WO2011138671A2 - Tubby-like protein isoforms and their applications - Google Patents

Abstract

Flag tagged TUBBY-like protein isoforms that are recombinantly expressed in cell lines are disclosed. These cell lines are used to identify specific DNA sites that are in direct physical interaction with transcription factors to identify genes responsible for various neurodegenerative diseases. Diagnostic testing and various therapies to treat the genetic diseases are also part of the present invention.

Description

TUBBY-LIKE PROTEIN ISOFORMS AND THEIR

APPLICATIONS

Field of the Invention

The present invention relates to Flag tagged TUBBY-like protein isoforms that are recombinantly expressed in cell lines. These cell lines are used to identify specific DNA sites that are in direct physical interaction with transcription factors to identify genes responsible for various diseases including obesity, diabetes mellitus, diseases of the hypothalnnus and diverse areas of the central nervous system, diseases of energy expenditure and fat storage in the body and neurodegenerative diseases. Diagnostic testing and various therapies to treat the genetic diseases are also part of the present invention.

Background of the Invention

The tubby gene was first identified from obese mice via positional cloning in 1996 (Kleyn et al (1996) Cell 86:263- 274;NobenTrauth et al (1996) Nature 380:534-538.) The identification of a mutation at the TUB locus led to the identification of TUBBY-like proteins (TULPS). Currently there are four TUBBY-like proteins; i.e., TULP1 , TULP2, TULP3 and TULP4, as well as TUB, which form a small and novel gene family. These TUBBY-like proteins play an important role in the maintenance and functioning of neuronal cells during post differentiation and development.

The TUBBY-like proteins have been found in multicellular organisms from the plant and animal kingdoms, but not in unicellar organisms (North et al (1997) PNAS USA 94:3128-3133). TUBBY-like proteins have also been identified in mammals (North et al (1997) PNAS USA 94: 3128-3133; Nishina et al (1998) Genomics 54:215-220) and all mammalian TUBBY-like proteins have an approximately 260 amino acid tubby domain at their C-terminal, but have diversified N-terminal sequences with respect to their length and amino acid sequences. The N- terminal regions of the TUBBY-like proteins comprise between 180 to 280 amino acids. They are localized primarily to nervous tissue (Kleyn et al, supra) and all TULPS are expressed in the retina.

The TUB protein, a founding member of TULPs, has dual subcellular localization at the plasma membrane and in the nucleus, which is due to the presence of competing localization signals in the N- and C- terminal domains. The N-terminal domain has a nuclear localization sequence and adopts completely nuclear localization, while the C- terminal is localized to the plasma membrane.

The TUB tubby domain binds Ptdlns(4,5)P2, Ptdlns(3,4)P2 and Ptdlns(3,4,5)P3 and singly phosphorylated phosphoinositides (Boggon et al (1999) Science 286:21 19-2125). The X-ray structure of the TUB tubby domain shows that the domain adopts a 12-stranded antiparallel β-barrel conformation that is filled with a central ahelix (see. Boggon et al, supra). The Ptdlns(4,5)P2-binding site is formed between the β-strands and an external helix.

The tubby phenotype caused by the loss of function mutation in the tub gene has been well documented as an autosomal recessive syndrome, which is characterized by adult-onset obesity, insulin resistance and neurosensory deficits. Homozygous mutations at the tub loci causes obesity which develops more slowly than those observed in obese or diabetic mice, (Coleman, D.L. and Eichner E.M. (1990) J. Heredity 81 :424-427) with TUB obesity developing more slowly than those observed in fat animals. This feature of the tub obese phenotype closely resembles the manner in which obesity develops in humans. However, even in the animal models, body weights attained are nearly two times the average weight seen in normal mice. Besides weight gain tub/tub mice also develop insulin resistance with the gain in weight, but do not develop overt diabetes. In addition to obesity, retinal defects, hearing loss and infertility have been observed in tub mice. (See, Heckenkivekly (1988) in Retinitis Pigmentosa, Heckenlively, ed. Lippincott, Philadelphia pp. 221 -235, Colemen et al, supra, Ohlemiller et al (1995) Neuroreport 6:845-849). Bardet-Biedl syndrome, Alstrom syndrome, polycystic ovarian disease and Usher's syndrome also are known to co-exist with an obesity phenotype.

Also various neurodegenerative diseases are associated with TUB and TUBBY-like proteins abnormalities. These neurodegenerative diseases include degenerative retinal diseases, cochlear and/or vestibular diseases, neurological diseases, psychiatric diseases, Bardet Biedl syndromes, Usher syndromes, inherited nephropathies, inherited ciliopathies, mental retardation, autisms, developmental abnormalities of neuronal migration, developmental abnormalities of synaptogenesis and/or abnormal maturation of synapses in the central nervous system and/or peripheral nervous system and the novel disease that combines obesity bull's eye like macular dystrophy and endocochlear deafness. DNA-protein interactions are important in the regulation of cellular functions such as gene transcription, DNA replication and recombination, segregation, repair, cell cycle progression, chromosomal stability and epigenetic silencing. The structure of chromatin is maintained by the binding of regulatory proteins and histones to the DNA. It is important to know which particular protein binds to a specific DNA sequence in vivo and how DNA binding proteins affect the functioning of a particular gene. Chromatin immunoprecipitation, known by the anachronymn ChIP, is a method for determining the in vivo location of various binding sites of transcription factors, proteins and histones, The ChIP method detects the proteins at their binding site with DNA that takes place in living cells. This method requires the use of specific antibodies that detect the DNA-protein interactions.

Thus, there is a need in the art to provide a means to detect DNA- protein interactions with respect to TUBBY-like isoforms that can be used to test for neurodegenerative diseases on patients and mammals using the chromatin immunoprecipitation method.

Therefore, in one aspect the present invention provides cell lines that can be used to perform chromatin immunoprecipitation of TUBBY-like isoforms using ChlP-Sequencing technology with an antibody exclusively recognizing a Flag tag sequence to detect DNA-protein interactions and identify targeted genes that bind to the TUBBY-like isoforms.

In another aspect the present invention relates to microarrays that have the presently disclosed cell lines applied thereto that can be used to detect target genes of transcription factors for TUBBY-like isoforms.

In another embodiment the present invention relates to a method for identifying unknown target genes of human transcription factors of TUBBY-like isoforms, said method comprising:

(a) adding a protein to be tested to the cultured cell lines of the present invention;

(b) chromatin immunoprecipitating the cell lines; and

(c) identifying if the protein interacts with the cell lines. These and other aspects and embodiments are achieved by the present invention as evidenced by the summary of the invention, description of the preferred embodiments and the claims. Summary of the Invention

In one aspect the present invention provides a nucleic acid molecule comprising, consisting essentially of or consisting of SEQ ID No.:5, SEQ ID No.:7 or SEQ ID No.: 10 or a sequence complementary to SEQ ID No.:5, SEQ ID No.:7 or SEQ ID No.: 10.

In another aspect nucleic acid molecules are provided, which have 90% to 99% sequence identity to those nucleic acid molecules in SEQ ID No.:5, SEQ ID No.:7 or SEQ ID No.: 10.

Sequences which hybridize under stringent conditions to the complement of the nucleic acid molecule of SEQ ID No.:.5, SEQ ID No.:7 or SEQ ID No.: 10 is another aspect of the present invention. In another aspect nucleic acid molecules which hybridize under stringent conditions to the full length sequence of SEQ ID No.: 5, SEQ ID No.:7 or SEQ ID No. :10 forms part of the present invention.

A vector containing the nucleic acid sequence of SEQ ID No.: 5, SEQ ID No.:7 or SEQ ID No.: 10. This vector can be an expression vector or in another aspect a lentiviral expression vector.

Host cells transformed with any one of the vectors described herein also forms part of the invention. Proteins expressed by the host cells is another aspect of the invention.

In another embodiment that present invention provides cell lines deposited at the C.N.C.M. on March 22, 2010 under accession number CNCM-4286 or a cell line deposited at the C.N.C.M. on March 22, 2010 under accession number CNCM-4287 or a cell line deposited at the C.N.C.M. on March 22, 2010 under accession number CNCM-4288. Microarrays having at least one of the cell lines of the present invention spotted thereon is yet another aspect of the invention.

In another aspect the cell lines are used in a ChlP-Seq procedure. Yet another aspect of the present invention provides a method for identifying unknown target genes of human transcription factors of

TUBBY-like isoforms, said method comprising:

(a) adding a protein to be tested to the cultured cell lines of the present invention;

(b) chromatin immunoprecipitating the cell lines; and

(c) identifying if the protein interacts with the cell lines.

Yet another aspect of the present invention provides a method for identifying unknown target genes of human transcription factors of

TUBBY-like isoforms, said method comprising:

(a) adding a protein to be tested to the cultured cell lines of the present invention to form a cell mixture;

(b) fixing said cell mixture with formaldehyde;

(c) sonicating said fixed cell mixture;

(d) chromatin immunoprecipitating the fixed cell mixture; and

(e) identifying if the protein interacts with the cell lines. In one aspect the proteins that interact with the cell lines are transcription factors in the human genome. In another aspect the proteins that interact with the cell lines are genetic promoters in the human genome.

Use of a cell line deposited at the C.N.C.M. on March 22, 2010 under accession number CNCM-4286 or a cell line deposited at the C.N.C.M. on March 22, 2010 under accession number CNCM-4287 or a cell line deposited at the C.N.C.M. on March 22, 2010 under accession number CNCM-4288 to identify target genes of transcription factors or genetic promoters of TUBBY-like isoforms. Brief Description of the Drawings

Fig. 1 is a schematic representation of the C-terminal pFlag-CMV- 5a,b,c plasmid. Fig. 2 is a schematic representation of the pcDNA3 HA plasmid.

Fig. 3 is a schematic representation of the pLV-EF1 -TUB-Flag plasmid. Detailed Description of the Preferred Embodiments of the Invention

As used herein "isoform" means a protein that has a related function to another protein or more likely a function different from another protein, the structure of which is very close, but is indeed different and results from the alternative splicing of a specific primary transcript. The primary transcript of any gene is the full length mRNA comprising introns and exons resulting from the transcription of a specific gene.

"Overexpression" as used herein means that too many copies of the protein are expressed or made.

As used herein "consisting essentially of or "consists essentially of means that the composition, nucleic acid molecules or amino acid sequences can contain other elements that are not necessary or material to the invention. In the case of nucleic acid molecules and amino acid sequences "consisting essentially of or "consists essentially of shall mean that the length of these sequences is not longer than that described, however additional nonessential material can be present with the nucleic acid molecule or amino acid sequence. By "complement" is meant a nucleotide sequence that is sufficiently complementary to a given nucleotide sequence such that it can hybridize thereto to form a stable duplex.

"ChlP-Seq" is an anachronym for the method of chromatin immunoprecipitation-sequencing and ChlP-ChIP is chromatin

immunopreciptation using microarrays.

More specifically, the present invention relates to nucleic acid molecules comprising, consisting essentially of or consisting of SEQ ID No:5, SEQ ID No:7 or SEQ ID No: 10. These nucleic acid molecules encode TUBBY-like protein isoforms that have at their C-terminal a Flag tag coding sequence. The Flag nucleotide sequence is: gattacaaggacgacgatgacaag (SEQ ID No: 1 1 ). This Flag sequence allows the TUBBY-like isoforms described herein to be recognized with an antibody against this Flag sequence. Nucleic acid molecules that are sufficiently identical to those sequences of SEQ ID No.:5, SEQ ID No.:7 or SEQ ID No.: 10 are also encompassed by the present invention.

By sufficiently identical is intended that the nucleotide sequence or amino acid sequence has at least about 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or greater sequence identity compared to a reference sequence using one of the alignment programs described herein using standard parameters. The skilled artisan would realize that these values can be appropriately adjusted to determine the corresponding identity of proteins encoded by two nucleotide sequences by taking into account codon degeneracy, amino acid similarity, reading frame position and the like.

To determine the percent identity of two amino acid sequences or two nucleic acid sequences, the sequences are aligned for optimal comparison purposes. The percent identity between two sequences is a function of the number of identical positions shared by the sequences; i.e., percent identity = number of identical positions/ total number of positions (e.g., overlapping positions) x 100. In one aspect the two sequences that are compared are the same length. In another embodiment, the percent identity is calculated across the entirety of the reference sequence. The percent identity can be determined with or without gaps. In calculating percent identity typically exact matches are counted.

The determination of percent identity between two sequences can be accomplished using a mathematical algorithm such as those described in Karlin and Altschul (1990) PNAS USA 87: 2264 modified in Karlin and Altschul, (1993) PNAS USA 90:5873-5877. Such an algorithm is

incorporated into the BLASTN and BLASTX programs of Altschul et al (1990) J. Mol. Β/Ό/.215:403. Thus, nucleotide alignments can be

performed with the BLASTN program, score=100, wordlength=12, while BLAST protein searches can be performed with the BLASTX program, score=50, wordlength=3. Gapped alignments can be obtained from

Gapped BLAST.

Other mathematical algorithms to compare sequences that can be used for sequence identity include the ClustalW algorithm(Higgins et al (1994) Nucleic Acids Res. 22:4673-4680, the algorithm of Meyers and Miller (1988) CABIOS, 4:1 1 -17 and that of Needleman and Wunsch (1970) J. Mol. Biol, 48(3):443-453, all incorporated herein by reference.

Complementary nucleic acid sequences to the nucleic acid molecules of SEQ ID No.:5, SEQ ID No.:7 or SEQ ID No.: 10 is yet another aspect of the present invention. In this regard, the sequences that are complementary are those complementary to the full length sequence.

Nucleic acid molecules which hybridize under high or moderate stringent conditions to the complement of the nucleic acid molecule of SEQ ID NO.:5, SEQ ID No.:7 or SEQ ID No.: 10, as well as nucleic acid molecules which hybridize under high or moderate stringent conditions to the full length sequence of SEQ ID No.: 5, SEQ ID No.:7 or SEQ ID No.: 10 are yet other embodiments of the invention. In this regard stringent conditions including high, moderate and low stringency are sequence dependent and will be different in different circumstances. Longer sequences hybridize specifically at higher temperatures. These conditions are defined, for example, in Sambrook and Russell, Molecular Cloning: A Laboratory Manual, Third Edition (2001 ) and Short Protocols in Molecular Biology, ed. Ausubet al al, hereby incorporated herein by reference. Generally stringent conditions are selected to be about 5 to 10°C lower than the thermal melting temperature T_m for the specific sequence at a defined ionic strength and pH. The T_m is the temperature (under defined ionic strength, pH and nucleic acid concentration) at which 50% of the probes complementary to the target hybridize to the target sequence. Stringent conditions will be those in which the salt concentration is less then about 1 .0 M sodium ion, typically about 0.01 to 1 .0 M sodium ion concentration (or other salts) at pH 7. to 8.3 and the temperature is at least 30°C for short probes of 10 to 50 nucleotides and at least 60°C for long probes of greater than 50 nucleotides.

Thus highly stringent conditions are hybridization in 7% sodium dodecyl sulfate (SDS), 1 mM EDTA at 65°C and washing in 0.1 X SSC/0.1 % SDS at 68°C. Moderately stringent conditions include hybridization in 7% sodium dodecyl sulfate (SDS), 1 mM EDTA at 65°C and washing in 0.2 X SSC/0.1 % SDS at 42°C.

Vector refers to a nucleic acid construct designed for transfer between different hosts. An expression vector is a vector that has the capability to incorporate, integrate and express heterologous DNA sequences in a foreign host cell . An expression vector contains an expression cassette which includes in the 5' to 3' direction of transcription, control sequences, a promoter, a nucleic acid molecule described herein and a transcriptional termination region.

Promoter refers to a nucleic acid sequence that functions to direct transcription of a downstream coding sequence and with other transcriptional and translational regulatory nucleic acid sequences is necessary for the expression of the DNA sequence of interest. The promoter is 5' upstream of the DNA sequence of interest to be expressed. Examples of promoters that can be used in the vectors of the present invention include all of the CMV promoters, the beta-actin promoters, the chicken beta-actin promoter, the CMV early enhancer chicken β actin (CAG) promoter and the like.

Vectors containing the nucleic acid molecules of SEQ ID No.:5, SEQ ID No.:7 or SEQ ID No.: 10 or the complementary sequences thereof or those nucleotide molecules that hybridize under high or moderate stringent conditions to the sequences of SEQ ID No.:5, SEQ ID No.:7 or SEQ ID No.: 10 or their complementary sequences are used in the present invention to over express the TUBBY-like isoforms disclosed herein. The moderate and stringent conditions are set forth above and these same conditions apply equally with respect to these vector embodiments.

The vector can be an expression vector. Examples of the vectors that can be used in the present invention include bacterial, viral, yeast, insect, adenoviral vectors, retroviral, lentiviral or animal cell expression vectors. Examples include, but are not limited to Bluescript®(strategene),pGEX vectors (Promega), CaMV, pHA-MEX (Dualsystems Biotech), pMEX-HA (Dualsystems Biotech), pBAD(lnvitrogen), pCFB-EGSH (Strategene), pFB (Strategene), pFB- ERV(Strategene) and the like. In one aspect the vector is a lentiviral expression vector into which the nucleic acid molecules of SEQ ID No.: 5, SEQ ID No.:7 or SEQ ID No.: 10 have been inserted.

In another aspect the vectors that are part of the present invention include pLV-EF1 -TUB506-Flag, pLV-EF1 -TUB561 -Flag and pLV-EF1 - TUB561A277P-Flag. Cell lines in which the expression vector can be inserted and expressed are eukaryotic host cells and include, but are not limited to CHO, VERO, BHK, HeLAm COS, MDCK, 293, 3T3, Wl 38, hypothalamic cell lines such as GN and GH-1 cell lines, conditionally immortalized preadipocyte cells lines from white adipose tissue (IMWAT), immortalized cell lines from adipose tissue, LS14 cell lines, immortalized human preadipocyte cell lines resulting from the combined expression of hTERT and the E7 oncoprotein of human papillomavirus type 16 with both an unlimited life span and preserved adipogenic potential, human immortalized brown adipocytes, 3T3L1 adipocytes, stably or conditionally immortalized adipocyte or preadipocyte cell lines and immortalized neuroblastoma cell lines. Examples of neuroblastoma cell lines include IMR5-BCL2, NBASI-

5, NBS-1 , NBS-2, AS-14.2N⁺, AS-1 1 .4N⁺,15N-TrkB, 41 1 , 512, 422, 1810, cl.4M, cl.6M, cl.3N, cl.9N, SK-N-AS:ylGN, LA-N-6:ylGN, LA-N-5:ylFN, LA- N-1 :ylFN, SK-N-FI:ylFN, TET-2N, TET-2, TET-21 N, TET-21 , SH-400; 310;907, SH-802;803, 15NA-P4;E1 ;D1 , tTA sense, tTA-antisense, SH- Sy5Y, RET/PTC 1 RET/PTC3, RET/MEN2A, RET/MEN2B, B-myb, B-myb antisense, SY5Y-TrkA, LAN5-TrkA, SKMYC2, SKMYC6, SKMYAS, SH400;310;907 and SH-802;803.

Examples of human brain cell lines include A-172, CCF-STTG1 , CHP-126, GIMEN, H-4, HBL-52, HS-683, IMR-32, SH-SY5Y, SK-N-LO, SK-N-MC, T-406, U-1 18 MG, U-138 MG, U-343 MG, U-373 MG and U-87 MG.

In one aspect the cell line that is used is from a human

neuroblastoma cell line. This neuroblastoma cell line is derived from SH- SY5Y cells. In another aspect cell lines are provided, which were deposited at the C.N.C.M. on March 22, 2010 under accession number CNCM-4286 or a cell line deposited at the C.N.C.M. on March 22, 2010 under accession number CNCM-4287 or a cell line deposited at the C.N.C.M. on March 22, 2010 under accession number CNCM-4288. These cell lines of neuroblastoma cells SH-SY5Y were infected by a lentiviral vector over expressing the normal human 561 amino acid residues of the TUBBY-like protein tagged with a single copy of the Flag sequence, a lentiviral vector over expressing the human 506 amino acid residues of a TUBBY-like protein tagged with a single copy of the Flag sequence and a lentiviral vector over expressing the mutated human 561 amino acid residues of the TUBBY-like protein tagged with a single copy of the Flag sequence, respectively. The mutant corresponds to the change in the alanine residue to a proline residue at codon 277 of the 561 TUBBY-like protein isoform.

These cell lines can be used to ascertain the genetic promoters and transcription factors of the whole human genome interacts with each TUBBY-like isoform or does not interact with the 561 TUBBY-like isoform mutant (A277P).

These cell lines are used to test for DNA-protein interactions to determine which proteins bind to the TUBBY-like isoforms described herein and more specifically transcription factors and/or genetic promoters.

The cell lines of the present invention can be used in a protein microarray and more specifically a functional protein microarray. Thus the cell lines of the present invention can be used in functional microarrays to identify specific DNA sites in direct interaction with transcription factors to identify genes responsible for various neurodegenerative diseases.

These neurodegenerative diseases include degenerative retinal diseases, cochlear and/or vestibular diseases, neurological diseases, psychiatric diseases, Bardet Biedl syndromes, Usher syndromes, inherited nephropathies, inherited ciliopathies, mental retardations, autisms, developmental abnormalities of neuronal migration, developmental abnormalities of synaptogenesis and/or abnormal maturation of synapses in the central nervous system and/or peripheral nervous system and the novel disease that combines obesity bull's eye like macular dystrophy and endocochlear deafness. Also these tests can be used as markers for the emergence of cancer. Protein chips for the microarrays are prepared by immobilizing the strains of the present invention onto a treated microscope slide using a contact spotter (MacBeath and Schreiber (2000) Science 289:1760-3, Zhu et al (2001 ) Science 293: 2101 -5). Alternatively a non-contact microarray can be used (Jones et al (2006) Nature 439:168-74). Sample buffers that have a high percentage of glycerol are used in the

immobilization process. The process is generally carried out in a humid controlled environment (MacBeath and Schreiber, supra, Zhu et al, supra).

The glass slides that can be used for the mircoarrays of the present invention include non-treated slides in which the protein is immobilized or treated slides. If treated the slides can be coated with nitrocellulose, gel pads or poly-L-lysine. Amine-aldehydye- and expoxy-derivatized glass surfaces can also be used, as well as nickel coated slides or streptavidin coated slides. The cell lines as described herein can be used to test various proteins that bind to the cell lines described herein using double hybrid screening in which the strains are used as baits. Double hybrid screening methods are known in the art and were originally developed by Fields and co-workers and described, for example, in U.S. Patent Nos. 5,283,173, 5,468,614 and 5,667,973, which are hereby incorporated by reference.

Yet another variant is that described in Vidal et al, Proc. Natl. Sci. 93: pgs. 10315-10320 called the reverse two- and one-hybrid systems where a collection of molecules can be screened that inhibit a specific protein-protein or protein-DNA interactions, respectively.

A summary of the available methodologies for detecting protein- protein interactions is described in Vidal and Legrain (Nucleic Acids Research Vol. 27, No. 4 pgs. 919-929 (1999)) and Legrain and Selig (FEBS Letters 480 pgs. 32-36 (2000)) which references are incorporated herein by reference.

Yeast or E. coli are used in the double hybrid screening method. The cells lines described herein are used in plasmid vectors that over express the binding partner fused with the green fluorescent protein and transfected using FuGene® as the transfectant. The cellular phenotype in various cells using videomicroscopic technologies are then observed. In another aspect a method is provided for identifying unknown target genes of human transcription factors of TUBBY-like isoforms, said method comprising:

(a) adding a protein to be tested to a cell line deposited at the C.N.C.M. on March 22, 2010 under accession number CNCM-4286 or a cell line deposited at the C.N.C.M. on March 22, 2010 under accession number CNCM-4287 or a cell line deposited at the C.N.C.M. on March 22, 2010 under accession number CNCM-4288;

(b) chromatin immunoprecipitating the cell lines; and

(c) identifying if the protein interacts with the cell lines.

Thus, sequencing the DNA-protein complex can be used in the identification process.

In another aspect a method for identifying unknown target genes of human transcription factors of TUBBY-like isoforms, said method comprising:

(a) adding a protein to be tested to the cultured cell lines of the present invention to form a cell mixture;

(b) fixing said cell mixture with formaldehyde;

(c) sonicating said fixed cell mixture;

(d) chromatin immunoprecipitating the fixed cell mixture; and

(e) identifying if the protein interacts with the cell lines.

Chromatin immunoprecipitation is a well known method for determining protein-DNA interactions, which are key events in the control of cellular processes. These cellular processes include DNA replication, repair, recombination, transcription and others. The immunoprecipitation of cross-linked chromatin fragments, known by the anachronymn, ChIP is a well accepted method for the study of protein DNA interactions in vivo and is especially used to identify specific DNA sites in direct physical interaction with transcription factors to identify genes responsible for various diseases.

Basically chromatin immunoprecipitation has three major steps of fixation, sonication and immunoprecipitation. The cell lines of the present invention are first cultured for the preparation of the chromatin immunoprecipitation. Generally 10⁵ to 10⁸ cells are used in this method and the protein of interest is added to the cell culture to determine whether this protein interacts with the TUBBY-like isoforms.

Fixation is the first step in ChIP and involves cross-linking DNA and the proteins of interest. Formaldehyde is the most commonly used cross- linking agent, which is added to the cell culture. Generally 1 % to 10% formaldehyde is used, which is added directly to the culture flask or plate. The formaldehyde enters the cells through the cell membrane and crosslinks the proteins to the chromatin. It causes DNA-protein, RNA-protein and protein-protein cross-linking. Formaldehyde targets lysine amino groups and side chains of cytosine, guanine and tyrosine. Generally optimal conditions for cross-linking with formaldehyde are determined using a time-course experiment.

Formaldehyde cross-linking is usually done during a period of 10 to 30 minutes depending on the cell types used in the method. However it can span a period of 20 minutes to 50 minutes.

The cross-linking reaction takes place at room temperature and is stopped by quenching the cells using glycine. Generally a concentration of 0.125 M to 3.0 M glycine is used and preferably 2.5 M glycine. Generally between 2.0 to 4.0 ml of glycine is added.

Dimethyl adipimidate can also be added during cross-linking with formaldehyde. However this chemical does not cross link proteins to DNA. Other cross-linking chemicals can be used that are known in the art such as methylene blue and acridine orange, cisplatin, dimethylarsinic acid and potassium chromate. Methylene blue and acridine orange couple proteins to DNA via oxygen free radicals, which diffuse away permitting the formation of covalent bounds between molecules that are in close contact(Toth et al (2000) Nucleic Acids Res. 28 e4). Cisplatin only cross- links proteins to DNA and is used at a concentration of 0.3 to 1 M for 30 minutes to 2 hours at 37°C.

Besides chemical cross-linking, UV light and lasers can be used for cross-linking. UV light only cross-links proteins to DNA and is generally performed on cell cultures that are kept on ice for around 15 minutes with a source of 366 nm UV light positioned 2-3 cm from the cultures. High power lasers can also be used following, for example, the process described in Lejnine et al, Nucleic Acids Res.27:3676-3684. After cross-linking the cells are then washed and centrifuged several times and finally resuspended in lysis buffer containing protease inhibitors prior to sonication.

The next major step is the sonication step since it is necessary to break the DNA to 100 to 500 base pair fragments to pinpoint the DNA of interest. The sample is aliquoted into about 1 .0 ml samples so that the sonication probe can be inserted into a depth of about 1 .0 cm. The samples are kept on ice and generally the sonication time and number of pulses will vary depending on cell line and the extent of cross-linking. 3 to 6 pulses for 10 to 30 seconds is sufficient to break the DNA into 100 to 500 base pair fragments. To aid in the sonication glass beads can be added.

An alternative to sonication is nuclease digestion. However, an alternative method of cross-linking other than using formaldehyde is needed when undertaking nuclease digestion. This method produces fragments of about 146 base pairs in size and is performed at 37°C for 5 minutes. The digestion is stopped by the addition of EDTA to a final concentration of between 3 to 7 mM. (See, O'Neill et al (2003) NChIP Methods 31 :76-82.

The chromatin after nuclease digestion is then purified by using cesium chloride gradient centrifugation (162 x g SW55Ti rotor at 20°C) and collecting the fractions at the bottom of the gradient using capillary needles.

To preclear the chromatin before immunoprecipitation blocked Staph A is added at a concentration of between 40 μ to 60 μΙ for 10⁸ cross- linked cells. Immunoprecipitation is the process in which the antibody against the protein of interest is allowed to bind to the protein-DNA complex and the complex is then precipitated. The optimum amount of binding of the antibody to the protein should be determined using increasing amounts of antibody combined with the cell lysate using, for example 0.5, 1 , 2, and 5 μg of antibody per 200 to 600 μΙ of sample. Incubation is generally carried out overnight at 4°C with rotation.

Once the optimum antibody concentration is established 400 to 600 μΙ samples are then subjected to immunopreciptation with the optimum antibody concentration. The incubation is carried out for at least 3 hours and preferably overnight using a rotating platform at 4°C. In the present case, the antibody that is utilized is an antibody that recognizes the epitope tag Flag. These antibodies are commercially available and known in the art. For example, the antibody THE™ anti-DYKDDDDK mAb from mouse can be purchased from GenScript. An immunosorbent is used to separate the antigen-antibody complex from the lysate such as salmon sperm DNA-protein A- Sepharose® or protein G. The immunoprecipitated DNA is then eluted using an elution buffer to elute the antibody/protein/DNA complexes. This elution buffer contains 1 % SDS and 30 to 60 mM NaHCO₃.

The formaldehyde cross- links are then reversed by incubating the eluted protein-DNA complexes at 68°C for at least 4 hours and preferably overnight. Prior to reversing the cross-linking high concentration RNase A and sodium chloride can be added to the sample. The protein can be digested using proteinase K. Generally the proteinase K is at a concentration of 25 mg/ml and 1 .5 μΙ to 10 μΙ is added.

The sample is then extracted with phenol:chloroform:isoamyl alcohol (25:24:1 ) and precipitated in the presence of a carrier DNA with 2 to 3 volumes of absolute ethanol. Glycogen or tRNA or Pellet Paint® (Novagen) can be used as the carrier DNA. Thus, the DNA is isolated and ready for analysis.

Once the DNA of interest is isolated many standard detection and quantification methods can be used to study the isolated gene fragment. For example, the DNA can be analyzed by Southern slot blot analysis or PCR. The DNA can be cloned into a vector such as pUC19, transformed and the clones sequenced. In yet another aspect a microarray can be used.

In another aspect the present invention provides flag tagged human Tubby like protein genes or flag tagged TUB gene, as well as the target genes of the TUBBY-like protein isoforms for genetic testing of patients affected by the inherited or sporadic diseases as described herein. Also contemplated by the present invention are antibodies targeting these target genes for use in pharmaceutical compositions for designing specific gene therapies and cellular therapies.

A number of embodiments of the invention have been described. Nevertheless, it will be understood that various modifications may be made without departing from the spirit and scope of the invention. Examples

Example 1 -Tub Cloning

Tubby cDNA was obtained by RNA extraction of fetal human brain (25 weeks PC) with Trizol (Invitrogen 15596-026). RT was performed with ThermoScript TR RNase H-Reverse Transcriptase (Invitrogen 12236- 022). Tub506, Tub561 and TUB 561 -A277P inserts were generated by PCR. Amplicons Tub506 and Tub561 were ligated into pcDNA-HA and pFlagCMV-5a (E3762 Sigma-Aldrich) by blunt/cohesive ligation, respectively Acc651 /EcoRI and EcoR\/Sal\. Candidate clones were selected and screened by colony PCR.

Plasmids were prepared by growing 5 ml aliquots overnight at 37°C in LB medium containing Neomycin or Ampicillin as the antibiotic. Plasmids were prepared using the SV Minipreps kit (Promega A1460), following the kit protocol. DNA quantity and quality were measured by spectrophotometer.

Example 2- Construction of Lentiviral Expression Plasmid pLV- EF1 -TUB506-Flag and pLV-EF1 -TUB506-Flag (pV.2.3.353) Plasmid The TUB506-Flag insert was generated by PCR using the TUB506- pcDNA3-HA plasmid as shown in Figure 2. The Flag tag was generated by 3 successive PCR's. Primers were provided by EUROGENTEC®. The forward primer was the same for the 3 PCR's. It was designed to include a KOZAK sequence, which is underlined below:

5'-GCCCACCATGACTTCCAAGCCCGCATTC-3' (SEQ I.D. No. 1 )

The successive reverse primers were:

1 ^st PCR:5'-GTCCTTGTAATCCTCGCACGCCAGCTTGCT-3' (SEQ I.D. No. 2)

2^nd PCR:

5'CTTGTCATCGTCCCCCCCCCCCCCGTCCTTGTAATCCTCGCA-3' (SEQ I.D. No. 3)

3^rd PCR: 5'-CTAACGCGTCTACTTGTCATCGTCGTCCTTGTAATC-3'

(SEQ I.D. No. 4)

The Mlu\ cloning site is shaded.

The resulting cDNA coding sequence was: atgacttccaagccgcattccgactggattccctacagtgtcttagatgatgagggcagaaacctgagg cagcagaagcttgatcggcagcgggccctgctggagcagaagcagaagaagaagcgccggagc ccctgatggtgcaggccaatgcagatgggcggccccggagccggcgggcccggcagtcagagga acaagcccccctggtggagtcctacctcagcagcagtggcagcaccagctaccaagttcaagaggc cgactcatcgccagtgtgcagctgggagccacgcgcccaacagcaccagcttcagccaagagaac caaggcggcagctacagcagggggccagggtggcgccgctaggaaggagaagaagggaaagc acaaaggcaccagcgggccagagcactggcagaagacaagtctgaggcccaaggcccagtgca gattctgactgtgggccagtcagaccacgcccaggacgcaggggagacggcagctggtgggggcg aacggcccagcgggcaggatctccgtgccacatgcagaggaagggcatctccagcagcatgagct ttgacgaggatgaggaggatgaggaggagaatagctccagctcctcccagctaaatagtaacaccc gccccagctctgctactagcaggaagtccgtcagggaggcgcctcagcccctagcccaacagctcc agagcaaccagtggacgttgaggtccaggatcttgaggagtttgcactgaggccggccccccagggt atcaccatcaaatgccgcatcactcgggacaagaaagggatggaccggggatgtaccccacctact ttctgcacctggaccgtgaggatgggaagaaggtgttcctcctggcgggaaggaagagaaagaag agtaaaacttccaattacctcatctctgtggacccaacagacttgtctcgaggaggggacagtatatcg ggaaactgcggtccaacttgatgggcaccaagttcactgtttatgacaatggagtcaaccctcagaag gcctcatcctccactttggaaagtggaaccttacgtcaggagctggcagctgtgtgctacgagacaaa gtcttaggcttcaaggggcctcggaagatgagcgtgattgtcccaggcatgaacatggttcatgagag agtctctatccgcccccgcaacgagcatgagacactgctagcacgctggcagaataagaacacgg agagtatcatcggctgcaaaacaagacacctgtctggaatgatgacacacagtcctatgtactcaactt ccatgggcgcgtcacacaggcctccgtgaagaacttccagatcatccatggcaatgacccggactac atcgtgatgcagtttggcgggtagcagaggatgtgttcaccatggattacaactacccgctgtgtgcact gcaggcctttgccattgccctgtccagcttcgacagcaagctggcgtgcgaggattacaaggacga cgatgacaagtag (SEQ I.D. No. 5)

The Flag tag coding sequence is shaded and underlined.

The amplicon was ligated into a lentiviral plasmid downstream the human EF1 a promoter by blunt/cohesive ligation. Candidate clones were selected and screened by colony PCR. Colony PCR positive clones were then grown in 4 ml LB-Ampicillin medium, miniprepped and fully sequenced between the two cloning. pLV-EF1 -TUB506-Flag plasmid was prepared as follows. A 120 ml culture of pV2.3.353 was grown overnight at 37°C in LB medium containing the antibiotic of ampicillin. The plasmid was prepared using the Endotoxin Free Nucleobond kit (Macherey Nagel), following the kit protocol. DNA quantity and quality were measured by spectrophotometer. DNA was checked by restriction digest using Hind\\\, Nco\ and Xho\.

Example 3 -Construction of Lentiviral Expression Plasmid pLV-EF1 - TUB561 -Flag and pLV-EF1 -TUB561-Flag (pV.2.3.352) Plasmid

The TUB561 -Flag insert was generated by PCR using the TUB561 - pFlagCMV-5a as shown in Figure 1 and the primers corresponding to the customer's sequence and provided by EUROGENTEC®.

The forward primer was designed to include a KOAZK sequence, which is underlined below: 5' GCCCACCATG G G G GCCAG G ACACCT 3' (SEQ I.D. No. 6)

The reverse primer was designed to include a Mlu\ site for cloning purposes, which site is shaded:

5' CTAACGCGTCTACTTGTCATCGTCGTCCTTGTAATC -3'(SEQ I.D. No.4)

The amplicon was ligated into a lentiviral plasmid downstream of the human EF1 a promoter by blunt/cohesive ligation. Candidiate clones were selected and screened by colony PCR. Colony PCR positive clones were then grown in 4 ml LB-Ampicillin medium, miniprepped amd fully sequenced between the 2 cloning sites. The resulting cDNA coding sequence was: atgggggccaggacacctttgccttctttctgggtttctttctttgccgagacagggattttgttcccaggag gcactccctggcccatgggatctcagcattcaaagcagcacaggaaacctgggccctgaaacgggg ccaccgaagagatcggagaacaaccaggaggaagtactggaaggaaggaagggagatcgctcg tgtcttagatgatgagggcagaaacctgaggcagcagaagcttgatcggcagcgggccctgctgga gcagagcagaagaagaagcgccaggagcccctgatggtgcaggccaatgcagatgggcggccc cggagccggcgggcccggcagtcagaggaacaagcccccctggtggagtcctacctcagcagca gtggcagcaccagctacaagttcaagaggccgactcactcgccagtgtgcagctgggagccacgcg cccaacagcaccagcttcagccaagagaaccaaggcggcagctacagcagggggccagggtgg cgccgctaggaaggagaagaagggaaagccaaaggcaccagcgggccagcagcactggcaga agacaagtctgaggcccaaggcccagtgcagattctgactgtgggccagtcagaccacgcccagg acgcaggggagacggcagctggtgggggcgaacggcccagcggcaggatctccgtgccacgatg cagaggaagggcatctccagcagcatgagctttgacgaggatgaggaggatgaggaggagaata gctccagctcctcccagctaaatagtaacacccgccccagctctgctactagcggaagtccgtcaggg aggcagcctcagcccctagcccaacagctccagagcaaccagtggacgttgaggtccaggatcttg aggagtttgcactgaggccggccccccagggtatcaccatcaaatgccgcatcactcgggaaagaa agggatggaccggggcatgtaccccacctactttctgcacctggaccgtgaggatgggaagaaggtg ttcctcctggcgggaaggaagagaaagaagagtaaaacttccaattacctcatctctgtggacccaac agcttgtctcgaggaggggacagctatatcgggaaactgcggtccaacttgatgggcaccaagttcac tgtttatgacaatggagtcaaccctcagaaggcctcatcctccactttggaaagtggaaccttacgtcag gagctggcgctgtgtgctacgagacaaacgtcttaggcttcaaggggcctcggaagatgagcgtgatt gtcccaggcatgaacatggttcatgagagagtctctatccgcccccgcaacgagcatgagacactgct agcacgctggcagaatagaacacggagagtatcatcgagctgcaaaacaagacacctgtctggaa tgatgacacacagtcctatgtactcaacttccatgggcgcgtcacacaggcctccgtgaagaacttcca gatcatccatggcaatgacccggactcatcgtgatgcagtttggccgggtagcagaggatgtgttcacc atggattacaactacccgctgtgtgcactgcaggcctttgccattgccctgtccagcttcgacagcaagc tggcgtgcgaggtcgacggatccggtaccgattacaaggacgacgatgacaagtag (SEQ ID No:7)

The Flag coding sequence is shaded.

The pLVEF1 -TUB561 -Flag plasmid was prepared as follows. A 120 ml culture of pV.2.3.352 was grown overnight at 37 °C in LB medium containing ampicillin as the antibiotic. The plasmid was prepared using the Endotoxin Free Nucleobond kit (Macherey Nagel), following the kit protocol. DNA quantity and quality were measured by spectrophotometer. DNA was checked by restriction digest using Hind\\\, BamH\ and Xho\. Example 4- Construction of Lentiviral Expression Plasmid pLV-

EF1 -TUB561A277P-Flag and pLV-EF1 -TUB561A277P-Flag (pV.2.3.354) Plasmid

The TUB561 A277P-Flag insert was generated by PCR using TUB561 -pFlagCMV-5a as shown in Figure 1 . In order to generate the A277P mutation, the TUB561 -5' end was amplified with the following primers provided by EUROGENTEC®:

The forward primer included a KOZAK sequence, which is underlined.

5'-GCCACCATGGGGGCCAGGACACCT-3' (SEQ I.D. No. 6)

The reverse primer included the A277P mutation that is shaded and had the following sequence:

5'-TCCTGCTAGTAGGAGAGCTGGGGCGGG-3' (SEQ I.D. No. 8) The TUB561 -FLAG-3'end was amplified using the following primers from EUROGENTEC®:

The forward primer was:

5'-AGTCCGTCAGGGAGGCAGCCTCAGC-3' (SEQ I.D. No. 9)

The reverse primer included a Mlul site for cloning, which is shaded is set forth below:

5'-CTAACGCGTCTACTTGTCATCGTCGTCCTTGTAATC-3' (SEQ ID No:4)

After pre-ligation of these two PCR products, the full sequence insert was amplified and the amplicon was ligated into a lentiviral plasmid downstream of the human EF1 a promoter by blunt/cohesive ligation. Candidate clones were selected and screened by colony PCR. Colony PCR clones were then grown in 4 ml LB-Ampicillin medium, minprepped and sequenced between the 2 cloning sights.

The resulting cDNA coding sequence was obtained: atgggggccaggacacctttgccttctttctgggtttctttctttgccgagacagggattttgttcccaggag gcactccctggcccatgggatctcagcattcaaagcagcacaggaaacctgggccctgaaacggg gccaccgaagagatcggagaacaaccaggaggaagtactggaaggaaggaagggagatcgctc gtgtcttagatgatgagggcagaaacctgaggcagcagaagcttgatcggcagcgggccctgctgg agcagagcagaagaagaagcgccaggagcccctgatggtgcaggccaatgcagatgggcggcc ccggagccggcgggcccggcagtcagaggaacaagcccccctggtggagtcctacctcagcagc agtggcagcaccagctacaagttcaagaggccgactcactcgccagtgtgcagctgggagccacg cgcccaacagcaccagcttcagccaagagaaccaaggcggcagctacagcagggggccagggt ggcgccgctaggaaggagaagaagggaaagccaaaggcaccagcgggccagcagcactggc agaagacaagtctgaggcccaaggcccagtgcagattctgactgtgggccagtcagaccacgccc aggacgcaggggagacggcagctggtgggggcgaacggcccagcggcaggatctccgtgccac gatgcagaggaagggcatctccagcagcatgagctttgacgaggatgaggaggatgaggaggag aatagctccagctcctcccagctaaatagtaacacccgccccagctctcctactagcggaagtccgtc agggaggcagcctcagcccctagcccaacagctccagagcaaccagtggacgttgaggtccagg atcttgaggagtttgcactgaggccggccccccagggtatcaccatcaaatgccgcatcactcggga aagaaagggatggaccggggcatgtaccccacctactttctgcacctggaccgtgaggatgggaag aaggtgttcctcctggcgggaaggaagagaaagaagagtaaaacttccaattacctcatctctgtgga cccaacagcttgtctcgaggaggggacagctatatcgggaaactgcggtccaacttgatgggcacca agttcactgtttatgacaatggagtcaaccctcagaaggcctcatcctccactttggaaagtggaacctt acgtcaggagctggcgctgtgtgctacgagacaaacgtcttaggcttcaaggggcctcggaagatga gcgtgattgtcccaggcatgaacatggttcatgagagagtctctatccgcccccgcaacgagcatgag acactgctagcacgctggcagaatagaacacggagagtatcatcgagctgcaaaacaagacacct gtctggaatgatgacacacagtcctatgtactcaacttccatgggcgcgtcacacaggcctccgtgaa gaacttccagatcatccatggcaatgacccggactcatcgtgatgcagtttggccgggtagcagagga tgtgttcaccatggattacaactacccgctgtgtgcactgcaggcctttgccattgccctgtccagcttcga cagcaagctggcgtgcgaggtcgacggatccggtaccgattacaaggacgacgatgacaagta g (SEQ I.D. No. 10) The Flag tag coding sequence is shaded.

The A277P mutation is underlined.

The pLVEF1 -TUB561A277P-Flag plasmid was prepared as follows. A 120 ml culture of pV.2.3.354 was grown overnight at 37 °C in LB medium containing ampicillin as the antibiotic. The plasmid was prepared using the Endotoxin Free Nudeobond kit (Macherey Nagel), following the kit protocol. DNA quantity and quality were measured by spectrophotometer. DNA was checked by restriction digest using Hind\\\, BamH\ and X ol.

Example 5-Stable Cell line Generation pLVEF1 -TUB561 -Flag and pLV-EF1 -TUB506-Flag were used for the final transfection (see, Figure 3). Moi 2.5 was used for transfection into SH-SY5Y cells in the presence of 8 pg/irnl polybren (hexadimethrine bromide H9268, Sigma), for rl_V-EF1 -TUB506 Flag and rl_V-EF1 -TUB561 - Flag vector and MOI 5 for rPL-EF1 -TUB561 A277P-Flag. Cells were selected with protein expression after limited dilution and Immunocytology with Flag antibody. Three cell lines were thus created. The first cell line was a SH-

SY5Y neuroblastoma cell line infected by a lentivirus over expressing the normal human 561 amino acids residues TUBBY- like protein tagged with one copy of the FLAG sequence (C.N. CM. I-4286). The second cell line was a SH-SY5Y neuroblastoma cell line infected by a lentivirus over expressing the mutated human 561 amino acids residues TUBBY-like protein isoform tagged with one copy of the FLAG sequence (C.N.C.M i- 4288). The mutant corresponds to the change of the alanine residue by a proline residue at the codon 277 of the 561 TUBBY like protein isoform (C.N.C.M. I-4288). A third cell was generated that was SH-SY5Y neuroblastoma cell line infected by a lentivirus over expressing the human 506 amino acids residues TUBBY like protein tagged with one copy of the FLAG sequence (C.N.C.M. I-4287).

All three cell lines were deposited at the Collection Nationale de Cultures de Microorganisms (C.N.C.M.), 25 Rue du Docteur Roux F- 75724 Paris Cedex 15, France on March 22, 2010. The identified cell lines that were deposited and their registration numbers are as follows:

Tub 561 -Flag- C.N.C.M. I-4286

Tub 506-Flag (Fc Flag)-C.N.C.M. I-4287

Tub 561 -A277P-Flag (Tub mut 1 )-C.N.C.M. I-4288 Example 6- ChIP Sequencing

The three cell lines Tub 561 -Flag (C.N.C.M. I-4286), Tub 506-Flag (Fc FlagXC.N.C.M. I-4287) and Tub 561 -A277P-Flag (Tub mut 1 )(C.N.C.M. I-4288) were used in ChlP-Sequencing to analyze interactions with DNA and more specifically how transcription factors and other chromatin-associated proteins influence phenotype-affecting mechanisms.

These three cell lines are cultured. 1 x 10⁷ to 1 x 10⁸ cells in culture medium with the molecules of the target genes to be tested. 1 % formaldehyde is added directly to the tissue culture and the suspension of cells are stirred and the cells are incubated on a shaking platform for 10 minutes at room temperature. The reaction is stopped by adding glycine to a final concentration of 0.125 M. The cells are then stirred for an additional 5 minutes. The cell medium is then poured off and the cells are rinsed twice with phosphate-buffered saline (PBS). 5 ml (per 500 cm² dish) of a 1 :5 dilution of a 1 x trypsin-EDTA tissue culture grade solution diluted in 1 X PBS is added and the cells are incubated for 10 minutes at 37°C. A small amount of serum is then added to inactivate the cells, which are then scraped from the dishes and centrifuged at 1500 rpm. The pellet is then washed once with 1 x PBS and phenylmethylsulfonyl fluoride (PMSF, 10 μΙ/ml).

The cell pellet is then resuspended in cell lysis buffer (5 mM PIPES, pH 8.0, 85 mM KCI, 0.5% Nonidet P-40 and protease inhibitors), 10 μΙ/ml PMSF, 1 μΙ/ml aprotinin and 1 μΙ/ml leupeptin and is incubated on ice for 10 minutes. The cells are then homogenized with a Douce homogenizer to release the nuclei. Cell lysis is monitored by examining the cells under a microscope. The cells are then centrifuged at 5,000 rpm for 5 minutes at 4°C to pellet the nuclei. The supernatant is then discarded and the nuclear pellet is suspended in lysis buffer and protease inhibitors and is incubated on ice for 10 minutes. The extracted chromatin is then sonicated on ice to an average length of 1 -2 kb using four pulses of 15 seconds at a setting of 7 on a Fisher Model 60 sonic dismembranator. After sonication the samples are then microcentrifuged at 14,000 for 10 minutes at 4°C. The supernatant is carefully removed and the chromatin is precleared by adding 50 μΙ of Staph A cells. The Staph A cells are prepared by resuspending 1 g of lyophilized protein A-positive Staphylococcus aureus whole cells (Cowan 1 strain), which are heat-killed, fixed in formalin in 10 ml of 1 X dialysis buffer (2 mM EDTA, 50 mM Tris-CI, pH 8.0, 0.2% Sarkosyl PMSF) and are centrifuged at 10,000 rpm for 5 minutes at 4°C. The supernantant is discarded and the wash is repeated. The cells are then resuspended in 3 ml of 1 x PBS, 3% SDS and 10% BME. The cells are then boiled for 30 minutes, centrifuged at 10,000 rpm for 5 minutes and resuspended in 4 ml of dialysis buffer. 10 μΙ of herring sperm DNA and 10 μΙ of BSA (10mg/nnl) are added and are incubated on a rotating platform at 4°C overnight, Prior to use the Staph A cells are microcentrifuged for 3 minutes, the supernatant is removed and the pellet is washed twice in 1 x dialysis buffer. The cells are resuspended in 1 x dialysis buffer before use.

After addition of the Staph A cells, the mixture is incubated on a rotating platform at 4°C for 15 minutes and then microcentrifuged at 14,000 rpm for 4 minutes. The supernatant is then transferred to a new tube and divided into 10 samples. One sample is used as a control and contains no antibody. Another control is a sample with only IP dilution buffer. The samples are then adjusted with two times the chromatin volume to be between 200 and 600 μΙ using IP dilution buffer (0.01 % SDS, 1 .1 % Triton X-100, 1 .2 mM EDTA, 16.7 mM Tris-CI, pH 8.1 , 167 mM NaCI and fresh protease inhibitors), 1 g of anti-Flag antibody is added to the samples and they are incubated on a rotating platform at 4°C overnight.

10 μ I of blocked Staph A cells is then added to each sample, which is then incubated on a rotating platform at 4° C for 15 minutes. The samples are then microcentrifuged at 14,000 rpm for 4 minutes. The supernatant is then decanted in all samples except one that is a control sample with no antibody and reflects the total input chromatin. The pellets are then washed with 1 .2 ml of 1 x dialysis buffer(2 mM EDTA, 50 mM Tris-CI, pH 8.0 0.2% Sarkosyl and PMSF) and four times with 1 .2 ml of IP wash buffer( (100 mM Tris-CI, pH 9.0, 500 mM LiCI, 1 % NP-40. 1 % deoxycholic acid and PMSF). An additional 600 μΙ of buffer is then added and the samples are incubated on a rotating platform for 3 minutes. The samples are then microcentrifuged at 14,000 rpm for 4 minutes and the buffer is removed.

The antibody/protein/DNA complex is then eluted by adding 150 μΙ of elution buffer (50 mM NaHCO3, 1 % SDS), the complex is then vortexed for at least 15 minutes and then microcentrifuged for 4 minutes at 14,000 rpm. The supernatants are then transferred to new tubes and the elution procedure is repeated and the supernatants combined. The samples are then microcentrifuged at 14,000 rpm for 4 minutes to remove the Staph A cells and the supernatants are transferred to new tubes. 1 μΙ of high- concentration RNAse A (10 mg/ml) and 12 μΙ of 5 M NaCI to a final concentration of 0.3 M is added to the samples. To the total input chromatin sample, 24 μΙ of 5 M NaCI and 2 μΙ RNase A is added. The samples are then incubated at 67°C for 5 hours to reverse the formaldehydye crosslinks. After the 5 hour incubation, 2.5 ml vol of ethanol is added and the samples are precipitated at -20°C overnight. The next day the samples are microcentrifuged at 14,000 rpm for 20 minutes at 4°C, the supernatant is discarded and the samples are respun to remove the ethanol . The pellets are allowed to dry. Each pellet is then dissolved in 100 μΙ of TE, 25 μΙ of 5 x PK buffer(50 mM Tris-CI, pH 7.5, 25 mM EDTA and 1 .25% SDS and 1 .5 μΙ of proteinase K (25 mg/ml) is added to each sample and the samples are incubated at 45°C for 2 hours. 175 μΙ of TE is then added to each sample, which is then extracted with 300 μΙ of phenol/chloroform/isoamyl alcohol and once with 300 μΙ chloroform/isoamyl alcohol. 30 μΙ of 5 M NaCI, 5 μg of glycogen and 750 μΙ of ethanol is added to each sample, which is left to precipitate at -20° C overnight.

The samples are microcentrifuged at 14,000 rpm for 20 minutes at 4°C and the pellets are allowed to dry. The samples are resuspended in 30 μΙ water and like samples are combined in one tube. An aliquot is saved of the experimental example to analyze known targets by PCR.

Blunt-ended DNA fragments for cloning are created using a polymerase reaction in which 60 μΙ of experimental sample, 20 μΙ of 1 mM dNTPs, 20 μΙ of 10 X T4DNA polymerase buffer. The samples are incubated at 37°C for 30 minutes. A phenol/chloroform extraction is then performed on the sample by adding 200 μΙ of phenol/chloroform/isoamyl alcohol (25:24:1 ) and the samples are vortexed. The samples are then centrifuged at 14,000 rpm for 5 minutes and the aqueous phase is saved in a new tube.

The DNA is precipitated with 0.1 vol 3 M NaOAc and 2.5 vol ethanol . The samples are incubated for 2 hours at -20°C. The samples are spun at 14,000 rpm for 20 minutes and the supernatant is disregarded. The DNA pellet is then dried and resuspended in 10 μΙ of water. A pUC19 vector digested with HincW and the sample is ligated into this vector at 16° overnight, Using TOP10 competent cells, standard transformation reactions are performed using a heat shock method for transformation. U.S. Patent Application No. 12/223,744The cells are then plated overnight at 37°C. The colonies are then picked and grown for 8 hours. The vector is isolated using a miniprep plasmid purification protocol following the directions provided by Qiagen. The vector is then digested with appropriate restriction enzymes to release the cloned DNA insert and is further run on agarose gel to determine the size. The cloned insert is then sequenced using vector-specific primers.

Example 7-ChlP on ChIP The three cell lines Tub 561 -Flag (C.N.C.M. I-4286), Tub 506-Flag

(Fc FlagXC.N.C.M. I-4287) and Tub 561 -A277P-Flag (Tub mut 1 )(C.N.C.M. I-4288) are grown in 50 ml of culture until the OD600 reaches 0.6 to 1 .0 with the molecules of the target genes to be tested. 1 .4 ml of 37% formaldehyde is added directly to the flask. The contents are then incubated for 30 minutes at room temperature under agitation, 2.5 ml of 2.5 M glycine is added to quench the formaldehyde. The samples are then centrifuged in 50 ml conical tubes for 5 minutes at 3,600 rpm at 4°C. The supernatant is poured off and the cells are washed by resuspending into 40 ml of ice cold TBS and vortexing. The sample is again centrifuged for 5 minutes at 3,600 rpm at 4°C and this washing and centrifuging process is repeated.

The cell pellet is resuspended in remaining TBS transferred into a 1 .5 ml screw cap tube and is centrifuged at maximum speed for 1 minute. The cells are then lysed using a lysis buffer of 50 mM HEPES-KOH pH 7.5, 140 mM NaCI, 1 mM EDTA, 1 % Triton X-100, 0.1 % Na-deoxycholate, 1 mM PMSF, 1 mM Benzamidine, 10 g Aprotinin, 1 g Leupeptin and 1 g/ml Pepstatin. The pellet is first resuspended in 700 μΙ lysis buffer and acid washed glass beads are added (400-600 m)(approximately 0.5 ml_ PCR tube of beads). The cap is screwed on tightly and the sample with beads is beaten with a bead beater for 5 minutes and then placed in an ice water bath for 5 minutes. This last step of beating is repeated three more times and the breakage of the cells is monitored under a light microscope. A hole is punched in the tube and it is placed into a 2 ml tube and centrifuged. The chromatin pellet is suspended in its own supernatant. The samples are sonicated 4 times for 20 seconds at power 4 using a Branson Sonifier 250. The sample tubes are placed on ice between sonicating. The sample tubes are centrifuged 5 minutes at maximum speed and the 500 μΙ of chromatin is transferred to a new tube. 30 μΙ of the anti-Flag antibody coupled to glass beads, which were prepared by centrifuging at low speed, washing twice with PBS+BSA and incubated overnight with the anti-Flag antibody. The beads are washed with lysis buffer to remove the excess. The samples are incubated overnight at 4°C with agitation. One whole cell extract of chromatin is saved at -20°C for sequence specific PCR to validate ChlP.

The beads are washed twice with 1 ml_ lysis buffer, twice with 1 ml lysis buffer supplemented with 360 mM NaCI, twice with 1 ml wash buffer( 10 mM Tris-Hcl pH 8.0, 250 mM LiCI, 0.5% Na-deoxycholate, 0.5% NP40, 1 mM EDTA) and once with 1 ml TE. After the last wash the samples are centrifuged and the remaining liquid is removed leaving a dry pellet.

The DNA is next purified using the pellet, as well as the saved washed cell extract. 50 μΙ of TE/SDS (10 mM Tris, pH 8.0, 1 mM EDTA and 1 % SDS) is added and the samples are vortexed and are incubated overnight at 65°C. The samples are centrifuged for 3 minutes and the supernatant is transferred to a new tube. 350 μΙ of a mixture of 345 μΙ TE, 3 μΙ RNase A, 2 μΙ glycogen is added and the samples are mixed and incubated for 2 hours at 37°C. 15 μΙ of 10% SDS and 7.5 μΙ of proteinase K solution are added and the samples mixed and are incubated for 2 hours at 37°C. The DNA is extracted twice with 400 μΙ phenol/chloroform/isoamyl alcohol. 14 μΙ of 5M NaCI (200 mM final concentration) is added to the samples, they are mixed and 1 ml of ethanol is added and the samples are vortexed and centrifuged at maximum speed for 20 minutes. The liquid is poured off and the pellet is washed with 70% ethanol. The samples are centrifuged 5 minutes and the liquid is poured off. This centrifuge step is repeated. The pellet is then suspended in 50 μΙ TE. 40 μΙ of the immunopreciptated DNA is transferred to a PCR tube and placed on ice. 70 μΙ of blunting mix (1 1 μΙ 10 X NEB #2 buffer, 0.5 μΙ BSA, 0.5 μΙ dNTPs, 0.2 μΙ T4 DNA pol) and 57.8 μΙ ice cold water is added. The samples are mixed and incubated for 20 minutes at 12 ⁰ C. Ligation is done by placing the samples on ice, and adding 1 1 .5 μΙ

3M NaOAc and 0.5 μΙ glycogen. The samples are vortexed and 120 μΙ of phenol/chloroform/isoamyl alcohol is added, the samples are mixed and are centrifuged for 5 minutes at maximum speed. 1 10 μΙ is transferred to a new tube and 230 μΙ ethanol is added. The samples are then vortexed and centrifuges for 20 minutes at 4°C. The supernatant is poured off and 500 μΙ of 70% ethanol is added. The samples are vortexed and centrifuged for 5 minutes at 4°C. The supernatant is then poured off, the samples are left to air dry for 1 minute and 25 μΙ ice cold water is added and the samples are put on ice for 30 minutes. The samples are centrifuged briefly and put on ice. 25 μΙ of ligase mixture is added ( 8 μΙ water, 10 μΙ 5X ligase buffer(lnvitrogen), 6.7 μΙ annealed linkers and 0.5 μΙ T4 DNA ligase.

The annealed linkers are prepared by annealing oligo 1 (GCGGTGACCCGGGAGATCTGAATTC (SEQ ID No.: 12)(40 μΜ stock) and 375 μΙ of oligo 2 (GAATTCAGATC)(SEQ ID No.: 13) (40 μΜ stock). In 250 μΙ 1 M Tris, pH 7.9. 50 μΙ aliquots are placed in 1 .5 ml tubes and heated at 95° C for 5 minutes. The tubes are transferred to a 70° C heat block and the block is placed at room temperature and cooled down to 25 ⁰ C. The block is transferred to 4°C and allowed to cool down overnight.The samples are mixed and incubated overnight at 16°C.

PCR is performed as follows. 6 μΙ of 3 M NaOAc is added and 130 μΙ EtOH to each sample. The sample is vortexed and centrifuged at 4° C at maximum speed. The supernatant is poured off and 500 μΙ 70% ethanol is added . The samples are vortexed and centrifuged for 5 minutes at 4°C at maximum speed. The supernatant is poured off, the samples are centrifuged briefly and the remaining liquid is removed. The samples are left to air dry for 1 minute and are resuspended in 25 μΙ ice cold water. The samples are left on ice for 30 minutes, vortexed, centrifuged briefly and put on ice. 15 μΙ of labelling mix ( 4 μΙ 10 X ThermoPol buffer(New England Biolabs), 7.75 μΙ water, 2 μΙ aa-dUTP dNTP mix, 1 .25 μΙ oligo 1 ) are added to the samples, which are then mixed and transferred to a new 0.5 ml PCR tube. The samples are put in a thermocycler which is programmed as follows:

Step 1 : 4 minutes at 55°C, Step 2: 5 minutes at 72°C, Step 3: 2 minutes at 95°C, Step 4: 30 seconds at 95°C, Step 5: 30 seconds at 55°C, Step 6: 1 minute at 72°C, step 7 (step 4 repeated 31 more times), Step 8: 4 minutes at 72°C, Step 9 4°C forever. When the temperature reaches 55°C, 10 μΙ of enzyme mix is added ( 8 μΙ water, 1 μΙ 10XThermoPol buffer, 1 μΙ Taq polymerase, 0.01 μΙ PFU turbo). The PCR reactions are purified on Qiaquick PCR purification kit using the manufacturer's protocol. However PE buffer is replaced with Phosphate wash buffer (80% Ethanol, 5 mMKPO₄ pH 8.5 and EB buffer with phosphate elution buffer 4 mM KPO₄ pH 8.5. The wash step is done twice and the elution step twice with phosphate elution buffer.

The eluates are dried in a speed-vac and the pellets are resuspended in 4.5 μΙ fresh 0.1 M Na₂CO₃, pH 9.0. 4.5 μΙ of Cy™-dye (Cy™5) for the samples and Cy™3 for the control is added. The dyes are diluted in 75 μΙ DMSO and the samples are incubated in the dark at room temperature for 1 hour. 35 μΙ 0.1 M NaOAC pH 5.2 and then 250 μΙ buffer PB (Qiagen) are added. The samples are purified on Qiaquick PCR purification columns following the manufacturer's protocol except the wash step is done twice. The eluates are dried in a speed-vac and stored at - 20°C in the dark until ready to be hybridized on a DNA array.

The samples are subjected to a DNA microarray. Hybridization reactions and hybridization cassettes that are used are from Array it® Corporation. The hybridization protocols followed are those from the manufacturer.

Example 8-Protein-Protein Interactions

The three cell lines Tub 561 -Flag (C.N.C.M. I-4286), Tub 506-Flag (Fc FlagXC.N.C.M. I-4287) and Tub 561 -A277P-Flag (Tub mut 1 )(C.N.C.M. I-4288) are used as baits. The DNA-binding domain is Gal4 (amino acids 1 -147) and the activation domain is Gal4 (amino acids 768- 881 ). The preys that are used are different human neuronal cell lines or neuronal tissue and the reporter genes are His 3 and lac Z. The procedure that is followed is that of U.S. Patent 6,187,535 to LeGrain et al incorporated herein by reference.

Basically the cDNA's of SEQ ID Nos. 5, 7 and 10 are ligated into a yeast plasmid expression vector having a DNA-binding domain and is transfected. The cDNA is obtained from the prey and ligated into a yeast plasmid expression vector having an activation domain and the cells are transfected and the plasmids are extracted and are added to the bait cells that are transfected. The cells and plasmids are retransformed and plated. If an interactions occurs the reporter gene lac Z is expressed and a blue color appears on the plates indicating a positive interaction. The identity of the protein is verified with Western blot or SDS-PAGE.

Claims

What is claimed is:

1 . A nucleic acid molecule comprising or consisting essentially of SEQ ID No.:5, SEQ ID No.:7 or SEQ ID No.: 10 or a nucleic acid molecule which has 91 % to 99% sequence identity to those nucleic acid molecules in SEQ ID No.:5, SEQ ID No.:7 or SEQ ID No.: 10 or a sequence complementary to SEQ ID No.:5, SEQ ID No.:7 or SEQ ID No.: 10.

2. The nucleic acid molecule according to Claim 1 , which hybridizes under stringent conditions to the complement of the nucleic acid molecule of SEQ ID No.: 5, SEQ ID No.:7 or SEQ ID No.: 10.

3. The nucleic acid molecule according to Claim 1 or Claim 2, which hybridizes under high or moderate stringent conditions to the full length sequence of SEQ ID No.: 5, SEQ ID No.:7 or SEQ ID No.: 10.

4. A vector containing the nucleic acid molecule of any one of Claims 1 to 3.

5. The vector according to Claim 4, which is an expression vector.

6. The vector according to Claim 4 or Claim 5, which is a lentiviral expression vector.

7. The vector according to Claim 6, which is selected from the group of pLV-EF1 -TUB506-Flag, pLV-EF1 -TUB561 -Flag and pLV-EF1 - TUB561 A277P-Flag.

8. Host cells transformed with any one of the vectors of Claims 4 to 7.

9. The host cells according to Claim 8, which are mammalian host cells.

10. The host cells according to Claim 9, wherein the mammalian host cells are CHO cells, VERO cells, BHK cells, HeLa cells, COS cells,

MDCK cells, 293 cells WI38 cells or hypothalamic cells.

11. The host cells according to Claim 10, wherein the hypothalamic cells are GN or GH-1 cell lines.

12. The host cells according to claim 9, which are human cells.

13. The host cells according to Claim 12, wherein said human cells are from a neoblastoma cell line.

14. The host cells according to Claim 13, wherein said neoblastoma cell line is selected from the group consisting of IMR5- BCL2, NBASI-5, NBS-1 , NBS-2, AS-14.2N⁺, AS-11.4N⁺,15N-TrkB, 411 , 512, 422, 1810, cl.4M, cl.6M, cl.3N, cl.9N, SK-N-ASiylGN, LA-N-6:YIGN, LA-N-5:YIFN, LA-N-1 :YIFN, SK-N-FI:YIFN, TET-2N, TET-2, TET-21 N, TET-21 , SH-400; 310;907, SH-802;803, 15NA-P4;E1 ;D1 , tTA sense, tTA- antisense, SH-Sy5Y, RET/PTC 1 RET/PTC3, RET/MEN2A, RET/MEN2B, B-myb, B-myb antisense, SY5Y-TrkA, LAN5-TrkA, SKMYC2, SKMYC6, SKMYAS, SH400;310;907 and SH-802;803.

15. The host cells according to Claim 14, wherein said neoblastoma cell line is a SH-SY5Y cell line.

16. A cell line deposited at the C.N.C.M. on March 22, 2010 under accession number CNCM-4286 or a cell line deposited at the C.N.C.M. on

March 22, 2010 under accession number CNCM-4287 or a cell line deposited at the C.N .C.M. on March 22, 2010 under accession number CNCM-4288.

17. A microarray having at least one of the cell lines of any one of Claims 8 to 15 spotted thereon.

18. The nucleic acid according to any one of Claims 1 to 3 encoding a Flag tagged TUBBY-like isoform.

19. A method for identifying unknown target genes of TUBBY-like isoforms, said method comprising:

(a) adding a protein to be tested to a cell line deposited at the C.N.C.M. on March 22, 2010 under accession number CNCM-4286 or a cell line deposited at the C.N.C.M. on March 22, 2010 under accession number CNCM-4287 or a cell line deposited at the C.N.C.M. on March 22, 2010 under accession number CNCM-4288.;

(b) chromatin immunoprecipitating the cell lines; and

(c) identifying if the protein interacts with the cell lines.

20. The method according to Claim 19, wherein the protein is identified by sequencing.

21 . The method according to Claim 19, wherein the target genes are transcription factors.

22. The method according to Claim 19, wherein the target genes are genetic promoters.

23. A method for identifying unknown target genes of human transcription factors of TUBBY-like isoforms, said method comprising (a) adding a protein to be tested to a cultured cell line deposited at the C.N.C.M. on March 22, 2010 under accession number CNCM-4286 or a cell line deposited at the C.N.C.M. on March 22, 2010 under accession number CNCM-4287 or a cell line deposited at the C.N.C.M. on March 22, 2010 under accession number CNCM-4286;

(b) fixing said cell mixture with formaldehyde;

(c) sonicating said fixed cell mixture;

(d) chromatin immunoprecipitating the fixed cell mixture; and

(e) identifying if the protein interacts with the cell lines.