WO2011078306A1 - Gpr119 agonist - Google Patents

Abstract

A compound represented by general formula (I), which is a GPR119 agonist, or a salt thereof is used as an antidiabetic drug. In general formula (I), Ar represents a phenyl group, a pyridyl group, etc.; A represents O, a bond, etc.; B represents (C(R⁷)H)_n, a bond, etc.; one of U and V represents N and the other represents CR⁹, or U and V both represent N; R¹ and R² represent a hydrogen atom, a halogen atom, etc.; R³ represents a hydrogen atom, a halogen atom, etc.; R⁴ and R⁵ represent a hydrogen atom, a C_1-8 alkyl group, etc.; X¹, X², X³, X⁴, X⁵ and X⁶ represent (CR¹⁰R¹¹)_p or a bond; Y represents a single bond, C(R¹⁵)(R¹⁶), etc.; and Z represents C(O)OR¹⁸, etc. or a 5- or 6-membered heteroaryl group.

Description

GPR119 agonist

The present invention relates to GPR119 agonists.

Diabetes, a lifestyle-related disease, has an increasing number of patients worldwide. Treatment methods for diabetes can be divided into diet therapy, exercise therapy, and drug therapy (insulin injection, oral diabetes drug). Oral diabetes drugs include α-glucosidase inhibitors (acarbose, voglibose), insulin resistance improvers (pioglitazone hydrochloride), biguanide preparations (metformin hydrochloride), sulfonylurea preparations (glibenclamide, glimepiride), accelerated rapid insulin secretion An agent (mitiglinide calcium hydrate) is commercially available.
More recently, incretin preparations (exenatide) and DPP IV inhibitors (sitagliptin), which are gastrointestinal hormones that enhance insulin secretion, have been developed and marketed, and SGLT inhibitors have also been developed. Yes.
By the way, GPR119 is a G protein-coupled receptor (GPCR) having N-Oleoylanolamide as an endogenous ligand, and has been reported as a receptor that enhances insulin secretion from pancreatic β cells. (Non-patent document 1) GPR119 agonists have been found to increase the plasma concentration of Glucagon like peptide-1 (GLP-1), which is one of the incretins, in the action in vivo (Non-patent document 1). 2) It may contribute indirectly to the increase in insulin secretion. Furthermore, the action which suppresses a body weight gain in the high fat diet load rat is reported (nonpatent literature 1), and the possibility of being concerned in energy metabolism is also suggested. From these facts, GPR119 agonists are expected not only as a therapeutic drug for diabetes but also for adaptation to lifestyle-related diseases such as obesity and metabolic syndrome.
As a GPR119 agonist, for example, Patent Document 1 describes the following compound (A) and the like,

Patent Document 2 describes the following compound (B) and the like,

Patent Document 3 describes the following compound (C) and the like.

However, the compounds of the present invention represented by the following general formula (I), (II) or (III) and the above-mentioned compounds (A), (B) and (C) are clearly different in structure. That is, in the compound (A), an azabicyclo ring is bonded to a nitrogen atom of a 5-membered triazole ring, whereas in the compound of the present invention, an azabicyclo ring is bonded to a carbon atom such as a 6-membered pyridine ring. is doing.
In the compound (B), an azabicyclo ring and a pyrimidine ring are bonded through an oxygen atom in the middle, whereas in the compound of the present invention, an azabicyclo ring and a pyridine ring are directly bonded.
Further, in the compound (C), a piperidine ring and a 5-membered thiazole ring are bonded, whereas in the compound of the present invention, an azabicyclo ring and a 6-membered pyridine ring are bonded.

Recently, the following general formula:

It is described in Patent Document 4 that a compound represented by is useful as a GPR119 agonist.
However, there is no specific description regarding the compound in which the pyridine ring and the azabicyclo ring are bonded in the compound of the present invention.

On the other hand, Patent Document 5 describes the following compound (D) in which an azabicyclo ring is bonded to a carbon atom of a pyridine ring.

The compound (D) is different from the compound of the present invention in the AB portion of the compound (I) of the present invention, and in Patent Document 4, the compound (D) is a synthetic intermediate of a renin inhibitor. However, there is no description that it has a GPR119 agonistic action.

WO 2009/014910 WO 2009/055331 WO 2008/083238 WO 2010/008739 WO 2007/085514

An object of the present invention is to provide a compound represented by the following general formula (I), (II) or (III) or a pharmaceutically acceptable salt thereof, and a therapeutic agent for diabetes containing these as active ingredients. is there.

That is, the present invention relates to a compound represented by the following general formula (I) or a pharmaceutically acceptable salt thereof.

(Wherein Ar is a halogen atom, a nitro group, a cyano group, a hydroxyl group, a C _1-8 alkyl group, a C _1-8 alkoxy group, a C _1-8 alkyl group substituted with 1 to 3 halogen atoms, C _1-8 alkoxy group substituted with 1 to 3 halogen atoms, phenyloxy group, alkoxycarbonyl group (alkoxy has 1 to 8 carbon atoms), carboxyl group, carbamoyl group, acyl group (alkyl carbon number is 1-8), alkylaminocarbonyl group (alkyl has 1 to 8 carbon atoms), dialkylaminocarbonyl group (alkyl has 2 to 12 carbon atoms), alkoxycarbonylmethylcarbonyl group (alkoxy has 1 to 8 carbon atoms) , alkylsulfonyl methyl group (the carbon number of alkyl is 1 to 8), an amino _{group, C 1-8} alkylamino _{group, C 2-12} dialkylamino , _{C 1-8} alkylsulfonylamino group, an acylamino group (1-8 carbon atoms in the _{alkyl), C 1-8} alkylsulfinyl _{group, C 1-8} alkylsulfonyl group, 3-6 membered cycloalkyl sulfonyl group ring, A phenyl group optionally substituted with a substituent selected from a sulfamoyl group, a C _1-8 alkylaminosulfonyl group, a C _2-12 dialkylaminosulfonyl group, a phenylsulfonyl group and a 5- or 6-membered heteroaryl group; Represents a pyridyl group, an indolyl group, an indolinyl group or a pyrrolopyridyl group,
A represents (CH ₂ ) _m , C (O), S, O, NR ⁶ or a bond,
Here, m represents an integer of 1 to 3, R ⁶ represents a hydrogen atom, a C _1-8 alkyl group or a 3- to 6-membered cycloalkyl group,
B represents (C (R ⁷ ) H) _n , S, O, CH═CH, NR ⁸ or a bond,
Here, n represents an integer of 1 to 3, and R ⁷ and R ⁸ represent a hydrogen atom, a C _1-8 alkyl group, or a 3- to 6-membered cycloalkyl group.
However, when A is S, O or NR ⁶ , B is not S, O or NR ⁸ .
One of U and V is N and the other is CR ⁹ or U and V are both N;
Here, R ⁹ is a hydrogen atom, a halogen atom, a hydroxyl group, a C _1-8 alkyl group, a C _1-8 alkoxy group, a C _1-8 alkyl group substituted with 1 to 3 halogen atoms, or 1 to 3 _Represents a C _1-8 alkoxy group substituted with one halogen atom,
R ¹ and R ² are the same or different and are a hydrogen atom, a halogen atom, a hydroxyl group, a C _1-8 alkyl group, a C _1-8 alkoxy group, a C _1-8 alkyl group substituted with 1 to 3 halogen atoms. Or a C _1-8 alkoxy group substituted with 1 to 3 halogen atoms,
R ³ represents a hydrogen atom, a hydroxyl group, a halogen atom or a C _1-8 alkyl group,
R ⁴ and R ⁵ are the same or different and each represents a hydrogen atom, a C _1-8 alkyl group or a 3- to 6-membered cycloalkyl group,
X ¹ , X ² , X ³ , X ⁴ , X ⁵ and X ⁶ are the same or different and represent (CR ¹⁰ R ¹¹ ) _p or a bond,
Here, R ¹⁰ and R ¹¹ represent a hydrogen atom, a hydroxyl group, a halogen atom, a C _1-8 alkyl group, a C _1-8 alkoxy group, or a 3- to 6-membered cycloalkyl group,
p represents 1 or 2,
Y is a single bond, a double bond, C (O), C = NOR ¹² , C = C (R ¹³ ) (R ¹⁴ ), C (R ¹⁵ ) (R ¹⁶ ), O, NR ¹⁷ or S (O) _q is represented.
Here, R ¹² , R ¹³ , R ¹⁴ , R ¹⁵ , R ¹⁶ and R ¹⁷ represent a hydrogen atom, a C _1-8 alkyl group or a _3-6 membered cycloalkyl group,
q represents an integer of 0-2.
However, when X ⁵ or X ⁶ is a bond, Y is not a double bond, and when Y is a double bond, X ⁵ and X ⁶ represent (CR ¹⁰ R ¹¹ ) _p .
And Z represents C (O) OR ¹⁸ , C (O) R ¹⁹ , SO ₂ R ²⁰ , C (O) NR ²¹ R ²² or CH ₂ C (O) N (R ²³ ) (R ²⁴ ) Or a C _1-8 alkyl group, a C _1-8 alkoxy group, a C _1-8 alkyl group substituted with 1 to 3 halogen atoms and a C ₁ substituted with 1 to 3 halogen atoms _A 5- or 6-membered heteroaryl group optionally having a substituent selected from _-8 alkoxy groups (the heteroaryl ring has a carbon atom and a nitrogen atom as ring-constituting atoms, and further an oxygen atom or sulfur Which may have an atom and is bonded to the nitrogen atom of the azabicyclo ring via a carbon atom constituting the ring),
Here, R ¹⁸ , R ¹⁹ , R ²⁰ , R ²¹ , R ²² , R ²³ and R ²⁴ are C _1-8 alkyl, C _2-8 alkenyl group, 3 to 6-membered cycloalkyl group, phenyl group or Represents a C _1-8 alkyl group substituted by a phenyl group. )

The present invention also relates to a compound represented by the following general formula (II) or a pharmaceutically acceptable salt thereof.

(In the formula, any one of T ¹ , T ² , T ³ and T ⁴ represents C (R ²⁵ ) or N, and the rest represents C (R ²⁶ ).
R ²⁵ and R ²⁶ are a hydrogen atom, a halogen atom, a nitro group, a cyano group, a hydroxyl group, a C _1-8 alkyl group, a C _1-8 alkoxy group, or a C ₁ substituted with 1 to 3 halogen atoms. _-8 alkyl group, C _1-8 alkoxy group substituted with 1 to 3 halogen atoms, phenyloxy group, alkoxycarbonyl group (alkoxy has 1 to 8 carbon atoms), carboxyl group, carbamoyl group, acyl group ( Alkyl has 1 to 8 carbon atoms, alkylaminocarbonyl group (alkyl has 1 to 8 carbon atoms), dialkylaminocarbonyl group (alkyl has 2 to 12 carbon atoms), alkoxycarbonylmethylcarbonyl group (alkoxy has carbon atoms) 1 to 8), an alkylsulfonyl radical (1-8 carbon atoms in the alkyl), amino _{group, C 1-8} alkylamino group, _{C 2 12} dialkylamino _{group, C 1-8} alkylsulfonylamino group, an acylamino group (1-8 carbon atoms in the _{alkyl), C 1-8} alkylsulfinyl _{group, C 1-8} alkylsulfonyl group, a cycloalkyl of 3 to 6-membered ring An alkylsulfonyl group, a sulfamoyl group, a C _1-8 alkylaminosulfonyl group, a C _2-12 dialkylaminosulfonyl group, a phenylsulfonyl group or a 5- or 6-membered heteroaryl group;
R ⁰³ and R ⁰⁴ are the same or different and each represents a hydrogen atom or a C _1-8 alkyl group,
A double line consisting of a solid line and a broken line represents a single bond or a double bond,
A ⁰¹ represents (CH ₂ ) _r , C (O) or a bond,
Where r represents an integer of 1 to 3,
B ⁰¹ represents (C (R ²⁷ ) H) _s , S, O, CH═CH, NR ²⁸ or a bond,
Here, s represents an integer of 1 to 3, and R ²⁷ and R ^{28 each} represents a hydrogen atom or a C _1-8 alkyl group.
However, when A ⁰¹ is CH ₂ or a bond, B ⁰¹ is not S, O, or NR ²⁸ .
Either one of U ⁰¹ and V ⁰¹ is N and the other is CR ²⁹ or U ⁰¹ and V ⁰¹ are both N;
Here, R ²⁹ is a hydrogen atom, a halogen atom, a hydroxyl group, a C _1-8 alkyl group, a C _1-8 alkoxy group, a C _1-8 alkyl group substituted with 1 to 3 halogen atoms, or 1 to 3 _Represents a C _1-8 alkoxy group substituted with one halogen atom,
R ⁰¹ and R ⁰² are a hydrogen atom, a halogen atom, a hydroxyl group, a C _1-8 alkyl group, a C _1-8 alkoxy group, a C _1-8 alkyl group substituted with 1 to 3 halogen atoms, or 1 to 3 _Represents a C _1-8 alkoxy group substituted with one halogen atom,
Z ⁰¹ represents C (O) OR ³⁰ , C (O) R ³¹ , SO ₂ R ³² , C (O) NR ³³ R ³⁴ or CH ₂ C (O) N (R ³⁵ ) (R ³⁶ ), Or a halogen atom, a C _1-8 alkyl group, a C _1-8 alkoxy group, a C _1-8 alkyl group substituted with 1 to 3 halogen atoms and a C _{1 1} substituted with 1 to 3 halogen atoms. _A 5- or 6-membered heteroaryl group optionally having a substituent selected from ₈ alkoxy groups (the heteroaryl ring has a carbon atom and a nitrogen atom as ring-constituting atoms, and further an oxygen atom or a sulfur atom And may be bonded to the nitrogen atom of the azabicyclo ring through the carbon atoms constituting the ring),
Here, R ³⁰ , R ³¹ , R ³² , R ³³ , R ³⁴ , R ³⁵ and R ³⁶ are C _1-8 alkyl, C _2-8 alkenyl group, _3-6 membered cycloalkyl group, phenyl group or Represents a C _1-8 alkyl group substituted with a phenyl group,
T represents 1 or 2. )

The present invention also relates to a compound represented by the following general formula (III) or a pharmaceutically acceptable salt thereof.

(Wherein R ⁰⁷ , R ⁰⁸ and R ⁰⁹ are the same or different and each represents a hydrogen atom, a halogen atom, a nitro group, a cyano group, a hydroxyl group, a C _1-8 alkyl group, a C _1-8 alkoxy group, 1 to 3 C _1-8 alkyl group substituted with a halogen atom, C _1-8 alkoxy group substituted with 1 to 3 halogen atoms, phenyloxy group, alkoxycarbonyl group (alkoxy has 1 to 8 carbon atoms), carboxyl Group, carbamoyl group, acyl group (alkyl has 1 to 8 carbon atoms), alkylaminocarbonyl group (alkyl has 1 to 8 carbon atoms), dialkylaminocarbonyl group (alkyl has 2 to 12 carbon atoms), alkoxycarbonyl methylcarbonyl group (number of carbon atoms in the alkoxy 1-8) alkylsulfonyl radical (1-8 carbon atoms in the alkyl), amino group, C _1- Alkylamino _{group, C 2-12} dialkylamino _{group, C 1-8} alkylsulfonylamino group, an acylamino group (1-8 carbon atoms in the _{alkyl), C 1-8} alkylsulfinyl _{group, C 1-8} alkylsulfonyl group, A 3- to 6-membered cycloalkylsulfonyl group, a sulfamoyl group, a C _1-8 alkylaminosulfonyl group, a C _2-12 dialkylaminosulfonyl group, a phenylsulfonyl group, or a 5- or 6-membered heteroaryl group,
Q represents C (R ³⁷ ) or N;
Here, R ³⁷ is the same as the above R ⁰⁷ , R ⁰⁸ and R ⁰⁹ ,
A ⁰² represents (CH ₂ ) _u , O, S, NR ³⁸ or a bond,
Here, u represents an integer of 1 to 3, R ³⁸ represents a hydrogen atom or a C _1-8 alkyl group,
B ⁰² represents (C (R ³⁹ ) H) _v , S, O, CH═CH or NR ⁴⁰ ;
Here, v represents an integer of 1 to 3, and R ³⁹ and R ^{40 each} represents a hydrogen atom or a C _1-8 alkyl group.
However, when A ⁰² is O, S or NR ³⁸ , B ⁰² is not O, S or NR ⁴⁰ .
Any one of U ⁰² and V ⁰² is N and the other is CR ⁴¹ or U ⁰ and V ⁰ are both N;
Here, R ⁴¹ is a hydrogen atom, a halogen atom, a hydroxyl group, a C _1-8 alkyl group, a C _1-8 alkoxy group, a C _1-8 alkyl group substituted with 1 to 3 halogen atoms, or 1 to 3 _Represents a C _1-8 alkoxy group substituted with one halogen atom,
R ⁰⁵ and R ⁰⁶ are a hydrogen atom, a halogen atom, a hydroxyl group, a C _1-8 alkyl group, a C _1-8 alkoxy group, a C _1-8 alkyl group substituted with 1 to 3 halogen atoms, or 1 to 3 _Represents a C _1-8 alkoxy group substituted with one halogen atom,
Z ⁰² represents C (O) OR ⁴² , C (O) R ⁴³ , SO ₂ R ⁴⁴ , C (O) NR ⁴⁵ R ⁴⁶ or CH ₂ C (O) N (R ⁴⁷ ) (R ⁴⁸ ), Or a halogen atom, a C _1-8 alkyl group, a C _1-8 alkoxy group, a C _1-8 alkyl group substituted with 1 to 3 halogen atoms and a C _{1 1} substituted with 1 to 3 halogen atoms. _A 5- or 6-membered heteroaryl group optionally having a substituent selected from ₈ alkoxy groups (the heteroaryl ring has a carbon atom and a nitrogen atom as ring-constituting atoms, and further an oxygen atom or a sulfur atom And may be bonded to the nitrogen atom of the azabicyclo ring via a carbon atom constituting the ring),
Here, R ⁴² , R ⁴³ , R ⁴⁴ , R ⁴⁵ , R ⁴⁶ , R ⁴⁷ and R ⁴⁸ are C _1-8 alkyl, C _2-8 alkenyl, 3- to 6-membered cycloalkyl, phenyl or Represents a C _1-8 alkyl group substituted with a phenyl group,
And w represents 1 or 2. )

The present invention also relates to a therapeutic agent for diabetes containing the compound represented by the above general formula (I), (II) or (III), or a pharmaceutically acceptable salt thereof as an active ingredient.
Furthermore, this invention relates to the GPR119 agonist which contains the compound represented by the said general formula (I), (II) or (III), or its pharmaceutically acceptable salt as an active ingredient.

Next, the present invention will be described in detail.
Among the compounds of the present invention represented by the above general formula (I), the following are preferable.
(1)
At least one of the substituents of Ar is a cyano group, an alkoxycarbonyl group (the alkoxy has 1 to 8 carbon atoms), a C _1-8 alkylsulfonyl group, a 3- to 6-membered cycloalkylsulfonyl group, a sulfamoyl group, a phenylsulfonyl group And a phenyl group, a pyridyl group, an indolyl group, an indolinyl group or a pyrrolopyridyl group substituted with 1 to 3 identical or different substituents selected from 5- or 6-membered heteroaryl groups. I) or a pharmaceutically acceptable salt thereof.
(2)
Ar is a cyano group, an alkoxycarbonyl group (the alkoxy has 1 to 8 carbon atoms), a C _1-8 alkylsulfonyl group, a 3- to 6-membered cycloalkylsulfonyl group, a sulfamoyl group, a phenylsulfonyl group, and a 5- or 6-membered ring. A compound represented by the above general formula (I), which is a phenyl group, a pyridyl group, an indolyl group, an indolinyl group or a pyrrolopyridyl group, which is substituted with any one substituent selected from: Acceptable salt.
(3)
In the above general formula (1), at least one of the substituents of Ar is a phenyl group, pyridyl group, indolyl group, indolinyl group or pyrrolopyridyl group substituted with 1 to 3 identical or different substituents which are C _1-8 alkylsulfonyl groups. I) or a pharmaceutically acceptable salt thereof.
(4)
A compound represented by the above general formula (I), wherein Ar is a phenyl group, pyridyl group, indolyl group, indolinyl group or pyrrolopyridyl group substituted with a C _1-8 alkylsulfonyl group, or a pharmaceutically acceptable salt thereof .
(5)
Ar is C _1-8 alkylsulfonyl group and a C _1-8 alkyl group or any one of the two is substituted with a substituent a phenyl group substituents of a halogen atom, a pyridyl group, an indolyl group, indolinyl group or pyrrolopyridyl group A compound represented by the above general formula (I), or a pharmaceutically acceptable salt thereof.
(6)
Phenyl group, pyridyl group, indolyl group, indolinyl substituted with 1 to 3 identical or different substituents wherein at least one of the substituents of Ar is 1-tetrazolyl group or 1,2,4-triazol-1-yl group A compound represented by the above general formula (I), which is a group or a pyrrolopyridyl group, or a pharmaceutically acceptable salt thereof.
(7)
A compound represented by the above general formula (I), wherein Ar is a phenyl group, pyridyl group, indolyl group, indolinyl group or pyrrolopyridyl group substituted with a 1-tetrazolyl group or a 1,2,4-triazol-1-yl group Or a pharmaceutically acceptable salt thereof.
(8)
A phenyl group in which Ar is substituted with two substituents of a 1-tetrazolyl group or a 1,2,4-triazol-1-yl group and a C _1-8 alkyl group or a halogen atom; The compound represented by the said general formula (I) which is a group, an indolyl group, an indolinyl group or a pyrrolopyridyl group, or a pharmaceutically acceptable salt thereof.
(9)
A compound represented by the above general formula (I) or a compound described in the above (1) to (8), or a pharmaceutically acceptable salt thereof, wherein A is CH ₂ and B is a bond.
(10)
A compound represented by the above general formula (I) wherein A is O and B is CH ₂ , or a compound described in (1) to (8) above, or a pharmaceutically acceptable salt thereof.
(11)
A compound represented by the above general formula (I), a compound described in the above (1) to (10), or a pharmaceutically acceptable salt thereof, wherein any one of U and V is N and the other is CH.
(12)
A compound represented by the above general formula (I) wherein U is N and V is CH, or a compound described in the above (1) to (10), or a pharmaceutically acceptable salt thereof.
(13)
A compound represented by the above general formula (I) wherein X ¹ , X ² , X ⁵ and X ⁶ are CH ₂ , a compound described in (1) to (12) above, or a pharmaceutically acceptable salt thereof.
(14)
A compound represented by the above general formula (I), wherein X ¹ , X ² , X ⁵ are CH ₂ and X ⁶ is CH ₂ CH ₂ , or a compound described in (1) to (12) above, or a pharmaceutical thereof Acceptable salt.
(15)
A compound represented by the above general formula (I), a compound described in (1) to (14) above, or a pharmaceutically acceptable salt thereof, wherein X ³ and X ⁴ are a bond.
(16)
A compound represented by the above general formula (I) or a compound described in the above (1) to (12), wherein X ¹ , X ⁴ and X ⁵ are a bond and X ² , X ³ and X ⁶ are CH ₂ , Or a pharmaceutically acceptable salt thereof.
(17)
A compound represented by the above general formula (I) wherein Y is O, a compound described in the above (1) to (16), or a pharmaceutically acceptable salt thereof.
(18)
A compound represented by the above general formula (I) wherein Y is a single bond, or a compound described in the above (1) to (16), or a pharmaceutically acceptable salt thereof.
(19)
The compound represented by the above general formula (I), the compounds described in the above (1) to (18), or a pharmaceutically acceptable salt thereof, wherein R ³ , R ⁴ and R ⁵ are hydrogen atoms.
(20)
A compound represented by the above general formula (I) wherein Z is C (O) OR ¹⁸ or a compound described in the above (1) to (19), or a pharmaceutically acceptable salt thereof.
(21)
The compound according to the above (20), wherein R ¹⁸ is C _1-8 alkyl, or a pharmaceutically acceptable salt thereof.
(22)
Z is a 3-C _1-8 alkyl-1,2,4-oxadiazol-5-yl group, a 5-C _1-8 alkyl-1,2,4-oxadiazol-3-yl group or 5- A compound represented by the above general formula (I) which is a C _1-8 alkylpyrimidin-2-yl group, a compound described in the above (1) to (19), or a pharmaceutically acceptable salt thereof.
(23)
Compounds represented by the above general formula (I), wherein either ^one of R ¹ and R ² is a hydrogen atom and the other is a hydrogen atom, C _1-8 alkyl or halogen atom, or the above (1) to (22) Or a pharmaceutically acceptable salt thereof.

Among the compounds of the present invention represented by the above general formula (II), the following are preferable.
(24)
R ²⁵ and R ²⁶ are the same or different and are a hydrogen atom, a halogen atom, a cyano group, a C _1-8 alkyl group, an alkoxycarbonyl group (alkoxy has 1 to 8 carbon atoms), a C _1-8 alkylsulfonyl group, 3 to 6 The compound of the above general formula (II), which is a membered cycloalkylsulfonyl group, sulfamoyl group, phenylsulfonyl group, or 5- or 6-membered heteroaryl group, or a pharmaceutically acceptable salt thereof.
(25)
A compound represented by the above general formula (II), wherein any one of T ¹ , T ² , T ³ and T ⁴ is C (C _1-8 alkylsulfonyl group), or a pharmaceutically acceptable salt thereof.
(26)
Any one of T ¹ , T ² , T ³ and T ⁴ is C (C _1-8 alkylsulfonyl group), and any one of the remaining is C (C _1-8 alkyl group) or C (halogen atom) A compound represented by the above general formula (II), or a pharmaceutically acceptable salt thereof.
(27)
Any one of T ¹ , T ² , T ³ and T ⁴ is C (1-tetrazolyl group) or C (1,2,4-triazol-1-yl group). Or a pharmaceutically acceptable salt thereof.
(28)
Any one of T ¹ , T ² , T ³ and T ⁴ is C (1-tetrazolyl group) or C (1,2,4-triazol-1-yl group), and any one of the remaining is C ( C _1-8 alkyl group) or C (halogen atom) represented by the above general formula (II), or a pharmaceutically acceptable salt thereof.
(29)
A compound represented by the above general formula (II), a compound described in the above (24) to (28), or a pharmaceutically acceptable salt thereof, wherein B ⁰¹ is a bond.
(30)
A compound represented by the above general formula (II) or a compound described in the above (24) to (28), or a pharmaceutically acceptable salt thereof, wherein A ⁰¹ is CH ₂ and B ⁰¹ is a bond.
(31)
A compound represented by the above general formula (II), wherein any one of U ⁰¹ and V ⁰¹ is N and the other is CH, or a compound described in (24) to (30) above or a pharmaceutically acceptable salt thereof .
(32)
A compound represented by the above general formula (II), wherein U ⁰¹ is N, and V ⁰¹ is CH, or a compound described in the above (24) to (30), or a pharmaceutically acceptable salt thereof.
(33)
A compound represented by the above general formula (II), wherein Z ⁰¹ is C (O) OR ³⁰ , or a compound described in the above (24) to (32), or a pharmaceutically acceptable salt thereof.
(34)
The compound of the above (33), wherein R ³⁰ is C _1-8 alkyl, or a pharmaceutically acceptable salt thereof.
(35)
Z ⁰¹ is a 3-C _1-8 alkyl-1,2,4-oxadiazol-5-yl group, a 5-C _1-8 alkyl-1,2,4-oxadiazol-3-yl group, or 5 A compound represented by the above general formula (II) which is a —C _1-8 alkylpyrimidin-2-yl group, a compound described in the above (24) to (32), or a pharmaceutically acceptable salt thereof.
(36)
The compound represented by the above general formula (II), wherein either one of R ⁰¹ and R ⁰² is a hydrogen atom and the other is a hydrogen atom, C _1-8 alkyl or halogen atom, or the above (24) to (35) Or a pharmaceutically acceptable salt thereof.
(37)
The compound represented by the above general formula (II), wherein R ⁰³ and R ⁰⁴ are hydrogen atoms, the compound described in the above (24) to (36), or a pharmaceutically acceptable salt thereof.
(38)
A compound represented by the above general formula (II) wherein t is 1, a compound described in the above (24) to (37), or a pharmaceutically acceptable salt thereof.
(39)
A compound represented by the above general formula (II) wherein t is 2, a compound described in the above (24) to (37), or a pharmaceutically acceptable salt thereof.

Of the compounds of the present invention represented by the above general formula (III), the following are preferable.
(40)
R ⁰⁷ , R ⁰⁸ and R ⁰⁹ are the same or different, a hydrogen atom, a halogen atom, a cyano group, a C _1-8 alkyl group, an alkoxycarbonyl group (the alkoxy has 1 to 8 carbon atoms), a C _1-8 alkylsulfonyl group, A compound represented by the above general formula (III), which is a 3- to 6-membered cycloalkylsulfonyl group, sulfamoyl group, phenylsulfonyl group, or 5- or 6-membered heteroaryl group, or a pharmaceutically acceptable salt thereof salt.
(41)
A compound represented by the above general formula (III), wherein any one of R ⁰⁷ , R ⁰⁸ and R ⁰⁹ is a C _1-8 alkylsulfonyl group, or a pharmaceutically acceptable salt thereof.
(42)
Any one of R ⁰⁷ , R ⁰⁸ and R ⁰⁹ is a C _1-8 alkylsulfonyl group, and the remaining one is a C _1-8 alkyl group or a halogen atom, and is represented by the above general formula (III) A compound, or a pharmaceutically acceptable salt thereof.
(43)
A compound represented by the above general formula (III), wherein any one of R ⁰⁷ , R ⁰⁸ and R ⁰⁹ is a 1-tetrazolyl group or a 1,2,4-triazol-1-yl group, or a pharmaceutically acceptable salt thereof Salt.
(44)
Any one of R ⁰⁷ , R ⁰⁸ and R ⁰⁹ is a 1-tetrazolyl group or a 1,2,4-triazol-1-yl group, and any one of the remaining is a C _1-8 alkyl group or a halogen atom The compound represented by the above general formula (III), or a pharmaceutically acceptable salt thereof.
(45)
A compound represented by the above general formula (III), wherein A ⁰² is O, and B ⁰² is CH ₂ , or a compound described in (40) to (44) above, or a pharmaceutically acceptable salt thereof.
(46)
A compound represented by the above general formula (III), wherein any one of U ⁰² and V ⁰² is N and the other is CH, or a compound described in the above (40) to (45) or a pharmaceutically acceptable salt thereof .
(47)
A compound represented by the above general formula (III), wherein U ⁰² is N, and V ⁰² is CH, or a compound described in (40) to (45) above, or a pharmaceutically acceptable salt thereof.
(48)
A compound represented by the above general formula (III) wherein Z ⁰² is C (O) OR ⁴² , a compound described in the above (40) to (47), or a pharmaceutically acceptable salt thereof.
(49)
The compound of the above (48), wherein R ⁴² is C _1-8 alkyl, or a pharmaceutically acceptable salt thereof.
(50)
Z ⁰² is a 3-C _1-8 alkyl-1,2,4-oxadiazol-5-yl group, a 5-C _1-8 alkyl-1,2,4-oxadiazol-3-yl group, or 5 A compound represented by the above general formula (III) which is a —C _1-8 alkylpyrimidin-2-yl group, a compound described in the above (40) to (47), or a pharmaceutically acceptable salt thereof.
(51)
Compounds represented by the above general formula (III), wherein any one of R ⁰⁵ and R ⁰⁶ is a hydrogen atom and the other is a hydrogen atom, C _1-8 alkyl or halogen atom, or the above (40) to (50) Or a pharmaceutically acceptable salt thereof.
(52)
A compound represented by the above general formula (III) wherein w is 1, a compound described in the above (40) to (51), or a pharmaceutically acceptable salt thereof.
(53)
A compound represented by the above general formula (III), wherein w is 2, a compound described in the above (40) to (51), or a pharmaceutically acceptable salt thereof.

In the compounds represented by the above general formula (I), (II) or (III), examples of the halogen atom include a fluorine atom, a chlorine atom or a bromine atom, and the C _1-8 alkyl group includes a methyl group. Ethyl group, propyl group, i-propyl group, butyl group, t-butyl group, pentyl group, neopentyl group, hexyl group and the like.
_{Examples of the} C _3-8 cycloalkyl group include a cyclopropyl group, a cyclopentyl group, and a cyclohexyl group.
Examples of the C _1-8 alkoxy group include a methoxy group, an ethoxy group, and a propoxy group. Examples of the C _1-8 alkyl group substituted with 1 to 3 halogen atoms include a chloromethyl group, a fluoromethyl group, and a fluoromethyl group. And a C _1-8 alkoxy group substituted with 1 to 3 halogen atoms includes a fluoromethoxy group or a trifluoromethoxy group.
Further, examples of the alkoxycarbonyl group (alkoxy has 1 to 8 carbon atoms) include a methoxycarbonyl group or an ethoxycarbonyl group, and examples of the acyl group (alkyl has 1 to 8 carbon atoms) include an acetyl group. Examples of the alkylaminocarbonyl group (the alkyl has 1 to 8 carbon atoms) include a methylaminocarbonyl group and an ethylaminocarbonyl group. The dialkylaminocarbonyl group (the alkyl has 2 to 12 carbon atoms) includes Examples thereof include a dimethylaminocarbonyl group and a diethylaminocarbonyl group. Examples of the alkoxycarbonylmethylcarbonyl group (the alkoxy has 1 to 8 carbon atoms) include a methoxycarbonylmethylcarbonyl group and an ethoxycarbonylmethylcarbonyl group.
In addition, examples of the alkylsulfonylmethyl group (wherein the alkyl has 1 to 8 carbon atoms) include a methanesulfonylmethyl group and an ethanesulfonylmethyl group. A C _1-8 alkylamino group includes a methylamino group and an ethylamino group. _{Examples of} the C _2-12 dialkylamino group include a dimethylamino group and a diethylamino group. Examples of the C _1-8 alkylsulfonylamino group include a methanesulfonylamino group and an ethanesulfonylamino group. Examples of the acylamino group (the alkyl has 1 to 8 carbon atoms) include an acetylamino group.
As the C _1-8 alkylsulfinyl group, and the like methylsulfinyl group or ethylsulfinyl group. Examples of the C _1-8 alkylsulfonyl group, such as methanesulfonyl group or ethanesulfonyl group, and 3-6 membered Examples of the cycloalkylsulfonyl group in the ring include a cyclopropylsulfonyl group and a cyclohexylsulfonyl group.
_{Examples of the} C _1-8 alkylaminosulfonyl group include a methylaminosulfonyl group and an ethylaminosulfonyl group. _{Examples of} the C _2-12 dialkylaminosulfonyl group include a dimethylaminosulfonyl group and a diethylaminosulfonyl group.
_{Examples of} the C _1-8 alkyl group substituted with a phenyl group include a benzyl group.
_{Examples of the} C _2-8 alkenyl group include a vinyl group and a propenyl group.
Examples of the 3- to 6-membered cycloalkyl group include a cyclopropyl group and a cyclohexyl group.
A compound represented by the above general formula (I), a substituent which the phenyl group, pyridyl group, indolyl group, indolinyl group or pyrrolopyridyl group of Ar may have, a compound represented by the above general formula (II) R ²⁵ , R ²⁶ and R ⁰⁷ , R ⁰⁸ , R ⁰⁹ of the compound represented by the above general formula (III) as the 5- or 6-membered heteroaryl group include a 1-tetrazolyl group or 1,2,4 -Triazol-1-yl group and the like.

In addition, Z in the above general formula (I), Z ^{01 in} the above general formula (II), and Z ^{02 in} the above general formula (III), a 5- or 6-membered heteroaryl group (the heteroaryl ring is a ring-constituting atom) Having a carbon atom and a nitrogen atom, and further having an oxygen atom or a sulfur atom, and bonded to the nitrogen atom of the azabicyclo ring via a carbon atom constituting the ring), Examples include a 2,4-oxadiazol-5-yl group, a 1,2,4-oxadiazol-3-yl group, and a pyrimidin-2-yl group.
The 5- or 6-membered heteroaryl group of Z, Z ⁰¹ and Z ⁰² is a halogen atom such as a fluorine atom, a C _1-8 alkyl group such as a methyl group, an ethyl group, a propyl group or an i-propyl group, a cyclo Having a substituent such as a C _1-8 alkyl group substituted with 1 to 3 halogen atoms such as a cycloalkyl group having 3 to 7 members such as a propyl group, a cyclopentyl group or a cyclohexyl group, and a trifluoromethyl group; May be.
In the compound represented by the general formula (I), the phenyl group, pyridyl group, indolyl group, indolinyl group, or pyrrolopyridyl group of Ar may have 1 to 3 substituents.
In the compound represented by the above general formula (I), the azabicyclo ring includes 8-azabicyclo [3.2.1] octane, 9-azabicyclo [3.3.1] nonane, 2-azabicyclo [2. 2.1] heptane and 3-oxa-9-azabicyclo [3.3.1] nonane are preferred.
In the compounds represented by the above general formula (I), (II) or (III), pharmaceutically acceptable salts include hydrochlorides, salts with inorganic acids such as sulfates, fumarate, mesyl And salts with organic acids such as acid salts.
In the present invention, the compound represented by the general formula (I), (II) or (III) includes a racemate and an optically active substance.
In the present invention, the compound represented by the general formula (I), (II) or (III) includes these hydrates and solvates.

Next, the manufacturing method of the compound represented by the said general formula (II) or its pharmacologically acceptable salt is shown below.
In the following, A ⁰¹ is CH ₂ and B ⁰¹ is a bond manufacturing method, but other similar compounds can be manufactured by the same method.

<Method A>

(In the formula, Halo represents a halogen atom such as chlorine, bromine or iodine, and L represents a halogen atom such as chlorine, bromine or iodine, or a leaving group such as a methanesulfonyloxy group or p-toluenesulfonyloxy group. R ⁰¹ , R ⁰² , R ⁰³ , R ⁰⁴ , T ¹ , T ² , T ³ , T ⁴ , U ⁰¹ , V ⁰¹ , Z ⁰¹ , and t are the same as above)

1) The starting material (a) can be synthesized by a known method (such as M.V.Cheliah et.al., J. Med. Chem., 2007, 50, 5147, WO2006014213), or a method analogous thereto. it can. The starting material (b) can be synthesized by a known method (G. Shyamali et.al., Can. J. Chem., 2006, 84, 555, WO2007081995, etc.) and a method according thereto.

2) The reaction of the starting material (a) and the starting material (b) in the first step is carried out in a solvent not involved in the reaction such as toluene, tetrahydrofuran, dioxane, N, N-dimethylformamide, potassium carbonate, cesium carbonate, sodium carbonate, etc. In the presence of a base of a compound of the general formula (c) by using a catalyst such as tetrakis (triphenylphosphine) palladium, [1,1′-bis (diphenylphosphino) ferrocene] palladium (II) dichloride dichloromethane complex or the like. Compounds can be obtained. In this case, the reaction temperature is 20 ° C. to 110 ° C.

3) Step 2 Conversion of the compound of the general formula (c) into the compound of the general formula (d) is a method in which catalytic hydrogenation is performed using palladium-carbon or the like as a catalyst in a solvent such as methanol or ethanol that does not participate in the reaction. It can be carried out.

4) Step 3 Conversion of the compound of the general formula (d) to the compound of the general formula (e) is performed in the presence or absence of a base such as pyridine or triethylamine in a solvent such as toluene or dichloromethane. , Methanesulfonyl chloride, p-toluenesulfonyl chloride, thionyl chloride and the like can be reacted.

5) Step 4 Conversion of the compound of the general formula (e) to the compound of the general formula (g) is carried out by using potassium hydroxide, hydrogenation in a solvent such as toluene, N, N-dimethylformamide, acetone, etc. The reaction can be carried out by reacting the compound of general formula (f) in the presence of a base such as sodium or potassium carbonate, in the presence or absence of an additive such as crown ether. In this case, the reaction temperature is from room temperature to 130 ° C.

Moreover, the compound represented by general formula (g) can be manufactured also by the following B method.

<Method B>

(In the formula, Halo represents a halogen atom such as chlorine, bromine or iodine, and L represents a halogen atom such as chlorine, bromine or iodine, or a leaving group such as a methanesulfonyloxy group or p-toluenesulfonyloxy group. R ⁰¹ , R ⁰² , R ⁰³ , R ⁰⁴ , T ¹ , T ² , T ³ , T ⁴ , U ⁰¹ , V ⁰¹ , Z ⁰¹ , and t are the same as above)

1) First Step Conversion of the starting material (a) into the compound of the general formula (h) can be carried out in the same manner as described in the above Method A.

2) Step 2 Conversion of the compound of the general formula (h) to the compound of the general formula (i) can be performed in the same manner as described in the above-mentioned method A.

3) Step 3 Conversion of the compound of the general formula (i) to the compound of the general formula (j) can be performed in the same manner as described in the method A.

4) Fourth Step The conversion of the compound of the general formula (j) into the compound of the general formula (g) can be performed in the same manner as described in the method A.


Next, the manufacturing method of the compound represented by the said general formula (III) or its pharmacologically acceptable salt is shown below.
In the following, a production method in which A ⁰² is O and B ⁰² is CH ₂ is exemplified, but other similar compounds can be produced by the same method.

<Method C>

(In the formula, R ⁰⁵ , R ⁰⁶ , R ⁰⁷ , R ⁰⁸ , R ⁰⁹ , Q, U ⁰² , V ⁰² , Z ⁰² , and w are the same as described above.)

1) The starting material (k) can be synthesized in the same manner as described in the above method A.

2) Step 1 Conversion of the compound of the general formula (k) into the compound of the general formula (m) can be carried out in a solvent that does not participate in the reaction such as tetrahydrofuran, dioxane, toluene, and the like, such as diethyl azodicarboxylate, diisopropyl azodicarboxylate The reaction can be carried out by reacting the azodicarboxylic acid ester with the phenol represented by the general formula (1) or heteroaryl alcohol in the presence of triphenylphosphine or the like. In this case, the reaction temperature is 0 ° C. to 80 ° C.

Further, the conversion of the compound of the general formula (k) into the compound of the general formula (m) can also be performed by the following method D.

<Method D>

(In the formula, L represents a halogen atom such as chlorine, bromine and iodine, or a leaving group such as a methanesulfonyloxy group and a p-toluenesulfonyloxy group, and R ⁰⁵ , R ⁰⁶ , R ⁰⁷ , R ⁰⁸ , R ⁰⁹ , Q, U ⁰² , V ⁰² , Z ⁰² , and w are the same as above.)

1) First Step Conversion of the compound of general formula (k) to the compound of general formula (n) can be carried out in the same manner as described in the above-mentioned method A.

2) Step 2 Conversion of the compound of the general formula (n) to the compound of the general formula (m) can be carried out by using sodium hydride, potassium carbonate, etc. in a solvent not involved in the reaction such as N, N-dimethylformamide, acetone, etc. In the presence of a base, the reaction can be carried out by reacting the phenol represented by the general formula (l) and a heteroaryl alcohol. In this case, the reaction temperature is 0 ° C. to 80 ° C.


Moreover, the compound represented by general formula (m) can be manufactured also by the following E method.

<Method E>

(In the formula, Halo represents a halogen atom such as chlorine, bromine or iodine, and L represents a halogen atom such as chlorine, bromine or iodine, or a leaving group such as a methanesulfonyloxy group or p-toluenesulfonyloxy group. ^{represents, R 05, R 06, R} 07, R 08, R 09, Q, U 02, V 02, Z 02, and w are as defined above.)

1) The starting material (o) can be synthesized in the same manner as described in the above method A.

2) The conversion of the starting material (o) of the first step into the compound of the general formula (p) can be carried out in the same manner as described in the method D above.

3) Second Step The conversion of the compound of the general formula (p) into the compound of the general formula (q) can be performed in the same manner as described in the method A.

4) Step 3 Conversion of the compound of the general formula (q) to the compound of the general formula (m) can be performed in the same manner as described in the method A above.

The compound represented by the general formula (I), (II) or (III) can also be produced by referring to the above production method, examples described later, and the above-mentioned patent documents 1 to 4 and the like.

Examples of representative compounds of the present invention are shown below.
(Representative compound example 1)

(In the formula, R ⁴² , R ⁴³ , R ⁴⁴ , R ⁴⁵ , R ⁴⁶ , A, B, U, V, Q and R ⁴¹ are as described in Tables 1 to 3.)

(Representative compound example 2)

(Wherein R ⁴² , R ⁴³ , R ⁴⁴ , R ⁴⁵ , R ⁴⁶ , A, B, U, V, Q and R ⁴¹ are as described in Tables 4 to 6)

(Representative compound example 3)

(In the formula, Ar, A, B, R ⁴⁵ , R ⁴⁶ , X ⁴⁰ , Q and R ⁴¹ are as described in Tables 7 and 8.)

Next, pharmacological tests are described.
(Pharmacological experiment 1)
The GPR119 agonistic effect was examined by measuring the effect of increasing the intracellular cAMP level of the test compound in cells into which human GPR119 was introduced. The test method is shown below.
(1) Construction of human GPR119 constant expression cells The human GPR119 gene (NM_178471) was purchased from ATCC (ATCC No. 10807349), and PCR amplification was performed so that a BamHI site was formed on the 5 ′ side and an Apa I site was formed on the 3 ′ side. (Primers: tcctggatccatggaatcatctttctcatt (SEQ ID NO: 1), tcctggggcccctagcacatactactgagc (SEQ ID NO: 2)). PCR conditions are as follows. Single-stranded DNA in which double-stranded DNA was heat denatured at 98 ° C. for 10 seconds per cycle using DNA polymerase (KOD-Plus-Ver.2; TOYOBO # KOD-211) and primer was denatured at 55 ° C. for 30 seconds. Followed by DNA elongation at 68 ° C. for 1 minute 15 seconds. This was repeated for 35 cycles. The PCR product was inserted as an insert into plasmid pcDNA5 / FRT / TO (Invitrogen # V6520-20), and the resulting plasmid was introduced into Flp-in T-Rex-293 cells (invitrogen # R78007). The introduction method was performed according to the product protocol.

(2) Intracellular cAMP measurement method Human GPR119 constant expression cells prepared by the above method were seeded in a 96-well plate to a concentration of 2500 cells / well (the medium contains 10% fetal bovine serum (FBS), Dulbecco's Modified Eagle Medium (DMEM) medium was used). Twenty-four hours after seeding the cells, tetracyclin (invitrogen # Q10019) (final concentration 20 ng / mL) was added to induce the expression of hGPR119. After 24 hours, the medium was discarded, and stimulation was performed at 37 ° C. for 30 minutes with assay buffer (0.5 mM IBMX PBS (−)) containing the test compound. The amount of intracellular cAMP was measured using a commercially available kit (HitHunter ^™ cAMP XS + Assay (GE Healthcare # 90007503)) and a measuring machine (FLUOstar Optima: BMG LABTECH). The test compound was dissolved in 100% DMSO and added at a final concentration of 1%.

(3) Test results As is clear from Table 9 of Example 13 and Table 10 of Example 14 which will be described later, the compounds described in the Examples showed excellent GPR119 agonist activity.

Therefore, since the compound represented by the above general formula (I), (II) or (III), or a pharmaceutically acceptable salt thereof has a GPR119 agonistic action and a blood glucose lowering action, it is used as a therapeutic agent for diabetes. It is also expected to be applied to lifestyle-related diseases such as obesity and metabolic syndrome.
The compound represented by the above general formula (I), (II) or (III), or a pharmaceutically acceptable salt thereof can also be used in combination with a known therapeutic agent for diabetes.

The compound represented by the above general formula (I), (II) or (III), or a pharmaceutically acceptable salt thereof is administered to a human by an appropriate administration method such as oral administration or parenteral administration. can do. It can also be used in combination with other therapeutic agents for diabetes.
For formulation, it can be produced into a dosage form such as a tablet, granule, powder, capsule, suspension, injection, suppository and the like by a conventional method in the technical field of formulation.
For these preparations, for example, in the case of tablets, usual excipients, disintegrants, binders, lubricants, pigments and the like are used. Here, as the excipient, lactose, D-mannitol, crystalline cellulose, glucose and the like are used, as the disintegrant, starch, carboxymethylcellulose calcium (CMC-Ca) and the like, as the lubricant, magnesium stearate, Examples of binders include talc and the like, hydroxypropylcellulose (HPC), gelatin, polyvinylpyrrolidone (PVP), and the like. Solvents, stabilizers, solubilizers, suspending agents, emulsifiers, soothing agents, buffers, preservatives and the like are used for the preparation of injections.

In general, for adults, the compound represented by the above general formula (I), (II) or (III), which is an active ingredient in an injection, or a pharmaceutically acceptable salt thereof is about 0. 01 mg to 100 mg, orally 1 mg to 2000 mg per day, but may be increased or decreased depending on age, symptoms, etc.
EXAMPLES Next, although an Example is given and this invention is demonstrated further in detail, this invention is not limited to these.

3- [2- (4-Methanesulfonylphenoxymethyl) pyridin-5-yl] -8-azabicyclo [3.2.1] octane-8-carboxylate t-butyl

(1) t-butyl 3- [2- (t-butyldimethylsilyloxymethyl) pyridin-5-yl] -8-azabicyclo [3.2.1] oct-2-ene-8-carboxylate

5-Bromo-2- (t-butyldimethylsilyloxymethyl) pyridine (2.67 g, 6.86 mmol) and 3- (4,4,5,5-tetramethyl [1,3,2] dioxaborolane-2- Yl) -8-azabicyclo [3.2.1] oct-2-ene-8-carboxylate t-butyl (2.30 g, 6.86 mmol) was dissolved in anhydrous dimethylformamide (34 mL) and [1,1 -Bis (diphenylphosphino) ferrocene] dichloropalladium (II) -dichloromethane adduct (112 mg, 0.14 mmol) and cesium carbonate (4.47 g, 13.72 mmol) were added. After stirring overnight at 90 ° C., the mixture was allowed to cool to room temperature, water was added, and the mixture was extracted with ethyl acetate. The organic layer was washed with saturated brine, dried over anhydrous sodium sulfate, and the solvent was evaporated under reduced pressure. The obtained residue was purified by silica gel column chromatography (hexane: acetone = 12: 1) to give the title compound (2.02 g, yield 68%) as a pale yellow oil.

¹ H NMR (CDCl ₃ , 400 MHz): δ =
0.11 (6H, s),
0.95 (9H, s),
1.50 (9H, s),
1.6-1.8 (1H, m),
1.9-2.1 (2H, m),
2.1-2.3 (2H, m),
2.9-3.2 (1H, m),
4.3-4.6 (2H, m),
4.81 (2H, s),
6.47 (1H, br s),
7.44 (1H, d, J = 8 Hz),
7.65 (1H, dd, J = 2 Hz, 8 Hz),
8.48 (1H, d, J = 2 Hz).

(2) 3- (2-hydroxymethylpyridin-5-yl) -8-azabicyclo [3.2.1] octane-8-carboxylate t-butyl 3- [2- (t-butyldimethyl) obtained above Silyloxymethyl) pyridin-5-yl] -8-azabicyclo [3.2.1] oct-2-ene-8-carboxylate t-butyl (800 mg, 1.85 mmol) was dissolved in anhydrous tetrahydrofuran (19 mL). , 1.0 M tetrabutylammonium fluoride-tetrahydrofuran solution (2.78 mL, 2.78 mmol) was added, and the mixture was stirred at room temperature for 2 hours. Ethyl acetate was added to the reaction mixture, and the organic layer was washed with saturated brine, dried over anhydrous sodium sulfate, and the solvent was evaporated under reduced pressure.
The obtained residue was dissolved in methanol (15 mL), 10% palladium-carbon (47 mg) was added, and catalytic hydrogenation was performed at room temperature for 1 hour at 1 atmosphere. The reaction mixture was filtered through celite, and the filtrate was concentrated under reduced pressure to give the title compound (473 mg, yield 80%, diastereomer ratio = 1: 2) as a colorless transparent oil.

¹ H NMR (CDCl ₃ , 400 MHz): δ =
1.50 (9H, s),
1.6-2.1 (5H, m),
2.4-3.0 (3.33H, m),
3.1-3.2 (0.67H, m),
4.2-4.5 (2H, m),
4.7-4.9 (2H, m),
7.2-7.3 (1H, m),
7.58 (0.67H, d, J = 8Hz),
7.65 (0.33H, d, J = 8 Hz),
8.43 (0.67H, s),
8.45 (0.33H, s).

(3) t-butyl 3- [2- (4-methanesulfonylphenoxymethyl) pyridin-5-yl] -8-azabicyclo [3.2.1] octane-8-carboxylate

Under nitrogen atmosphere, tert-butyl 3- (2-hydroxymethylpyridin-5-yl) -8-azabicyclo [3.2.1] octane-8-carboxylate (24 mg, 0.075 mmol) obtained above was chlorinated. It melt | dissolved in the methylene (0.8 mL), and triethylamine (0.016 mL, 0.12 mmol) was added under ice-cooling. Subsequently, methanesulfonyl chloride (7 μL, 0.095 mmol) was added dropwise, and after stirring at room temperature for 3 hours, water (1 mL) was added and extracted with methylene chloride. The organic layer was washed with saturated brine, dried over anhydrous sodium sulfate, and the solvent was evaporated under reduced pressure to give 3- [2- (methanesulfonyloxymethyl) pyridin-5-yl] -8-azabicyclo [3.2. .1] A crude product of t-butyl octane-8-carboxylate was obtained.
Next, 4-methanesulfonylphenol (16 mg, 0.098 mmol) is dissolved in N, N-dimethylformamide (0.8 mL) under a nitrogen atmosphere, and sodium hydride (5 mg, 0.119 mmol) is added under ice cooling. added. After stirring at room temperature for 30 minutes, the 3- [2- (methanesulfonyloxymethyl) pyridin-5-yl] -8-azabicyclo [3.2.1] octane-8-carvone obtained above was again cooled on ice. A solution of t-butyl acid in N, N-dimethylformamide (0.4 mL) was added. After stirring at room temperature for 3 hours and at 50 ° C. for 1 hour, the mixture was allowed to cool to room temperature, water was added, and the mixture was extracted with ethyl acetate. The organic layer was washed with saturated brine, dried over anhydrous sodium sulfate, and the solvent was evaporated under reduced pressure. The obtained residue was purified by silica gel column chromatography (hexane: ethyl acetate = 1: 2) to give the title compound (21 mg, yield 56%, diastereomer ratio = 1: 2) as a pale yellow amorphous product. .

FAB-MS (m / z): 473 (M + 1)
¹ H NMR (CDCl ₃ , 400 MHz): δ =
1.34 (9H, s),
1.6-2.2 (7.33H, m),
2.4-2.6 (0.67H, m),
2.6-2.8 (0.33H, m),
3.03 (3H, s),
3.1-3.3 (0.67H, m),
4.2-4.5 (2H, m),
5.24 (2H, s),
7.0-7.2 (2H, m),
7.3-7.5 (1H, m),
7.54 (0.67H, dd, J = 2Hz, 8Hz),
7.59 (0.33H, dd, J = 2Hz, 8Hz),
7.8-7.9 (2H, m),
8.44 (0.67H, d, J = 2 Hz),
8.52 (0.33H, d, J = 2 Hz).

3- [2- [4- (Tetrazol-1-yl) phenoxymethyl] pyridin-5-yl] -8-azabicyclo [3.2.1] octane-8-carboxylate t-butyl

Example 1 (3) was prepared using t-butyl 3- (2-hydroxymethylpyridin-5-yl) -8-azabicyclo [3.2.1] octane-8-carboxylate (46 mg, 0.144 mmol). A crude methanesulfonylate was obtained by the described method.
Next, 1- (4-hydroxyphenyl) tetrazole (21 mg, 0.13 mmol) was dissolved in ethanol, and potassium hydroxide solution (0.5 M ethanol solution, 0.26 mL, 0.13 mmol) was added. After stirring at room temperature for 15 minutes, the solvent was distilled off under reduced pressure to dryness. The obtained residue was dissolved in N, N-dimethylformamide (1 mL) under a nitrogen atmosphere, and a crude solution of methanesulfonylated N, N-dimethylformamide (0.5 mL) was added under ice cooling. After stirring at room temperature for 20 hours, water was added and the mixture was extracted with ethyl acetate. The organic layer was washed with saturated brine, dried over anhydrous sodium sulfate, and the solvent was evaporated under reduced pressure. The obtained residue was purified by silica gel column chromatography (hexane: ethyl acetate = 1: 4) to give the title compound (21 mg, yield 32%, diastereomer ratio = 1: 2) as pale brown crystals. .

FAB-MS (m / z): 463 (M + 1)
m. p. : 154-155 ° C
¹ H NMR (CDCl ₃ , 400 MHz): δ =
1.50 (9H, s),
1.5-2.2 (7H, m),
2.4-2.6 (1H, m),
2.6-2.8 (0.33H, m),
3.0-3.2 (0.67H, m),
4.2-4.5 (2H, m),
5.24 (2H, s),
7.1-7.2 (2H, m),
7.4-7.5 (1H, m),
7.5-7.6 (3H, m),
8.46 (0.67H, d, J = 2 Hz),
8.50 (0.33H, d, J = 2 Hz),
8.91 (1H, s).

3- [2- (5-Methanesulfonylindol-1-ylmethyl) pyridin-5-yl] -8-azabicyclo [3.2.1] octane-8-carboxylate t-butyl

Example 1 (3) was prepared using t-butyl 3- (2-hydroxymethylpyridin-5-yl) -8-azabicyclo [3.2.1] octane-8-carboxylate (50 mg, 0.157 mmol). A crude methanesulfonylate was obtained by the described method.
The above crude methanesulfonylated product, 5-methanesulfonylindole (31 mg, 0.157 mmol), potassium hydroxide (36 mg, 0.157 mmol) and 18-crown-6-ether (41 mg, 0.157 mmol) were mixed with anhydrous toluene. (1.6 mL), and heated and stirred at 80 ° C. overnight. After cooling to room temperature, water was added and the mixture was extracted with ethyl acetate. The organic layer was washed with saturated brine, dried over anhydrous sodium sulfate, and the solvent was evaporated under reduced pressure. The obtained residue was purified by silica gel column chromatography (hexane: ethyl acetate = 1: 2) to give the title compound (14 mg, yield 19%, diastereomer ratio = 1: 10) as a white amorphous substance.

FAB-MS (m / z): 496 (M + 1)
¹ H NMR (CDCl ₃ , 400 MHz): δ =
1.49 (9H, s),
1.5-2.1 (7.8H, m),
2.4-2.6 (0.2H, m),
2.6-2.7 (0.1 H, m),
3.0-3.2 (0.9H, m),
3.07 (3H, s),
4.1-4.5 (2H, m),
5.46 (2H, s),
6.6-6.8 (2H, m),
7.3-7.4 (2H, m),
7.4-7.5 (1H, m),
7.5-7.6 (0.1 H, m),
7.70 (0.9H, dd, J = 2Hz, 9Hz),
8.2-8.3 (1H, m),
8.43 (0.9H, d, J = 2Hz),
8.47 (0.1 H, d, J = 2 Hz).

8- (5-Ethylpyrimidin-2-yl) -3- [2- (4-methanesulfonylphenoxymethyl) pyridin-5-yl] -8-azabicyclo [3.2.1] octane

T-butyl 3- [2- (4-methanesulfonylphenoxymethyl) pyridin-5-yl] -8-azabicyclo [3.2.1] octane-8-carboxylate as described in Example 1 (50 mg,. 11 mmol) was dissolved in dichloromethane (0.55 mL) and trifluoroacetic acid (0.55 mL) was added. After stirring at room temperature for 2 hours, the reaction solution was concentrated to dryness under reduced pressure.
The obtained crude 3- [2- (4-methanesulfonylphenoxymethyl) pyridin-5-yl] -8-azabicyclo [3.2.1] octane was dissolved in anhydrous acetonitrile (1 mL), and potassium carbonate ( 76 mg, 0.55 mmol) and 2-chloro-5-ethylpyrimidine (26 μL, 0.22 mmol) were added. After heating and stirring at 80 ° C. for 12 hours, the mixture was allowed to cool to room temperature, water was added, and the mixture was extracted with ethyl acetate. The organic layer was washed with saturated brine, dried over anhydrous sodium sulfate, and the solvent was evaporated under reduced pressure. The obtained residue was purified by silica gel column chromatography (hexane: ethyl acetate = 1: 2) to give the title compound (10 mg, yield 19%, diastereomer ratio = 1: 7) as white crystals.

FAB-MS (m / z): 479 (M + 1)
¹ H NMR (CDCl ₃ , 400 MHz): δ =
1.1-1.3 (3H, m),
1.6-2.2 (7.74H, m),
2.4-2.6 (2H, m),
2.6-2.7 (0.39H, m),
3.02 (3H, s),
3.2-3.4 (0.87H, m),
4.7-4.9 (2H, m),
5.21 (1.74H, s),
5.23 (0.26H, s),
7.0-7.2 (2H, m),
7.34 (0.87H, d, J = 8Hz),
7.38 (0.13H, d, J = 8 Hz),
7.48 (0.87H, dd, J = 2Hz, 8Hz),
7.60 (0.13H, dd, J = 2Hz, 8Hz),
7.8-7.9 (2H, m),
8.19 (0.26H, s),
8.20 (1.74H, s),
8.42 (0.87H, d, J = 2Hz),
8.48 (0.13H, d, J = 2 Hz).

8- (5-Isopropyl- [1.2.4] oxadiazol-3-yl) -3- [2- (4-methanesulfonylphenoxymethyl) pyridin-5-yl] -8-azabicyclo [3.2 .1] Octane

(1) 3- [2- (4-Methanesulfonylphenoxymethyl) pyridin-5-yl] -8-azabicyclo [3.2.1] octane-8-carbonitrile

A crude product (0.41 mmol) of 3- [2- (4-methanesulfonylphenoxymethyl) pyridin-5-yl] -8-azabicyclo [3.2.1] octane obtained by the method described in Example 4 was obtained. Dissolved in dichloromethane (1 mL) and a solution of sodium bicarbonate (69 mg, 0.82 mmol) in water (1 mL) was added. Under ice cooling, a solution of cyanogen bromide (24 mg, 0.227 mmol) in dichloromethane (1 mL) was added, and the mixture was stirred for 30 minutes, and further stirred at room temperature for 2 hours. The reaction mixture was poured into saturated multistory water and extracted with ethyl acetate. The organic layer was washed with saturated brine, dried over anhydrous sodium sulfate, and the solvent was evaporated under reduced pressure. The obtained residue was purified by silica gel column chromatography (hexane: ethyl acetate = 1: 4) to give the title compound (127 mg, yield 78%, diastereomeric ratio = 1: 2) as a colorless transparent oil. It was.

FAB-MS (m / z): 398 (M + 1)
¹ H NMR (CDCl ₃ , 400 MHz): δ =
1.6-2.3 (7.33H, m),
2.50-2.7 (0.67H, m),
3.0-3.3 (1H, m),
3.03 (3H, m),
4.1-4.2 (2H, m),
5.25 (2H, s),
7.1-7.2 (2H, m),
7.4-7.5 (1H, m),
7.6-7.7 (1H, m),
7.8-7.8 (2H, m),
8.49 (0.67H, d, J = 2 Hz),
8.57 (0.33H, d, J = 2 Hz).

(2) N-hydroxy-3- [2- (4-methanesulfonylphenoxymethyl) pyridin-5-yl] -8-azabicyclo [3.2.1] octane-8-carboxamidine

3- [2- (4-Methanesulfonylphenoxymethyl) pyridin-5-yl] -8-azabicyclo [3.2.1] octane-8-carbonitrile (127 mg, 0.32 mmol) obtained above was added to ethanol ( 1.6%), 50% aqueous hydroxylamine solution (0.26 mL) was added, and the mixture was stirred at 60 ° C. for 3 hours. The reaction mixture was returned to room temperature, and the solvent was distilled off under reduced pressure to obtain the title compound (116 mg, yield 84%).

FAB-MS (m / z): 431 (M + 1)

(3) 8- (5-Isopropyl- [1.2.4] oxadiazol-3-yl) -3- [2- (4-methanesulfonylphenoxymethyl) pyridin-5-yl] -8-azabicyclo [ 3.2.1] Octane

N-hydroxy-3- [2- (4-methanesulfonylphenoxymethyl) pyridin-5-yl] -8-azabicyclo [3.2.1] octane-8-carboxamidine (116 mg, 0.27 mmol), isobutyric acid ( 53 μL, 0.27 mmol) and 1-hydroxybenzotriazole monohydrate (45 mg, 0.30 mmol) were dissolved in N, N-dimethylformamide (2.7 mL), and diisopropylethylamine (155 μL, 0.89 mmol), 1- (3-dimethylaminopropyl) -3-ethylcarbodiimide hydrochloride (62 mg, 0.32 mmol) was added. After stirring at room temperature for 6 hours, the reaction mixture was poured into saturated multistory water, extracted with ethyl acetate, dried over anhydrous sodium sulfate, and the solvent was distilled off under reduced pressure. The obtained residue was suspended in toluene (5.4 mL) and heated to reflux for 6 hours. The reaction mixture was returned to room temperature, the solvent was distilled off under reduced pressure, and the obtained residue was purified by silica gel column chromatography (hexane: ethyl acetate 1: 4) to give the title compound (81 mg, yield 62%, dia). Stereomer ratio = 1: 2) was obtained as white crystals.

FAB-MS (m / z): 483 (M + 1)
m. p. 165-167 ° C
¹ H NMR (CDCl ₃ , 400 MHz): δ =
1.37 (6H, d, J = 7 Hz),
1.8-3.3 (10H, m),
3.02 (2.01H, s),
3.03 (0.99H, s),
4.3-4.5 (2H, m),
5.23 (1.34H, s),
5.24 (0.66H, s),
7.0-7.2 (2H, m),
7.3-7.5 (1H, m),
7.52 (0.67H, dd, J = 2, 8 Hz),
7.62 (0.33H, dd, J = 2, 8 Hz),
7.8-7.9 (2H, m),
8.45 (0.67H, d, J = 2 Hz),
8.51 (0.33H, d, J = 2 Hz).

5- [2- (4-Methanesulfonylphenoxymethyl) pyridin-5-yl] -2-azabicyclo [2.2.1] heptane-2-carboxylate t-butyl

(1) 5-Bromo-2- (4-methanesulfonylphenoxymethyl) pyridine

5-Bromo-2- (hydroxymethyl) pyridine (344 mg, 2.0 mmol), 4-methanesulfonylphenol (376 mg, 2.0 mmol) and triphenylphosphine (577 mg, 2.2 mmol) are dissolved in anhydrous tetrahydrofuran (20 mL). did. It cooled to 0 degreeC and the 2.2 mol / L toluene solution (1.0 mL, 2.2 mmol) of diethyl azodicarboxylate was dripped. After stirring at room temperature for 16 hours, ethyl acetate was added to the reaction solution, washed with 1N aqueous sodium hydroxide solution, dried over anhydrous sodium sulfate, and the solvent was distilled off under reduced pressure. The obtained residue was purified by silica gel column chromatography (methylene chloride: ethyl acetate = 10: 1) to give the title compound (636 mg, yield 93%) as white crystals.

¹ H NMR (CDCl ₃ , 400 MHz): δ =
3.04 (3H, s),
5.23 (2H, s),
7.10 (2H, d, J = 9 Hz),
7.40 (1H, d, J = 8 Hz),
7.8-7.9 (3H, m),
8.68 (1H, d, J = 2 Hz).

(2) 5- [2- (4-Methanesulfonylphenoxymethyl) pyridin-5-yl] -2-azabicyclo [2.2.1] heptane-2-carboxylate t-butyl

5-bromo-2- (4-methanesulfonylphenoxymethyl) pyridine obtained above (150 mg, 0.44 mmol), Nt-butoxycarbonyl-2-azanorbornene (86 mg, 0.44 mmol), piperidine (135 μL, 1.36 mmol), palladium acetate (5 mg, 0.022 mmol), triphenylphosphine (12 mg, 0.044 mmol) and formic acid (43 μL, 1.14 mmol) were suspended in anhydrous N, N-dimethylformamide (1 mL), The mixture was heated and stirred at 80 ° C. for 6 hours. After cooling to room temperature, water was added and the mixture was extracted with ethyl acetate. The organic layer was washed with saturated brine, dried over anhydrous sodium sulfate, and the solvent was evaporated under reduced pressure. The obtained residue was purified by silica gel column chromatography (hexane: ethyl acetate = 1: 2, chloroform: ethyl acetate = 1: 1) to give the title compound (4 mg, yield 2%, diastereomer ratio = 2). 3) was obtained as a white amorphous.

FAB-MS (m / z): 459 (M + 1)
¹ H NMR (CDCl ₃ , 400 MHz): δ =
1.48 (3.6H, s),
1.51 (5.4H, s),
1.5-1.7 (2H, m),
1.9-2.0 (2H, m),
2.6-2.8 (1H, m),
3.0-3.1 (3.4H, m),
3.1-3.4 (2.6H, m),
4.12 (0.6H, s),
4.34 (0.4H, s),
5.25 (2H, s),
7.11 (2H, d, J = 9 Hz),
7.39 (0.4H, d, J = 8 Hz),
7.43 (0.6 H, d, J = 8 Hz),
7.54 (0.6H, d, J = 8Hz),
7.58 (0.4H, d, J = 8Hz),
7.87 (2H, d, J = 9 Hz),
8.50 (1H, s).

3- [2- (7-Fluoro-5-nitroindol-1-ylmethyl) pyridin-5-yl] -8-azabicyclo [3.2.1] octane-8-carboxylate t-butyl

(1) 3-[(2-tert-butyldimethylsilyloxymethyl) -3-fluoropyridin-5-yl] -8-azabicyclo [3.2.1] oct-2-ene-8-carboxylic acid t- Butyl 5-bromo- (2-tert-butyldimethylsilyloxymethyl) -3-fluoropyridine (376 mg, 1.17 mmol) and 3- (4,4,5,5-tetramethyl [1,3,2] dioxaborolane -2-yl) -8-azabicyclo [3.2.1] oct-2-ene-8-carboxylate t-butyl (394 mg, 1.17 mmol) in the same manner as in Example 1 (1). The title compound (245 mg, yield 47%) was obtained as a colorless oil.

¹ H NMR (CDCl ₃ , 400 MHz): δ =
0.11 (6H, s),
0.91 (9H, s),
1.45 (9H, s),
1.6-1.8 (1H, m),
1.9-2.1 (2H, m),
2.1-2.3 (2H, m),
2.9-3.2 (1H, m),
4.4-4.6 (2H, m),
4.84 (2H, s),
6.54 (1H, br s),
7.30 (1H, d, J = 11 Hz),
8.39 (1H, s).

(2) t-butyl 3- (3-fluoro-2-hydroxymethylpyridin-5-yl) -8-azabicyclo [3.2.1] oct-2-ene-8-carboxylate (2-t-Butyldimethylsilyloxymethyl-3-fluoropyridin-5-yl) -8-azabicyclo [3.2.1] oct-2-ene-8-carboxylate t-butyl (245 mg, 0.546 mmol ) Was dissolved in anhydrous tetrahydrofuran (5.5 mL), and 1.0 M tetrabutylammonium fluoride-tetrahydrofuran solution (0.66 mL, 0.655 mmol) was added. After stirring at room temperature for 1 hour, water was added and the mixture was extracted with ethyl acetate. The organic layer was washed with saturated brine, dried over anhydrous sodium sulfate, and the solvent was evaporated under reduced pressure. The obtained residue was purified by silica gel column chromatography (hexane: ethyl acetate = 7: 1 → 0: 100) to give the title compound (177 mg, yield 97%) as a yellow oil.

¹ H NMR (CDCl ₃ , 400 MHz): δ =
1.45 (9H, s),
1.6-1.8 (1H, m),
1.9-2.1 (2H, m),
2.1-2.3 (2H, m),
2.9-3.2 (1H, m),
3.76 (1H, br s),
4.4-4.6 (2H, m),
4.81 (2H, d, J = 2 Hz),
6.54 (1H, s),
7.33 (1H, dd, J = 2 Hz, 11 Hz),
8.3-8.4 (1H, m).

(3) 3- (3-Fluoro-2-hydroxymethylpyridin-5-yl) -8-azabicyclo [3.2.1] octane-8-carboxylate t-butyl obtained above -2-hydroxymethylpyridin-5-yl) -8-azabicyclo [3.2.1] oct-2-ene-8-carboxylate t-butyl (177 mg, 0.529 mmol) in methanol (2.6 mL)- It melt | dissolved in the tetrahydrofuran (2.6 mL) liquid mixture, 10% palladium carbon (18 mg) was added, and catalytic hydrogenation was performed for 23 hours at 1 atmosphere of room temperature. The reaction mixture was filtered through celite, and the filtrate was concentrated under reduced pressure. The obtained residue was purified by silica gel column chromatography (hexane: tetrahydrofuran = 6: 1), and diastereomer A (later eluted; 80 mg, 45% yield) and diastereomer B (first eluted) of the title compound. Each yielded 33 mg, 19% yield) as a colorless oil.

Diastereomer A
¹ H NMR (CDCl ₃ , 400 MHz): δ =
1.50 (9H, s),
1.7-2.0 (6H, m),
2.0-2.1 (2H, m),
3.1-3.2 (1H, m),
3.74 (1H, br s),
4.2-4.5 (2H, m),
4.79 (2H, s),
7.20 (1H, dd, J = 2 Hz, 10 Hz),
8.2-8.3 (1H, m).

Diastereomer B
¹ H NMR (CDCl ₃ , 400 MHz): δ =
1.50 (9H, s),
1.4-1.6 (2H, m),
1.5-1.7 (2H, m),
2.0-2.1 (2H, m),
2.4-2.6 (2H, m),
2.6-2.8 (1H, m),
3.95 (1H, br s),
4.2-4.4 (2H, m),
4.79 (2H, s),
7.26 (1H, dd, J = 2Hz, 10Hz),
8.28 (1H, s).

(4) 3- [3-Fluoro-2- (7-fluoro-5-nitroindol-1-ylmethyl) pyridin-5-yl] -8-azabicyclo [3.2.1] octane-8-carboxylic acid t -Butyl diastereomer A of t-butyl 3- (3-fluoro-2-hydroxymethylpyridin-5-yl) -8-azabicyclo [3.2.1] octane-8-carboxylate obtained above (124 mg , 0.369 mmol) and diastereomer B (48 mg, 0.143 mmol) and diastereomer A (171 mg, 93% yield) and diastereomer B (yield 93%) in the same manner as in Example 3. 48 mg, 67% yield) were obtained as yellow oils.

Diastereomer A
¹ H NMR (CDCl ₃ , 400 MHz): δ =
1.48 (9H, s),
1.6-1.9 (6H, m),
2.0-2.1 (2H, m),
3.0-3.2 (1H, m),
4.2-4.4 (2H, m),
5.67 (2H, s),
6.74 (1H, t, J = 3 Hz),
7.22 (1H, dd, J = 2 Hz, 10 Hz),
7.35 (1H, d, J = 3 Hz),
7.78 (1H, dd, J = 2 Hz, 12 Hz),
8.18 (1H, s),
8.38 (1H, d, J = 2 Hz).

Diastereomer B
¹ H NMR (CDCl ₃ , 400 MHz): δ =
1.48 (9H, s),
1.4-1.8 (4H, m),
1.9-2.1 (2H, m),
2.4-2.6 (2H, m),
2.6-2.8 (1H, m),
4.2-4.4 (2H, m),
5.67 (2H, s),
6.75 (1H, t, J = 3 Hz),
7.2-7.3 (1H, m),
7.35 (1H, d, J = 3 Hz),
7.79 (1H, dd, J = 2 Hz, 12 Hz),
8.21 (1H, s),
8.38 (1H, d, J = 2 Hz).

3- [2- (5-Amino-7-fluoroindol-1-ylmethyl) -3-fluoropyridin-5-yl] -8-azabicyclo [3.2.1] octane-8-carboxylate t-butyl reduction Iron (93 mg) and ammonium chloride (3.1 mg) were suspended in a mixed solution of acetic acid (15 μL) -water (0.15 mL), and the mixture was heated to reflux for 1 hour. After adding isopropanol (0.15 mL), 3- [3-fluoro-2- (7-fluoro-5-nitroindol-1-ylmethyl) pyridin-5-yl] -8-azabicyclo obtained in Example 7 was used. [3.2.1] Isopropanol solution (0.15 mL) of diastereomer A (85 mg, 0.171 mmol) of t-butyl octane-8-carboxylate was added dropwise. After heating to reflux for 10 minutes at the same temperature, the reaction mixture was filtered through Celite, and the filtrate was concentrated under reduced pressure. The obtained residue was purified by silica gel column chromatography (hexane: ethyl acetate = 7: 1 → 0: 100) to give the title compound diastereomer A (76 mg, yield 95%) as a brown amorphous substance.
3- [3-Fluoro-2- (7-fluoro-5-nitroindol-1-ylmethyl) pyridin-5-yl] -8-azabicyclo [3.2.1] octane-8- obtained in Example 7 Using diastereomer B of t-butyl carboxylate (48 mg, 0.0963 mmol), diastereomer B of the title compound (36 mg, yield 80%) was obtained as a brown oil in the same manner.

Diastereomer A
¹ H NMR (CDCl ₃ , 400 MHz): δ =
1.48 (9H, s),
1.6-2.0 (6H, m),
2.0-2.1 (2H, m),
3.0-3.2 (1H, m),
3.81 (2H, br s),
4.2-4.4 (2H, m),
5.54 (2H, d, J = 2 Hz),
6.31 (1H, t, J = 3 Hz),
6.35 (1H, dd, J = 2 Hz, 13 Hz),
6.63 (1H, d, J = 2 Hz),
7.10 (1H, d, J = 3 Hz),
7.16 (1H, dd, J = 2Hz, 10Hz),
8.19 (1H, s).

Diastereomer B
¹ H NMR (CDCl ₃ , 400 MHz): δ =
1.48 (9H, s),
1.4-1.7 (4H, m),
1.9-2.1 (2H, m),
2.4-2.6 (2H, m),
2.6-2.7 (1H, m),
3.68 (2H, br s),
4.2-4.4 (2H, m),
5.54 (2H, d, J = 2 Hz),
6.31 (1H, t, J = 3 Hz),
6.35 (1H, dd, J = 2 Hz, 13 Hz),
6.63 (1H, d, J = 2 Hz),
7.10 (1H, d, J = 3 Hz),
7.22 (1H, dd, J = 2 Hz, 11 Hz),
8.22 (1H, s).

3- [3-Fluoro-2- [7-fluoro-5- (tetrazol-1-yl) indol-1-ylmethyl] pyridin-5-yl] -8-azabicyclo [3.2.1] octane-8- T-Butyl carboxylate 3- [2- (5-Amino-7-fluoroindol-1-ylmethyl) -3-fluoropyridin-5-yl] -8-azabicyclo [3] obtained in Example 8 2.1] Diastereomer A of octane-8-carboxylate t-butyl (76 mg, 0.162 mmol) was dissolved in acetic acid (3.5 mL) and ethyl orthoformate (0.15 mL, 0.892 mmol) and Sodium azide (47 mg, 0.730 mmol) was added. After stirring at 90 ° C. for 3 hours, the mixture was allowed to cool to room temperature, water and a saturated aqueous sodium hydrogen carbonate solution were added, and the mixture was extracted with ethyl acetate. The organic layer was washed with saturated brine, dried over anhydrous sodium sulfate, and the solvent was evaporated under reduced pressure. The obtained residue was purified by silica gel column chromatography (hexane: ethyl acetate = 2: 1) to give diastereomer A (50 mg, yield 59%) of the title compound as a pale yellow amorphous product.
3- [2- (5-Amino-7-fluoroindol-1-ylmethyl) -3-fluoropyridin-5-yl] -8-azabicyclo [3.2.1] octane-8- obtained in Example 8 Using diastereomer B of t-butyl carboxylate (36 mg, 0.0768 mmol), the title compound diastereomer B (25 mg, 62% yield) was obtained as a yellow powder in the same manner.

Diastereomer A
FAB-MS (m / z): 522 (M + 1)
¹ H NMR (CDCl ₃ , 400 MHz): δ =
1.48 (9H, s),
1.6-2.0 (6H, m),
2.0-2.1 (2H, m),
3.0-3.2 (1H, m),
4.2-4.4 (2H, m),
5.68 (2H, d, J = 1 Hz),
6.6-6.7 (1H, m),
7.2-7.3 (2H, m),
7.35 (1H, d, J = 3 Hz),
7.66 (1H, d, J = 1 Hz),
8.19 (1H, s),
8.93 (1H, s).

Diastereomer B
FAB-MS (m / z): 522 (M + 1)
¹ H NMR (CDCl ₃ , 400 MHz): δ =

1.48 (9H, s),
1.5-1.6 (2H, m),
1.6-1.8 (2H, m),
1.9-2.1 (2H, m),
2.4-2.6 (2H, m),
2.6-2.8 (1H, m),
4.2-4.4 (2H, m),
5.68 (2H, s),
6.6-6.7 (1H, m),
7.2-7.3 (2H, m),
7.36 (1H, d, J = 3 Hz),
7.66 (1H, d, J = 2 Hz),
8.22 (1H, s),
8.94 (1H, s).

3- [3-Fluoro-2- [7-fluoro-5- (tetrazol-1-yl) indol-1-ylmethyl] pyridin-5-yl] -8-azabicyclo [3.2.1] octane-8- Isopropyl carboxylate 3- [3-Fluoro-2- [7-fluoro-5- (tetrazol-1-yl) indol-1-ylmethyl] pyridin-5-yl] -8 obtained in Example 9 -Diastereomer A of t-butyl azabicyclo [3.2.1] octane-8-carboxylate (38 mg, 0.0729 mmol) was dissolved in trifluoroacetic acid (0.36 mL) and stirred at 0 ° C. for 2 hours. The reaction mixture was concentrated under reduced pressure. The obtained residue was dissolved in a tetrahydrofuran (0.4 mL) -water (0.4 mL) mixed solution, and triethylamine (0.1 mL, 0.729 mmol) and chloropropyl formate (0.01 mL, 0.0874 mmol) were added. After stirring at room temperature for 30 minutes, water was added and the mixture was extracted with ethyl acetate. The organic layer was washed with saturated brine, dried over anhydrous sodium sulfate, and the solvent was evaporated under reduced pressure. The obtained residue was purified by silica gel column chromatography (hexane: ethyl acetate = 7: 1 → 0: 100) to give the title compound diastereomer A (37 mg, yield 100%) as a pale yellow amorphous product. .

FAB-MS (m / z): 508 (M + 1)
¹ H NMR (CDCl ₃ , 400 MHz): δ =
1.26 (6H, d, J = 6 Hz),
1.7-2.0 (6H, m),
2.0-2.1 (2H, m),
3.0-3.2 (1H, m),
4.3-4.5 (2H, m),
4.9-5.0 (1H, m),
5.68 (2H, d, J = 1 Hz),
6.6-6.7 (1H, m),
7.2-7.3 (2H, m),
7.35 (1H, d, J = 3 Hz),
7.66 (1H, d, J = 1 Hz),
8.19 (1H, s),
8.93 (1H, s).

3- [2-[(5-Methanesulfonyl) pyrrolo [2,3-b] pyridin-1-ylmethyl] pyridin-5-yl] -9-azabicyclo [3.3.1] nonane-9-carboxylic acid t -Butyl

(1) 3-trifluoromethanesulfonyloxy-9-azabicyclo [3.3.1] non-2-ene-9-carboxylate t-butyl 1.0 M hexamethyldisilazane lithium-tetrahydrofuran solution (6.9 mL, 6 .9 mmol) in tetrahydrofuran (12 mL) at −78 ° C. under a nitrogen atmosphere at 0 ° C. 3-oxo-9-azabicyclo [3.3.1] nonane-9-carboxylate t-butyl (1.50 g, 6.27 mmol) Of tetrahydrofuran (9 mL) was added dropwise over 20 minutes and stirred at the same temperature for 45 minutes. Next, a solution of N-phenylbis (trifluoromethanesulfonimide) (2.24 g, 6.27 mmol) in tetrahydrofuran (9 mL) was added and stirred at 0 ° C. for 45 minutes, and then the solvent was distilled off under reduced pressure to obtain The residue was purified by silica gel column chromatography (hexane: ethyl acetate = 10: 1) to give the title compound (2.01 g, yield 86%).

¹ H NMR (CDCl ₃ , 400 MHz): δ =
1.46 (9H, s),
1.4-1.8 (6H, m),
2.15 (1H, d, J = 18 Hz),
2.7-2.9 (1H, m),
4.4-5.0 (2H, m),
5.7-5.9 (1H, m).

(2) 3- (4,4,5,5-tetramethyl [1,3,2] dioxaborolan-2-yl) -9-azabicyclo [3.3.1] non-2-ene-9-carboxylic acid t-Butyl 3-trifluoromethanesulfonyloxy-9-azabicyclo [3.3.1] non-2-ene-9-carboxylate t-butyl (2.00 g, 5.39 mmol) obtained above, potassium acetate ( 1.59 g, 16.2 mmol), 1,1-bis (diphenylphosphino) ferrocene (90 mg, 0.162 mmol), [1,1-bis (diphenylphosphino) ferrocene] dichloropalladium (II) · dichloromethane adduct (132 mg, 0.162 mmol) and bis (pinacolato) diboron (1.37 g, 5.39 mmol) suspended in dioxane (35 mL) Under 囲気 and stirred overnight at 80 ° C.. The mixture was allowed to cool to room temperature, poured into water, extracted with ethyl acetate, and the organic layer was washed with saturated brine. After drying over anhydrous sodium sulfate, the solvent was distilled off under reduced pressure, and the resulting residue was purified by silica gel column chromatography (hexane: ethyl acetate = 1: 2, chloroform: ethyl acetate = 1: 1) to give the title compound (1.80 g, 96% yield) was obtained as white crystals.

¹ H NMR (CDCl ₃ , 400 MHz): δ =
1.27 (12H, s),
1.45 (9H, s),
1.4-1.8 (6H, m),
1.9-2.1 (1H, m),
2.5-2.7 (1H, m),
4.2-4.8 (2H, m),
6.4-6.5 (1H, m).

(3) tert-butyl 3- (3-fluoro-2-hydroxymethylpyridin-5-yl) -9-azabicyclo [3.3.1] non-2-ene-9-carboxylate obtained above (4,4,5,5-tetramethyl [1,3,2] dioxaborolan-2-yl) -9-azabicyclo [3.3.1] non-2-ene-9-carboxylate t-butyl (419 mg , 1.20 mmol) and 5-bromo-2-hydroxymethylpyridine (205 mg, 1.00 mmol) in the same manner as in Example 1 (1) to give the title compound (109 mg, yield 33%) as a pale yellow oil Obtained as a thing.

¹ H NMR (CDCl ₃ , 400 MHz): δ =
1.48 (9H, s),
1.4-1.9 (6H, m),
2.26 (1H, d, J = 18 Hz),
2.8-3.0 (1H, m),
3.77 (1H, t, J = 5 Hz),
4.5-4.9 (2H, m),
4.82 (2H, d, J = 5 Hz),
6.1-6.3 (1H, m),
7.39 (1H, dd, J = 2 Hz, 11 Hz),
8.45 (1H, s).

(4) 3- (3-Fluoro-2-hydroxymethylpyridin-5-yl) -9-azabicyclo [3.3.1] nonane-9-carboxylate t-butyl 3- (2-hydroxy) obtained above Methylpyridin-5-yl) -9-azabicyclo [3.3.1] non-2-ene-9-carboxylate t-butyl (109 mg, 1.20 mmol) and similar to Example 7 (3) The title compound (73 mg, 66% yield, diastereomer ratio = 1: 3) was obtained as a colorless oil by the procedure.

¹ H NMR (CDCl ₃ , 400 MHz): δ =
1.49 (6.75 H, s),
1.50 (2.25H, s),
1.4-2.3 (10H, m),
2.5-2.7 (0.75H, m),
3.5-3.7 (0.25H, m),
3.77 (1H, br s),
4.2-4.7 (2H, m),
4.79 (2H, s),
6.1-6.3 (1H, m),
7.2-7.3 (1H, m),
8.2-8.3 (1H, m).

(5) 3- [3-Fluoro-2-[(5-methanesulfonyl) pyrrolo [2,3-b] pyridin-1-ylmethyl] pyridin-5-yl] -9-azabicyclo [3.3.1] Nonane-9-carboxylate t-butyl 3- (2-hydroxymethylpyridin-5-yl) -9-azabicyclo [3.3.1] nonane-9-carboxylate t-butyl (72 mg, 0 205 mmol), and eluting first with diastereomer A of the title compound (silica gel column chromatography (hexane: tetrahydrofuran = 3: 1 → 2: 1) in the same manner as in Example 3, 52 mg, 48% yield And diastereomer B (silica gel column chromatography (hexane: tetrahydrofuran = 3: 1 → 2: 1) to elute later, 10 mg, yield 9%).

Diastereomer A
FAB-MS (m / z): 529 (M + 1)
¹ H NMR (CDCl ₃ , 400 MHz): δ =
1.48 (9H, s),
1.3-2.1 (8H, m),
2.0-2.3 (2H, m),
2.4-2.6 (1H, m),
3.11 (3H, s),
4.3-4.6 (2H, m),
5.72 (2H, d, J = 2 Hz),
6.66 (1H, d, J = 3 Hz),
7.29 (1H, d, J = 11 Hz),
7.53 (1H, d, J = 3 Hz),
8.24 (1H, s),
8.46 (1H, d, J = 1 Hz),
8.88 (1H, d, J = 2 Hz).

Diastereomer B
FAB-MS (m / z): 529 (M + 1)
¹ H NMR (CDCl ₃ , 400 MHz): δ =
1.47 (9H, s),
1.3-2.1 (10H, m),
3.11 (3H, s),
3.5-3.7 (1H, m),
4.2-4.5 (2H, m),
5.71 (2H, d, J = 1 Hz),
6.65 (1H, d, J = 3 Hz),
7.2-7.3 (1H, m),
7.53 (1H, d, J = 3 Hz),
8.23 (1H, s),
8.46 (1H, d, J = 2 Hz),
8.88 (1H, d, J = 2 Hz).

7- [2- (5-Methanesulfonylindol-1-ylmethyl) pyridin-5-yl] -3-oxa-9-azabicyclo [3.3.1] nonane-9-carboxylate t-butyl

(1) 7-trifluoromethanesulfonyloxy-3-oxa-9-azabicyclo [3.3.1] non-6-ene-9-carboxylate 7-oxo-3-oxa-9-azabicyclo [3 3.1] The title compound (1.24 g, 67% yield) was obtained in the same manner as in Example 11 (1) using t-butyl nonane-9-carboxylate (1.20 g, 4.97 mmol). Obtained as white crystals.

¹ H NMR (CDCl ₃ , 400 MHz): δ =
1.47 (9H, s),
2.2-2.4 (1H, m),
2.8-3.0 (1H, m),
3.5-3.9 (4H, m),
4.1-4.7 (2H, m),
5.8-6.0 (1H, m).

(2) 7- (4,4,5,5-tetramethyl [1,3,2] dioxaborolan-2-yl) -3-oxa-9-azabicyclo [3.3.1] non-6-ene- 9-carboxylate t-butyl 7-trifluoromethanesulfonyloxy-3-oxa-9-azabicyclo [3.3.1] non-6-ene-9-carboxylate t-butyl (1.24 g, 3.32 mmol) was used to give the title compound (819 mg, yield 70%) as white crystals in the same manner as in Example 11 (2).

¹ H NMR (CDCl ₃ , 400 MHz): δ =
1.26 (12H, s),
1.47 (9H, s),
2.1-2.3 (1H, m),
2.5-2.8 (1H, m),
3.5-3.9 (4H, m),
4.0-4.6 (2H, m),
6.5-6.7 (1H, m).

(3) 7- [2- (5-Methanesulfonylindol-1-ylmethyl) pyridin-5-yl] -3-oxa-9-azabicyclo [3.3.1] non-6-ene-9-carboxylic acid t-butyl 7- (4,4,5,5-tetramethyl [1,3,2] dioxaborolan-2-yl) -3-oxa-9-azabicyclo [3.3.1] nona- obtained above Example 1 using t-butyl 6-ene-9-carboxylate (38 mg, 0.108 mmol) and 1- (5-bromopyridin-2-ylmethyl) -5-methanesulfonylindole (33 mg, 90.4 μmol) The title compound (32 mg, yield 69%) was obtained as a colorless oil by the same method as (1).

¹ H NMR (CDCl ₃ , 400 MHz): δ =
1.46 (9H, s),
2.3-2.5 (1H, m),
2.8-3.1 (1H, m),
3.07 (3H, s),
3.5-3.9 (4H, m),
4.2-4.7 (2H, m),
5.49 (2H, s),
6.2-6.3 (1H, m),
6.7-6.8 (2H, m),
7.37 (1H, d, J = 3 Hz),
7.41 (1H, d, J = 9 Hz),
7.58 (1H, dd, J = 2 Hz, 8 Hz),
7.70 (1H, dd, J = 1 Hz, 9 Hz),
8.29 (1H, d, J = 1 Hz),
8.66 (1H, s).

(4) t-butyl 7- [2- (5-methanesulfonylindol-1-ylmethyl) pyridin-5-yl] -3-oxa-9-azabicyclo [3.3.1] nonane-9-carboxylate 7- [2- (5-Methanesulfonylindol-1-ylmethyl) pyridin-5-yl] -3-oxa-9-azabicyclo [3.3.1] non-6-ene-9-carboxylic acid obtained in The title compound (23 mg, yield 75%, diastereomer ratio = 1: 4) was obtained as a pale green amorphous substance using t-butyl (31 mg, 60.8 μmol) in the same manner as in Example 7 (3). .

FAB-MS (m / z): 512 (M + 1)
¹ H NMR (CDCl ₃ , 400 MHz): δ =
1.48 (7.2H, s),
1.50 (1.8H, s),
1.4-2.5 (4.8H, m),
3.07 (3H, s),
3.5-4.4 (6.2H, m),
5.47 (2H, s),
6.7-6.8 (2H, m),
7.37 (1H, d, J = 3 Hz),
7.43 (1H, d, J = 9 Hz),
7.48 (1H, dd, J = 2Hz, 8Hz),
7.70 (1H, dd, J = 1 Hz, 9 Hz),
8.29 (1H, d, J = 1 Hz),
8.48 (1H, d, J = 2 Hz).

Pharmacological experiment 1
(1) Construction of human GPR119 constant expression cell The human GPR119 gene (NM_178471) was purchased from ATCC (ATCC No. 10807349), and PCR amplification was performed so that a BamHI site was formed on the 5 ′ side and an ApaI site was formed on the 3 ′ side. (Primers: TCCTGGATCCatggaatcatctttctcatt, TCCTGGGCCCttagcccatcaactctgagc). PCR conditions are as follows. Single-stranded DNA in which double-stranded DNA was heat denatured at 98 ° C. for 10 seconds per cycle using DNA polymerase (KOD-Plus-Ver.2; TOYOBO # KOD-211) and primer was denatured at 55 ° C. for 30 seconds. Followed by DNA elongation at 68 ° C. for 1 minute 15 seconds. This was repeated for 35 cycles. The PCR product was inserted as an insert into plasmid pcDNA5 / FRT / TO (Invitrogen # V6520-20), and the resulting plasmid was introduced into Flp-in T-Rex-293 cells (invitrogen # R78007). The introduction method was performed according to the product protocol.

(2) Intracellular cAMP measurement method Human GPR119 constant expression cells prepared by the above method were seeded in a 96-well plate to a concentration of 2500 cells / well (the medium contains 10% fetal bovine serum (FBS), Dulbecco's Modified Eagle Medium (DMEM) medium was used). Twenty-four hours after seeding the cells, tetracyclin (invitrogen # Q10019) (final concentration 20 ng / mL) was added to induce the expression of hGPR119. After 24 hours, the medium was discarded, and stimulation was performed at 37 ° C. for 30 minutes with assay buffer (0.5 mM IBMX PBS (−)) containing the test compound. The amount of intracellular cAMP was measured using a commercially available kit (HitHunter ^™ cAMP XS + Assay (GE Healthcare # 90007503)) and a measuring machine (FLUOstar Optima: BMG LABTECH). The test compound was dissolved in 100% DMSO and added at a final concentration of 1%.

(3) Experimental results Table 9 shows the experimental results.

As is clear from Table 9, the compounds described in the Examples exhibited excellent GPR119 agonist activity.

Test Method By the same test method as in Example 13, the amount of intracellular cAMP was measured.

Experimental results Table 10 shows the test results.

As is clear from Table 10, the compounds described in Examples 9 and 10 exhibited excellent GPR119 agonist activity.

Claims (58)

1. The compound represented by the following general formula (I), or a pharmaceutically acceptable salt thereof.
   

   

   (Wherein Ar is a halogen atom, a nitro group, a cyano group, a hydroxyl group, a C _1-8 alkyl group, a C _1-8 alkoxy group, a C _1-8 alkyl group substituted with 1 to 3 halogen atoms, C _1-8 alkoxy group substituted with 1 to 3 halogen atoms, phenyloxy group, alkoxycarbonyl group (alkoxy has 1 to 8 carbon atoms), carboxyl group, carbamoyl group, acyl group (alkyl carbon number is 1-8), alkylaminocarbonyl group (alkyl has 1 to 8 carbon atoms), dialkylaminocarbonyl group (alkyl has 2 to 12 carbon atoms), alkoxycarbonylmethylcarbonyl group (alkoxy has 1 to 8 carbon atoms) , alkylsulfonyl methyl group (the carbon number of alkyl is 1 to 8), an amino _{group, C 1-8} alkylamino _{group, C 2-12} dialkylamino , _{C 1-8} alkylsulfonylamino group, an acylamino group (1-8 carbon atoms in the _{alkyl), C 1-8} alkylsulfinyl _{group, C 1-8} alkylsulfonyl group, 3-6 membered cycloalkyl sulfonyl group ring, A phenyl group optionally substituted with a substituent selected from a sulfamoyl group, a C _1-8 alkylaminosulfonyl group, a C _2-12 dialkylaminosulfonyl group, a phenylsulfonyl group and a 5- or 6-membered heteroaryl group; Represents a pyridyl group, an indolyl group, an indolinyl group or a pyrrolopyridyl group,
   A represents (CH ₂ ) _m , C (O), S, O, NR ⁶ or a bond,
   Here, m represents an integer of 1 to 3, R ⁶ represents a hydrogen atom, a C _1-8 alkyl group or a 3- to 6-membered cycloalkyl group,
   B represents (C (R ⁷ ) H) _n , S, O, CH═CH, NR ⁸ or a bond,
   Here, n represents an integer of 1 to 3, and R ⁷ and R ⁸ represent a hydrogen atom, a C _1-8 alkyl group, or a 3- to 6-membered cycloalkyl group.
   However, when A is S, O or NR ⁶ , B is not S, O or NR ⁸ .
   One of U and V is N and the other is CR ⁹ or U and V are both N;
   Here, R ⁹ is a hydrogen atom, a halogen atom, a hydroxyl group, a C _1-8 alkyl group, a C _1-8 alkoxy group, a C _1-8 alkyl group substituted with 1 to 3 halogen atoms, or 1 to 3 _Represents a C _1-8 alkoxy group substituted with one halogen atom,
   R ¹ and R ² are the same or different and are a hydrogen atom, a halogen atom, a hydroxyl group, a C _1-8 alkyl group, a C _1-8 alkoxy group, a C _1-8 alkyl group substituted with 1 to 3 halogen atoms. Or a C _1-8 alkoxy group substituted with 1 to 3 halogen atoms,
   R ³ represents a hydrogen atom, a hydroxyl group, a halogen atom or a C _1-8 alkyl group,
   R ⁴ and R ⁵ are the same or different and each represents a hydrogen atom, a C _1-8 alkyl group or a 3- to 6-membered cycloalkyl group,
   X ¹ , X ² , X ³ , X ⁴ , X ⁵ and X ⁶ are the same or different and represent (CR ¹⁰ R ¹¹ ) _p or a bond,
   Here, R ¹⁰ and R ¹¹ represent a hydrogen atom, a hydroxyl group, a halogen atom, a C _1-8 alkyl group, a C _1-8 alkoxy group, or a 3- to 6-membered cycloalkyl group,
   p represents 1 or 2,
   Y is a single bond, a double bond, C (O), C = NOR ¹² , C = C (R ¹³ ) (R ¹⁴ ), C (R ¹⁵ ) (R ¹⁶ ), O, NR ¹⁷ or S (O) _q is represented.
   Here, R ¹² , R ¹³ , R ¹⁴ , R ¹⁵ , R ¹⁶ and R ¹⁷ represent a hydrogen atom, a C _1-8 alkyl group or a _3-6 membered cycloalkyl group,
   q represents an integer of 0-2.
   However, when X ⁵ or X ⁶ is a bond, Y is not a double bond, and when Y is a double bond, X ⁵ and X ⁶ represent (CR ¹⁰ R ¹¹ ) _p .
   And Z represents C (O) OR ¹⁸ , C (O) R ¹⁹ , SO ₂ R ²⁰ , C (O) NR ²¹ R ²² or CH ₂ C (O) N (R ²³ ) (R ²⁴ ) Or a C _1-8 alkyl group, a C _1-8 alkoxy group, a C _1-8 alkyl group substituted with 1 to 3 halogen atoms and a C ₁ substituted with 1 to 3 halogen atoms _A 5- or 6-membered heteroaryl group optionally having a substituent selected from _-8 alkoxy groups (the heteroaryl ring has a carbon atom and a nitrogen atom as ring-constituting atoms, and further an oxygen atom or sulfur Which may have an atom and is bonded to the nitrogen atom of the azabicyclo ring via a carbon atom constituting the ring),
   Here, R ¹⁸ , R ¹⁹ , R ²⁰ , R ²¹ , R ²² , R ²³ and R ²⁴ are C _1-8 alkyl, C _2-8 alkenyl group, 3 to 6-membered cycloalkyl group, phenyl group or Represents a C _1-8 alkyl group substituted by a phenyl group. )
2. At least one of the substituents of Ar is a cyano group, an alkoxycarbonyl group (the alkoxy has 1 to 8 carbon atoms), a C _1-8 alkylsulfonyl group, a 3 to 6-membered cycloalkylsulfonyl group, a sulfamoyl group, a phenylsulfonyl group And a phenyl group, a pyridyl group, an indolyl group, an indolinyl group or a pyrrolopyridyl group substituted with 1 to 3 identical or different substituents selected from 5- or 6-membered heteroaryl groups. Or a pharmaceutically acceptable salt thereof.
3. Ar is a cyano group, an alkoxycarbonyl group (the alkoxy has 1 to 8 carbon atoms), a C _1-8 alkylsulfonyl group, a 3- to 6-membered cycloalkylsulfonyl group, a sulfamoyl group, a phenylsulfonyl group, and a 5- or 6-membered ring. The compound according to claim 1, which is a phenyl group, a pyridyl group, an indolyl group, an indolinyl group or a pyrrolopyridyl group substituted with any one substituent selected from the above heteroaryl groups, or a pharmaceutically acceptable salt thereof .
4. 2. The phenyl group, pyridyl group, indolyl group, indolinyl group or pyrrolopyridyl group substituted with 1 to 3 identical or different substituents, wherein at least one of the substituents of Ar is a C _1-8 alkylsulfonyl group. Or a pharmaceutically acceptable salt thereof.
5. The compound according to claim 1, or a pharmaceutically acceptable salt thereof, wherein Ar is a phenyl group, pyridyl group, indolyl group, indolinyl group or pyrrolopyridyl group substituted with a C _1-8 alkylsulfonyl group.
6. Ar is C _1-8 alkylsulfonyl group and a C _1-8 alkyl group or any one of the two is substituted with a substituent a phenyl group substituents of a halogen atom, a pyridyl group, an indolyl group, indolinyl group or pyrrolopyridyl group The compound according to claim 1, or a pharmaceutically acceptable salt thereof.
7. Phenyl group, pyridyl group, indolyl group, indolinyl substituted with 1 to 3 identical or different substituents wherein at least one of the substituents of Ar is 1-tetrazolyl group or 1,2,4-triazol-1-yl group The compound according to claim 1, which is a group or a pyrrolopyridyl group, or a pharmaceutically acceptable salt thereof.
8. The compound according to claim 1, wherein Ar is a phenyl group, a pyridyl group, an indolyl group, an indolinyl group or a pyrrolopyridyl group substituted with a 1-tetrazolyl group or a 1,2,4-triazol-1-yl group, or a pharmaceutical thereof Acceptable salt.
9. A phenyl group in which Ar is substituted with two substituents of a 1-tetrazolyl group or a 1,2,4-triazol-1-yl group and a C _1-8 alkyl group or a halogen atom; The compound according to claim 1, which is a group, indolyl group, indolinyl group or pyrrolopyridyl group, or a pharmaceutically acceptable salt thereof.
10. The compound or a pharmaceutically acceptable salt thereof according to claim 1, wherein A is CH ₂ and B is a bond.
11. The compound according to any one of claims 1 to 9, or a pharmaceutically acceptable salt thereof, wherein A is O and B is CH ₂ .
12. The compound according to any one of claims 1 to 11, or a pharmaceutically acceptable salt thereof, wherein any one of U and V is N and the other is CH.
13. The compound according to any one of claims 1 to 11, or a pharmaceutically acceptable salt thereof, wherein U is N and V is CH.
14. The compound or a pharmaceutically acceptable salt thereof according to claim ¹ , wherein X ¹ , X ² , X ⁵ and X ⁶ are CH ₂ .
15. The compound or a pharmaceutically acceptable salt thereof according to claim ¹ , wherein X ¹ , X ² and X ⁵ are CH ₂ and X ⁶ is CH ₂ CH ₂ .
16. The compound or a pharmaceutically acceptable salt thereof according to claim 1, wherein X ³ and X ⁴ are a bond.
17. The compound or a pharmaceutically acceptable salt thereof according to claim ¹ , wherein X ¹ , X ⁴ and X ⁵ are a bond and X ² , X ³ and X ⁶ are CH ₂ .
18. The compound or a pharmaceutically acceptable salt thereof according to claim 1, wherein Y is O.
19. The compound or a pharmaceutically acceptable salt thereof according to claim 1, wherein Y is a single bond.
20. The compound according to any one of claims 1 to 19, or a pharmaceutically acceptable salt thereof, wherein R ³ , R ⁴ and R ⁵ are hydrogen atoms.
21. The compound according to claim 1 or 20, wherein Z is C (O) OR ¹⁸ , or a pharmaceutically acceptable salt thereof.
22. The compound according to claim 21, or a pharmaceutically acceptable salt thereof, wherein R ¹⁸ is C _1-8 alkyl.
23. Z is a 3-C _1-8 alkyl-1,2,4-oxadiazol-5-yl group, a 5-C _1-8 alkyl-1,2,4-oxadiazol-3-yl group or 5- _21. The compound according to claim 1 which is a C _1-8 alkylpyrimidin-2-yl group, or a pharmaceutically acceptable salt thereof.
24. The compound according to any one of claims 1 to 23, or a pharmaceutically acceptable salt thereof, wherein ^one of R ¹ and R ² is a hydrogen atom, and the other is a hydrogen atom, C _1-8 alkyl or a halogen atom.
25. The compound represented by the following general formula (II), or a pharmaceutically acceptable salt thereof.
    

    

    (In the formula, any one of T ¹ , T ² , T ³ and T ⁴ represents C (R ²⁵ ) or N, and the rest represents C (R ²⁶ ).
    R ²⁵ and R ²⁶ are a hydrogen atom, a halogen atom, a nitro group, a cyano group, a hydroxyl group, a C _1-8 alkyl group, a C _1-8 alkoxy group, or a C ₁ substituted with 1 to 3 halogen atoms. _-8 alkyl group, C _1-8 alkoxy group substituted with 1 to 3 halogen atoms, phenyloxy group, alkoxycarbonyl group (alkoxy has 1 to 8 carbon atoms), carboxyl group, carbamoyl group, acyl group ( Alkyl has 1 to 8 carbon atoms, alkylaminocarbonyl group (alkyl has 1 to 8 carbon atoms), dialkylaminocarbonyl group (alkyl has 2 to 12 carbon atoms), alkoxycarbonylmethylcarbonyl group (alkoxy has carbon atoms) 1 to 8), an alkylsulfonyl radical (1-8 carbon atoms in the alkyl), amino _{group, C 1-8} alkylamino group, _{C 2 12} dialkylamino _{group, C 1-8} alkylsulfonylamino group, an acylamino group (1-8 carbon atoms in the _{alkyl), C 1-8} alkylsulfinyl _{group, C 1-8} alkylsulfonyl group, a cycloalkyl of 3 to 6-membered ring An alkylsulfonyl group, a sulfamoyl group, a C _1-8 alkylaminosulfonyl group, a C _2-12 dialkylaminosulfonyl group, a phenylsulfonyl group or a 5- or 6-membered heteroaryl group;
    R ⁰³ and R ⁰⁴ are the same or different and each represents a hydrogen atom or a C _1-8 alkyl group,
    A double line consisting of a solid line and a broken line represents a single bond or a double bond,
    A ⁰¹ represents (CH ₂ ) _r , C (O) or a bond,
    Where r represents an integer of 1 to 3,
    B ⁰¹ represents (C (R ²⁷ ) H) _s , S, O, CH═CH, NR ²⁸ or a bond,
    Here, s represents an integer of 1 to 3, and R ²⁷ and R ^{28 each} represents a hydrogen atom or a C _1-8 alkyl group.
    However, when A ⁰¹ is CH ₂ or a bond, B ⁰¹ is not S, O, or NR ²⁸ .
    Either one of U ⁰¹ and V ⁰¹ is N and the other is CR ²⁹ or U ⁰¹ and V ⁰¹ are both N;
    Here, R ²⁹ is a hydrogen atom, a halogen atom, a hydroxyl group, a C _1-8 alkyl group, a C _1-8 alkoxy group, a C _1-8 alkyl group substituted with 1 to 3 halogen atoms, or 1 to 3 _Represents a C _1-8 alkoxy group substituted with one halogen atom,
    R ⁰¹ and R ⁰² are a hydrogen atom, a halogen atom, a hydroxyl group, a C _1-8 alkyl group, a C _1-8 alkoxy group, a C _1-8 alkyl group substituted with 1 to 3 halogen atoms, or 1 to 3 _Represents a C _1-8 alkoxy group substituted with one halogen atom,
    Z ⁰¹ represents C (O) OR ³⁰ , C (O) R ³¹ , SO ₂ R ³² , C (O) NR ³³ R ³⁴ or CH ₂ C (O) N (R ³⁵ ) (R ³⁶ ), Or a halogen atom, a C _1-8 alkyl group, a C _1-8 alkoxy group, a C _1-8 alkyl group substituted with 1 to 3 halogen atoms and a C _{1 1} substituted with 1 to 3 halogen atoms. _A 5- or 6-membered heteroaryl group optionally having a substituent selected from ₈ alkoxy groups (the heteroaryl ring has a carbon atom and a nitrogen atom as ring-constituting atoms, and further an oxygen atom or a sulfur atom And may be bonded to the nitrogen atom of the azabicyclo ring through the carbon atoms constituting the ring),
    Here, R ³⁰ , R ³¹ , R ³² , R ³³ , R ³⁴ , R ³⁵ and R ³⁶ are C _1-8 alkyl, C _2-8 alkenyl group, _3-6 membered cycloalkyl group, phenyl group or Represents a C _1-8 alkyl group substituted with a phenyl group,
    T represents 1 or 2. )
26. R ²⁵ and R ²⁶ are the same or different and are a hydrogen atom, a halogen atom, a cyano group, a C _1-8 alkyl group, an alkoxycarbonyl group (alkoxy has 1 to 8 carbon atoms), a C _1-8 alkylsulfonyl group, 3 to 6 26. The compound according to claim 25, or a pharmaceutically acceptable salt thereof, which is a membered cycloalkylsulfonyl group, sulfamoyl group, phenylsulfonyl group, or 5- or 6-membered heteroaryl group.
27. 26. The compound according to claim 25, or a pharmaceutically acceptable salt thereof, wherein any one of T ¹ , T ² , T ³ and T ⁴ is C (C _1-8 alkylsulfonyl group).
28. Any one of T ¹ , T ² , T ³ and T ⁴ is C (C _1-8 alkylsulfonyl group), and any one of the remaining is C (C _1-8 alkyl group) or C (halogen atom) 26. The compound according to claim 25, or a pharmaceutically acceptable salt thereof.
29. 26. The compound according to claim 25, wherein any one of T ¹ , T ² , T ³ and T ⁴ is C (1-tetrazolyl group) or C (1,2,4-triazol-1-yl group), or a compound thereof A pharmaceutically acceptable salt.
30. Any one of T ¹ , T ² , T ³ and T ⁴ is C (1-tetrazolyl group) or C (1,2,4-triazol-1-yl group), and any one of the remaining is C ( 26. The compound according to claim 25, or a pharmaceutically acceptable salt thereof, which is _C1-8 alkyl group) or C (halogen atom).
31. The compound according to claim 25, wherein B ⁰¹ is a bond, or a pharmaceutically acceptable salt thereof.
32. The compound according to claims 25 to 30, or a pharmaceutically acceptable salt thereof, wherein A ⁰¹ is CH ₂ and B ⁰¹ is a bond.
33. The compound or a pharmaceutically acceptable salt thereof according to claim 25, wherein any one of U ⁰¹ and V ⁰¹ is N and the other is CH.
34. The compound according to claims 25 to 32, or a pharmaceutically acceptable salt thereof, wherein U ⁰¹ is N and V ⁰¹ is CH.
35. The compound according to claim 25, wherein Z ⁰¹ is C (O) OR ³⁰ , or a pharmaceutically acceptable salt thereof.
36. 36. The compound according to claim 35, wherein R ³⁰ is C _1-8 alkyl, or a pharmaceutically acceptable salt thereof.
37. Z ⁰¹ is a 3-C _1-8 alkyl-1,2,4-oxadiazol-5-yl group, a 5-C _1-8 alkyl-1,2,4-oxadiazol-3-yl group, or 5 The compound according to claims 25 to 34, or a pharmaceutically acceptable salt thereof, which is a -C _1-8 alkylpyrimidin-2-yl group.
38. The compound according to any one of claims 25 to 37, or a pharmaceutically acceptable salt thereof, wherein any one of R ⁰¹ and R ⁰² is a hydrogen atom, and the other is a hydrogen atom, C _1-8 alkyl or a halogen atom.
39. The compound according to claims 25 to 38, or a pharmaceutically acceptable salt thereof, wherein R ⁰³ and R ⁰⁴ are a hydrogen atom.
40. 40. The compound according to claim 25, wherein t is 1, or a pharmaceutically acceptable salt thereof.
41. 40. The compound according to claim 25, wherein t is 2, or a pharmaceutically acceptable salt thereof.
42. The compound represented by the following general formula (III), or a pharmaceutically acceptable salt thereof.
    

    

    (Wherein R ⁰⁷ , R ⁰⁸ and R ⁰⁹ are the same or different and each represents a hydrogen atom, a halogen atom, a nitro group, a cyano group, a hydroxyl group, a C _1-8 alkyl group, a C _1-8 alkoxy group, 1 to 3 C _1-8 alkyl group substituted with a halogen atom, C _1-8 alkoxy group substituted with 1 to 3 halogen atoms, phenyloxy group, alkoxycarbonyl group (alkoxy has 1 to 8 carbon atoms), carboxyl Group, carbamoyl group, acyl group (alkyl has 1 to 8 carbon atoms), alkylaminocarbonyl group (alkyl has 1 to 8 carbon atoms), dialkylaminocarbonyl group (alkyl has 2 to 12 carbon atoms), alkoxycarbonyl methylcarbonyl group (number of carbon atoms in the alkoxy 1-8) alkylsulfonyl radical (1-8 carbon atoms in the alkyl), amino group, C _1- Alkylamino _{group, C 2-12} dialkylamino _{group, C 1-8} alkylsulfonylamino group, an acylamino group (1-8 carbon atoms in the _{alkyl), C 1-8} alkylsulfinyl _{group, C 1-8} alkylsulfonyl group, A 3- to 6-membered cycloalkylsulfonyl group, a sulfamoyl group, a C _1-8 alkylaminosulfonyl group, a C _2-12 dialkylaminosulfonyl group, a phenylsulfonyl group, or a 5- or 6-membered heteroaryl group,
    Q represents C (R ³⁷ ) or N;
    Here, R ³⁷ is the same as the above R ⁰⁷ , R ⁰⁸ and R ⁰⁹ ,
    A ⁰² represents (CH ₂ ) _u , O, S, NR ³⁸ or a bond,
    Here, u represents an integer of 1 to 3, R ³⁸ represents a hydrogen atom or a C _1-8 alkyl group,
    B ⁰² represents (C (R ³⁹ ) H) _v , S, O, CH═CH or NR ⁴⁰ ;
    Here, v represents an integer of 1 to 3, and R ³⁹ and R ^{40 each} represents a hydrogen atom or a C _1-8 alkyl group.
    However, when A ⁰² is O, S or NR ³⁸ , B ⁰² is not O, S or NR ⁴⁰ .
    Any one of U ⁰² and V ⁰² is N and the other is CR ⁴¹ or U ⁰ and V ⁰ are both N;
    Here, R ⁴¹ is a hydrogen atom, a halogen atom, a hydroxyl group, a C _1-8 alkyl group, a C _1-8 alkoxy group, a C _1-8 alkyl group substituted with 1 to 3 halogen atoms, or 1 to 3 _Represents a C _1-8 alkoxy group substituted with one halogen atom,
    R ⁰⁵ and R ⁰⁶ are a hydrogen atom, a halogen atom, a hydroxyl group, a C _1-8 alkyl group, a C _1-8 alkoxy group, a C _1-8 alkyl group substituted with 1 to 3 halogen atoms, or 1 to 3 _Represents a C _1-8 alkoxy group substituted with one halogen atom,
    Z ⁰² represents C (O) OR ⁴² , C (O) R ⁴³ , SO ₂ R ⁴⁴ , C (O) NR ⁴⁵ R ⁴⁶ or CH ₂ C (O) N (R ⁴⁷ ) (R ⁴⁸ ), Or a halogen atom, a C _1-8 alkyl group, a C _1-8 alkoxy group, a C _1-8 alkyl group substituted with 1 to 3 halogen atoms and a C _{1 1} substituted with 1 to 3 halogen atoms. _A 5- or 6-membered heteroaryl group optionally having a substituent selected from ₈ alkoxy groups (the heteroaryl ring has a carbon atom and a nitrogen atom as ring-constituting atoms, and further an oxygen atom or a sulfur atom And may be bonded to the nitrogen atom of the azabicyclo ring via a carbon atom constituting the ring),
    Here, R ⁴² , R ⁴³ , R ⁴⁴ , R ⁴⁵ , R ⁴⁶ , R ⁴⁷ and R ⁴⁸ are C _1-8 alkyl, C _2-8 alkenyl, 3- to 6-membered cycloalkyl, phenyl or Represents a C _1-8 alkyl group substituted with a phenyl group,
    And w represents 1 or 2. )
43. R ⁰⁷ , R ⁰⁸ and R ⁰⁹ are the same or different, a hydrogen atom, a halogen atom, a cyano group, a C _1-8 alkyl group, an alkoxycarbonyl group (alkoxy has 1 to 8 carbon atoms), a C _1-8 alkylsulfonyl group, The compound according to claim 42, or a pharmaceutically acceptable salt thereof, which is a 3- to 6-membered cycloalkylsulfonyl group, a sulfamoyl group, a phenylsulfonyl group, or a 5- or 6-membered heteroaryl group.
44. R ^07, any one of ^{R 08} and ^{R 09} is A compound according to claim 42, wherein a _{C 1-8} alkylsulfonyl group, or a pharmaceutically acceptable salt thereof.
45. R ^07, any one of ^{R 08} and ^{R 09} is a _{C 1-8} alkylsulfonyl group, a compound of one any remaining claim 42, wherein the _{C 1-8} alkyl group or a halogen atom, or a pharmaceutically Acceptable salt.
46. R ^07, any one of ^{R 08} and ^{R 09} is 1-tetrazolyl group or a 1,2,4-triazol-1-yl is based on claim 42 A compound according or a pharmaceutically acceptable salt thereof.
47. Any one of R ⁰⁷ , R ⁰⁸ and R ⁰⁹ is a 1-tetrazolyl group or a 1,2,4-triazol-1-yl group, and any one of the remaining is a C _1-8 alkyl group or a halogen atom 43. A compound according to claim 42, or a pharmaceutically acceptable salt thereof.
48. A ⁰² is in ^O, The compound of claim 42-47, wherein ^{B 02} is CH _2, or a pharmaceutically acceptable salt thereof.
49. ^49. The compound or a pharmaceutically acceptable salt thereof according to claim 42, wherein any one of U ⁰² and V ⁰² is N and the other is CH.
50. ^49. The compound according to claim 42, wherein U ⁰² is N and V ⁰² is CH, or a pharmaceutically acceptable salt thereof.
51. 51. The compound according to claim ⁴² , wherein Z ⁰² is C (O) OR ⁴² , or a pharmaceutically acceptable salt thereof.
52. _52. The compound according to claim 51, or a pharmaceutically acceptable salt thereof, wherein R ⁴² is C _1-8 alkyl.
53. Z ⁰² is a 3-C _1-8 alkyl-1,2,4-oxadiazol-5-yl group, a 5-C _1-8 alkyl-1,2,4-oxadiazol-3-yl group, or 5 51. The compound according to claim 42, which is a —C _1-8 alkylpyrimidin-2-yl group, or a pharmaceutically acceptable salt thereof.
54. The compound according to any one of claims 42 to 53, or a pharmaceutically acceptable salt thereof, wherein one of R ⁰⁵ and R ⁰⁶ is a hydrogen atom, and the other is a hydrogen atom, C _1-8 alkyl or a halogen atom.
55. The compound according to claim 42, wherein w is 1, or a pharmaceutically acceptable salt thereof.
56. The compound according to claim 42, wherein w is 2, or a pharmaceutically acceptable salt thereof.
57. A therapeutic agent for diabetes comprising the compound according to any one of claims 1 to 56 or a pharmaceutically acceptable salt thereof as an active ingredient.
58. A GPR119 agonist comprising the compound according to any one of claims 1 to 56 or a pharmaceutically acceptable salt thereof as an active ingredient.