Hoechst 33258 is a known bisbenzimide double stranded DNA detecting molecule that binds to the AT rich regions of DNA in duplex. Hoechst 33258 excites at 350 nm and emits at 450 nm. YO-PRO-1, exciting at 450 nm and emitting at 550 nm, has been reported to be a double stranded DNA specific detecting molecule. In a preferred embodiment of the present invention, the double stranded DNA detecting molecule is SYBR Green I.

A primer-based double stranded DNA detecting molecule is covalently linked to a primer and either increases or decreases fluorescence emission when amplicons form a duplex structure. Increased fluorescence emission is observed when a primer-based double stranded DNA detecting molecule is attached close to the 3' end of a primer and the primer terminal base is either dG or dC. The detecting molecule is quenched in the proximity of terminal dC-dG and dG-dC base pairs and dequenched as a result of duplex formation of the amplicon when the detecting molecule is located internally at least 6 nucleotides away from the ends of the primer. The dequenching results in a substantial increase in fluorescence emission. Examples of these type of detecting molecules include but are not limited to fluorescein (exciting at 488 nm and emitting at 530 nm), FAM (exciting at 494 nm and emitting at 518 nm), JOE (exciting at 527 and emitting at 548), HEX (exciting at 535 nm and emitting at 556 nm), TET (exciting at 521 nm and emitting at 536 nm), Alexa Fluor 594 (exciting at 590 nm and emitting at 615 nm), ROX (exciting at 575 nm and emitting at 602 nm), and TAMRA (exciting at 555 nm and emitting at 580 nm). In contrast, some primer-based double stranded DNA detecting molecules decrease their emission in the presence of double stranded DNA against single stranded DNA. Examples include, but are not limited to, rhodamine, and BODIPY-FI (exciting at 504 nm and emitting at 513 nm). These detecting molecules are usually covalently conjugated to a primer at the 5' terminal dC or dG and emit less fluorescence when amplicons are in duplex. It is believed that the decrease of fluorescence upon the formation of duplex is due to the quenching of guanosine in the complementary strand in close proximity to the detecting molecule or the quenching of the terminal dC-dG base pairs.

According to one embodiment, the primer-based double stranded DNA detecting molecule is a 5' nuclease probe. Such probes incorporate a fluorescent reporter molecule at either the 5' or 3' end of an oligonucleotide and a quencher at the opposite end. The first step of the amplification process involves heating to denature the double stranded DNA target molecule into a single stranded DNA. During the second step, a forward primer (including its 5' oligonucleotide tail, as described above) anneals to the target strand of the DNA and is extended by Taq polymerase. A reverse primer (including its 5' oligonucleotide tail, as described above) and a 5' nuclease probe then anneal to this newly replicated strand.

The present inventors contemplate that the 5' nuclease probe may be designed to have a sequence capable of hybridizing to the tail on the forward primer). According to one embodiment, each primer has oligonucleotide 5' oligonucleotides tails. In this fashion a universal probe may be synthesized which recognizes the tail. Accordingly, the probe measures each product in exactly the same way. Such a method is both cheap (universal probe) and more accurate that current methods since the binding to the tail is more specific and efficient due to the sequence characterisitics of the tail.

The polymerase extends and cleaves the probe from the target strand. Upon cleavage, the reporter is no longer quenched by its proximity to the quencher and fluorescence is released. Each replication will result in the cleavage of a probe. As a result, the fluorescent signal will increase proportionally to the amount of amplification product.

The present inventors contemplate use of the oligonucleotides described herein for a multitude of purposes including, but not limited to identification of the presence of particular polymorphisms (such as SNPs), alleles, or haplotypes, or chromosomal abnormalities, such as amplifications, deletions, or aneuploidy. The oligonucleotides may be employed in genotyping, which can be carried out in a number of contexts, including diagnosis of genetic diseases or disorders, pharmacogenomics (personalized medicine), quality control in agriculture (e.g., for seeds or livestock), the study and management of populations of plants or animals (e.g., in aquaculture or fisheries management or in the determination of population diversity), or paternity or forensic identifications. The oligonucleotides of the invention can be applied to the identification of sequences indicative of particular conditions or organisms in biological or environmental samples (or to negation of the presence of such sequences). For example, the oligonucleotides can be used to identify or negate the occurrence of pathogens, such as viruses, bacteria, and fungi). The oligonucleotides can also be used to characterize environments or microenvironments, e.g., to characterize the microbial species in the human gut.

These oligonucleotides can also be employed to determine DNA or RNA (e.g., mRNA, miRNA) copy number. Determinations of aberrant DNA copy number in genomic DNA is useful, for example, in the diagnosis and/or prognosis of genetic defects and diseases, such as cancer. Determination of RNA "copy number," i.e., expression level is useful for expression monitoring of genes of interest, e.g., in different individuals, tissues, or cells under different conditions (e.g., different external stimuli or disease states) and/or at different developmental stages. Primers can also function as probes.

In addition, the oligonucleotides can be employed to prepare nucleic acid samples for further analysis, such as, e.g., DNA sequencing. Adding extensions to DNA in preparation for sequencing is a common practice. Addition of oligonucleotides tails to the primers should make the sequencing more accurate and more efficient.

As used herein the term "about" refers to ± 10 %.

The terms "comprises", "comprising", "includes", "including", "having" and their conjugates mean "including but not limited to".

The term "consisting of means "including and limited to".

The term "consisting essentially of" means that the composition, method or structure may include additional ingredients, steps and/or parts, but only if the additional ingredients, steps and/or parts do not materially alter the basic and novel characteristics of the claimed composition, method or structure. Throughout this application, various embodiments of this invention may be presented in a range format. It should be understood that the description in range format is merely for convenience and brevity and should not be construed as an inflexible limitation on the scope of the invention. Accordingly, the description of a range should be considered to have specifically disclosed all the possible subranges as well as individual numerical values within that range. For example, description of a range such as from 1 to 6 should be considered to have specifically disclosed subranges such as from 1 to 3, from 1 to 4, from 1 to 5, from 2 to 4, from 2 to 6, from 3 to 6 etc., as well as individual numbers within that range, for example, 1, 2, 3, 4, 5, and 6. This applies regardless of the breadth of the range.

Whenever a numerical range is indicated herein, it is meant to include any cited numeral (fractional or integral) within the indicated range. The phrases "ranging/ranges between" a first indicate number and a second indicate number and "ranging/ranges from" a first indicate number "to" a second indicate number are used herein interchangeably and are meant to include the first and second indicated numbers and all the fractional and integral numerals therebetween.

As used herein the term "method" refers to manners, means, techniques and procedures for accomplishing a given task including, but not limited to, those manners, means, techniques and procedures either known to, or readily developed from known manners, means, techniques and procedures by practitioners of the chemical, pharmacological, biological, biochemical and medical arts.

It is appreciated that certain features of the invention, which are, for clarity, described in the context of separate embodiments, may also be provided in combination in a single embodiment. Conversely, various features of the invention, which are, for brevity, described in the context of a single embodiment, may also be provided separately or in any suitable subcombination or as suitable in any other described embodiment of the invention. Certain features described in the context of various embodiments are not to be considered essential features of those embodiments, unless the embodiment is inoperative without those elements.

Various embodiments and aspects of the present invention as delineated hereinabove and as claimed in the claims section below find experimental support in the following examples. EXAMPLES

Reference is now made to the following examples, which together with the above descriptions illustrate some embodiments of the invention in a non limiting fashion.

Generally, the nomenclature used herein and the laboratory procedures utilized in the present invention include molecular, biochemical, microbiological and recombinant DNA techniques. Such techniques are thoroughly explained in the literature. See, for example, "Molecular Cloning: A laboratory Manual" Sambrook et al., (1989); "Current Protocols in Molecular Biology" Volumes I-III Ausubel, R. M., ed. (1994); Ausubel et al., "Current Protocols in Molecular Biology", John Wiley and Sons, Baltimore, Maryland (1989); Perbal, "A Practical Guide to Molecular Cloning", John Wiley & Sons, New York (1988); Watson et al., "Recombinant DNA", Scientific American Books, New York; Birren et al. (eds) "Genome Analysis: A Laboratory Manual Series", Vols. 1-4, Cold Spring Harbor Laboratory Press, New York (1998); methodologies as set forth in U.S. Pat. Nos. 4,666,828; 4,683,202; 4,801,531; 5,192,659 and 5,272,057; "Cell Biology: A Laboratory Handbook", Volumes I-III Cellis, J. E., ed. (1994); "Culture of Animal Cells - A Manual of Basic Technique" by Freshney, Wiley- Liss, N. Y. (1994), Third Edition; "Current Protocols in Immunology" Volumes I-III Coligan J. E., ed. (1994); Stites et al. (eds), "Basic and Clinical Immunology" (8th Edition), Appleton & Lange, Norwalk, CT (1994); Mishell and Shiigi (eds), "Selected Methods in Cellular Immunology", W. H. Freeman and Co., New York (1980); available immunoassays are extensively described in the patent and scientific literature, see, for example, U.S. Pat. Nos. 3,791,932; 3,839,153; 3,850,752; 3,850,578; 3,853,987; 3,867,517; 3,879,262; 3,901,654; 3,935,074; 3,984,533; 3,996,345; 4,034,074; 4,098,876; 4,879,219; 5,011,771 and 5,281,521; "Oligonucleotide Synthesis" Gait, M. J., ed. (1984); "Nucleic Acid Hybridization" Hames, B. D., and Higgins S. J., eds. (1985); "Transcription and Translation" Hames, B. D., and Higgins S. J., eds. (1984); "Animal Cell Culture" Freshney, R. I., ed. (1986); "Immobilized Cells and Enzymes" IRL Press, (1986); "A Practical Guide to Molecular Cloning" Perbal, B., (1984) and "Methods in Enzymology" Vol. 1-317, Academic Press; "PCR Protocols: A Guide To Methods And Applications", Academic Press, San Diego, CA (1990); Marshak et al., "Strategies for Protein Purification and Characterization - A Laboratory Course Manual" CSHL Press (1996); all of which are incorporated by reference as if fully set forth herein. Other general references are provided throughout this document. The procedures therein are believed to be well known in the art and are provided for the convenience of the reader. All the information contained therein is incorporated herein by reference.

MATERIALS AND METHODS

~150 base sequences were amplified from yeast genomic DNA, by two types of primers: Short primers that were designed by a conventional primer design algorithm (primer3; S. Rozen and H. Skaletsky, Methods in molecular biology (Clifton, N.J.), Vol. 132, 2000, pp. 365-86), and the same primers but with additional 25 bases tails at their 5' end.

The tails contained A and C bases only, and were designed to ensure minimal secondary structures, inter-primer interactions, repeat elements and homology to the yeast genome. The primers were designed to have ~50% C and -50% A with a C cap at the 5' end.

Amplicon 1:

Forward short primer:

CGCCAATCACAGTATGCTATGCC (SEQ ID NO: 1)

Forward tailed primer (tail in bold):

CAACCCAAAAAACCCCCAACCAAACCGCCAATCACAGTATGCTATG CC (SEQ ID NO: 2)

Reverse short primer:

GAAGTTCCACCTGCCATTGT (SEQ ID NO: 3)

Reverse tailed primer:

CCAACACCACCAACCCACCCCCCACGAAGTTCCACCTGCCATTGT

(SEQ ID NO: 4)

Amplicon 2:

Forward short primer:

CTCGCATTTGAGAGTTCACG (SEQ ID NO: 5)

Forward tailed primer:

CCACCACAACCCCCAACAACAACACCTCGCATTTGAGAGTTCACG

(SEQ ID NO: 6) Reverse short primer:

TGGGTCCCCTCTTTCTTTTC (SEQ ID NO: 7)

Reverse tailed primer:

CAACAAACAACACAACAAACCACACTGGGTCCCCTCTTI CTTTTC

(SEQ ID NO: 8)

PCR protocol:

1) Denaturation - 95 degrees - 10 minutes

2) Denaturation - 95 degrees - 20 seconds

3) Annealing - 55 degrees - 20 seconds

4) Elongation - 72 degrees - 30 seconds

5) Goto step 2— > 45 cycles

RESULTS

Two different PCR reactions were tested with both short primers and tailed primers. For each reaction four different enzymes were used - Kod, Kod hostart, Taq and Dream-Taq. In both amplifications and for all the enzymes, the short primers produced hardly any product of the desired length and much non-specific product (Figures 1 and 2, short primer lanes). In contrast, the tailed primers produced in 7 of 8 cases only the desired products, and in much greater amounts.

Although the invention has been described in conjunction with specific embodiments thereof, it is evident that many alternatives, modifications and variations will be apparent to those skilled in the art. Accordingly, it is intended to embrace all such alternatives, modifications and variations that fall within the spirit and broad scope of the appended claims.

All publications, patents and patent applications mentioned in this specification are herein incorporated in their entirety by reference into the specification, to the same extent as if each individual publication, patent or patent application was specifically and individually indicated to be incorporated herein by reference. In addition, citation or identification of any reference in this application shall not be construed as an admission that such reference is available as prior art to the present invention. To the extent that section headings are used, they should not be construed as necessarily limiting.

Claims

WHAT IS CLAIMED IS:

1. A method of amplifying a target nucleic acid sequence comprised in a nucleic acid sample, the method comprising:

(a) contacting the nucleic acid sample with a forward and reverse oligonucleotide primer under conditions which allow hybridization of said forward and reverse oligonucleotide primer to the target nucleic acid sequence, wherein said forward and reverse primer are each covalently attached at their 5' end to a oligonucleotide tail having a nucleic acid sequence that is not complementary to the target nucleic acid sequence, wherein at least 70 % of said tail consists of two bases that do not complement each other; and wherein said oligonucleotide tail is no longer than 80 bases

2. The method of claim 1, wherein said forward and reverse oligonucleotide primer are each between 18-30 bases.

3. The method of claim 1, wherein said oligonucleotide tail is between 10- 25 bases.

4. The method of claim 1, wherein said oligonucleotide tail consists of two bases that do not complement each other.

5. The method of claim 1, wherein said oligonucleotide tail consists of three bases, wherein at least 70 % of said tail consists of two bases of said three bases that do not complement each other.

6. The method of claim 1, wherein said oligonucleotide tail is devoid of a sequence which repeats consecutively more than four times.

7. The method of claim 1, wherein a 5' end of said oligonucleotide tail has a C or G base.

8. The method of claim 1, wherein said oligonucleotide tail does not encode a restriction site.

9. The method of claim 1, wherein said oligonucleotide tail is attached to said forward and/or reverse primer via an additional oligonucleotide encoding a restriction site.

10. The method of claim 1, wherein a nucleic acid sequence of said oligonucleotide tail attached to said forward primer is non-identical to a nucleic acid sequence of said oligonucleotide tail attached to said reverse primer.

11. The method of claim 1, wherein said amplifying is effected in a presence of a double stranded DNA detecting molecule.

12. The method of claim 11, wherein said double stranded detecting molecule is a double stranded DNA intercalating detecting molecule.

13. The method of claim 12, wherein said double stranded DNA intercalating detecting molecule is selected from the group consisting of ethidium bromide, YO-PRO- 1, Hoechst 33258, SYBR Gold, and SYBR Green I.

14. The method of claim 11, wherein said double stranded DNA detecting molecule is a primer-based double stranded DNA detecting molecule.

15. The method of claim 14, wherein said primer-based double stranded DNA detecting molecule is selected from the group consisting of fluorescein, FAM, JOE, HEX, TET, Alexa Fluor 594, ROX, TAMRA, rhodamine and BODIPY-FI.

16. The method of claim 14, wherein said primer-based double stranded DNA detecting molecule has a nucleic acid sequence identical to said nucleic acid sequence of said oligonucleotide tail of said forward primer or said reverse primer.

17. A computing platform for identifying a sequence of a primer suitable for amplifying a target nucleic acid sequence, the computing platform comprising:

(a) a user interface for specifying a target;

(b) software for computing the sequence of the primer, the primer being selected to have an oligonucleotide tail at its 5' end, wherein said tail has a nucleic acid sequence that is not complementary to the target nucleic acid sequence, wherein at least 70 % of said tail consists of two bases that do not complement each other; and

(c) a processing unit for outputting said nucleic acid sequence of said primer.

18. The computing platform of claim 17, further comprising software for computing a sequence of a pair to said primer.

19. A primer pair comprising a forward and reverse primer for amplifying a target nucleic acid sequence, wherein said forward and reverse primer are each covalently attached at their 5' end to a oligonucleotide tail having a nucleic acid sequence that is not complementary to the target nucleic acid sequence, wherein at least 70 % of said tail consists of two bases that do not complement each other; and wherein said oligonucleotide is no longer than 30 bases.

20. A kit comprising the primer pair of claim 19.

21. The kit of claim 20, further comprising a thermostable DNA polymerase.

22. The kit of claim 20, further comprising at least one dNTP.