WO2011119906A1 - HUMAN POLYOMAVIRUS 6 (HPyV6) AND HUMAN POLYOMAVIRUS 7 (HPyV7) - Google Patents

Abstract

The nucleic acid sequences of two new human polyomaviruses, Human Polyomavirus 6 (HPyV6) and Human Polyomavirus 7 (HPyV7), are provided. Compositions comprising the nucleic acid sequences, monoclonal antibodies, PCR primers and oligonucleotide probes, as well their use in methods of diagnosis and testing are provided.

Description

HUMAN POLYOMAVIRUS 6 (HPyV6) AND HUMAN POLYOMAVIRUS 7 (HPyV7)

CROSS-REFERENCE TO RELATED APPLICATION

[0001] This application claims the benefit of U.S. Provisional Application No.

61/318,080, filed on March 26, 2010, the entire contents of which are incorporated by reference.

BACKGROUND OF THE INVENTION

[0002] The Polyomaviridae are a family of non-enveloped viruses that carry a circular, double-stranded DNA genome. The family is named for some members' ability to induce various types of tumors in experimentally infected animals. For example, the polyomaviruses BKV and JCV, which chronically infect the urinary epithelia in a great majority of humans, can cause tumors in experimentally inoculated rodents.

[0003] Although BKV and JCV have been indirectly associated with the development of various forms of human cancer, such as prostate cancer and colorectal cancer (respectively), conclusive proof of a causal relationship between BKV or JCV and human cancers has remained elusive.

[0004] The recent discovery of a fifth human polyomavirus associated with an unusual form of skin cancer called Merkel cell carcinoma (MCC) has rekindled research interest in the possibility that polyomaviruses cause cancer in humans.

BRIEF SUMMARY OF THE INVENTION

[0005] The present inventors have found that DNA sequences of a newly-discovered virus, named Merkel cell polyomavirus (MCV), are present in about 80% of MCC tumor specimens. In accordance with the invention, nucleic acid sequences of the complete genomes of two previously unknown polyomaviruses which are now identified as Human Polyomavirus 6 (HPyV6) and Human Polyomavirus 7 (HPyV7), are provided.

[0006] The invention provides two new human polyomaviruses which are capable of, for example, being used for antigen production, antibody production, diagnostic testing and oligonucleotide primer and/or probe production, and other uses. [0007] In an embodiment, the present invention provides an isolated nucleic acid molecule encoding the genome of the polyoma virus HPyV6, comprising a nucleotide sequence of any one of SEQ ID NOs: 1 to 6, or the complement thereof.

[0008] In another embodiment, the present invention provides an isolated nucleic acid molecule encoding the genome of the polyoma virus HPyV7, comprising a nucleotide sequence of any one of SEQ ID NOs: 7 to 12, or the complement thereof.

[0009] In another embodiment, the present invention provides a nucleic acid molecule of any of SEQ ID NOs: 1 to 12.

[0010] In yet another embodiment, the present invention provides an isolated nucleic acid molecule that specifically hybridizes to the nucleotide sequence set forth in any of the SEQ ID NOs: 1-12, or to the complement thereof.

[0011] In a further embodiment, the present invention provides an isolated host cell comprising the isolated nucleic acid molecule of any of SEQ ID NOS: 1 to 12. The host cell can be a mammalian cell. In an embodiment, the host cell is a skin cell.

[0012] In another embodiment, the present invention also provides an isolated nucleic acid molecule that specifically hybridizes to the nucleotide sequence set forth in any of the SEQ ID NOS: 1-12 or to the complement thereof. The nucleic acid molecule can be an oligonucleotide primer of at least about 10 nucleotides in length. For example, the primer can comprise between about 10 nucleotides to about 30 nucleotides in length.

[0013] In addition, in an embodiment, the present invention provides at least one pair of oligonucleotide primers for use with PCR, wherein the first primer is an isolated nucleic acid molecule comprising between about 10 nucleotides to about 30 nucleotides in length that specifically hybridizes to the nucleotide sequence set forth in any of the SEQ ID NOs: 1-6; and the second primer is an isolated nucleic acid molecule comprising between about 10 nucleotides to about 30 nucleotides in length that specifically hybridizes to the complement of the nucleotide sequence set forth in any of the SEQ ID NOs: 1-6. The primer pairs of the present invention can be included in a kit for testing a sample for the presence of HPyV6, in, for example, a sterile solution.

[0014] In another embodiment, the present invention provides at least one pair of oligonucleotide primers for use with PCR, wherein the first primer is an isolated nucleic acid molecule comprising between about 10 nucleotides to about 30 nucleotides in length that specifically hybridizes to the nucleotide sequence set forth in any of the SEQ ID NOs: 7-12; and the second primer is an isolated nucleic acid molecule comprising between about 10 nucleotides to about 30 nucleotides in length that specifically hybridizes to the complement of the nucleotide sequence set forth in any of the SEQ ID NOs: 7-12. The primer pairs of the present invention are included in a kit for testing a sample for the presence of HPyV7, in, for example, a sterile solution.

[0015] In an embodiment, the present invention also provides methods of testing a sample for the presence of HPyV6 or HPyV7, comprising: (i) providing a test sample; (ii) adding first and second oligonucleotide PGR primers (as described above) to the sample; and (iii) testing the sample for the presence of a PCR product, wherein detection of a PCR product indicates that HPyV6 or HPyV7 is present in the sample.

[0016] In another embodiment, the present invention provides an isolated polypeptide encoded by the nucleic acid or a fragment thereof, according to any of SEQ ID NOs: 1 to 12. The present invention also provides, in an embodiment, an antibody, or antigen-binding fragment thereof, which specifically binds an isolated polypeptide or a fragment thereof, encoded by nucleic acid according to any of SEQ ID NOs: 1 to 12.

[0017] In an embodiment, the present invention provides a method of testing a sample from a subject for the presence of antibodies to HPyV6 or HPyV7 VPl protein or a fragment thereof, the method comprising: (i) providing a test sample from a subject having a first antibody or antigen-binding fragment thereof specific to HPyV6 or HPyV7 VPl protein or a fragment thereof; (ii) contacting the test sample with an HPyV6 or HPyV7 VPl protein, or fragment thereof, under conditions in which the first antibody, binds the HPyV6 or HPyV7 VPl protein or a fragment thereof, if present, to form an antibody-antigen complex; (iii) washing the sample to remove any unbound antibody; (iv) contacting the sample with a second antibody, wherein the second antibody binds the first antibody, if present, and wherein the second antibody is labeled with a detectable label; (v) washing the sample to remove any unbound antibody, and (iv) testing for the presence of the detectable label, wherein the amount of the detectable label indicates the quantity of antibodies specific to HPyV6 or HPyV7 VPl protein in the sample of the subject.

BRIEF DESCRIPTION OF THE SEVERAL VIEWS OF THE DRAWING(S)

[0018] Figure 1 shows a gel with an analysis of a set of RCA reactions from swabs of 22 subjects. RCA-amplified DNA was analyzed by digestion with BamHl followed by agarose gel electrophoresis. The digests were compared to the 1 kb ladder (Invitrogen, Carlsbad, CA). The top letter A marks the prominent band that yielded HPV127. The lower letter B marks the prominent band that marks MCV isolate R17a.

[0019] Figure 2 shows the phylogenetic analysis of the complete genomes of HPyV6 and HPyV7. HPyV6 clones were identified using a "1" with a two digit identifier, and HPyV7 clones were identified using a "2" with a two digit identifier. The lowercase "a" or "b" denotes the initial or repeat sampling, respectively. Subject 13 (identifiers "213a" and "213b") was born in Asia, and subject 6 (identifier "106b") was born in Europe. All other subjects were born in North America.

[0020] Figure 3 shows the phylogenetic analysis of the nucleotide sequences of the large T antigen gene (early region), or VP1+VP2 genes (late region) of various polyomavirus species that were used to construct separate phylogenetic trees. Human polyomaviruses (and putative human polyomaviruses) are underlined. HPyV6 and HPyV7 (identified as EPV1 and EPV2 in the figure respectively are in bold).

[0021] Figure 4 is a series of graphs depicting gradient ultracentrifugation analysis of shed polyomavirus DNA. Polyomavirus virions were extracted from skin swab specimens and subjected to endonuclease digestion followed by gradient ultracentrifugation. Each gradient was collected as ten 0.5 ml fractions. DNA was extracted from samples of each fraction and quantitated by qPCR comparison to serially diluted cloned viral DNA. The bottom panel shows results for a control gradient in which a mock extract was spiked with cloned MCV DNA in the absence of endonuclease. An additional control gradient in which spiked MCV DNA was digested with endonuclease showed no signal (data not shown).

[0022] Figure 5 is a graph showing a serological analysis of EPV exposure. A set of 95 human sera was diluted 1 : 100 and subjected to ELISA using VLPs of the polyomavirus species indicated. The optical density (OD) values for a representative set of 12 samples are shown graphically. A seropositivity OD cutoff value of 0.105 (dotted line) was chosen to exclude the maximum signal observed in the MPyV (negative control) ELISA. The table at the bottom of the figure shows observed frequency of single, double and triple seropositivity for the three human polyomavirus species, as well as expected frequencies derived by multiplication of individual frequencies. DETAILED DESCRIPTION OF THE INVENTION

[0023] The invention provides two new human polyomaviruses which are capable of, for example, being used for antigen production, antibody production, diagnostic testing and oligonucleotide primer and/or probe production, and other uses.

[0024] In an embodiment the present invention provides an isolated nucleic acid molecule encoding the genome of the polyoma virus HPyV6, comprising a nucleotide sequence of any one of SEQ ID NOs: 1 to 6, or the complement thereof.

[0025] In another embodiment the present invention provides an isolated nucleic acid molecule encoding the genome of the polyoma virus HPyV7, comprising a nucleotide sequence of any one of SEQ ID NOs: 7 to 12, or the complement thereof.

[0026] In another embodiment, the present invention provides a nucleic acid molecule of any of SEQ ID NOs: 1 to 12, wherein the molecule is DNA, or RNA.

[0027] In an embodiment, the present invention provides an isolated nucleic acid molecule that specifically hybridizes to the nucleotide sequence set forth in any of the SEQ

ID NOs: 1-12, or to the complement thereof.

[0028] In a further embodiment, the present invention provides an isolated host cell comprising the isolated nucleic acid molecule of any of SEQ ID NOs: 1 to 12. The host cell can be a mammalian cell. In an embodiment, the host cell is a skin cell.

[0029] In another embodiment, the present invention also provides an isolated nucleic acid molecule that specifically hybridizes to the nucleotide sequence set forth in any of the SEQ ID NOS: 1-12 or to the complement thereof. The nucleic acid molecule can be an oligonucleotide primer of at least about 10 nucleotides in length. For example, the primer can comprise between about 10 nucleotides to about 30 nucleotides in length.

[0030] In addition, in an embodiment, the present invention provides at least one pair of oligonucleotide primers for use with PCR, wherein the first primer is an isolated nucleic acid molecule comprising between about 10 nucleotides to about 30 nucleotides in length that specifically hybridizes to the nucleotide sequence set forth in any of the SEQ ID NOs: 1-6; and the second primer is an isolated nucleic acid molecule comprising between about 10 nucleotides to about 30 nucleotides in length that specifically hybridizes to the complement of the nucleotide sequence set forth in any of the SEQ ID NOs: 1-6. The primer pairs of the present invention can be included in a kit for testing a sample for the presence of HPyV6, in, for example, a sterile solution.

[0031] In another embodiment, the present invention provides at least one pair of oligonucleotide primers for use with PCR, wherein the first primer is an isolated nucleic acid molecule comprising between about 10 nucleotides to about 30 nucleotides in length that specifically hybridizes to the nucleotide sequence set forth in any of the SEQ ID NOs: 7-12; and the second primer is an isolated nucleic acid molecule comprising between about 10 nucleotides to about 30 nucleotides in length that specifically hybridizes to the complement of the nucleotide sequence set forth in any of the SEQ ID NOs: 7-12. The primer pairs of the present invention can be included in a kit for testing a sample for the presence of HPyV7, in, for example, a sterile solution.

[0032] In another embodiment, the present invention also provides methods of testing a sample for the presence of HPyV6 and/or HPyV7, comprising: (i) providing a test sample; (ii) adding first and second oligonucleotide PCR primers (as described above) to the sample; and (iii) testing the sample for the presence of a PCR product, wherein detection of a PCR product indicates that HPyV6 and/or HPyV7 is present in the sample.

[0033] In another embodiment, the present invention provides an isolated polypeptide encoded by the nucleic acid or a fragment thereof, according to any of SEQ ID NOs: 1 to 12. The present invention also provides, in an embodiment, an antibody, or antigen-binding fragment thereof, which specifically binds an isolated polypeptide or a fragment thereof, encoded by nucleic acid according to any of SEQ ID NOs: 1 to 12.

[0034] In an embodiment, the present invention provides a method of testing a sample from a subject for the presence of antibodies to HPyV6 and/or HPyV7 VP1 protein or a fragment thereof, the method comprising: (i) providing a test sample from a subject having a first antibody or antigen-binding fragment thereof specific to HPyV6 and/or HPyV7 VP1 protein or a fragment thereof; (ii) contacting the test sample with an HPyV6 and/or HPyV7 VP1 protein, or fragment thereof, under conditions in which the first antibody, binds the HPyV6 and/or HPyV7 VP1 protein or a fragment thereof, if present, to form an antibody- antigen complex; (iii) washing the sample to remove any unbound antibody; (iv) contacting the sample with a second antibody, wherein the second antibody binds the first antibody, if present, and wherein the second antibody is labeled with a detectable label; (v) washing the sample to remove any unbound antibody, and (iv) testing for the presence of the detectable label, wherein the amount of the detectable label indicates the quantity of antibodies specific to HPyV6 and/or HPyV7 VP1 protein in the sample of the subject.

[0035] In accordance with the present invention, the complete genomic DNA sequences of six isolates of HPyV6, identified as SEQ ID NOs: 1-6 are provided. SEQ ID NOs: 1-2, and 5-6 are from different subjects. SEQ ID NOs: 3 and 4 are from the same subject, with SEQ ID NO: 4 collected after an interval of three months.

[0036] In accordance with the present invention, the complete genomic DNA sequences of six isolates of HPyV7, identified as SEQ ID NOs: 7-12 are provided. SEQ ID NOs: 7 and 8 are from one subject, and SEQ ID NOs: 9 and 10 are also from one subject. SEQ ID NOs: 1 1 and 12 are from different subjects. The DNA sequences of SEQ ID NOs: 8 and 10 were collected from the same subjects, respectively, after an interval of three months.

[0037] The genomes of HPyV6 and HPyV7 are shed from the skin as complete virions. The data show that patients infected with either of these polyomaviruses continue to shed them from their skin without any significant changes to the viral DNA sequences for months.

[0038] In addition, the present invention also provides an isolated or purified polypeptide comprising a translated portion of any of HPyV6 or HPyV7 nucleic acids provided herein. The term "polypeptide" as used herein includes oligopeptides and refers to a single chain of amino acids connected by one or more peptide bonds.

[0039] The protein of the invention can be a recombinant antibody comprising at least one of the inventive polypeptides described herein. As used herein, "recombinant antibody" refers to a recombinant (e.g., genetically engineered) protein comprising at least one of the polypeptides of the invention and a polypeptide chain of an antibody, or a portion thereof. The polypeptide of an antibody, or portion thereof, can be a heavy chain, a light chain, a variable or constant region of a heavy or light chain, a single chain variable fragment (scFv), or an Fc, Fab, or F(ab)₂' fragment of an antibody, etc. The polypeptide chain of an antibody, or portion thereof, can exist as a separate polypeptide of the recombinant antibody.

Alternatively, the polypeptide chain of an antibody, or portion thereof, can exist as a polypeptide, which is expressed in frame (in tandem) with the polypeptide of the invention. The polypeptide of an antibody, or portion thereof, can be a polypeptide of any antibody or any antibody fragment, including any of the antibodies and antibody fragments described herein. [0040] By "nucleic acid" as used herein includes "polynucleotide," "oligonucleotide," and "nucleic acid molecule," and generally means a polymer of DNA or RNA, which can be single-stranded or double-stranded, synthesized or obtained (e.g., isolated and/or purified) from natural sources, which can contain natural, non-natural or altered nucleotides, and which can contain a natural, non-natural or altered internucleotide linkage, such as a phosphoroamidate linkage or a phosphorothioate linkage, instead of the phosphodiester found between the nucleotides of an unmodified oligonucleotide. It is generally preferred that the nucleic acid does not comprise any insertions, deletions, inversions, and/or substitutions. However, it may be suitable in some instances, as discussed herein, for the nucleic acid to comprise one or more insertions, deletions, inversions, and/or substitutions.

[0041 ] In an embodiment, the nucleic acids of the invention are recombinant. As used herein, the term "recombinant" refers to (i) molecules that are constructed outside living cells by joining natural or synthetic nucleic acid segments to nucleic acid molecules that can replicate in a living cell, or (ii) molecules that result from the replication of those described in (i) above. For purposes herein, the replication can be in vitro replication or in vivo replication.

[0042] The nucleic acids can be constructed based on chemical synthesis and/or enzymatic ligation reactions using procedures known in the art. See, for example, Sambrook et al. (eds.), Molecular Cloning, A Laboratory Manual, 3^,d Edition, Cold Spring Harbor Laboratory Press, New York (2001) and Ausubel et al., Current Protocols in Molecular Biology, Greene Publishing Associates and John Wiley & Sons, NY (1994). For example, a nucleic acid can be chemically synthesized using naturally occurring nucleotides or variously modified nucleotides designed to increase the biological stability of the molecules or to increase the physical stability of the duplex formed upon hybridization (e.g.,

phosphorothioate derivatives and acridine substituted nucleotides). Examples of modified nucleotides that can be used to generate the nucleic acids include, but are not limited to, 5- fiuorouracil, 5-bromouracil, 5-chlorouracil, 5-iodouracil, hypoxanfhine, xanthine, 4- acetylcytosine, 5-(carboxyhydroxymethyl) uracil, 5-carboxymethylaminomethyl-2- thiouridine, 5-carboxymethylaminomethyluracil, dihydrouracil, beta-D-galactosylqueosine, inosine, N⁶-isopentenyladenine, 1 -methylguanine, 1-methylinosine, 2, 2-di methyl guanine, 2- methyladenine, 2-methylguanine, 3-methylcytosine, 5-methylcytosine, N⁶-substituted adenine, 7-methylguanine, 5 -methyl aminomethyluracil, 5-methoxyaminomethyl-2-thiouracil, beta-D-mannosylqueosine, 5'-methoxycarboxymethyluracil, 5-methoxyuracil, 2-methylthio- N⁶-isopentenyladenine, uracil-5-oxyacetic acid (v), wybutoxosine, pseudouracil, queosine, 2- thiocytosine, 5-methyl-2-thiouracil, 2-thiouracil, 4-thiouracil, 5-methyluracil, uracil-5- oxyacetic acid methylester, 3-(3-amino-3-N-2-carboxypropyl) uracil, and 2,6-diaminopurine. Alternatively, one or more of the nucleic acids of the invention can be purchased from companies, such as Macromolecular Resources (Fort Collins, CO) and Synthegen (Houston, TX).

[0043] The nucleic acid can comprise any nucleotide sequence that encodes any of the HPyV6 or HPyV7 polypeptides, or proteins, or fragments or functional portions or functional variants thereof. For example, the nucleic acid can comprise a nucleotide sequence comprising any of SEQ ID NOs: 1-6 or 7-12, or alternatively can comprise a nucleotide sequence that is degenerate to any of SEQ ID NOs: 1-6 or 7-12.

[0044] The invention also provides an isolated or purified nucleic acid comprising a nucleotide sequence which is complementary to the nucleotide sequence of any of the nucleic acids described herein or a nucleotide sequence which hybridizes under stringent conditions to the nucleotide sequence of any of the nucleic acids described herein. In an embodiment, the present invention provides a nucleic acid molecule which is complementary to the full length nucleotide sequence of any of SEQ ID NOs: 1-6 or 7-12.

[0045] As defined herein, a functional portion or functional variant of any of the HPyV6 or HPyV7 polypeptides, or proteins, includes, for example, any of the VP1, VP2, small t antigen, or large T antigen proteins, and fragments thereof.

[0046] In an embodiment, the isolated nucleic acid molecule comprises a nucleotide sequence which is at least 50%, e.g., 60%, 70%, 80% or 90% or more identical to, e.g., having contiguous nucleic acid sequence identity to, one of SEQ ID NOs: 1-6 or 7-12, or the complement thereof.

[0047] The nucleotide sequence which hybridizes under stringent conditions preferably hybridizes under high stringency conditions. By "high stringency conditions" is meant that the nucleotide sequence specifically hybridizes to a target sequence (the nucleotide sequence of any of the nucleic acids described herein) in an amount that is detectably stronger than non-specific hybridization. High stringency conditions include conditions which would distinguish a polynucleotide with an exact complementary sequence, or one containing only a few scattered mismatches from a random sequence that happened to have a few small regions (e.g., 3-10 bases) that matched the nucleotide sequence. Such small regions of complementarity are more easily melted than a full-length complement of 14-17 or more bases, and high stringency hybridization makes them easily distinguishable. Relatively high stringency conditions would include, for example, low salt and/or high temperature conditions, such as provided by about 0.02-0.1 M NaCl or the equivalent, at temperatures of about 50-70 °C.

[0048] The nucleic acids of the invention can be incorporated into a recombinant expression vector. In this regard, the invention provides recombinant expression vectors comprising any of the nucleic acids of the invention. For purposes herein, the term

"recombinant expression vector" means a genetically-modified oligonucleotide or polynucleotide construct that permits the expression of an mRNA, protein, polypeptide, or peptide by a host cell, when the construct comprises a nucleotide sequence encoding the mRNA, protein, polypeptide, or peptide, and the vector is contacted with the cell under conditions sufficient to have the mRNA, protein, polypeptide, or peptide expressed within the cell. The vectors of the invention are not naturally-occurring as a whole. However, parts of the vectors can be naturally-occurring. The inventive recombinant expression vectors can comprise any type of nucleotides, including, but not limited to DNA and RNA, which can be single-stranded or double-stranded, synthesized or obtained in part from natural sources, and which can contain natural, non-natural or altered nucleotides. The recombinant expression vectors can comprise naturally-occurring, non-naturally-occurring intemucleotide linkages, or both types of linkages. Preferably, the non-naturally occurring or altered nucleotides or intemucleotide linkages do not hinder the transcription or replication of the vector.

[0049] The recombinant expression vector of the invention can be any suitable recombinant expression vector, and can be used to transform or transfect any suitable host. Suitable vectors include those designed for propagation and expansion or for expression or both, such as plasmids and viruses. The vector can be selected from the group consisting of the pUC series (Fermentas Life Sciences), the pBluescript series (Stratagene, La Jolla, CA), the pET series (Novagen, Madison, WI), the pGEX series (Pharmacia Biotech, Uppsala, Sweden), and the pEX series (Clontech, Mountain View, CA). Bacteriophage vectors, such as λΰΤΙΟ, GTl 1 , ZapII (Stratagene), λΕΜΒί4, and λΝΜΙ 149, also can be used.

Examples of plant expression vectors include pBIOl, pBI101.2, pBI101.3, pBI121 and pBIN19 (Clontech). Examples of animal expression vectors include pEUK-Cl, pMAM and pMAMneo (Clontech). Preferably, the recombinant expression vector is a viral vector, e.g., a retroviral vector.

[0050] The recombinant expression vectors of the invention can be prepared using standard recombinant DNA techniques described in, for example, Sambrook et al., supra, and Ausubel et al., supra. Constructs of expression vectors, which are circular or linear, can be prepared to contain a replication system functional in a prokaryotic or eukaryotic host cell. Replication systems can be derived, e.g., from ColEl, 2 μ plasmid, λ, SV40, bovine papilloma virus, and the like.

[0051] Desirably, the recombinant expression vector comprises regulatory sequences, such as transcription and translation initiation and termination codons, which are specific to the type of host (e.g., bacterium, fungus, plant, or animal) into which the vector is to be introduced, as appropriate and taking into consideration whether the vector is DNA or RNA based.

[0052] The recombinant expression vector can include one or more marker genes, which allow for selection of transformed or transfected hosts. Marker genes include biocide resistance, e.g., resistance to antibiotics, heavy metals, etc., complementation in an auxotrophic host to provide prototrophy, and the like. Suitable marker genes for the inventive expression vectors include, for instance, neomycin/G418 resistance genes, hygromycin resistance genes, histidinol resistance genes, tetracycline resistance genes, and ampicillin resistance genes.

[0053] The recombinant expression vector can comprise a native or nonnative promoter operably linked to the nucleotide sequence encoding the HPyV6 or HPyV7 viral

polypeptides, or proteins (including functional portions and functional variants thereof), such as small t antigen, large T antigen VP1 or VP2 and the like, or to the nucleotide sequence which is complementary to, or which hybridizes to the nucleotide sequence encoding the HPyV6 or HPyV7 viral polypeptides, or proteins discussed above.

[0054] The selection of promoters, e.g., strong, weak, inducible, tissue-specific and developmental-specific, is within the ordinary skill of the artisan. Similarly, the combining of a nucleotide sequence with a promoter is also within the skill of the artisan. The promoter can be a non-viral promoter or a viral promoter, e.g., a cytomegalovirus (CMV) promoter, an SV40 promoter, an RSV promoter, and a promoter found in the long-terminal repeat of the murine stem cell virus. [0055] The invention further provides a host cell comprising any of the recombinant expression vectors described herein. As used herein, the term "host cell" refers to any type of cell that can contain the inventive recombinant expression vector. The host cell can be a eukaryotic cell, e.g., plant, animal, fungi, or algae, or can be a prokaryotic cell, e.g., bacteria or protozoa. The host cell can be a cultured cell or a primary cell, i.e., isolated directly from an organism, e.g., a human. The host cell can be an adherent cell or a suspended cell, i.e., a cell that grows in suspension. Suitable host cells are known in the art and include, for instance, DH5a E. coli cells, Chinese hamster ovarian cells, monkey VERO cells, COS cells, HEK293 cells, and the like. For purposes of amplifying or replicating the recombinant expression vector, the host cell is preferably a prokaryotic cell, e.g., a DH5a cell. For purposes of producing a recombinant HPyV6 and/or HPyV7 virus, polypeptide, or protein, the host cell is preferably a mammalian cell. Most preferably, the host cell is a human cell. The host cell can be of any cell type, can originate from any type of tissue, and can be of any developmental stage. The host cell can be an epithelial cell, such as A549 cells, or epidermal cells, or skin cells, for example.

[0056] Also provided by the invention is a population of cells comprising at least one host cell described herein. The population of cells can be a heterogeneous population comprising the host cell comprising any of the recombinant expression vectors described, in addition to at least one other cell, e.g., a host cell (e.g., a skin cell), which does not comprise any of the recombinant expression vectors, or a cell other than a skin cell, e.g., a macrophage, a neutrophil, an erythrocyte, a hepatocyte, an endothelial cell, an epithelial cell, a muscle cell, a brain cell, etc. Alternatively, the population of cells can be a substantially homogeneous population, in which the population comprises mainly of host cells (e.g., consisting essentially of) comprising the recombinant expression vector. The population also can be a clonal population of cells, in which all cells of the population are clones of a single host cell comprising a recombinant expression vector, such that all cells of the population comprise the recombinant expression vector. In one embodiment of the invention, the population of cells is a clonal population comprising host cells comprising a recombinant expression vector as described herein.

[0057] The present invention provides monoclonal antibodies directed against the any of the HPyV6 or HPyV7 polypeptides, or proteins, including, for example, the VPl, VP2, small t antigen, or large T antigen proteins, and fragments thereof. In an embodiment, the present invention provides monoclonal antibodies directed against HPyV6, HPyV7 small t antigen.

[0058] The term "isolated and purified" as used herein means a protein that is essentially free of association with other proteins or polypeptides, e.g., as a naturally occurring protein that has been separated from cellular and other contaminants by the use of antibodies or other methods or as a purification product of a recombinant host cell culture.

[0059] The term "biologically active" as used herein means an enzyme or protein having structural, regulatory, or biochemical functions of a naturally occurring molecule.

[0060] In particular embodiments, a "functional variant" of an amino acid sequence as used herein, refers to no more than one, two, three, four, five, six, seven, eight, nine or ten amino acid substitutions in the sequence of interest. The functional variant retains at least one biological activity normally associated with that amino acid sequence. In particular embodiments, the functional variant retains at least about 40%, 50%, 60%, 75%, 85%, 90%, 95% or more biological activity normally associated with the full-length amino acid sequence. In other embodiments, a functional variant is an amino acid sequence that is at least about 60%, 70%, 80%, 90%, 95% 97% or 98% similar to the polypeptide sequence disclosed herein (or fragments thereof).

[0061] As defined herein, functional variants of the antibodies of the present invention are capable of binding to any of the HPyV6 or HPyV7 polypeptides, or proteins, including, for example, the VP1 , VP2, small t antigen, or large T antigen proteins, and fragments thereof. Functional variants include, but are not limited to, derivatives that are substantially similar in primary structural sequence, but which contain e.g., in vitro or in vivo

modifications, chemical and/or biochemical, that are not found in the parent binding molecule. Such modifications include inter alia acetylation, acylation, covalent attachment of a nucleotide or nucleotide derivative, covalent attachment of a lipid or lipid derivative, cross-linking, disulfide bond formation, glycosylation, hydroxylation, methylation, oxidation, pegylation, proteolytic processing, phosphorylation, and the like.

[0062] Another embodiment of the present invention relates to monoclonal antibodies, and antigen-binding fragments or portions thereof, which recognize the common portion of the HPyV6 and HPyV7 small t and large T antigen. Thus, the present invention encompasses the specific monoclonal antibodies "ltl" and "2t2" as well as their antigen-binding fragments, having specificity for the above-described antigen. [0063] Nonlimiting examples of antibody fragments or antigen-binding fragments that bind to epitopes on the antigen include the following: Fab fragments, F(ab)2 fragments, Fab' fragments, fragments produced by F(ab) expression libraries, F(ab')₂ fragments, Fd fragments, Fd' fragments and Fv fragments. The antibodies may be human, or from animals other than humans, preferably mammals, such as rat, mouse, guinea pig, rabbit, goat, sheep, and pig. Preferred are mouse monoclonal antibodies and antigen-binding fragments or portions thereof. In addition, chimeric antibodies and hybrid antibodies are embraced by the present invention.

[0064] In accordance with the present invention, the monoclonal antibodies and antigen- binding fragments thereof may be characterized as those which are: 1) produced from a hybridoma cell line, for example, hybridoma cell line "ltl" and "2t2"; 2) antibodies that are capable of binding to the same antigenic determinant as does the monoclonal antibody produced by the hybridoma cell lines of (1); 3) antigen-binding fragments of the monoclonal antibody produced by the hybridoma cell lines; or 4) antigen-binding fragments of a m onoclonal antibody capable of binding to the same antigenic determinant as does the monoclonal antibody produced by the hybridoma cell lines.

[0065] In an embodiment, the monoclonal antibody of the present invention can be obtained by culturing a hybridoma producing the antibody of the present invention in a culture medium, for example, a RPMI1640 medium that contains fetal bovine serum.

Alternatively, it can be obtained by preparing a gene comprising a heavy chain or a light chain, in which a DNA encoding a constant region of heavy chain or light chain is Iigated to a DNA encoding each variable region by means of a PCR method or a chemical synthesis; inserting the obtained gene into a conventionally-used expression vector (e.g., pcDNA3.1 (Invitrogen) capable of expressing the gene; expressing the gene in a host cell such as a CHO cell (Chinese hamster ovary cell) or Escherichia coli to produce the antibody; and purifying the obtained antibody from the culture medium using a Protein A/G column or the like.

[0066] Furthermore, the monoclonal antibody of the present invention may be obtained by: preparing a hybridoma from a mammal immunized with a recombinant fusion protein comprising any of the HPyV6 and HPyV7 proteins, or fragments thereof, including for example, small t antigen, large T antigen, VP1 and VP2, and one or more other proteins; expressing the fusion protein in a bacterial culture; purifying the fusion protein from bacterial lysates; mixing the purified fusion protein comprising any of the HPyV6 and HPyV7 proteins, or fragments thereof, with adjuvant and inoculating the mammal with the purified fusion protein. The inoculated mammals are given a booster inoculation after three weeks and then the splenocytes and lymphocytes are collected three days after the booster.

Lymphocytes and splenocytes were fused with murine B cell hybridoma cells, such as SP2/mIL6 cells (ATCC), and propagated using HFCS supplement (Roche) according to manufacturer's instructions. Hybridomas are then screened for reactivity with the various species of recombinant HPyV6 and HPyV7 proteins, or fragments thereof.

[0067] Included in the scope of the present invention are conjugates, e.g., bioconjugates, comprising any of the inventive monoclonal antibodies (including any of the functional portions or variants thereof), host cells, populations of host cells, or antibodies, or antigen binding portions thereof. Conjugates, as well as methods of synthesizing conjugates in general, are known in the art. See, for instance, Hudecz, F., Methods Mol. Biol., 298:209-223 (2005) and Kirin et al. norg. Chem., 44(15):5405-5415 (2005).

[0068] The antibody can be any type of immunoglobulin that is known in the art. For instance, the antibody can be of any isotype, e.g., IgA, IgD, IgE, IgG, IgM, etc. The antibody can be monoclonal or polyclonal. The antibody can be a naturally-occurring antibody, e.g., an antibody isolated and/or purified from a mammal, e.g., mouse, rabbit, goat, horse, chicken, hamster, human, etc. Alternatively, the antibody can be a genetically-engineered antibody, e.g., a humanized antibody or a chimeric antibody. The antibody can be in monomeric or polymeric form. Also, the antibody can have any level of affinity or avidity for any of the HPyV6 or HPyV7 polypeptides, or proteins, including, for example, the VP1 , VP2, small t antigen, or large T antigen proteins, and fragments thereof.

[0069] Methods of testing antibodies for the ability to bind any of the HPyV6 and HPyV7 proteins, or fragments thereof are known in the art and include any antibody-antigen binding assay, such as, for example, radioimmunoassay (RIA), ELISA, Western blot,

immunoprecipitation, and competitive inhibition assays (see, e.g., Janeway et al., infra, and U.S. Patent Application Publication No. 2002/0197266 Al).

[0070] Suitable methods of making antibodies are known in the art. For instance, standard hybridoma methods are described in, e.g., Kohler and Milstein, Eur. J. Immunol, 5:51 1-519 (1976), Harlow and Lane (eds.), Antibodies: A Laboratory Manual, CSH Press (1988), and C.A. Janeway et al. (eds.), Immunobiology, 5^th Ed., Garland Publishing, New York, NY (2001)). Alternatively, other methods, such as EBV-hybridoma methods (Haskard and Archer, J. Immunol. Methods, 74(2):361-67 (1984), and Roder et al., Methods Enzymol., 121 : 140-67 (1986)), and bacteriophage vector expression systems (see, e.g., Huse et al., Science, 246: 1275-81 (1989)) are known in the art. Further, methods of producing antibodies in non-human animals are described in, e.g., U.S. Patents 5,545,806, 5,569,825, and

5,714,352, and U.S. Patent Application Publication No. 2002/0197266 Al).

[0071] Antibodies can be produced by transgenic mice that are transgenic for specific heavy and light chain immunoglobulin genes. Such methods are known in the art and described in, for example U.S. Patents 5,545,806 and 5,569,825, and Janeway et al., supra.

[0072] Methods for generating humanized antibodies are well known in the art and are described in detail in, for example, Janeway et al., supra, U.S. Patents 5,225,539, 5,585,089 and 5,693,761. Humanized antibodies can also be generated using the antibody resurfacing technology described in U.S. Patent 5,639,641 and Pedersen et al., J. Mol. Biol, 235:959-973 (1994).

[0073] A single-chain variable region fragment (sFv) antibody fragment, which consists of a truncated Fab fragment comprising the variable (V) domain of an antibody heavy chain linked to a V domain of a light antibody chain via a synthetic peptide, can be generated using routine recombinant DNA technology techniques (see, e.g., Janeway et al., supra). Similarly, disulfide-stabilized variable region fragments (dsFv) can be prepared by recombinant DNA technology (see, e.g., Reiter et al, Protein Engineering, 7:697-704 (1994)). Antibody fragments of the invention, however, are not limited to these exemplary types of antibody fragments.

[0074] In another embodiment, the antibody, or antigen binding fragment thereof, is modified to comprise a detectable label, such as, for instance, a radioisotope, a fluorophore (e.g., fluorescein isothiocyanate (FITC), phycoerythrin (PE)), an enzyme (e.g., alkaline phosphatase, horseradish peroxidase), and element particles (e.g., gold or magnetic particles).

[0075] Once an antibody molecule of the invention has been produced by an animal, chemically synthesized, or recombinantly expressed, it may be purified by any method known in the art for purification of an immunoglobulin molecule, for example, by

chromatography (e.g., ion exchange, affinity, protein A/G immunoprecipitation

chromatography, and sizing column chromatography), centrifugation, differential solubility, or by any other standard technique for the purification of proteins. In addition, the antibodies of the present invention or fragments thereof can be fused to heterologous polypeptide sequences described herein or otherwise known in the art, to facilitate purification.

[0076] The antibodies of the present invention can be employed to prepare antigen- antibody affinity columns, which may be used for the purification of the antigen. For example, gel supports or beads can be activated with various chemical compounds, e.g., cyanogen bromide, N-hydroxysuccinimide esters, and antibodies can be bound thereto. More particularly, and by way of example, antibodies can be added to Affigel-10 (BioRad,

Hercules, CA), a gel support which is activated with N-hydroxysuccinimide esters, such that the antibodies form covalent linkages with the agarose gel bead support. The antibodies are then coupled to the gel via amide bonds with a spacer arm. The remaining activated esters are then quenched with ethanolamine HC1, 1 M, pH 8. The column is washed with water, followed by 0.23 M glycine HC1, pH 2.6, to remove any non-conjugated antibody or extraneous protein. The column is then equilibrated in phosphate buffered saline (PBS), pH 7.3, with appropriate detergent, and the sample materials, i.e., cell culture supematants or cell extracts, for example, containing the cancer-specific antigens (e.g., prepared using

appropriate membrane solubilizing surfactants) are slowly passed over the column. The column is washed with PBS/surfactant until the optical density falls to background. The protein is then eluted from the column with 0.23 M glycine-HCl, pH 2.6/surfactant. The purified antigens are then dialyzed against PBS/surfactant.

[0077] Methods of detecting the presence of HPyV6 and/or HPyV7 in a host and methods of treating or preventing infection of a host with HPyV6 and/or HPyV7 are further provided by the present invention. The inventive method of detecting the presence of HPyV6 and/or HPyV7 in a host comprises (i) contacting a sample comprising cells of the host with any of the inventive antibodies, or antigen-binding fragments thereof, described herein, thereby forming a complex, and (ii) detecting the complex, wherein detection of the complex is indicative of the presence of HPyV6 and/or HPyV7 infection in the host.

[0078] The present invention further provides a method for localizing cells infected with HPyV6 and/or HPyV7 in a patient, especially cells expressing the small t antigen,

comprising: (a) administering to the patient a detectably-labeled monoclonal antibody of the invention, or binding fragment thereof; (b) allowing the detectably-labeled (e.g., radiolabeled; flui chrome labeled, or enzyme labeled, for example, via ELISA) monoclonal antibody, or binding fragment thereof, to bind to the infected cells within the patient; and (c) detennining the location of the labeled monoclonal antibody or binding fragment thereof, within the patient.

[0079J In a further embodiment, the antibody of the invention may be labeled with a detectable moiety, such as a fluorophore, a chiOmophore, a radionuclide, a chemiluminescent agent, a bioluminescent agent and an enzyme.

[0080] In an embodiment, antibodies of the present invention are labeled with such reagents using protocols and techniques known and practiced in the art. See, for example, Wenzel and Meares, Radioimmuno imaging and Radioimmunotherapy, Elsevier, New York, (1983); Colcer et al., Meth. Enzymol., 121 : 802-816 (1986); and Monoclonal Antibodies for Cancer Detection and Therapy, Baldwin et al., (eds) Academic Press, 303-316 (1985), for techniques relating to the radiolabeling of antibodies.

[0081] In an embodiment, the antibodies, or antigen-binding fragments thereof, are delivered parenterally, such as by intravenous, subcutaneous, or intraperitoneal

administration, e.g., injection. Suitable buffers, earners, and other components known in the art can be used in formulating a composition comprising the antibody or fragments for suitable shelf-life and compatibility for the administration. These substances may include ancillary agents such as buffering agents and protein stabilizing agents (e.g.,

polysaccharides).

[0082] More specifically, therapeutic formulations of the antibodies, or antigen-binding fragments thereof, are prepared for storage by mixing the antibodies or their antigen-binding fragments, having the desired degree of purity, with optional physiologically acceptable carriers, excipients, or stabilizers {Remington's Pharmaceutical Sciences, 21st edition, (Ed.) Lippincott, Williams and Wilkins Publishers, Philadelphia, Pa., (2005)), in lyophilized form or in the form of aqueous solutions. Acceptable earners, excipients or stabilizers are nontoxic to recipients at the dosages and concentrations employed, and include buffers such as phosphate, citrate, and other organic acids; antioxidants including ascorbic acid; low molecular weight (e.g., about 10-15 amino acid residues or less) polypeptides; proteins, such as serum albumin, gelatin, or immunoglobulins; hydrophilic polymers such as

polyvinylpyrrolidone; amino acids such as glycine, glutamine, asparagine, arginine or lysine; monosaccharides, disaccharides, and other carbohydrates including glucose, mannose, or dextrins; chelating agents such as EDTA; sugar alcohols such as mannitol or sorbitol; salt- forming counterions such as sodium; and/or nonionic surfactants such as TWEEN™ (polysorbates), PLURONICS™ (block copolymers of ethylene oxide (EO) and propylene oxide (PO)) or polyethylene glycol (PEG). The antibodies, or antigen-binding fragments thereof, also may be entrapped in microcapsules prepared, for example, by coacervation techniques or by interfacial polymerization (for example, hydroxymethyl cellulose or gelatin- microcapsules and poly-[methylmethacylate] microcapsules, respectively), in colloidal drug delivery systems (for example, liposomes, albumin microspheres, microemulsions, nano- particles and nanocapsules), or in macroemulsions. Such techniques are disclosed in

Remingto 's Pharmaceutical Sciences, supra.

[0083] Antibodies or their antigen-binding fragments to be used for in vivo administration must be sterile. This is readily accomplished by filtration through sterile filtration

membranes, prior to, or following lyophilization and reconstitution. The antibodies, or antigen-binding fragments thereof, ordinarily will be stored in lyophilized form or in solution.

[0084] Therapeutic antibody compositions generally are placed into a container having a sterile access port, for example, an intravenous solution bag or vial having a stopper pierceable by a hypodermic injection needle. The route of administration of the antibodies, or antigen-binding fragments thereof, in accordance with the present invention, is in accord with known methods, e.g., injection or infusion by intravenous, intraperitoneal,

intramuscular, intrarterial, subcutaneous, intralesional routes, by aerosol or intranasal routes, or by sustained release systems as noted below. The antibodies, or antigen-binding fragments thereof, are administered continuously by infusion or by bolus injection. Suitable examples of sustained-release preparations include semipermeable matrices of solid hydrophobic polymers containing the protein, which matrices are in the form of shaped articles, e.g., films, or microcapsules. Examples of sustained-release matrices include polyesters, hydrogels (e.g., poly(2-hydi xyethyl-methacrylate) as described by Langer et al., J. Biomed. Mater. Res., 15 : 167-277 (1981) and Langer, Chem. Tech., 12:98-105 (1982)), or poly(vinylalcohol), polylactides (U.S. Pat. No. 3,773,919), copolymers of L-glutamic acid and gamma ethyl-L- glutamate (Sidman et al., Biopolymers, 22:547-556 (1983)), non-degradable ethylene- vinyl acetate (Langer et al., supra), degradable lactic acid-glycolic acid copolymers such as the LUPRON DEPOT™ (injectable microspheres composed of lactic acid-glycolic acid copolymer and leuprolide acetate), and poly-D-(-)-3-hydroxybutyric acid (EP 133,988).

[0085] An effective amount of antibody to be employed therapeutically will depend, for example, upon the therapeutic and treatment objectives, the route of administration, the age, condition, and body mass of the patient undergoing treatment or therapy, and auxiliary or adjuvant therapies being provided to the patient. Accordingly, it will be necessary and routine for the practitioner to titer the dosage and modify the route of administration, as required, to obtain the optimal therapeutic effect. A typical daily dosage might range from about 1 mg/kg to up to about 100 mg/kg or more, preferably from about 0.1 to about 10 mg/kg/day depending on the above-mentioned factors. Typically, the clinician will administer antibody until a dosage is reached that achieves the desired effect. The progress of this therapy is easily monitored by conventional assays.

[0086] Various adjuvants may be used to increase the immunological response to the antigen and to elicit specific antibodies according to the present invention. Depending on the host species to be immunized, adjuvants may include, but are not limited to, Freund's (complete and incomplete), mineral gels, such as aluminum hydroxide, surface active agents, such as lysolecithin, pluronic polyols, polyanions, peptides, oil emulsions, keyhole limpet hemocyanin, dinitrophenol, and potentially useful human adjuvants such as BCG (bacille Calmette-Guerin) and Corynebacterium parvum.

[0087] The antibodies of the present invention are also useful for in vitro diagnostic applications for the detection of HPyV6 and/or HPyV7 infected cells that possess the antigen for which the antibodies are specific. As detailed above, in vitro diagnostic methods include immunohisto logical or immunohistochemical detection of HPyV6 and/or HPyV7 infected cells (e.g., on human tissue, or on cells dissociated from excised specimens), or serological detection of HPyV6 and/or HPyV7 associated antigens (e.g., in blood samples or other biological fluids). Immunohistochemical techniques involve staining a biological specimen, such as a tissue specimen, with one or more of the antibodies of the invention and then detecting the presence on the specimen of antibody-antigen complexes comprising antibodies bound to the cognate antigen. The formation of such antibody-antigen complexes with the specimen indicates the presence of HPyV6 and/or HPyV7 infection in the tissue.

[0088] Detection of the antibody on the specimen can be accomplished using techniques known in the art such as immunoenzymatic techniques, e.g., immunoperoxidase staining technique, or the avidin-biotin technique, or immunofluorescence techniques (see, e.g., Ciocca et al., Meth. Enzymol, 121 :562-79 (1986), and Introduction to Immunology, (3^,d Ed), 1 13-117, Macmillan Publishing Company (1990)). Serologic diagnostic techniques involve the detection and quantification of tumor-associated antigens that have been secreted or "shed" into the serum or other biological fluids of patients thought to be suffering from cancer, as mentioned above. Such antigens can be detected in the body fluids using techniques known in the art, such as radioimmunoassays (RIA) or enzyme-linked

immunoabsorbant assays (ELISA), wherein antibody reactive with the shed antigen is used to detect the presence of the antigen in a fluid sample (See, e.g., Uotila et al., J. Immunol.

Methods, 42: 1 1 (1981) and Fayed et al., Disease Markers, 14: 155-160 (1998)).

[0089] In an embodiment, the present invention provides a method of detection of circulating serum antibodies specific for HPyV6 or HPyV7 VP1 proteins or fragments thereof in a biological sample from a subject using an ELISA assay comprising: (a) contacting the at least one biological sample having at least one antibody or antigen-binding portion thereof, specific for HPyV6 or HPyV7 VP1 protein, or at least a fragment of the protein, with an HPyV6 or HPyV7 VP1 protein or a fragment thereof, and (b) detecting the formation of an antigen-antibody complex between the HPyV6 or HPyV7 protein or a fragment thereof, and an HPyV6 or HPyV7 VP1 specific antibody or antigen-binding fragment thereof, present in the biological sample.

[0090] The antibody or antibodies which is/are used in the context of the present invention can, themselves, be linked to a detectable label. Such a detectable label allows for the presence of, or the amount of the primary immune complexes to be determined.

Alternatively, the first added component that becomes bound within the primary immune complexes can be detected by means of a second binding ligand that has binding affinity for the first antibody. In these cases, the second binding ligand is itself, often an antibody, which can be termed a "secondary" antibody. The primary immune complexes are contacted with the labeled, secondary binding ligand, or antibody, for a period of time sufficient to allow the formation of secondary immune complexes. The secondary immune complexes are then washed to remove any non-specifically bound labeled secondary antibodies or ligands, and the remaining label in the secondary immune complexes is then detected.

[0091] In an embodiment a method of detecting the presence and extent of infection of HPyV6 and/or HPyV7 in a patient is provided, comprising: determining the level of the antigen in a sample of bodily fluid or a tissue section from the patient and correlating the quantity of the antigen with the presence and extent of the infection in the patient. In one embodiment, the antigen is detected by (1) adding monoclonal antibody "ltl" and/or "2t2" to the sample or tissue section; (2) adding goat anti-mouse IgG antibody conjugated with peroxidase; (3) fixing with diaminobenzidene and peroxide, and (4) examining the sample or section, wherein reddish brown color indicates that the cells bear the antigen.

[0092] In another embodiment, the present invention provides a method of making affinity-purified polyclonal antibodies using a 10 kD recombinant version of the small and large T common leader peptide. The common leader peptide is transfected into bacteria and the leader peptide is expressed and is suitably soluble in aqueous solution. Polyclonal antibodies are ordinarily obtained from the serum of goat or rabbit immunized with a particular antigen, in an embodiment, the antigen is the 10 kD recombinant version of the small and large T common leader peptide. The antiserum is affinity purified to remove nonspecific antibodies, increasing sensitivity and reducing background. Further purification is performed to remove potential nonspecific reactivities among related animal species, or to reduce shared reactivity with other heavy and light chains. In an embodiment, the purified antibody is labeled with a detectable marker, for example, rhodamine. The purified polyclonal antibodies are used to detect antigen using tissue samples that are fixed and embedded in paraffin, using methods known in the art.

10093] Further methods include the detection of primary immune complexes by a two- step approach. A second binding ligand, such as an antibody, that has binding affinity for the first antibody is used to form secondary immune complexes, as described above. After washing, the secondary immune complexes are contacted with a third binding ligand or antibody that has binding affinity for the second antibody, for a period of time sufficient to allow the formation of immune complexes (tertiary immune complexes). The third ligand or antibody is linked to a detectable label, allowing detection of the tertiary immune complexes thus formed.

[0094] The monoclonal antibodies of the invention can be administered parenterally by injection or by gradual perfusion over time. The monoclonal antibodies of the invention can be administered intravenously, intraperitoneally, intramuscularly, subcutaneously, intracavity, or transdermally, alone or in combination with effector cells. Preparations for parenteral administration include sterile aqueous or non-aqueous solutions, suspensions, and emulsions. Examples of non-aqueous solvents are propylene glycol, polyethylene glycol, vegetable oils such as olive oil, and injectable organic esters such as ethyl oleate. Aqueous carriers include water, alcoholic/aqueous solutions, emulsions or suspensions, including saline and buffered media. Parenteral vehicles include sodium chloride solution, Ringer's dextrose, dextrose and sodium chloride, lactated Ringer's, or fixed oils. Intravenous vehicles include fluid and nutrient replenishers, electrolyte replenishers (such as those based on Ringer's dextrose), and the like. Preservatives and other additives may also be present such as, for example, antimicrobials, anti-oxidants, chelating agents, and inert gases and the like.

[0095] In an embodiment, the monoclonal antibodies, or antigen-binding fragments thereof, according to the present invention, are used to quantitatively or qualitatively detect the presence of the any of the HPyV6 and HPyW proteins, or fragments thereof, on or in various skin or other cells. This can be achieved, for example, by immunofluorescence techniques employing a fluorescently labeled antibody, coupled with light microscopic, flow cytometric, or fluorometric detection. In addition, the antibodies, or antigen-binding fragments thereof, according to the present invention may additionally be employed histologically, as in immunofluorescence, immunoelectron microscopy, or non-immuno assays, for in situ detection of the cancer-specific antigen on cells, such as for use in monitoring, diagnosing, and/or detection assays.

[0096] In yet another embodiment, in situ detection is accomplished by removing a histological specimen from a patient, and applying thereto a labeled antibody according to this invention. The antibody, or antigen-binding fragment thereof, is preferably applied by overlaying the labeled antibody or fragment onto the biological sample. Through the use of such a procedure, it is possible to determine not only the presence of the antigen, or conserved variants, or peptide fragments, but also its distribution in the examined tissue. Those of ordinary skill in the art will readily recognize that any of a wide variety of histological methods, e.g., staining procedures, can be modified in order to achieve such in situ detection.

[0097] In an immunoassay of the present invention, a biological sample may be brought into contact with, and immobilized onto, a solid phase support or earner, such as

nitrocellulose, or other solid support or matrix, which is capable of immobilizing cells, cell particles, membranes, or soluble proteins. The support is then washed with suitable buffers, followed by treatment with the detectably-labeled antibody. The solid phase support is then washed with buffer a second time to remove unbound antibody. The amount of bound label on the solid support is then detected by conventional means. Accordingly, in another embodiment of the present invention, compositions are provided comprising the monoclonal antibodies, or antigen-binding fragments thereof, bound to a solid phase support, such as described herein.

[0098] By solid phase support, or carrier, or matrix, is meant any support capable of binding an antigen or an antibody. Well-known supports or carriers include glass, plastic, nylon wool, polystyrene, polyethylene, polypropylene, dextran, nylon, amylases, films, resins, natural and modified celluloses, polyacrylamides, agarose, alumina gels, gabbros, and magnetite. The nature of the carrier can be either soluble to some extent, or insoluble for the purposes of the present invention. The support material may have virtually any possible structural configuration as long as the coupled molecule is capable of binding to an antigen or antibody. Thus, the support configuration may be spherical, as in a bead, cylindrical, as in the inside surface of a test tube, or the external surface of a rod. Alternatively, the surface may be flat, such as a sheet, film, test strip, stick, and the like.

[0100] In an embodiment, the solid support is inert to the reaction conditions for binding and may have reactive groups, or activated groups, in order to attach the monoclonal antibody, a binding fragment, or the binding partner of the antibody. The solid phase support can also be useful as a chromatographic support, such as the carbohydrate polymers

SEPHAROSE™ (crosslinked agarose beads), SEPHADEX™ (crosslinked dextran gel), or agarose. Indeed, a large number of such supports for binding antibody or antigen are commercially available and known to those having skill in the art.

[0101 ] The binding activity for a given antibody may be determined by well-known methods. With respect to the cancer specific antibodies of the present invention, numerous ways to detectably label such protein molecules are known and practiced in the art. For example, in an embodiment, the antibodies can be detectably labeled is by linking the antibody to an enzyme, e.g., for use in an enzyme immunoassay (EIA), (Voller et al., Diagnostic Horizons, 2: 1-7 (1978); Butler et al., Meths. Enzymol, 73:482-523 (1981)). The enzyme that is bound to the antibody reacts with an appropriate substrate, preferably a chromogenic substrate, so as to produce a chemical moiety which can be detected, for example, by spectrophotometric, fluorometric, or by visual detection means. Nonlimiting examples of enzymes which can be used to detectably label the antibodies include malate dehydrogenase, staphylococcal nuclease, delta-5 -steroid isomerase, yeast alcohol

dehydrogenase, alpha-glycerophosphate dehydrogenase, triose phosphate isomerase, horseradish peroxidase, alkaline phosphatase, ribonuclease, urease, catalase, glucose-6- phosphate dehydrogenase, glucoamylase and acetylcholinesterase. The detection can be accomplished by chromometric methods, which employ a chromogenic substrate for the enzyme, or by visual comparison of the extent of enzymatic reaction of a substrate compared with similarly prepared standards or controls.

[0102] The antibodies of the present invention, or their antigen-binding fragments can also be labeled using a fluorescent compound. When the fluorescently labeled antibody is exposed to light of the proper wavelength, its presence can then be detected due to

fluorescence. Some of the most commonly used fluorescent labeling compounds include fluorescein isothiocyanate, rhodamine, phycoerythrin, phycocyanin, allophycocyanin, o- phth aldehyde and fluorescamine.

[0103] In an alternate embodiment, the antibodies of the present invention can also be detectably labeled by coupling them to a chemiluminescent compound. The presence of the chemiluminescent-tagged antibody is then determined by detecting the presence of luminescence that develops during the course of a chemical reaction. Examples of particularly useful chemiluminescent labeling compounds include, without limitation, luminol, isoliiniinol, theromatic acridinium ester, imidazole, acridinium salt and oxalate ester. Similarly, a bioluminescent compound may be used to label the antibodies of the present invention. Bio luminescence is a type of chemiluminescence found in biological systems in which a catalytic protein increases the efficiency of the chemiluminescent reaction. The presence of a bioluminescent protein is determined by detecting the presence of

luminescence. Useful bioluminescent labeling compounds include luciferin, luciferase and aequorin.

[0104] The following examples further illustrate the invention but, of course, should not be construed as in any way limiting its scope.

EXAMPLES

[0105] Subjects and sample collection. Employees of the NCI's Laboratory of Cellular Oncology were recruited for the study under NIH protocol number 09-C-N219. Each volunteer was informed about the study and invited to consent to self-sampling by drawing a sterile wooden cotton-tipped swab across the skin of their forehead, hairline and eyebrows.

[0106] Phylogenetic analyses. Sequence analysis was performed using MacVector 1 1 software (MacVector, Inc., Cary, NC). Neighbor-joining phylogenetic trees were constructed from ClustalW alignments using Kimura's two-parameter distance method for nucleotide sequences or uncorrected ("p") for peptide sequences, without bootstrapping. Trees were displayed using FigTree 1.2 software (freeware available at:

tree .b i o . ed . ac . uk/so ftware/ figtr ee) .

[0107] Virion and VLP isolation. Skin swab specimens were collected as described above. Swab tips were broken off and packed into a Pierce #89896 spin column (Pierce, Rockford, IL). The packed swab tips were suffused with 1ml of Dulbecco's PBS with calcium and magnesium (DPBS, Invitrogen, Carlsbad, CA) supplemented with 0.5% Triton X-100 (Pierce) and 500 U/ml Benzonase Nuclease (Sigma, St. Louis, MO). Fluid was collected by centrifuging the packed swab tips at 3000 x g. The swab tips were further washed with DPBS containing 800 mM NaCl and 0.5% Triton X-100. The pooled extracts were sonicated for 30 seconds at maximum power in Misonix cup sonicator then

ultracentrifuged through a previously described Optiprep velocity/density gradient system (Buck, C.B., et al., J. Virol. 78:751-757 (2004); (Buck, C.B., et al, Current Protocols in Cell Biology, editorial board, Juan S. Bonifacino et al., Chapter 26, Unit 26.21 (2007)).

[0108] Briefly, a gradient was prepared with DPBS containing 0.8 M NaCl and 1 ml steps of 27%), 33%) and 39% iodixanol (Optiprep, Sigma). The 3 ml step gradient was overlaid with 2 ml of extract then centrifuged 3.5 hours at 50,000 rpm (234,000 x g) in an SW55ti rotor (Beckman, Brea, CA). Fractions were collected by bottom-puncture of the tube with a 25-gauge needle.

[0109] For qPCR analysis of the gradient fractions, 50 μΐ samples of each gradient fraction were digested by adding a final concentration of 20 mM Tris pH 8.3, 20 mM DTT, 20 mM EDTA, 0.5% SDS and 6 U/ml proteinase K, followed by incubation for 15 minutes at 50 °C. The digested samples were then subjected to overnight ammonium acetate/ethanol precipitation, as above (Crouse, J., and Amorese, D., Focus (Invitrogen-BRL) 19: 13 (1987)).

[0110] VP1 was produced by trans fecting 293 TT cells with expression plasmids pElVPl or pE2VPl carrying HPyV6 or HPyV7 VP1 ORFs. The ORFs were constructed synthetically to incorporate a maximum number of silent mutations, with the hope of eradicating any expression-inhibitory elements present in the original viral ORFs (Pastrana, D.V., et al., Virology, 321 :205-216 (2004)). Synthetic production of the codon-modified ORFs was carried out using Blue Heron Biotechnology's VectorReady service (Blue Heron

Biotechnology, Bothel, WA). [0111] Non-quantitative reactions were performed using Accuprime Pfx (Invitrogen), according to manufacturer's instructions. Gateway technology (Invitrogen) was used to clone PCR-amplified EPV genomes, as well as the "b" isolates of MCV. PCR-amplifed MCV "a" isolates were captured by ligase-mediated cloning into a unique BanHI site. Quantitative PCR (qPCR) analysis was performend using DyNAmo HS SYBR Green qPCR Kit (New England Biolabs, Ipswich, MA) with a BioRad MylQ single-color thermocycler according to manufacturer's instructions (Bio-Rad). Control experiments using cloned viral genomes as templates showed that each pair of qPCR primers detected only its cognate polyomavirus species and not either of the other cutaneous polyomavirus species (data not shown).

EXAMPLE 1

[0112] This example discloses collecting and analyzing the HPyV6 and HPyV7 viral DNA genomes.

[01 13] Rolling circle amplification of HPyV6 and HPyV7 genomes. The initial goal was to isolate full-length, wild-type genomic DNA from swabs drawn across the surface of human skin. The skin of the forehead was chosen based on a recent report showing that short MCV PCR products can be amplified from this easily-sampled skin surface (Wieland, U., et al., Enierg. Infect. Diseases, 15: 1496-1498 (2009)). DNA was extracted from the skin swab specimens, and then subjected to random hexamer-primed RCA.

[01 14] The DNA was extracted from the skin swab specimens by first breaking the end of the swab into a microcentrifuge tube, followed by suffusing the cotton with 150 μΐ of a digestion solution composed of 25 mM Tris pH 7.5, 25 mM EDTA, 1 % SDS and 3 mAU/ml proteinase K (Qiagen, Valencia, CA). The suffused swab was incubated at 37 °C for 15 minutes, then 1 ml of Buffer PB from a QIAquick PCR Extraction Kit (Qiagen) was added to the tube. The swab was briefly centrifuged at 16,000 x g to facilitate suffusion of the cotton with PB buffer. The suffused swab was then removed to a QIAquick spin column and centrifuged briefly. The remaining PB extract was loaded onto the spin column using a vacuum manifold. The spin column was washed with PE buffer, then spun dry for 10 minutes, followed by elution with 50 μΐ of TE buffer (2 mM Tris pH 8.5, 0.5 mM EDTA).

[01 15] A portion of the purified DNA was digested for 30 minutes at 37 °C with 5 U of either NotI or Sall-HF restriction enzyme (NEB) together with Plasmid Safe ATP-Dependent DNase (exodeoxyribonuclease V, Epicentre) in lx NEBuffer 4 (New England Biolabs), supplemented with 1 niM ATP. The pre-digested sample was then precipitated by addition of 0.5 volume of 7.5 M ammonium acetate followed by 2.6 volumes (with respect to the DNA+ammonium acetate mixture) of 95% ethanol. The precipitation was conducted overnight at 4 °C, followed by a one hour spin at 16,000 x g at 25 °C. The precipitated DNA pellet was washed once with 70% ethanol, and then dried for 10 minutes. The pellet was re- dissolved directly in 10 μΐ of Sample Buffer from an Illustra TempliPhi RCA kit (GE

Healthcare Life Sciences, Piscataway, NJ). The sample was denatured and treated with 10 μΐ of phi29 polymerase mix at 30 °C for 24 hours, according to kit instructions.

[01 16] The amplified sample was heat inactivated for 10 minutes at 65 °C, then small samples of the reaction were subjected to restriction digestion or PCR amplification.

Individual restriction fragments were gel-purified (QIAquick Gel Extraction Kit, Qiagen) using TAE-agarose gels precast with GelRed (Phenix Research Products, Horsham, PA). Fragments were captured by standard T4 DNA ligase (New England Biolabs) mediated cloning. In some instances, fragments were captured using plasmid pZERO-2 (Invitrogen). Other fragments were captured using pAsylum, a cloning plasmid designed with the goal of protecting the captured insert from unwanted bacterial transcription arising from the plasmid backbone. Growth of transfomied bacteria was conducted at 30 °C, with the aim of reducing plasmid copy number, thereby minimizing the impact of hypothetically toxic inserts.

[01 17] Under ideal circumstances, RCA produces a long polymer of tandem repeats of any circular template present in the reaction mixture. RCA reactions performed on DNA extracted from skin swabs were analyzed by digesting the finished reaction with restriction enzymes, such as BamHI or EcoRI, that were expected to cut known MCV isolates to unit length. Agarose gel analysis of an initial set of samples showed a smoothly distributed smear of products, suggesting that the majority of RCA products were derived from random fragments of linear cellular DNA, as opposed to discrete circular DNA templates (data not shown). To overcome this problem, a pre-processing step was incorporated in which the extracted DNA was digested with exodeoxyribonuclease V, an enzyme that digests linear DNA molecules but spares double-stranded circular DNA molecules. This pre-processing step was augmented by the inclusion of a restriction enzyme that we reasoned would be unlikely to digest MCV DNA.

[0118] Like other polyomavirus genomes, available MCV sequences are relatively deficient in CpG dinucleotide motifs. The restriction enzyme Notl, which contains two CpG dinucleotides in its eight base pair recognition motif, was therefore used for the pre-digestion step. The recognition sequence of the restriction enzyme Sail, which contains one CpG motif, also tends not to occur in polyomavirus genomes, so this enzyme was chosen for the pre-treatment step in repeat sampling experiments.

[0119] Modified RCA analysis of swab samples contributed by 21 laboratory volunteers revealed discrete restriction fragment patterns for most individuals (Figure 1).

EXAMPLE 2

|0120] This example describes isolating the novel polyomaviruses from samples containing MCV isolates.

[0121] Identification of novel human polyomaviruses. Restriction digests of RCA- amplified DNA revealed an array of unique bands distinct from the cloned MCV bands (Figure 1). Sequencing of cloned non-MCV restriction fragments revealed varying degrees of homology to known cutaneous Human Papillomaviruses (HPVs) from genera beta and gamma.

[0122] Sequencing of a 1.6 kb BamHI fragment from the initial RCA analysis of subject 7 revealed limited homology to the VP2 protein of WU polyomavirus in a BLASTX search. The full genomic sequence of the previously unknown virus species was captured by PCR amplification and named "Human Polyomavirus 6" (HPyV6). The novel virus appears to occupy a fifth distinct human polyomavirus clade, with BKV/JCV, African green monkey B- lymphotropic polyomavirus (LPV), WUV/KIV and MCV representing previously identified clades (Figure 2).

[0123] To search for additional polyomaviruses similar to HPyV6, PCR was performed using degenerate, broad-specificity PCR primers designed to simultaneously detect

MCV+EPV1 , WUV+EPV1 or LPV+MCV (Table 1). The WUV+EPV1 primer pair amplified a unique polyomavirus-like sequence from the initial RCA reaction of subject 13. The complete genome of this second new polyomavirus was amplified by PCR and was found to be 68% identical to HPyV6 at the nucleotide level. The new virus was classified as another novel human polyomavirus species (HPyV7). Complete HPyV6 and HPyV7 genomes were cloned from a total of 5/35 or 4/35 subjects, respectively. As with MCV, sequencing of repeat samples showed that individual subjects continued to shed a similar or identical HPyV sequence again suggesting a chronic clonal infection. TABLE 1

Product Primers Thermocycle Profile

CTACTGGATCCAGAGGATGAGG (SEQ ID NO:

MCV-Bam 13) (95°15 55°30"/68°300")x30

CCTCTGGATCCAGTAGCAGAGAGG (SEQ ID

NO: 14)

GGGGACAAGTTTGTACAAAAAAGCAGGCTC CAAGTAGGAGGAAATCCAAACCAAAG (SEQ

MCV-att ID NO: 15) (95°15759^o30768°290"+3")x30

GGGGACCACTTTGTACAAGAAAGCTGGGAA AGTTTTGACTGGTGGC (SEQ ID NO: 16)

GGGGACAAGTTTGTACAAAAAAGCAGGCTC AAAAGCTTCCCAGAGTAATAAAAAAAGG

HPyVl (SEQ ID NO: 17) (95°15759°30768°290"+3")x30

GGGGACCACTTTGTACAAGAAAGCTGGGTA AGCTTTTGAATTGGTCCATTTCCTTTTCTG

(SEQ ID NO: 18)

GGGGACAAGTTTGTACAAAAAAGCAGGCTC AATTGTGGTTGCCACAAGCGTGG (SEQ ID

HPyV2 NO: 19) (95°15759°30768°290"+3")x30

GGGGACCACTTTGTACAAGAAAGCTGGGTCA ATTGAAGTGCCATGGTTGTGCTTCC (SEQ ID

NO: 20)

GGAGGRGSAGAGGCCCTGKMAATTGCTGG

WU+EPV1 (SEQ ID NO: 21 ) (95°15755°30768°90")x30

CCWCCWACMAYTCTKCCAAARTATCTRC

(SEQ ID NO: 22)

MCV+EPV GWAGCACTKGTAGCAMMAGCACTTTCCCC

1 (SEQ ID NO: 23) (95^o15755°30768°290"+3")x30

TGCTATMAGTGCTWTWKTCTYTGGTTTGG

(SEQ ID NO: 24)

CATTWTAACWGAATTTCCTCCTTTATCAGG

MCV+LPV (SEQ ID NO: 25) (95^o15755°30768°10")x30

CTCCKMSKCTTCTKKMAAMAAAGAGAGAGG CTTTKGAGGC (SEQ ID NO: 26) MCV-qPCR GGTGCAGATGCAGTAAGCAG (SEQ ID NO: 27) (95°10760^o60^*')x40

TTGTCTCGCCAGCATTGTAG (SEQ ID NO: 28)

HPyVl- qPCR(a) ATCAGCTTCCACAGGTAGGC (SEQ ID NO: 29)

TTGCCTTCTCAAAAAGGAGC (SEQ ID NO: 30) (95°10"/60°60")x40

HPyV2- qPCR AGATTTAGCTGTCCCCAAAG (SEQ ID NO: 31)

AAGAAGGCCAAAGAGTATGC (SEQ ID NO: 32)

HPyVl- qPCR(b) TAATTCCCAACCAATCCAGG (SEQ ID NO: 33)

(95°10760°60")x40

AGTGCTGGTGCTACAAGTGC (SEQ ID NO: 34)

|0124] Separate phylogenetic analyses of the nucleotide sequences of polyomavirus early or late genes show that the two halves of the HPyV genomes occupy different positions within polyomavirus phylogenetic trees (Figure 3). The late region sequences of the HPyVs appear to be more closely related to WUV/KIV than to other polyomavirus species, while the HPyV early regions are closer to the root of the phylogenetic tree. Similar results were observed when the predicted peptide sequences of individual early or late proteins were subjected to phylogenetic analyses (data not shown).

EXAMPLE 3

[0125] The following example demonstrates that the human polyomaviruses are actively shed from the skin of infected individuals.

[0126] Productive viral infection is associated with the generation of progeny virions. To determine whether the polyomavirus DNA detected in the skin swab specimens was shed in the form of assembled virions, a set of swabs contributed by nine volunteers was extracted using nondenaturing conditions. A broad-spectrum endonuclease was added to the extract with the goal of digesting any DNA not protected within a virion. The digested extracts were subjected to a standard density gradient ultracentrifugation technique designed to purify virions away from free DNA and other extract components. As depicted in Figure 4, qPCR signals for MCV, HPyV6 and HPyV7 were observed in the portion of the gradient where virions and virus-like particles typically migrate. No qPCR signal was detected in a control gradient in which cloned MCV genomic DNA was spiked into a mock extract containing endonuclease, confirming that the endonuclease effectively degrades free DNA under these conditions (data not shown). Cloned MCV DNA that was not subjected to nuclease treatment remained in the upper portion of the ultracentrifuge gradient (Figure 4), consistent with the greater buoyancy of non-encapsidated DNA.

[0127] Quantitative analysis indicated the presence of a total of roughly two million MCV genome equivalents within the gradient. Both HPyV6 and HPyV7 were detected at lower copy numbers. Similar results were observed for a separate gradient analysis of skin swabs from an overlapping set of 1 1 volunteers (data not shown). The results show that polyomavirus DNA is shed from human skin in the form of assembled virions.

EXAMPLE 4

[0128] The following example describes the serological analysis of HPyV6 and/or HPyV7 polyomavirus exposure.

[0129] Polyomavirus VP1 proteins typically have the ability to spontaneously self- assemble into virus-like particles (VLPs) when expressed as recombinant proteins. Enzyme- linked immunosorbent assays (ELISAs) employing recombinant polyomavirus VLPs have been widely used to detect virus-specific antibody responses aroused during natural infection. To develop ELISAs targeting HPyV6 and HPyV7, the VP1 protein of each virus was expressed in transfected 293 TT cells and purified using previously reported methods developed for ultracentrifugal purification of VLPs (See, Buck, C.B., et al. (2004), supra, and Tolstov Y.L., et al, Intl. J. Cancer, 125 : 1250-56 (2009)). Although the HPyV6 and HPyV7 VP1 proteins migrated to the core fractions of the gradient where VLPs are typically found, electron micrographs revealed irregular particles smaller than the 45-50 nra diameters expected for full-size polyomavirus VLPs (data not shown). The VP1 subviral particles were of sufficient purity for use in ELISAs. Full-size murine polyomavirus (MPyV) or MCV- based VLPs were produced in 293TT cells for use in negative and positive control ELISAs, respectively.

[0130] Sera from a convenience set of 95 commercial donors were screened in separate ELISAs against each of the four VP1 species (Figure 5). Each serum sample showed a distinct pattern of reactivity to each of the three human polyomavirus VP1 proteins, suggesting that each ELISA is polyomavirus species-specific. The 58/95 (61 %) rate of seropositivity for MCV is similar to previous ELISA-based observations using this same set of sera. Reactivity against HPyV6 was common, with 66/95 (69%) subjects scoring seropositive. The seropositivity rate for HPyV7 was lower, with 33/95 (35%) subjects scoring seropositive. The frequency of double seropositivity for pairs of virus species was similar to frequencies predicted by the products of individual frequencies (Figure 5). This suggests that serological exposure to each cutaneous polyomavirus species is an independent variable.

EXAMPLE 5

[0131] This example demonstrates the development of monoclonal antibodies capable of detecting the T antigen proteins of the skin-tropic human polyomaviruses HPyV6 and HPyV7. The mAbs are useful for diagnosing the presence of the viruses in human tumors or other disease-associated tissue specimens.

[0132] Mice were immunized with recombinant small t antigen proteins of MCV, HPyV6, or HPyV7. The recombinant proteins were produced by fusing the small t antigen ORF to maltose binding protein (MBP) by ligating a PCR product into plasmid pMXB l O (New England Biolabs). The fusion protein was purified out of bacterial lysates using amylose resin (New England Biolabs). About 100 μg of the purified antigen was mixed with complete Freund's adjuvant and administered subcutaneously. The mice were boosted after three weeks with antigen in incomplete Freund's adjuvant. Splenocytes and lympocytes were collected three days after the boost.

[0133] Lymphocytes and splenocytes were fused with SP2/mIL6 cells (ATCC, Manassas, VA) and propagated using HFCS supplement (Roche Applied Science, Indianapolis, IN) according to manufacturer's instructions. Hybridomas were screened for reactivity with the various species of recombinant small t antigen and for lack of reactivity with the MBP tag protein.

[0134] Hybridoma Screening. Selected hybridomas were cloned and screened for ability to stain coverslip-mounted formalin-fixed cells, which were transfected with mammalian expression constructs encoding the small t antigens of HPyV6, HPyV7 and MCV. Since polyomavirus small and large T antigens share a common amino-terminal leader, we also tested the ability of the monoclonal antibodies to stain cells transfected with an MCV large T antigen expression construct, pCDNAclt206antigenl (provided by Patrick Moore and Yuan Chang). [0135] Two monoclonal antibodies, named ltl and 2t2, detected all three species of the common portion of the small t antigen, as well as the MCV large T antigen. These monoclonal antibodies were from mice immunized with HPyV6 or HPyV7 small t antigens (respectively). The monoclonal antibodies were tested against HeLa cells that were first transfected with MCV T antigen then formalin-fixed, embedded in paraffin and sectioned. Only 2t2 reacted with the paraffin-embedded cells. It compared favorably with a previously- reported MCV T antigen specific monoclonal antibody known as CM2B4. The 2t2 mAb does not react with cells expressing the large T antigen of SV40 (data not shown).

[0136] All references, including publications, patent applications, and patents, cited herein are hereby incorporated by reference to the same extent as if each reference were individually and specifically indicated to be incorporated by reference and were set forth in its entirety herein.

[0137] The use of the terms "a" and "an" and "the" and similar referents in the context of describing the invention (especially in the context of the following claims) are to be construed to cover both the singular and the plural, unless otherwise indicated herein or clearly contradicted by context. The terms "comprising," "having," "including," and "containing" are to be construed as open-ended terms (i.e., meaning "including, but not limited to,") unless otherwise noted. Recitation of ranges of values herein are merely intended to serve as a shorthand method of referring individually to each separate value falling within the range, unless otherwise indicated herein, and each separate value is incorporated into the specification as if it were individually recited herein. All methods described herein can be performed in any suitable order unless otherwise indicated herein or otherwise clearly contradicted by context. The use of any and all examples, or exemplary language (e.g., "such as") provided herein, is intended merely to better illuminate the invention and does not pose a limitation on the scope of the invention unless otherwise claimed. No language in the specification should be construed as indicating any non-claimed element as essential to the practice of the invention.

[0138] Preferred embodiments of this invention are described herein, including the best mode known to the inventors for carrying out the invention. Variations of those preferred embodiments may become apparent to those of ordinary skill in the art upon reading the foregoing description. The inventors expect skilled artisans to employ such variations as appropriate, and the inventors intend for the invention to be practiced otherwise than as specifically described herein. Accordingly, this invention includes all modifications and equivalents of the subject matter recited in the claims appended hereto as permitted by applicable law. Moreover, any combination of the above-described elements in all possible variations thereof is encompassed by the invention unless otherwise indicated herein or otherwise clearly contradicted by context.

Claims

CLAIM(S):

1. An isolated nucleic acid molecule encoding the genome of the polyoma virus HPyV6 comprising a nucleotide sequence of any one of SEQ ID NOs: 1 to 6, or the complement thereof.

2. An isolated nucleic acid molecule encoding the genome of the polyoma virus HPyV7 comprising a nucleotide sequence of any one of SEQ ID NOs: 7 to 12, or the complement thereof.

3. An isolated host cell comprising the isolated nucleic acid molecule of claim 1 or 2.

4. The isolated host cell of claim 3, wherein the host cell is a mammalian cell.

5. The isolated host cell of either of claims 3 or 4, wherein the host cell is a skin cell.

6. An isolated nucleic acid molecule that specifically hybridizes to the nucleotide sequence set forth in any of the SEQ ID NOs: 1-12 or to the complement thereof.

7. A nucleic acid molecule according to claim 6, which is an oligonucleotide primer between about 10 and about 30 nucleotides in length.

8. A pair of oligonucleotide primers for PCR, wherein the first primer is an isolated nucleic acid molecule between about 10 and about 30 nucleotides in length that specifically hybridizes to the nucleotide sequence set forth in any of the SEQ ID NOs: 1 -6; and the second primer is an isolated nucleic acid molecule between about 10 and about 30 nucleotides in length that specifically hybridizes to the complement of the nucleotide sequence set forth in any of the SEQ ID NOs: 1-6.

9. A pair of oligonucleotide primers for PCR, wherein the first primer is an isolated nucleic acid molecule between about 10 and about 30 nucleotides in length that specifically hybridizes to the nucleotide sequence set forth in any of the SEQ ID NOs: 7-12; and the second primer is an isolated nucleic acid molecule between about 10 and about 30 nucleotides in length that specifically hybridizes to the complement of the nucleotide sequence set forth in any of the SEQ ID NOs: 7-12.

10. A kit for testing a sample for the presence of HPyV6, comprising a pair of oligonucleotide primers according to claim 8, in sterile solution.

11. A kit for testing a sample for the presence of HPyV7, comprising a pair of oligonucleotide primers according to claim 9, in sterile solution.

12. A method of testing a sample for the presence of HPyV6 or HPyV7, the method comprising:

(i) providing a test sample;

(ii) adding first and second oligonucleotide PCR primers according to claim 8 or claim 9 to the sample; and

(iii) testing the sample for the presence of a PCR product, wherein detection of a PCR product indicates that HPyV6 or HPyV7 is present in the sample.

13. The method of claim 12, wherein the sample is obtained from a patient.

14. An isolated polypeptide encoded by nucleic acid according to claim 1 or 2.

15. An antibody, or antigen-binding fragment thereof, which specifically binds to the nucleic acid molecule of claim 1 or 2, or the isolated polypeptide of claim 14.

16. The antibody according to claim 15, which is a human or humanized antibody molecule.

17. The antibody according to claim 15 or 16, which is labeled with a detectable label.

18. A method of testing a sample for the presence of HPyV6 or HPyV7, the method compri sing detecting the presence of a polypeptide in the sample that specifically binds to the antibody according to any of claims 15 to 17.

19. A method of testing a sample for the presence of HPyV6 or HPyV7, the method comprising:

(i) providing a test sample;

(ii) contacting the test sample with a antibody according to any of claims 15 to

17 under conditions in which the antibody or fragment thereof binds an HPyV6 or HPyV7 polypeptide, if present, to form a antibody

polypeptide complex;

(iii) washing the sample to remove any unbound antibody;

(iv) contacting the sample with a second antibody, wherein the second

antibody binds the said antibody according to any of claims 15 to 17, if present, and wherein the second antibody is labeled with a detectable label;

(v) washing the sample to remove any unbound antibody, and

(iv) testing for the presence of the detectable label, wherein the presence of the detectable label indicates the presence of HPyV6 or HPyV7 polypeptide in the sample.

20. A method of testing a sample for the presence of antibodies to HPyV6 or HPyV7 VP1 protein or a fragment thereof, the method comprising:

(i) providing a test sample;

(ii) contacting the test sample with a HPyV6 or HPyV7 VP1 protein or

fragment thereof, under conditions in which the first antibody binds the HPyV6 or HPyV7 VP1 protein or a fragment thereof, if present, to form an antibody-antigen complex;

(iii) washing the sample to remove any unbound antibody;

(iv) contacting the sample with a second antibody, wherein the second

antibody binds the first antibody, if present, and wherein the second antibody is labeled with a detectable label;

(v) washing the sample to remove any unbound antibody, and

(iv) testing for the presence of the detectable label, wherein the amount of the detectable label indicates the quantity of antibodies to HPyV6 or HPyV7 VP1 protein in the sample.