WO2011049964A1

WO2011049964A1 - Rna detection and quantitation

Info

Publication number: WO2011049964A1
Application number: PCT/US2010/053224
Authority: WO
Inventors: Zhen Huang; Sarah M. Spencer
Original assignee: Lab Scientific Group
Priority date: 2009-10-19
Filing date: 2010-10-19
Publication date: 2011-04-28

Abstract

The present invention is directed to a highly sensitive and specific method for direct detection of at least one specific RNA in a sample. The presence of a specific RNA provides a positive indicator of a pathogenic agent, contaminant, and/or normal or abnormal genes or gene products in the sample. Applications for which the method of the invention is particularly well suited include point-of-care disease diagnosis, cancer early detection, detection of microbial contamination in food and/or water supplies, and pathogen detection in biodefense.

Description

RNA DETECTION AND QUANTITATION

CROSS-REFERENCE TO RELATED APPLICATIONS

[0001] This application claims benefit of U.S. Provisional Application No. 61/252,940, filed October 19, 2009, which is hereby incorporated herein by reference in its entirety.

STATEMENT REGARDING FEDERALLY SPONSORED RESEARCH

[0002] This work was supported by the NIH (NIAID, AI058051), the Georgia Cancer Coalition Distinguished Cancer Clinicians & Scientists Award, and the Molecular Basis of Disease Fellowship & Program

REFERENCE TO SEQUENCE LISTING

[0010] The Sequence Listing submitted October 19, 2010 as a text file named

"25154_5_9001_2010_10_19_AMD_AFD_Sequence_Listing.txt," created on October 19,2010, and having a size of 18,874 bytes is hereby incorporated by reference pursuant to 37 C.F.R. § 1.52(e)(5).

FIELD OF INVENTION

[0003] The present invention relates to methods and devices for detecting nucleic acid sequences, the presence of which is a positive indicator of a pathogenic agent, contaminant, and/or normal or abnormal genes or gene products.

BACKGROUND

[0004] Several publications and patent documents are referenced in this application in order to more fully describe the state of the art to which this invention pertains. The disclosure of each of these publications and documents is incorporated by reference in its entirety herein.

[0005] A number of techniques have been developed that facilitate rapid and accurate detection of infectious agents, such as viruses, bacteria and fungi. These methods may also be applied to the detection and differentiation of normal and abnormal genes, or gene products. Most of these protocols employ exponential amplification of minute amounts of a target nucleic acid sequence (e.g., DNA or RNA) in a test sample. These include the polymerase chain reaction (PCR) (Saiki et al., Science 230:1350, 1985; Saiki et al., Science 239:487, 1988; PCR Technology, Henry A. Erlich, ed., Stockton Press, 1989; Patterson et al., Science 260:976, 1993), ligase chain reaction (LCR) (Barany, Proc. Natl. Acad. Sci. USA 88:189,

1991) , strand displacement amplification (SDA) (Walker et al., Nucl. Acids Res. 20:1691,

1992) , Q.beta. replicase amplification (Q.beta.RA) (Wu et al., Proc. Natl. Acad. Sci. USA 89:11769, 1992; Lomeli et al., Clin. Chem. 35:1826, 1989), nucleic acid sequence based amplification (NASBA), and self-sustained replication (3SR) (Guatelli et al., Proc. Natl. Acad. Sci. USA 87:1874-1878, 1990). While all of these techniques are powerful tools for the detection and identification of trace amounts of a target nucleic acid in a sample, they all exhibit various shortcomings, which have prevented their general applicability as routine diagnostic techniques in clinical laboratory settings.

[0006] The preparation of the target nucleic acid, for example, is a procedural impediment required for subsequent steps such as amplification and detection. Target nucleic acid preparation is time and labor intensive and, thus, generally unsuitable for a clinical setting, where rapid and accurate results are required. Another problem, which is particularly pronounced when using PCR and SDA, is the necessity for empirically determining optimal conditions for target nucleic acid amplification for each target. Moreover, conditions required for standardizing quantitation assessments can also vary from sample to sample. This lack of precision manifests itself most dramatically when the diagnostic assay is implemented in multiplex format, that is, in a format designed for the simultaneous detection of several different target sequences.

[0007] Thus, the development of more rapid and less technically challenging protocols for detecting trace amounts of nucleic acid sequences associated with or indicative of the presence of a pathogen, for example, would be useful for clinical diagnostic screening assays.

[0008] Related U.S. Patent 7,354,716 is hereby incorporated by reference in its entirety.

SUMMARY

[0009] The present compositions, articles, and methods aredirected to identification of nucleic acids, such as RNA molecules. For example, disclosed are methods for detecting at least one specific RNA molecule in a population comprising a plurality of different RNA molecules, said method comprising: a method for detecting at least one specific RNA molecule in a population comprising a plurality of different RNA molecules, said method comprising: making a hybrid template comprising a first portion and a second portion, wherein said first and second portion of said hybrid template are operably linked, and wherein the first portion is an RNA sequence complementary to an internal sequence of said specific RNA molecule and said second portion is a DNA sequence complementary to a region proximal to the internal sequence of said specific RNA molecule;

in a single buffer solution a) binding said hybrid template to said specific RNA molecule, wherein said binding produces a complex comprising said specific RNA molecule and said hybrid template and said binding results in formation of a double stranded RNA/RNA duplex at the internal sequence of said specific RNA molecule and a double stranded RNA/DNA duplex at the region proximal to the internal sequence of said specific RNA molecule;

b) digesting said complex with a riboendonuclease capable of digesting double- stranded RNA/DNA duplexes, wherein said digesting cleaves said specific RNA molecule at the region proximal to the internal sequence and leaves intact double stranded RNA/RNA duplex at the internal sequence to produce a digested complex comprising a truncated specific RNA molecule and bound hybrid template;

c) performing an extension of said digested complex, wherein said hybrid template acts as a template for extension of the truncated specific RNA molecule and said extension incorporates at least one detectable label into an extended RNA molecule; and

detecting a presence of the at least one detectable label in said extended RNA molecule, wherein said presence of said at least one detectable label in said extended RNA molecule provides a positive indicator for detecting a specific RNA molecule in a population comprising a plurality of different RNA molecules. In one aspect, the method of the invention is directed to the detection of a specific messenger RNA (mRNA) molecule.

[0011] In another aspect disclosed arepopulations comprising a plurality of different RNA molecules is derived from a sample. In an embodiment, the sample is a biological sample. In another aspect, detecting a specific RNA molecule is a positive indicator of a presence of a microorganism, pathogen, or gene in a sample.

[0012] In a particular embodiment of the method, the DNA and/or RNA sequences of the hybrid template are modified. Exemplary modifications of the DNA sequences of a hybrid template of the method include, but are not limited to, 3' amino group modification. Exemplary modifications of the RNA sequences of a hybrid template of the method include, but are not limited to, 2'-0-methyl group modification.

[0013] In a particular embodiment of the method, the riboendonuclease used is RNase H. In some forms of the disclosed methods, the extension can be performed by a polymerase. In one embodiment, the polymerase is a Klenow DNA polymerase.

[0014] In a particular embodiment of the method, at least one hybrid template is bound to a solid matrix to produce a hybrid template bound solid matrix. [0015] Also encompassed by the invention is a hybrid template bound solid matrix (e.g., an RNA chip) produced by the method of the invention. Such RNA chips may comprise a plurality of different hybrid templates. In one embodiment, an RNA chip may comprise a plurality of different hybrid templates that are specific for a single microorganism, pathogen, or gene. Exemplary hybrid templatesinclude, but are not limited to, SEQ ID NOs: 14, 15, 5, 6, 20, 23, 26, and 29. See, for example, FIGS. 8, 9A, 9B, 10, 11, 12, and 13 for details pertaining to microorganisms and viruses for which these hybrid templates may be used as described hereinas tools for detection thereof. Alternatively, an RNA chip may comprise a plurality of different hybrid templates that are specific for a plurality of microorganisms, pathogens, or genes.

[0016] Also encompassed are methods of using a hybrid template bound solid matrix of the invention, such as an RNA chip, for detecting a specific RNA molecule in a sample, wherein detecting a specific RNA molecule in a sample is a positive indicator of a presence of a microorganism, pathogen, or gene in the sample.

[0017] Also disclosed are methods for detecting at least one specific RNA molecule in a population comprising a plurality of different RNA molecules, said method comprising: (a) making a hybrid template comprising a middle portion and two portions flanking the middle portion, wherein said middle and flanking portions of said hybrid template are operably linked, and wherein the middle portion comprises an RNA sequence complementary to an internal sequence of said specific RNA molecule and said flanking portions comprise DNA sequences complementary to regions flanking the internal sequence of said specific RNA molecule; (b) binding said hybrid template to said specific RNA molecule, wherein said binding produces a complex comprising said specific RNA molecule and said hybrid template and said binding results in formation of a double stranded RNA/RNA duplex at the internal sequence of said specific RNA molecule and double stranded RNA/DNA duplexes at the regions flanking the internal sequence of said specific RNA molecule; (c) digesting said complex with a riboendonuclease capable of digesting double- stranded RNA/DNA duplexes, wherein said digesting cleaves said specific RNA molecule at the regions flanking the internal sequence and leaves intact double stranded RNA/RNA duplex at the internal sequence to produce a digested complex comprising a truncated specific RNA molecule and bound hybrid template; (d) performing an extension of said digested complex, which in one embodiment, may be polymerase mediated, wherein said hybrid template acts as a template for extension of the truncated specific RNA molecule and said extension incorporates at least one detectable label into an extended RNA molecule; and (e) detecting a presence of at least one detectable label in said extended RNA molecule, wherein said presence of said at least one detectable label in said extended RNA molecule provides a positive indicator for detecting a specific RNA molecule in a population comprising a plurality of different RNA molecules.

[0018] In one aspect methods are disclosed wherein a hybrid template comprising a middle (or central) and flanking portions (i.e., a tripartite hybrid template) is used, the method is directed to the detection of a specific messenger RNA (mRNA) molecule.

[0019] In another aspect of the method wherein a tripartite hybrid template is used, the population comprising a plurality of different RNA molecules is derived from a sample. In an embodiment, the sample is a biological sample. In another aspect of the method wherein a tripartite hybrid template is used, detecting a specific RNA molecule is a positive indicator of a presence of a microorganism, pathogen, or gene in a sample.

[0020] In a particular embodiment of the method, the DNA and/or RNA sequences of the tripartite hybrid template are modified. Exemplary modifications of the DNA sequences of a tripartite hybrid template of the method include, but are not limited to, 3' amino group modification. Exemplary modifications of the RNA sequences of a hybrid template of the method include, but are not limited to, 2'-0-methyl group modification.

[0021] In a particular embodiment of the method wherein a tripartite hybrid template is used, the riboendonuclease used is RNase H. In some forms of the disclosed methods, the extension can be performed by a polymerase. In one embodiment, the polymerase is a Klenow DNA polymerase.

[0022] In a particular embodiment, a tripartite hybrid template is bound to a solid matrix to produce a hybrid template bound solid matrix.

[0023] Also encompassed are hybrid template bound solid matrices(e.g., an RNA chip) produced by this method, wherein a tripartite hybrid template(s) is bound to a solid matrix.

Such RNA chips may comprise a plurality of different tripartite hybrid templates. In one embodiment, an RNA chip may comprise a plurality of different tripartite hybrid templates that are specific for a single microorganism, pathogen, or gene. Alternatively, an RNA chip may comprise a plurality of different tripartite hybrid templates that are specific for a plurality of microorganisms, pathogens, or genes. [0024] Also encompassed are methods of using a hybrid template bound solid matrix, such as an RNA chip, for detecting a specific RNA molecule in a sample, wherein the RNA chip comprises different bound tripartite hybrid templates, and detecting a specific RNA molecule in a sample is a positive indicator of a presence of a microorganism, pathogen, or gene in the sample.

[0025] Also disclosed are buffer solutions for the performance of the hybridization, digestion and extension steps of the disclosed methods, the buffer solution comprising a digestion buffer, a hybridization buffer, and an extension buffer.

[0026] The present invention also encompasses a kit. Such a kit comprises materials for practicing the methods described herein, including: RNase H; Klenow DNA polymerase; a buffer compatible with RNase H and Klenow DNA polymerase activities; a positive control RNA; a hybrid template and/or tripartite hybrid template specific for said control RNA; and instructional materials.

BRIEF DESCRIPTION OF THE DRAWINGS

[0027] FIG. 1 shows an autoradiogram and procedural flowchart depicting labeling of RNA at an internal site after RNase H digestion. Lane 1, Klenow extension of RNA50 without the RNase H digestion; lane 2, digestion and extension on a control template (DNA20. 10); lane 3, Klenow extension of RNA50 on the DNA template (DNA20.8) after the RNase H digestion on the DNA-2'-O-Me-RNA20.8 hybrid template; lane 4, Klenow extension of RNA50 on the same DNA-2'-O-Me-RNA20.8 hybrid template after RNase H digestion. The bold sequences are sequences for RNase H digestion guidance and Klenow extension template, and the underlined sequences are complementary to the RNA substrate after the RNase H digestion. Sequences shown are identified as follows: RNA50 (SEQ ID NO: 7); Hybrid Template DNA-2'-O-Me-RNA20.8 (SEQ ID NO: 3); Digested RNA40 (SEQ ID NO: 10); Template bound to RNA40 (SEQ ID NO: 11); Labeled RNA41 (SEQ ID NO: 12); and Template bound to RNA41 (SEQ ID NO: 11).

[0028] FIG. 2 shows an autoradiogram and cartoon illustrating selective labeling and detection of lacZ mRNA in E. coli total RNA via RNase H digestion and DNA polymerase extension. Lane 1, marker; lane 2, total RNA (0.4 μg) isolated from IPTG induced E. coli cells; lane 3, total RNA (0.4 μg) isolated from glucose repressed E. coli cells; lane 4, IPTG- induced total RNA (0.4 g), no Klenow. The autoradiography film was exposed for one day before development. [0029] FIG. 3 shows an autoradiogram and schematic depicting the labeling and detection of RNA31 and lacZ mRNA on template DNA-2'-0-Me-RNA35.1. 1 ΐ. of [<x-³²P]- dATP (3000 Ci/mmol, 10 mCi/mL) and cold dATP (1 x 10^"12 moles) were used for each labeling reaction of lanes 4-10. Glucose-repressed E. coli total RNA (1 μg) was individually added to each sample of lanes 4-7. Lane 1 & 2, RNA marker (24 nt); lane 3, empty; lane 4, 5. times.10.sup. -15 moles of RNA31; lane 5, 5.times. l0.sup.-16 moles of RNA31 ; lane 6, 5.times. l0.sup.-17 moles of RNA31; lane 7, 5.times. l0.sup.-18 moles of RNA31 ; lane 8, IPTG-induced E. coli total RNA (1 μg); lane 9, glucose-repressed E. coli total RNA (1 μg); lane 10, yeast total mRNA (10 ng) isolated from lacZ mRNA-expressing yeast system.

[0030] FIG. 4 shows a cartoon illustrating the detection of mRNA with enzyme labeling and chemiluminescence.

[0031] FIG. 5 shows an autoradiogram which visualizes selective labeling of lacZ mRNA on a 96-well plate. Spot 1 (negative control), no RNA; Spot 2, total mRNA isolated from the glucose culture; Spot 3, total mRNA isolated from the galactose culture; Spot 4 (positive control), RNA24; Spot 5, RNA24 addition to experiment in Spot 2; Spot 6, repeat of Spot 4.

[0032] FIG. 6 is a flowchart of RNA specific detection on a plate or microchip.

[0033] FIG. 7 is a stick figure illustrating the general design of a hybrid template.

[0034] FIG. 8 shows a nucleic acid sequence of a bacterial Rps F gene (SEQ ID NO: 13). Nucleic acid sequences comprising Template 1 (SEQ ID NO: 14) and Template 2 (SEQ ID NO: 15) and their targeting sequences (SEQ ID Nos: 16 and 17, respectively) in the Rps F gene are also indicated.

[0035] FIGS. 9 A and 9B show a nucleic acid sequence of an E. coli lacZ gene open reading frame encoding beta-galactosidase (EC 3.2.1.23) (SEQ ID NO: 18). Nucleic acid sequences comprising Template 1 (SEQ ID NO: 5) and Template 2 (SEQ ID NO: 6) and their targeting sequences in the E. coli lacZ gene open reading frame are also indicated.

[0036] FIG. 10 shows a nucleic acid sequence of an exoA gene of S. meliloti strain 1021 (SEQ ID NO: 19). Nucleic acid sequences comprising a Template (SEQ ID NO: 20) and its targeting sequences (SEQ ID NO: 21) in the exoA gene are also indicated.

[0037] FIG. 11 shows a nucleic acid sequence of a PF2NC15 polyprotein gene of

Hepatitis C Virus (SEQ ID NO: 22). Nucleic acid sequences comprising a Template (SEQ ID NO: 23) and its targeting sequences (SEQ ID NO: 24) in the PF2NC15 polyprotein gene are also indicated.

[0038] FIG. 12 shows a nucleic acid sequence of a human immunodeficiency virus- 1 (HIV-1) envelope (env) gene (SEQ ID NO: 25). Nucleic acid sequences comprising a Template (SEQ ID NO: 26) and its targeting sequences (SEQ ID NO: 27) in the env gene are also indicated.

[0039] FIG. 13 shows a nucleic acid sequence of a SARS gene (SEQ ID NO: 28).

Nucleic acid sequences comprising a Template (SEQ ID NO: 29) and its targeting sequences (SEQ ID NO: 30) in the SARS gene are also indicated.

[0040] FIG. 14 shows a schematic flow chart of specific RNA detection on a microplate.

[0041] FIGS. 15A and B show autoradiograms which visualize enzymatic detection of RNA on 96-well microplates. Target RNA24.1 (1 pmole) and template DNA35.1 (100 pmole). Well 1, no RNA24.1 ; well 2, no DNA35.1; well 3, no biotin-dATP; well 4, no Klenow; and well 5, the positive experiment with all reagents. (B) Detection sensitivity studies were as follows: well 1, no RNA24.1 ; well 2, 1 x 10^"15 mole; well 3, 1. times.10. sup. -4 mole; well 4, 1. times. lO.sup.- 13 mole. The film was exposed for one hour (A) or five hours (B) after substrate addition.

[0042] FIG. 16 shows an autoradiogram revealing selective detection of lacZ mRNA on a microplate. Total mRNA and RNA24.1 used for each experiment were 0.1 μg and 10 fmole, respectively (6 hr exposure). Well 1, galactose-induced mRNA; well 2, glucose-repressed mRNA; well 3, no RNA (negative control); well 4, glucose-repressed mRNA and RNA24.1 ; and well 5, RNA24.1 (positive control).

[0043] Figure 17 A and 17B show hybridization kinetics and rapid RNA detection. A) the rate of interaction of the target RNA (5 ' - AUGUGGAUUGGCGAUAAAAAACAA- biotin-Cy3-3 ') and the chimeric probe [5-d(GTTGTTTTTT)2 ' -O-Me-

RNA(AUCGCCAAUCCACAU)-d(CTGTGAAAGA-NH₃-3'] on RNA the microchip. B) Rapid detection of lacZ RNA on the RNA Microchip in the presence of the BA probe as a negative control, while the biotin-labeled DNA was used as a positive control. The target RNA was detected in approximately 20min.

[0044] Figure 18 shows RNA detection on RNA microchip with single-nucletide discrimination via the RNase H digestion and Klenow extension at 60° C. [0045] Figure 19 shows the detection sensitivity and selective detection of an individual mRNA. 19A shows the RNA detection sensitivity; Image 1-5: 0, 1, 10, 25 and 50 fmole RNA respectively. 19B shows the detection of lacL mRNA in the IPTG-induced total RNA; Image 1-4: no RNA, the glucose-suppressed total RNA, a mixture of the glucose- suppressed total RNA and the lacL mRNA synthetic fragment, and the IPTG-induced total RNA, respectively.

[0046] Figure 20 shows the scheme of rapid RNA detection using enzymatic reactions on RNA chips

[0047] Figure 21 shows the activation of the silicon or glass microchip surface.

[0048] Figure 22A, B, C, D, E, and F show simultaneous and selective detection of multi-pathogen RNAs on RNA microchip. The RNA microchip was immobilized with the corresponding detecting probes (2x2 spots for each probe) for the lacZ mRNA (lacZ), Bacillus anthracis RNA (BA), bird flu RNA (BF), and swine flu RNA (SF). A) The SF RNA and its detecting probe are shown here as examples; the other RNA sequences and their probes are presented in the supporting information. SF RNA was specifically detected by incorporating the biotin-labeled dGTP and dATP into the RNA. B) Selective detection of the SF RNA when only SF was present in the sample, while the other probes worked as controls; C) Selective detection of the BA RNA when only BA was present in the sample, while the other probes worked as controls; D) Simultaneous and selective detection of the BA and SF RNAs when both were present in the sample, while the immobilized probes for the lacZ and BF RNAs were the negative controls; E) Simultaneous and selective detection of the lacZ and BF RNAs when both were present in the sample, while the immobilized probes for the BA and SF RNAs were the negative controls; F) Simultaneous and selective detection of the BA, BF and SF RNAs when they were present in the sample, while the immobilized lacZ probe was the negative control.

DETAILED DESCRIPTION

[0049] Before the present compounds, compositions, articles, devices, and/or methods are disclosed and described, it is to be understood that they are not limited to specific synthetic methods or specific recombinant biotechnology methods unless otherwise specified, or to particular reagents unless otherwise specified, as such may, of course, vary. It is also to be understood that the terminology used herein is for the purpose of describing particular embodiments only and is not intended to be limiting. [0050] Unless defined otherwise, all technical and scientific terms used herein have the same meanings as commonly understood by one of skill in the art to which the disclosed method and compositions belong. Although any methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present method and compositions, the particularly useful methods, devices, and materials are as described.

[0051] It is understood that the disclosed method and compositions are not limited to the particular methodology, protocols, and reagents described as these may vary. It is also to be understood that the terminology used herein is for the purpose of describing particular embodiments only, and is not intended to limit the scope which will be limited only by the appended claims.

[0052] Those skilled in the art will recognize, or be able to ascertain using no more than routine experimentation, many equivalents to the specific embodiments of the method and compositions described herein. Such equivalents are intended to be encompassed by the following claims.

A. Definitions

1. A

[0053] As used in the specification and the appended claims, the singular forms "a," "an" and "the" or like terms include plural referents unless the context clearly dictates otherwise. Thus, for example, reference to "a pharmaceutical carrier" includes mixtures of two or more such carriers, and the like.

2. Abbreviations

[0054] Abbreviations, which are well known to one of ordinary skill in the art, may be used (e.g., "h" or "hr" for hour or hours, "g" or "gm" for gram(s), "mL" for milliliters, and "rt" for room temperature, "nm" for nanometers, "M" for molar, and like abbreviations).

3. About

[0055] About modifying, for example, the quantity of an ingredient in a composition, concentrations, volumes, process temperature, process time, yields, flow rates, pressures, and like values, and ranges thereof, employed in describing the embodiments of the disclosure, refers to variation in the numerical quantity that can occur, for example, through typical measuring and handling procedures used for making compounds, compositions, concentrates or use formulations; through inadvertent error in these procedures; through differences in the manufacture, source, or purity of starting materials or ingredients used to carry out the methods; and like considerations. The term "about" also encompasses amounts that differ due to aging of a composition or formulation with a particular initial concentration or mixture, and amounts that differ due to mixing or processing a composition or formulation with a particular initial concentration or mixture. Whether modified by the term "about" the claims appended hereto include equivalents to these quantities.

4. Comprise

[0056] Throughout the description and claims of this specification, the word "comprise" and variations of the word, such as "comprising" and "comprises," means "including but not limited to," and is not intended to exclude, for example, other additives, components, integers or steps.

5. Consisting essentially of

[0057] "Consisting essentially of in embodiments refers, for example, to a surface composition, a method of making or using a surface composition, formulation, or composition on the surface of the biosensor, and articles, devices, or apparatus of the disclosure, and can include the components or steps listed in the claim, plus other components or steps that do not materially affect the basic and novel properties of the compositions, articles, apparatus, and methods of making and use of the disclosure, such as particular reactants, particular additives or ingredients, a particular agents, a particular cell or cell line, a particular surface modifier or condition, a particular ligand candidate, or like structure, material, or process variable selected. Items that may materially affect the basic properties of the components or steps of the disclosure or may impart undesirable characteristics to the present disclosure include, for example, decreased affinity of the cell for the biosensor surface, aberrant affinity of a stimulus for a cell surface receptor or for an intracellular receptor, anomalous or contrary cell activity in response to a ligand candidate or like stimulus, and like characteristics.

6. Components

[0058] Disclosed are the components to be used to prepare the disclosed compositions as well as the compositions themselves to be used within the methods disclosed herein. These and other materials are disclosed herein, and it is understood that when combinations, subsets, interactions, groups, etc. of these materials are disclosed that while specific reference of each various individual and collective combinations and permutation of these molecules may not be explicitly disclosed, each is specifically contemplated and described herein. Thus, if a class of molecules A, B, and C are disclosed as well as a class of molecules D, E, and F and an example of a combination molecule, A-D is disclosed, then even if each is not individually recited each is individually and collectively contemplated meaning

combinations, A-E, A-F, B-D, B-E, B-F, C-D, C-E, and C-F are considered disclosed.

Likewise, any subset or combination of these is also disclosed. Thus, for example, the subgroup of A-E, B-F, and C-E would be considered disclosed. This concept applies to all aspects of this application including, but not limited to, steps in methods of making and using the disclosed compositions. Thus, if there are a variety of additional steps that can be performed it is understood that each of these additional steps can be performed with any specific embodiment or combination of embodiments of the disclosed methods.

7. Compounds and compositions

[0059] Compounds and compositions have their standard meaning in the art. It is understood that wherever, a particular designation, such as a molecule, substance, marker, cell, or reagent compositions comprising, consisting of, and consisting essentially of these designations are disclosed.

8. Detection label

[0060] A "detection label" or like terms refers to any molecule or moiety which can be detected by, such as flourescence, radioactivity, phosphorescence, or the like.

9. Extended RNA molecule

[0061] The term "extended RNA molecule" refers to an RNA molecule which has been extended or made longer. Disclosed herein, "extended RNA molecules" can comprise at least one detectable label. The extended RNA molecule can be shorter than the original specific RNA molecule that binds to a hybrid template but will be longer than the RNase H treated RNA molecule.

10. Hybrid template

[0062] The term hybrid template refers to the combination of one or more different things on one template. For example, as disclosed herein a hybrid template can comprise a nucleic acid template comprising both DNA and RNA. In some instances, the hybrid template comprises two DNA portions and one RNA portion. In some instances the hybrid template comprises one DNA portion and one RNA portion. 11. Microorganism or pathogen

[0063] The terms "microorganism" or "pathogen" refers to a variety of organisms. Microorganisms can include bacteria, fungi, archaea, and protists; microscopic plants (green algae); and animals such as plankton and the planarian. In some instances, viruses can be considered microorganisms. Pathogens are biological agents that can cause disease. Many microorganisms are also pathogens.

12. Operably linked

[0064] As used herein, the terms "linked", "operably linked" and "operably bound" and variants thereof mean, for purposes of the specification and claims, to refer to fusion, bond, adherence or association of sufficient stability to withstand conditions encountered in single molecule applications and/or the methods and systems disclosed herein, between a combination of different molecules such as, but not limited to: between a detectable label and nucleotide, between a detectable label and a linker, between a nucleotide and a linker, between a protein and a functionalized nanocrystal; between a linker and a protein; and the like. For example, in a labeled polymerase, the label is operably linked to the polymerase in such a way that the resultant labeled polymerase can readily participate in a polymerization reaction. See, for example, Hermanson, G., 2008, Bioconjugate Techniques, Second Edition. Such operable linkage or binding may comprise any sort of fusion, bond, adherence or association, including, but not limited to, covalent, ionic, hydrogen, hydrophilic, hydrophobic or affinity bonding, affinity bonding, van der Waals forces, mechanical bonding, etc.

13. Or

[0065] The word "or" or like terms as used herein means any one member of a particular list and also includes any combination of members of that list.

14. Positive indicator

[0066] The term "positive indicator" refers to anything that provides the ability to positively identify a specific sample. For example, a detectable label on an extended RNA molecule can act as a positive indicator by allowing one to positively identify that particular extended RNA molecule as the specific RNA molecule of interest.

15. Publications

[0067] Throughout this application, various publications are referenced. The disclosures of these publications in their entireties are hereby incorporated by reference into this application in order to more fully describe the state of the art to which this pertains. The references disclosed are also individually and specifically incorporated by reference herein for the material contained in them that is discussed in the sentence in which the reference is relied upon. Nothing herein is to be construed as an admission that the present invention is not entitled to antedate such disclosure by virtue of prior invention. No admission is made that any reference constitutes prior art. The discussion of references states what their authors assert, and applicants reserve the right to challenge the accuracy and pertinency of the cited documents. It will be clearly understood that, although a number of publications are referred to herein, such reference does not constitute an admission that any of these documents forms part of the common general knowledge in the art.

16. Ranges

[0068] Ranges can be expressed herein as from "about" one particular value, and/or to "about" another particular value. When such a range is expressed, another embodiment includes from the one particular value and/or to the other particular value. Similarly, when values are expressed as approximations, by use of the antecedent "about," it will be understood that the particular value forms another embodiment. It will be further understood that the endpoints of each of the ranges are significant both in relation to the other endpoint, and independently of the other endpoint. It is also understood that there are a number of values disclosed herein, and that each value is also herein disclosed as "about" that particular value in addition to the value itself. For example, if the value "10" is disclosed, then "about 10" is also disclosed. It is also understood that when a value is disclosed that "less than or equal to" the value, "greater than or equal to the value" and possible ranges between values are also disclosed, as appropriately understood by the skilled artisan. For example, if the value "10" is disclosed the "less than or equal to 10"as well as "greater than or equal to 10" is also disclosed. It is also understood that the throughout the application, data is provided in a number of different formats, and that this data, represents endpoints and starting points, and ranges for any combination of the data points. For example, if a particular data point "10" and a particular data point 15 are disclosed, it is understood that greater than, greater than or equal to, less than, less than or equal to, and equal to 10 and 15 are considered disclosed as well as between 10 and 15. It is also understood that each unit between two particular units are also disclosed. For example, if 10 and 15 are disclosed, then 11, 12, 13, and 14 are also disclosed. 17. Riboendonuclease

[0069] The term "riboendonuclease" refers to an enzyme that can cleave RNA within the RNA molecule and does not require a free 3' or 5' terminus. They can be specific or nonspecific. One example of a riboendonuclease is RNase H which cleaves RNA found in an RNA/DNA duplex.

18. Sample

[0070] By sample or like terms is meant an animal, a plant, a fungus, etc.; a natural product, a natural product extract, etc.; a tissue or organ from an animal; a cell (either within a subject, taken directly from a subject, or a cell maintained in culture or from a cultured cell line); a cell lysate (or lysate fraction) or cell extract; or a solution containing one or more molecules derived from a cell or cellular material (e.g. a polypeptide or nucleic acid), which is assayed as described herein. A sample may also be any body fluid or excretion (for example, but not limited to, blood, urine, stool, saliva, tears, bile) that contains cells or cell components.

19. Solid matrix

[0071] Solid matrix for use in the disclosed method can include any solid material to which components of the assay can be adhered or coupled. Examples of substrates include, but are not limited to, materials such as acrylamide, cellulose, nitrocellulose, glass, silicon chip, gold, polystyrene, polyethylene vinyl acetate, polypropylene, polymethacrylate, polyethylene, polyethylene oxide, polysilicates, polycarbonates, teflon, fluorocarbons, nylon, silicon rubber, polyanhydrides, polyglycolic acid, polylactic acid, polyorthoesters, polypropylfumerate, collagen, glycosaminoglycans, and polyamino acids. Substrates can have any useful form including thin films or membranes, beads, bottles, dishes, fibers, woven fibers, shaped polymers, particles and microparticles. Preferred forms of substrates are glass slides, plates and beads. The most preferred form of beads are magnetic beads.

20. Values

[0072] Specific and preferred values disclosed for components, ingredients, additives, cell types, markers, and like aspects, and ranges thereof, are for illustration only; they do not exclude other defined values or other values within defined ranges. The compositions, apparatus, and methods of the disclosure include those having any value or any combination of the values, specific values, more specific values, and preferred values described herein. [0073] Thus, the disclosed methods, compositions, articles, and machines, can be combined in a manner to comprise, consist of, or consist essentially of, the various components, steps, molecules, and composition, and the like, discussed herein.

B. Methods

[0074] Disclosed are methods for directly detecting a specific RNA molecule in a sample. Such a sample may comprise a plurality of different RNA species. In one aspect, the methods are used to detect directly a specific mRNA molecule in a sample. In another aspect, the methods are used in the context of a solid matrix to produce an RNA chip. Also encompassed is an RNA chip made using the described methods. Details pertaining to the method and products generated using the method are clearly set forth herein below.

[0075] Ribonuclease H (RNase H) is an endoribonuclease which specifically hydrolyzes the phosphodiester bonds of RNA which is hybridized to DNA. This enzyme does not digest single stranded nucleic acids, double- stranded DNA, or double stranded RNA.

[0076] Rapid progress in research endeavors directed to genome sequencing and functional genomics has enabled the determination of the complete genome sequences of many organisms, including a number of pathogens. Research in these fields has also provided considerable insight into disease mechanisms via gene expression profiling (Alizadeh et al. (2000) Nature 403:503-511; Lockhart and Winzeler (2000) Nature 405:827-836). A variety of nucleic acid-based detection techniques have been used, adapted, or developed as experimental systems for determining gene expression patterns. Such systems include:

Southern and Northern blot analysis using fluorescent or chemiluminescent probes, quantitative PCR (Chung et al. (1999) J. Microbiol. Methods 38:119-130), fluorescent quantitative PCR or real-time PCR (Holland et al. (1991) Proc. Natl. Acad. Sci. USA

88:7276-7280; Nadkarni et al. (2002) Microbiology 148:257-66), the branched DNA (bDNA) assay (Horn et al. (1997) Nucleic Acids Res. 25:4842-4849), rolling circle amplification

(Schweitzer et al. (2000) Proc. Natl. Acad. Sci. USA 97:10113-10119), GeneChip technology (Chee et al. (1996) Science 274:610-614), and MicroArray technology (Iyer et al. (1999) Science 283:83-87). Such systems can be used to identify microorganisms (e.g., pathogens), validate new drug targets, and provide diagnostic disease indicators. Of note, several of these systems have been approved by the Food and Drug Administration (FDA) for the detection of infectious diseases, such as, human immunodeficiency virus (HIV) and Mycobacterium tuberculosis (MTb). [0077] Microarray analysis and real-time PCR are the most popular technologies in this area (Golub et al. (1999) Science 286:531-537; Trottier et al. (2002) J. Virol. Methods 103:89-99). Microarrays comprised of oligonucleotides or complementary DNA (cDNA) have been used successfully in gene expression profiling studies. Such studies provide information on expression levels of individual genes and reveal patterns of coordinated gene expression. This information can be used in drug discovery, cancer monitoring, cancer type classification, and identification of microorganisms, viruses, and other pathogens in a sample (Golub, et al. 1999, supra; Young et al. (2002) J Virol Methods 103:27-39). Moreover, technologies directed to the use of high-density microarrays allow gene expression profiling of over tens of thousands of genes (Lockhart and Winzeler, 2000, supra).

[0078] Nucleic acid-detection methods for viral and bacterial real-time analysis, using reverse transcription and polymerase chain reaction (PCR) technologies (Trottier et al. 2002, supra; Aldea et al. (2002) J Clin Microbiol 40, 1060-2; Nadkarni et al. (2002) Microbiology 148, 257-66; Young et al. (2002) J Virol Methods 103, 27-39), have significantly improved the precision of pathogen detection and shortened analysis time, features which are especially useful under emergency conditions. Real-time PCR technology allows accurate quantitation of gene expression and gene expression patterns in multiple samples and over a large dynamic range. Though these methods are used to analyze mRNA expression levels, the quantitation is actually determined indirectly by measuring the amount of amplified cDNA or bound probe, rather than the amount of RNA.

[0079] In brief, real-time PCR technology is dependent on reverse transcription, PCR amplification and probe digestion, whereby a fluorescent signal is detected after DNA polymerase mediated cleavage and release of the reporter in each amplification cycle. In contrast, the oligonucleotide microarray procedure generally consists of the following steps: reverse transcription, DNA polymerization, transcription, biotin- strep tavidin interactions or antibody binding (or the like), and fluorophore labeling. The signals are amplified during the transcription step and subsequent steps, wherein fluorescent labels are incorporated. In order to perform detection and quantification, the fluorophores are activated by laser excitation to emit detectable fluorescent signals. Although these methods are bolstered by high detection sensitivity and are powerful for studying functional genomics and drug discovery, they are not well suited to real life applications, such as emergent field detection and rapid clinical diagnosis for the point-of-care. Significant drawbacks associated with these methods include the complicated and time-consuming nature of the procedures, problems arising from cross- contamination, the necessity of expensive equipment, and the prohibitive cost of analysis. For daily clinical diagnosis and emergent field detection, it would be ideal to have a simple, rapid, sensitive, specific, accurate, high-throughput, and cost-effective method to directly detect and quantify RNA of interest.

[0080] To address this need, disclosed aremicrochip technologies directed to the detection of fingerprint RNAs present in an RNA mixture. Examples of fingerprint RNAs include, but are not limited to, viral and bacterial RNAs in RNA samples, or specific mRNA transcripts in samples comprising total RNA. Disclosed are modified terminal RNA labeling methods which directly label and detect specific RNA molecules in a mixture. The methods are can fundamentally differ from existing methods that have been used to determine gene expression patterns in that it does not require reverse transcription, PCR, in vitro

transcription, or gel electrophoresis. As a consequence, the methods dramatically accelerate the speed with which a specific RNA can be detected in a mixture of molecules and thus expedites the detection of a deleterious nucleic acid molecule and/or pathogen associated with a specific nucleic acid molecule (e.g. a specific RNA molecule). The methods, therefore, provide an accurate indicator of the presence of a disease and/or microorganism in a sample. As this direct RNA detection microchip technology is simple, rapid, accurate, sensitive, high- throughput, and cost-effective, it is an ideal assay for point-of-care disease diagnosis, detection of microbial contamination in food and/or water supplies, and pathogen detection in biodefense.

[0081] The above mentioned novel chip technology uses direct labeling/detection of a specific mRNA in total mRNA or a sample comprising total RNA. To this end, a method wasevised to remove the 3 '-region which is conserved among most eukaryotic mRNA transcripts [e.g., the poly(A) tail and 3 '-untranslated region )3'-UTR)] from a specific mRNA and, thereby expose intrinsic 3'-sequences for labeling and detection.

[0082] The method can involve an Rnase H digestion protocol which takes advantage of the ability of Rnase H to digest RNA which has formed a duplex with a DNA sequence (Nakamura and Oda. (1991) Proc. Natl. Acad. Sci. USA 88:11535-11539). The method can rely on the selection of a 2'-0-Me-RNA/DNA hybrid which binds to a specific mRNA and protects a unique internal sequence of the mRNA from Rnase H mediated digestion (via RNA/RNA duplex formation), but also binds/positions other regions of the mRNA (such as the 3 '-region), so as to render these regions susceptible to Rnase H digestion (via RNA/DNA duplex formation). The overhang formed following Rnase H mediated digestion serves as a recognition/extension site for a DNA polymerase (e.g., Klenow) on the fragment of the specific mRNA whereby nucleotide labels may be incorporated to effect detection of the specific mRNA.

[0083] The methods are based in part on a method developed by Huang and Szostak [(1996) Nucleic Acids Res. 24, 4360-1] for labeling the 3'-termini of RNA. This method took advantage of a natural function of DNA polymerases: elongation of RNA primers on DNA templates. This observation was subsequently investigated further and shown to be applicable to the development of a method for labeling and detecting specific RNA transcripts. Huang and Szostak [(2003) Anal Biochem 315: 129-133] discovered that the ready availability of short synthetic DNA template allows an RNA of known 3 '-terminal sequence to be selectively extended in a template-dependent manner at its 3 '-end, which facilitates labeling and detection of the specific RNA in an RNA mixture, without separation, purification, reverse transcription, or PCR. The contents of each of Huang and Szostak [(1996) Nucleic Acids Res. 24, 4360-1] and Huang and Szostak [(2003) Anal Biochem 315: 129-133] are incorporated herein by reference in their entirety. Methodology relating to labeling and modification of RNA 3'-termini are also described in U.S. Pat. No. 6,238,865 (issued to Huang and Szostak), the entire contents of which is incorporated herein by reference.

[0084] To simplify the experimental procedure, avoid the use of radioactivity, and further increase detection sensitivity, the step of radioactive labeling method of Huang and Szostak [(2003), supra)] can also be modified to become an enzyme labeling method, which uses enzymes such as peroxidase or alkaline phosphatase to catalyze chemiluminescent reactions (Pollard-Knight et al. (1990) Anal. Biochem. 185, 84-89; Reddy et al. (1999) Biotechniques 26710-714). Details pertaining to using the method with various

labeling/detection methods are described in greater detail herein below.

[0085] The direct labeling of specific RNA using the 3 '-terminal labeling method described herein above simplifies the experimental procedure and reduces the time required for analysis of a specific RNA transcript or transcripts in a sample. Such features are particularly important in emergency situations, such as those involving a potential or realized epidemic, a pathogenic contaminant in a biological resource (such as, for example, a public food or water supply), or the detection and/or determination of a bio-terrorist attack. As described herein, specific RNAs can be labeled initially with antigens and subsequently labeled with enzymes, such as alkaline phosphatase (AP), which can catalyze a

chemiluminescent reaction. Unlike fluorescence detection, wherein detection sensitivity is relatively low and laser excitation is required to generate fluorescent signals,

chemiluminescence detection sensitivity is high and excitation is not needed. These features can dramatically reduce the instrumental costs associated with detection. Moreover, an instrument which is not required to have laser excitation capabilities would also tend to be smaller and lighter than those used for fluorescence detection. Such aspects of the invention are well suited to the challenges associated with field detection and point-of-care.

1. Methodological Details

i. DNA and RNA Polymerases

[0086] A variety of DNA and RNA polymerases have been screened and examined for the ability to catalyze RNA 3 '-extension on a DNA template. Enzymes, including E. coli DNA polymerase I, the Klenow fragment of E. coli DNA polymerase I (Sanger et al. (1977) Proc. Natl. Acad. Sci. USA 74:5463-5467), T4 DNA polymerase, T7 DNA polymerase, T7 RNA polymerase, M-MuLV reverse transcriptase, and Taq DNA polymerase have been tested for utility in the present methods by incubating each enzyme with a 5'-.sup.32P- labeled RNA, dNTPs, and a DNA template. In a similar fashion to that observed for DNA polymerase III mediated extension of RNA with dNTPs on a DNA template in vivo, many other DNA polymerases are able to extend RNA with dNTPs on a DNA template in vitro.

Both Klenow and T7 DNA polymerase effectively extend RNA, while the other polymerases tested either performed less efficiently or resulted in a greater extent of degradation. Under more stringent conditions, such as lower RNA substrate and DNA template concentrations, the Klenow fragment showed higher extension efficiency than T7 DNA polymerase.

Therefore, the Klenow fragment may be considered a preferred enzyme for use in 3 '-labeling reactions as described herein. See Huang and Szostak [(2003) Anal Biochem 315:129-133].

2. RNA Labeling and Detection Studies

i. RNA 3'-Terminal Labeling

[0087] Three methods for RNA terminal-labeling are commonly used: 5 '-labeling with T4 polynucleotide kinase and [.gamma.-. sup.32P]-ATP (Sambrook et al. (1989) Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory Press: Cold Spring Harbor); 3'-labeling with T4 RNA ligase, and 3',5'-[5'-.sup.32P]-pCp (England and Uhlenbeck. (1978) Nature 275:560-561); and 3'-labeling with poly(A) polymerase and [a-32P]- cordycepin 5 '-triphosphate (CoTP or 3'-deoxy-ATP; Linger and Keller. (1993) Nucleic Acids Res. 21:2917-2920). Since the enzymes used in these methods recognize RNA substrates nonspecifically, all RNA substrates in an RNA mixture are labeled at either 5' or 3' termini. The non-specific labeling feature of these methods provides an advantage when labeling and detection of all RNAs in an RNA mixture is desired. This advantage, however, becomes a drawback when labeling and detection of a specific RNA in an RNA mixture is desired (Sorensen et al. (2000) J. Lab Clin. Med. 136:209-217). Specific labeling may be necessitated when analyzing, for example, a specific viral RNA, ribosomal RNA, or cellular mRNA in a total RNA sample. In order to use these conventional methods in direct detection and analysis of a specific RNA, separation steps are required to isolate the specific RNA from the mixture.

[0088] The above requirement may be avoided by taking advantage of the following properties of polymerases. During double stranded DNA replication in cells, Okazaki fragments (Okazaki and Okazaki. (1969) Proc. Natl. Acad. Sci. USA 64:1242-1248) are synthesized by DNA polymerase III, via extension of RNA primers on a DNA strand to allow 3'-5' DNA lagging synthesis. Based on this RNA primer extension principle, DNA polymerase has been demonstrated to be capable of extending an RNA substrate with dNTPs on a short DNA template [see Huang and Szostak. (1996) Nucleic Acids Res. 24, 4360-1].

3. General Guidelines for Template Design

[0089] 1. Identification of RNA of interest (such as an mRNA, or other functional RNA) or protein targets for analysis.

[0090] 2. Acquisition of sequences comprising an RNA(s) or mRNA open-reading frame encoding a protein from scientific literature and/or GenBank

(http : //www.ncbi. nlm. nih. gov/) .

[0091] 3. Although any arbitrary section of an RNA [comprising 6-80 nucleotides(nt)] can be chosen for designing a hybrid template, the following issues should be considered when designing an effective template. In order to prevent secondary structure formation of a hybrid template, an RNA sequence (6-80 nt.) intended for incorporation into a template should be analyzed using computer-assisted folding programs, such as Mfold (M. Zuker,

Rensselaer Polytechnic Institute) to assess its potential for formation of secondary structure. If the sequence is predicted to form a secondary structure, a different RNA sequence should be considered.

[0092] 4. There are two basic designs for hybrid templates: 5'-DNA-(2'-MeO-RNA)-3' (I) and 5'-DNA-(2'-MeO-RNA)-DNA-3' (II). Design (I) comprises a 5'-end DNA (1-30 nt.) and a 3'-end 2'-MeO-RNA (5-79 nt.). The DNA is designated herein template DNA and the 2'-MeO-RNA is designated herein binding MeO-RNA. The targeted RNA sequence section bound to the template DNA is referred to as the labeling region and the targeted RNA sequence section bound to the binding MeO-RNA sequence is referred to as the binding region. Design (II) comprises 5'-end and 3'-end DNA sequences (1-30 nt. each) flanking the central 2'-MeO-RNA sequence (4-78 nt.). The 5'-end DNA is called template DNA, the 3'- end DNA is called digestion DNA, and the 2 '-MeO-RNA is called binding MeO-RNA. See FIG. 7. The targeted RNA sequence section bound to the template DNA is referred to as the labeling region, the targeted RNA sequence section bound to the digestion DNA is referred to as the digestion region, and the targeted RNA sequence section bound to the binding MeO- RNA sequence is referred to as the binding region.

[0093] 5. In order to minimize usage of different labeled dNTPs, the first several 5'- nucleotides (at least two nucleotides) in the labeling region may be selected to be a single kind of nucleotide, so as to produce, for example, a stretch of 5'-AAAA.

[0094] A hybrid template (I or II) may be chemically synthesized on solid phase and purified by HPLC or gel electrophoresis. Techniques directed to the synthesis and purification of such sequences are known in the art and routinely practiced.

[0095] FIGS. 8-13 provide nucleic acid sequences of a subset of exemplary genes, some of which are associated with various microorganisms and/or pathogens, which may be used in the detection methods of the present invention. Also presented in FIGS. 8-13 are sequences of hybrid templates useful in the method of the invention for detection of the specific gene (i.e., the RNA) indicated.

[0096] The basic molecular biology techniques used to practice the methods are well known in the art, and are described for example in Sambrook et al., 1989, Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory, New York; Ausubel et al., 1988, Current Protocols in Molecular Biology, John Wiley & Sons, New York; and Ausubel et al., 2002, Short Protocols in Molecular Biology, John Wiley & Sons, New York). [0097] Before the present assays methodology methodology are described, it is to be understood that they are not limited to particular assay methods, or test compounds and experimental conditions described, as such methods and compounds may vary. It is also to be understood that the terminology used herein is for the purpose of describing particular embodiments only, and is not intended to be limiting, since the scope of the present invention will be limited only the appended claims.

C. Hybridization/Selective Hybridization

[0098] The term hybridization typically means a sequence driven interaction between at least two nucleic acid molecules, such as a primer or a probe and a gene. Sequence driven interaction means an interaction that occurs between two nucleotides or nucleotide analogs or nucleotide derivatives in a nucleotide specific manner. For example, G interacting with C or A interacting with T are sequence driven interactions. Typically sequence driven interactions occur on the Watson-Crick face or Hoogsteen face of the nucleotide. The hybridization of two nucleic acids is affected by a number of conditions and parameters known to those of skill in the art. For example, the salt concentrations, pH, and temperature of the reaction all affect whether two nucleic acid molecules will hybridize.

[0099] Parameters for selective hybridization between two nucleic acid molecules are well known to those of skill in the art. For example, in some embodiments selective hybridization conditions can be defined as stringent hybridization conditions. For example, stringency of hybridization is controlled by both temperature and salt concentration of either or both of the hybridization and washing steps. For example, the conditions of hybridization to achieve selective hybridization can involve hybridization in high ionic strength solution (6.times.SSC or 6.times.SSPE) at a temperature that is about 12-25° C. below the Tm (the melting temperature at which half of the molecules dissociate from their hybridization partners) followed by washing at a combination of temperature and salt concentration chosen so that the washing temperature is about 5. degree. C. to 20° C. below the Tm. The temperature and salt conditions are readily determined empirically in preliminary experiments in which samples of reference DNA immobilized on filters are hybridized to a labeled nucleic acid of interest and then washed under conditions of different stringencies. Hybridization temperatures are typically higher for DNA-RNA and RNA-RNA

hybridizations. The conditions can be used as described above to achieve stringency, or as is known in the art. (Sambrook et al., Molecular Cloning: A Laboratory Manual, 2nd Ed., Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y., 1989; Kunkel et al. Methods Enzymol. 1987:154:367, 1987 which is herein incorporated by reference for material at least related to hybridization of nucleic acids). A preferable stringent hybridization condition for a

DNA:DNA hybridization can be at about 68° C. (in aqueous solution) in 6.times.SSC or 6.times.SSPE followed by washing at 68° C. Stringency of hybridization and washing, if desired, can be reduced accordingly as the degree of complementarity desired is decreased, and further, depending upon the G-C or A-T richness of any area wherein variability is searched for. Likewise, stringency of hybridization and washing, if desired, can be increased accordingly as homology desired is increased, and further, depending upon the G-C or A-T richness of any area wherein high homology is desired, all as known in the art.

[00100] Another way to define selective hybridization is by looking at the amount (percentage) of one of the nucleic acids bound to the other nucleic acid. For example, in some embodiments selective hybridization conditions would be when at least about, 60, 65, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100 percent of the limiting nucleic acid is bound to the non-limiting nucleic acid. Typically, the non-limiting primer is in for example, 10 or 100 or 1000 fold excess. This type of assay can be performed at under conditions where both the limiting and non-limiting primer are for example, 10 fold or 100 fold or 1000 fold below their k.sub.d, or where only one of the nucleic acid molecules is 10 fold or 100 fold or 1000 fold or where one or both nucleic acid molecules are above their k_<|.

[0100] Another way to define selective hybridization is by looking at the percentage of primer that gets enzymatically manipulated under conditions where hybridization is required to promote the desired enzymatic manipulation. For example, in some embodiments selective hybridization conditions would be when at least about, 60, 65, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100 percent of the primer is enzymatically manipulated under conditions which promote the enzymatic manipulation, for example if the enzymatic manipulation is DNA extension, then selective hybridization conditions would be when at least about 60, 65, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100 percent of the primer molecules are extended. Preferred conditions also include those suggested by the manufacturer or indicated in the art as being appropriate for the enzyme performing the manipulation. [0101] Just as with homology, it is understood that there are a variety of methods herein disclosed for determining the level of hybridization between two nucleic acid molecules. It is understood that these methods and conditions can provide different percentages of hybridization between two nucleic acid molecules, but unless otherwise indicated meeting the parameters of any of the methods would be sufficient. For example if 80% hybridization was required and as long as hybridization occurs within the required parameters in any one of these methods it is considered disclosed herein.

[0102] It is understood that those of skill in the art understand that if a composition or method meets any one of these criteria for determining hybridization either collectively or singly it is a composition or method that is disclosed herein.

D. Detectable labels

[0103] A variety of detectable agents are useful in the disclosed methods. As used herein, the term "detectable label" refers to any molecule which can be detected. Useful detectable labels include compounds and molecules that can be administered in vivo and subsequently detected. Detectable labels useful in the disclosed compositions and methods include yet are not limited to radiolabels and fluorescent molecules. The detectable label can be, for example, any moiety or molecule that facilitates detection, either directly or indirectly, preferably by a non-invasive and/or in vivo visualization technique. For example, a detectable label can be detectable by any known imaging techniques, including, for example, a radiological technique, a magnetic resonance technique, or an ultrasound technique.

Detectable labels can include, for example, a contrast agent. The contrast agent can be, for example, Feridex. The contrasting agent can be, for example, ionic or non-ionic. In some embodiments, for instance, the detectable label comprises a tantalum compound and/or a barium compound, e.g., barium sulfate. In some embodiments, the detectable label comprises iodine, such as radioactive iodine. In some embodiments, for instance, the detectable label comprises an organic iodo acid, such as iodo carboxylic acid, triiodophenol, iodoform, and/or tetraiodoethylene. In some embodiments, the detectable label comprises a non-radioactive detectable agent, e.g., a non-radioactive isotope. For example, iron oxide and Gd can be used as a non-radioactive detectable label in certain embodiments. Detectable labels can also include radioactive isotopes, enzymes, fluorophores, and quantum dots (Qdot®). For example, the detection label can be an enzyme, biotin, metal, or epitope tag. Other known or newly discovered detectable labels are contemplated for use with the provided compositions. In some embodiments, for instance, the detectable label comprises a barium compound, e.g., barium sulfate.

[0104] Other examples of detectable labels include molecules which emit or can be caused to emit detectable radiation (e.g., fluorescence excitation, radioactive decay, spin resonance excitation, etc.), molecules which affect local electromagnetic fields (e.g., magnetic, ferromagnetic, ferromagnetic, paramagnetic, and/or superparamagnetic species), molecules which absorb or scatter radiation energy (e.g., chromophores and/or fluorophores), quantum dots, heavy elements and/or compounds thereof. See, e.g., detectable agents described in U.S. Publication No. 2004/0009122. Other examples of detectable labels include a proton-emitting molecules, a radiopaque molecules, and/or a radioactive molecules, such as a radionuclide like Tc-99m and/or Xe-13. Such molecules can be used as a

radiopharmaceutical. In still other embodiments, the disclosed compositions can comprise one or more different types of detectable labels, including any combination of the detectable labels disclosed herein.

[0105] Useful fluorescent labels include fluorescein isothiocyanate (FITC), 5,6- carboxymethyl fluorescein, Texas red, nitrobenz-2-oxa-l,3-diazol-4-yl (NBD), coumarin, dansyl chloride, rhodamine, amino-methyl coumarin (AMCA), Eosin, Erythrosin, BODIPY^®, Cascade Blue^®, Oregon Green^®, pyrene, lissamine, xanthenes, acridines, oxazines, phycoerythrin, macrocyclic chelates of lanthanide ions such as quantum dye™, fluorescent energy transfer dyes, such as thiazole orange-ethidium heterodimer, and the cyanine dyes Cy3, Cy3.5, Cy5, Cy5.5 and Cy7. Examples of other specific fluorescent labels include 3- Hydroxypyrene 5,8,10-Tri Sulfonic acid, 5-Hydroxy Tryptamine (5-HT), Acid Fuchsin, Alizarin Complexon, Alizarin Red, Allophycocyanin, Aminocoumarin, Anthroyl Stearate, Astrazon Brilliant Red 4G, Astrazon Orange R, Astrazon Red 6B, Astrazon Yellow 7 GLL, Atabrine, Auramine, Aurophosphine, Aurophosphine G, BAO 9

(Bisaminophenyloxadiazole), BCECF, Berberine Sulphate, Bisbenzamide, Blancophor FFG Solution, Blancophor SV, Bodipy Fl, Brilliant Sulphoflavin FF, Calcien Blue, Calcium Green, Calcofluor RW Solution, Calcofluor White, Calcophor White ABT Solution, Calcophor White Standard Solution, Carbostyryl, Cascade Yellow, Catecholamine,

Chinacrine, Coriphosphine O, Coumarin-Phalloidin, CY3.1 8, CY5.1 8, CY7, Dans (1-

Dimethyl Amino Naphaline 5 Sulphonic Acid), Dansa (Diamino Naphtyl Sulphonic Acid), Dansyl NH-CH3, Diamino Phenyl Oxydiazole (DAO), Dimethylamino-5-Sulphonic acid, Dipyrrometheneboron Difluoride, Diphenyl Brilliant Flavine 7GFF, Dopamine, Erythrosin ITC, Euchrysin, FIF (Formaldehyde Induced Fluorescence), Flazo Orange, Fluo 3,

Fluorescamine, Fura-2, Genacryl Brilliant Red B, Genacryl Brilliant Yellow 10GF, Genacryl Pink 3G, Genacryl Yellow 5GF, Gloxalic Acid, Granular Blue, Haematoporphyrin, Indo-1, Intrawhite Cf Liquid, Leucophor PAF, Leucophor SF, Leucophor WS, Lissamine Rhodamine B200 (RD200), Lucifer Yellow CH, Lucifer Yellow VS, Magdala Red, Marina Blue, Maxilon Brilliant Flavin 10 GFF, Maxilon Brilliant Flavin 8 GFF, MPS (Methyl Green Pyronine Stilbene), Mithramycin, NBD Amine, Nitrobenzoxadidole, Noradrenaline, Nuclear Fast Red, Nuclear Yellow, Nylosan Brilliant Flavin E8G, Oxadiazole, Pacific Blue,

Pararos aniline (Feulgen), Phorwite AR Solution, Phorwite BKL, Phorwite Rev, Phorwite RPA, Phosphine 3R, Phthalocyanine, Phycoerythrin R, Polyazaindacene Pontochrome Blue Black, Porphyrin, Primuline, Procion Yellow, Pyronine, Pyronine B, Pyrozal Brilliant Flavin 7GF, Quinacrine Mustard, Rhodamine 123, Rhodamine 5 GLD, Rhodamine 6G, Rhodamine B, Rhodamine B 200, Rhodamine B Extra, Rhodamine BB, Rhodamine BG, Rhodamine WT, Serotonin, Sevron Brilliant Red 2B, Sevron Brilliant Red 4G, Sevron Brilliant Red B, Sevron Orange, Sevron Yellow L, SITS (Primuline), SITS (Stilbene Isothiosulphonic acid), Stilbene, Snarf 1 , sulpho Rhodamine B Can C, Sulpho Rhodamine G Extra, Tetracycline, Thiazine Red R, Thioflavin S, Thioflavin TCN, Thioflavin 5, Thiolyte, Thiozol Orange, Tinopol CBS, True Blue, Ultralite, Uranine B, Uvitex SFC, Xylene Orange, and XRITC.

[0106] Particularly useful fluorescent labels include fluorescein (5-carboxyfluorescein- N-hydroxysuccinimide ester), rhodamine (5,6-tetramethyl rhodamine), and the cyanine dyes Cy3, Cy3.5, Cy5, Cy5.5 and Cy7. The absorption and emission maxima, respectively, for these fluors are: FITC (490 nm; 520 nm), Cy3 (554 nm; 568 nm), Cy3.5 (581 nm; 588 nm), Cy5 (652 nm: 672 nm), Cy5.5 (682 nm; 703 nm) and Cy7 (755 nm; 778 nm), thus allowing their simultaneous detection. Other examples of fluorescein dyes include 6- carboxyfluorescein (6-FAM), 2',4',1,4,-tetrachlorofluorescein (TET), 2',4',5',7',1,4- hexachlorofluorescein (HEX), 2',7'-dimethoxy-4', 5'-dichloro-6-carboxyrhodamine (JOE), 2'- chloro-5'-fluoro-7',8'-fused phenyl- l,4-dichloro-6-carboxyfluorescein (NED), and 2'-chloro- 7'-phenyl-l,4-dichloro-6-carboxyfluorescein (VIC). Fluorescent labels can be obtained from a variety of commercial sources, including Amersham Pharmacia Biotech, Piscataway, NJ;

Molecular Probes, Eugene, OR; and Research Organics, Cleveland, Ohio. Fluorescent probes and there use are also described in Handbook of Fluorescent Probes and Research Products by Richard P. Haugland.

[0107] Further examples of radioactive detectable labels include gamma emitters, e.g., the gamma emitters In-I ll, 1-125 and 1-131, Rhenium-186 and 188, and Br-77 (see. e.g., Thakur, M. L. et al., Throm Res. Vol. 9 pg. 345 (1976); Powers et al., Neurology Vol. 32 pg. 938 (1982); and U.S. Pat. No. 5,011,686); positron emitters, such as Cu-64, C-ll, and 0-15, as well as Co-57, Cu-67, Ga-67, Ga-68, Ru-97, Tc-99m, In- 113m, Hg-197, Au-198, and Pb- 203. Other radioactive detectable labels can include, for example tritium, C-14 and/or thallium, as well as Rh-105, 1-123, Nd-147, Pm-151, Sm-153, Gd-159, Tb-161, Er-171 and/or Tl-201.

[0108] The use of Technitium-99m (Tc-99m) is preferable and has been described in other applications, for example, see U.S. Pat. No. 4,418,052 and U.S. Pat. No. 5,024,829. Tc- 99m is a gamma emitter with single photon energy of 140 keV and a half-life of about 6 hours, and can readily be obtained from a Mo-99/Tc-99 generator.

[0109] In some embodiments, compositions comprising a radioactive detectable label can be prepared by coupling radioisotopes suitable for detection to the disclosed components and compositions. Coupling can be, for example, via a chelating agent such as

diethylenetriaminepentaacetic acid (DTP A), 4,7,10-tetraazacyclododecane-N- ,N',N",N"'- tetraacetic acid (DOTA) and/or metallothionein, any of which can be covalently attached to the disclosed components, compounds, and compositions. In some embodiments, an aqueous mixture of technetium-99m, a reducing agent, and a water-soluble ligand can be prepared and then allowed to react with a disclosed component, compound, or composition. Such methods are known in the art, see e.g., International Publication No. WO 99/64446. In some embodiments, compositions comprising radioactive iodine, can be prepared using an exchange reaction. For example, exchange of hot iodine for cold iodine is well known in the art. Alternatively, a radio-iodine labeled compound can be prepared from the corresponding bromo compound via a tributylstannyl intermediate.

[0110] Magnetic detectable labels include paramagnetic contrasting agents, e.g., gadolinium diethylenetriaminepentaacetic acid, e.g., used with magnetic resonance imaging (MRI) (see, e.g., De Roos, A. et al., Int. J. Card. Imaging Vol. 7 pg. 133 (1991)). Some preferred embodiments use as the detectable label paramagnetic atoms that are divalent or trivalent ions of elements with an atomic number 21, 22, 23, 24, 25, 26, 27, 28, 29, 42, 44, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, or 70. Suitable ions include, but are not limited to, chromium(III), manganese(II), iron(II), iron(III), cobalt(II), nickel(II), copper(II), praseodymium(III), neodymium(III), samarium(III) and ytterbium(III), as well as gadolinium(III), terbiurn(III), dysoprosium(III), holmium(III), and erbium(III). Some preferred embodiments use atoms with strong magnetic moments, e.g., gadolinium(III).

[0111] In some embodiments, compositions comprising magnetic detectable labels can be prepared by coupling the disclosed components, compounds, and compositions with a paramagnetic atom. For example, the metal oxide or a metal salt, such as a nitrate, chloride or sulfate salt, of a suitable paramagnetic atom can be dissolved or suspended in a water/alcohol medium, such as methyl, ethyl, and/or isopropyl alcohol. The mixture can be added to a solution of an equimolar amount of the disclosed components, compounds, and compositions in a similar water/alcohol medium and stirred. The mixture can be heated moderately until the reaction is complete or nearly complete. Insoluble compositions formed can be obtained by filtering, while soluble compositions can be obtained by evaporating the solvent. If acid groups on the chelating moieties remain in the disclosed compositions, inorganic bases (e.g., hydroxides, carbonates and/or bicarbonates of sodium, potassium and/or lithium), organic bases, and/or basic amino acids can be used to neutralize acidic groups, e.g., to facilitate isolation or purification of the composition.

[0112] In preferred embodiments, the detectable label can be coupled to the composition in such a way so as not to interfere with the ability of the compound to interact with the template. In some embodiments, the detectable label can be chemically bound to the compound. In some embodiments, the detectable label can be chemically bound to a moiety that is itself chemically bound to the compound, indirectly linking the imaging and the disclosed components, compounds, and compositions.

EXAMPLES

A. Example I: Detection of a Specific mRNA in a Sample Comprised of Total RNA 1. Materials and Methods

i. Oligonucleotides, total RNA, and Enzymes

[0113] DNA20.8 (5 '-TGAATCAGCATCTAGCTACG-3 ') (SEQ ID NO: 1), DNA20.10 (5'-GGCTACAGGAAG-GCCAGACG-3') (SEQ ID NO: 2), DNA-2'-O-Me-RNA20.8 [a hybrid template, 5'-d(TGAAT)-2'-0-Me-(CAGCAUCUAGCUACG)-3'] (SEQ ID NO: 3), RNA31 (s'-AUGUGGAUUGGCGAUAAAAAACAACU-GCUGU-3', fragment of lacZ mRNA from 2302 to 2331 with an 3'-overhang U) (SEQ ID NO: 4), DNA-2'-0-Me- RNA30.5 [5'-d(CAGCAGTTGTTTTT-T)-2'-Me-ribo(AUCG-CCAAUCCACAU)-3', complementary to lacZ mRNA from 2305-2334 nt,] (SEQ ID NO: 5), and DNA-2'-0-Me- RNA35.1 [5 ' -d(GTTGTTTTTT)-2' -Me-ribo(AUCGCC AAUCCAC AU)-d(CTCTGAA- AGA)-3', complementary to lacZ mRNA from 2292 to 2326 nt] (SEQ ID NO: 6) were chemically synthesized. RNA50 (5'-

GGAGAGUAUGCAGUAGUCAUCGCGACGUAGCUAGAUG-CUGAUUCAACUAC-3') (SEQ ID NO: 7) was prepared by in vitro transcription of synthetic oligodeoxynucleotide templates with T7 RNA polymerase. The above DNAs and RNA were purified by gel electrophoresis.

[0114] Isopropyl-.beta.-D-l-thiogalactopyranoside (IPTG) can be used to induce E. coli K12 to express lacZ mRNA, while glucose represses lacZ mRNA expression in these cells (Barkley and Bourgeois In: The Operon, Reznikoff and Miller (Eds.) Cold Spring Harbor Laboratory, New York, 1978, pp. 177-220). Therefore, total RNA containing lacZ mRNA was isolated from cells (E. coli K12, strain MG1665) induced by IPTG, and total RNA without lacZ mRNA was prepared from cells in the presence of glucose (Khodursky et al. (2003) Methods Mol Biol. 224:61-78). Total yeast mRNA containing lacZ mRNA was isolated (Lin et al. In: A laboratory guide to RNA: isolation, analysis, and synthesis, Krieg (Ed.), Wiley-Liss Publication, New York, 1996, pp. 43-50) from a yeast strain comprising lacZ-expressing plasmids using the Qiagen Oligotex kit. The Klenow fragment of E. coli

DNA polymerase I was purchased from New England Biolabs; RNase H was purchased from GIBCO BRL. [a-32P]-dATP was purchased from NEN (PerkinElmer).

ii. General Conditions for RNA Labeling and Detection via Klenow Extension

[0115] RNase H digestion reactions (5 ί) were generally carried out at 37. degree. C. for 1 hr in buffer [20 mM Tris-HCl (pH 7.5), 100 mM KC1, 10 mM MgCl.sub.2, 0.1 mM DTT, and 5% (w/v) sucrose], with RNA (1 pM-10 nM), DNA template or DNA-2'-0-Me- RNA hybrid template (1-500 nM), and RNase H (0.4 U/μΕ). After ethanol precipitation of the digested RNA-DNA hybrid, Klenow extension was conducted. Klenow extension reactions (5 μΕ) were generally performed at 37. degree. C. for 1 hr in buffer [10 mM Tris-HCl (pH 7.5), 17.5 mM DTT, and 5 mM MgCl.sub.2], with RNA (1 pM-10 nM), DNA template (1- 500 nM), Klenow (0.5 U/μΕ), and 0.1-1 μΕ of [a -32P]-dATP (3000 Ci/mmol, 10 mCi/mL). Electrophoresis on polyacrylamide gels (3-12%) was used to separate nucleic acids by size, and radioactively labeled nucleic acids were visualized by autoradiography. In experiments where the same buffer (a buffer mixture of RNase H and Klenow buffer at a 2:8 ratio) was used for both RNase H and Klenow reactions, the intervening ethanol precipitation step was omitted.

iii. RNA Labeling via RNase H Digestion and Klenow Extension

[0116] Because eukaryotic mRNA transcripts generally comprise a poly(A) tail and 3'- untranslated region (3'-UTR), it is not possible to directly detect and analyze a specific mRNA using the 3'-labeling and detection methods previously described. See commentary herein above for additional details. In order to directly label a specific mRNA in total mRNA or a sample comprising total RNA, the 3'-region which is conserved among most mRNA transcripts must, therefore, be removed from the specific mRNA in order to expose its intrinsic 3 '-sequence for labeling and detection.

[0117] To address this experimental obstacle an RNase H digestion protocol was developed with which to remove the 3 -'region of a specific RNA transcript. Since RNase H is capable of digesting RNA which has formed a duplex with a DNA sequence (Nakamura and Oda. (1991) Proc. Natl. Acad. Sci. USA 88:11535-11539), the poly(A) tail and 3'-UTR can be removed by RNase H digestion after formation of such an RNA/DNA duplex. As previously reported, a 2'-methylated RNA sequence can bind to RNA and form a stable RNA/RNA duplex and the formation of the duplex provides a mechanism for protecting the bound RNA from RNase H digestion (Hayase et al. (1990) Biochemistry 29:8793-8797). This information is utilized in the design of a 2'-0-Me-RNA/DNA hybrid which is used as a hybrid template in the experiments described herein. See FIG. 1. In brief, the DNA portion of the hybrid template forms an RNA/DNA duplex which is susceptible to digestion by RNase H and 2'-0-Me-RNA portion forms an RNA/RNA duplex which is resistant to RNase H digestion.

[0118] As shown in FIG. 1, RNase H recognizes the RNA/DNA duplex region and digests the RNA strand of the duplex. The results also show that Klenow recognizes the 2'-0- Me-RNA-DNA hybrid as a template and is capable of catalyzing a nucleotide extension reaction on the hybrid template. Moreover, the extension process on a hybrid template is shown to be as efficient as that observed on a non-hybrid, "regular" DNA template.

[0119] As shown in FIG. 1, RNase H digestion of RNA50 on a DNA-2'-O-Me-RNA20.8 hybrid template removes the 3' region of the RNA and generates the complex of digested RNA40 and the bound template with an overhang sequence 5'-TGAAT-3'. The Klenow extension introduced one ³²P-labeled dA of [a-32P]-dATP (complementary to the first 3'- nucleotide of the overhang sequence) to the RNA40 fragment. In experiments comparing Klenow extension capabilities using a DNA template and a hybrid template, the hybrid template is competed out using the DNA template 100-fold over the hybrid after RNase H digestion and heat denaturing (FIG. 1). In sum, the experimental results show that both RNase H and Klenow recognize the same hybrid template, and the Klenow extension reaction on the hybrid template is as efficient as on the regular DNA template. Thus, it is

demonstrated herein for the first time that a 2'-0-Me-RNA-DNA hybrid can serve as the template for both RNase H digestion and Klenow extension.

B. Example II: Detection of a Specific mRNA via the RNaseH Digestion and Klenow Extension

[0120] As indicated herein above, cleavage of the common 3 '-region of eukaryotic mRNAs (i.e., the poly(A) tail and 3'-UTR) is required to expose intrinsic internal sequences for selective RNA labeling and detection. By utilizing the RNase H digestion technique described in Example I, the 3 '-region of a test mRNA (lacZ mRNA) has been selectively removed to expose its internal sequences. The sequence of the hybrid template for lacZ mRNA labeling and detection was designed based on the coding region of the target RNA, which is publicly available via GenBank (http://www.ncbi.nlm.nih.gov/). In order to prevent secondary structure formation of the hybrid template, the RNA sequence (25-50 nt.) used for the template design was chosen after examination of non- secondary structure formation using computer-assisted folding programs, such as Mfold (M. Zuker, Rensselaer Polytechnic Institute). The selected template for the lacZ mRNA labeling and detection is DNA-2'-0-Me- RNA30.5 hybrid template [5'-d(CAGCAGTTGTTTTTT)-2'-ME- ribo(AUCGCCAAUCCAC-AU)-3'] (SEQ ID NO: 5), which is complementary to lacZ mRNA from nucleotide positions 2305-2334. Of which, six bases from nucleotide 2320-2325 are all adenine OA's). These A s served as the template for multiple rounds of a-32P-dATP incorporation during subsequent Klenow extension steps, which followed RNase H digestion to remove the 3 '-region of lacZ mRNA.

[0121] Briefly, a lacZ-expressing plasmid is introduced into yeast. The expression of lacZ from this plasmid is controlled by a galactose (Gal) promoter which can be induced in response to the presence of galactose in the media. The promoter is not induced in the presence of glucose, which serves as an experimental negative control condition. Two total mRNA samples were prepared: one sample was derived from galactose-induced yeast comprising the lacZ-expressing plasmid and a second sample was derived from yeast comprising the lacZ-expressing plasmid which were maintained in glucose-containing media, in the absence of galactose.

[0122] To minimize experimental steps, the RNase H and Klenow reactions were consolidated in an optimized reaction buffer. After screening different buffer conditions, a buffer mixture of RNase H and Klenow buffers (2:8 ratio) was identified that produced optimal labeling. Although the glucose-induced E. coli total RNA contains thousands of mRNA transcripts (Barkley and Bourgeois In: The Operon, Reznikoff and Miller (Eds.) Cold Spring Harbor Laboratory, New York, 1978, pp. 177-220; Rhodius et al. (2002) Annu. Rev. Microbiol. 56:599-624), no mRNA is detectably labeled in this sample. See FIG. 2, Lane 3. In contrast, LacZ mRNA is selectively labeled and detected in IPTG-induced E. coli total RNA, as evidenced by a labeled lacZ mRNA large fragment (>2300 nt.) of the expected size. See FIG. 2, Lane 2. As expected, in the absence of Klenow, no mRNA is labeled (FIG. 2, Lane 4).

1. Sensitivity Study of the Labeling and Detection in the Presence of Other RNAs

[0123] Since multiple label incorporation can enhance detection sensitivity, a template system was designed wherein multiple labels (e.g., a-32P-dA) are introduced. Indeed, this multi-label incorporation system is effective for the detection of lacZ mRNA in total RNA. See FIG. 2. A drawback of this system, however, is that multiple bands or a smear may be observed in gel electrophoresis analysis of short oligonucleotides due to incomplete incorporation (Huang and Szostak. 1996, supra). Even in the presence of excess cold dATP, multiple bands may still be observed under some experimental conditions when labeling RNA31 (5' - AUGUGGAUUGGCGAUAAAAAACAACUG-CUGU-3 ' , fragment of lacZ mRNA from 2302 to 2331 with a 3 '-overhang U) (SEQ ID NO: 4) on DNA-2' -O-Me- RNA35.1 [5 ' -d(GTTGTTTTTT)-2' -Me-ribo(AUCGCCAAUCCAC AU)-d(CTCTGAA- AGA)-3' (SEQ ID NO: 6), complementary to lacZ mRNA from 2292 to 2326 nt]. See FIG. 3.

[0124] To examine issues related to detection sensitivity, experiments directed to RNA31 labeling were performed in the presence of the glucose-repressed E. coli total RNA. The results presented herein show that the glucose-repressed total RNA does not interfere with RNA31 detection. Indeed, the higher the quantity of RNA, the more specific RNA is labeled. Also, since both the concentration (from 1 nM to 1 pM) and volume (5 μί) are low, the detection sensitivity is high. These results also reveal that RNA of low quantity

(5.times. l0.sup.-18mol, at attomol levels) is still detectable, even in the presence of other RNAs. The effective labeling and detection, which are consistent with previous studies (Huang and Szostak. 2003, supra), may be due to the high affinity of DNA polymerase for DNA template/RNA substrate complex (McClure and Jovin. (1975) J. Biol. Chem. 250:4073- 4080; Polesky et al. (1990) J. Biol. Chem. 265: 14579-14591). This behavior is analogous to the ability of Taq DNA polymerase to bind and amplify DNA molecules at very low concentrations.

[0125] To confirm and extend the labeling result from the single digestion experiment, a DNA-2'-O-Me-RNA30.5, DNA-2'-0-Me-RNA35.1 was designed for Rnase H double digestion of lacZ mRNA at both 3' and 5' regions. Thus, the double digestion generates a short central lacZ mRNA fragment. See FIG. 3. This short labeled fragment is indeed observed with the ITPG-induced total RNA (Lane 8), and absent in glucose repressed cells (Lane 9), which is consistent with the results presented in FIG. 2. This short fragment is also observed in the total mRNA isolated from lacZ mRNA-expressing yeast (Lane 10). This double-digestion approach is also capable of detecting mRNA fragments, as well as full- length mRNA. Therefore, mRNA fragments arising from degradation can also be assayed using the method of the present invention, which further increases the detection sensitivity. The ability to detect even degraded RNA illustrates yet another significant advantage of the present method over previously described methods for indirectly detecting RNA. Since E. coli and yeast comprise thousands of mRNA species (Rhodius et al. (2002) Annu. Rev. Microbiol. 56:599-624; Ross-Macdonald et al. (1999) Nature 402:413-418), the experimental results presented herein also underscore the selectivity of the present invention even in the presence of a plurality of other mRNA transcripts.

[0126] Thus, a novel method is described herein that combines RNase H mediated cleavage of the 3 '-region of mRNA and Klenow selective labeling of RNA 3 '-termini.

Moreover, the method of the present invention has been used to selectively label and detect a specific mRNA transcript (i.e., LacZ mRNA) in a total RNA sample comprising thousands of different RNA transcripts. Furthermore, since only a small quantity of total RNA (0.4 μg) is used in each experiment (FIG. 2, Lanes 2-4), the method exhibits a high degree of sensitivity with regard to labeling and detection. 2. Discussion

[0127] As shown herein for the first time a novel method that combines RNase H cleavage and Klenow labeling to selectively label and detect a specific RNA (e.g., mRNA) in a total RNA sample have been developed and used. This direct and rapid RNA detection method has great potential for RNA quantification, especially individual mRNA

quantification, which is difficult to achieve using DNA microarray and real-time PCR technologies (Freeman et al. (1999) BioTechniques 26:112-125; Lockhart and Winzeler (2000) Nature 405:827-836). As a consequence, the method of the present invention provides significant experimental advantages over microarray and real-time PCR technologies.

[0128] Moreover, the method of the present invention is complementary to conventional RNA detection methods, such as Northern blotting. Indeed, because this method for specific mRNA labeling allows assay of both fragmented and full-length mRNA, it greatly advances studies of mRNA decay and metabolic regulation. Total RNA, rather than mRNA, can be used for such labeling and detection studies, thereby obviating the need for mRNA isolation procedures which can result in degradation. The present method is also compatible with the use of non-radioactive labels, such as fluorophore and antigen labels (Freeman et al. 1999, supra). Such labels can be incorporated, and the labeling and detection determined by standard approaches, including the use of conjugated alkaline phosphatase or peroxidase to catalyze chemiluminescence reactions and ELISA quantitation (Young et al. (2002) J. Virol. Methods 103:27-39). For more details see Example VI, which describes an ELISA procedure for use with the present method and chip.

[0129] As described herein above, the DNA-2'-0-Me-RNA hybrid template system has been developed, which enables RNase H and Klenow to share the same template and buffer. This methodological feature shortens the number of experimental steps and reduces the time required to obtain results. Gel electrophoresis can also be avoided by immobilizing the template on solid supports, such as a microplate or microchip surface (Benters et al. (2002) Nucl. Acids. Res. 30:el0). After RNA substrate immobilization, RNase H, Klenow, non- incorporated labels, and buffers can simply be washed away after each step. Indeed, the multi-label incorporation system is extremely useful for enhancing the detection sensitivity of the method, especially on solid phase or for long RNA transcripts analyzed by gel electrophoresis. See Examples III, IV and VIII for additional details. [0130] Since RNase H digestion can remove mRNA 3 '-common sequences, such as a eukaryotic mRNA 3 '-poly (A) tail and 3'-UTR, this method is especially useful for direct mRNA labeling and detection in total RNA without the intricacies of reverse transcription and PCR procedures. This feature of the present method significantly simplifies the experimental procedure and shortens analysis time. Moreover, the RNA labeling method is highly sensitive and allows detection of RNA at attomole levels. As shown herein, the detection sensitivity can be further enhanced by extending the length of the over-hang sequence of the DNA template. The use of ELISA and micro-spotting techniques in conjunction with the present method also serves to increase the detection sensitivity. In addition, the present method is also exquisitely selective, as demonstrated by selective labeling and detection of lacZ mRNA in the presence of thousands of mRNAs. Therefore, as described herein below, this method can be used to advantage in microplate-based rapid and high-throughput detection technology, and in microchip-based rapid gene expression profiling technology.

[0131] The accurate and rapid identification of viruses and bacteria is essential in clinical settings and industrial and/or regulatory settings wherein, for example, food purity is evaluated. An understanding of RNAs expressed uniquely in each organism and which can be used as positive indicators of a contaminant (e.g., a pathogen) in a sample is of paramount importance in such settings. Contaminant specific RNAs or "fingerprint" RNAs, may include, without limitation, mRNA, ribosomal RNA, heteronuclear RNA, and mitochondrial RNA. Indeed, the expression profile of fingerprint RNAs is a powerful tool useful in the

determination of organism identity and/or cellular phenotype. Thus, detection and

identification of fingerprint RNAs using this rapid, sensitive, and selective strategy can lead to identification of microorganisms (such as pathogens), diseases, and/or characterization of disease status. This feature of the invention is described in greater detail elsewhere in the specification.

C. Example III: Direct RNA Detection with Non-radioactive Labels on a Plate Format

[0132] The method of the present invention has been modified for use with a solid matrix. In order to further increase detection sensitivity, simplify the detection procedure, and avoid using radioactive material, fluorophore and enzyme labels were evaluated after template immobilization on a solid phase. Solid matrices envisioned for use in the present invention include, without limitation, 96-well plates and microchips. It should be understood, however, that a variety of solid matrices are known in the art and may be used in the method of the invention.

[0133] In brief, the protocol developed for using fluorophore labeling in the present invention is similar to that used for radioactive labeling, but fluorophore-labeled dNTPs are used instead of radioactively labeled a-32P-dNTPs. After washing the plate to remove un- reacted fluorophore-labeled dNTPs, the fluorescent signals are detected and quantified with microplate fluorometer or imaging system.

[0134] Enzyme labeling, however, offered much greater sensitivity than the fluorophore labeling. This finding was likely a result of signal amplification that occurs during the course of an enzyme catalyzed reaction, such as that mediated by alkaline phosphatase. See FIG. 4. The chemiluminescence detection may be performed by microplate luminometer, imaging system, or film detection. Although it is possible to detect RNA with fluorophore labels, the greater sensitivity observed with enzymatic labeling presents this approach as the exemplary labeling method at the present time. Moreover, chemiluminescence detection is simpler and requires less sophisticated equipment, attributes which further underscore its utility. For all of these reasons, additional experiments were performed using enzymatic labeling methodology.

[0135] LacZ mRNA was used as a test model RNA with which to evaluate the method of the present invention on solid phase. See FIG. 2 for schematic. After incubation of total mRNA sample in a 96- well plate (DNA-Bind.TM., purchased from Corning) on which the lacZ-mRNA hybrid template [5 '-d(CAGCAGTTGTTTTTT)-2'-Me-ribo(AUCGCCAAU- CCACAU)-NH.sub.2-3', binding to the lacZ mRNA from 2305-2334 nt] (SEQ ID NO: 5) had been previously immobilized, lacZ mRNA was bound specifically to the plate via the hybrid template and unbound mRNAs were washed away. After RNase H digestion and Klenow extension with biotinylated dATPs, the conjugate of anti-biotin antibody and alkaline phosphatase was added. Following removal of unbound enzyme by washing and addition of the dioxetane substrate (Sigma), chemiluminescent signals were detected and visualized on film. See FIG. 5. RNA24 [ 5' - AUGUGGAUUGGCGAUAAAAAACAA-3 ' (SEQ ID NO: 8), the lacZ mRNA sequence from 2305-2328 nt.] was chemically synthesized and served as a positive control for the experiment; the underlined sequence is the binding region, and the italicized sequence is the digestible RNA-DNA duplex region.

[0136] As anticipated, the positive control RNA24 was detected on the solid phase, whereas the negative control (no RNA) produced a signal not distinguishable from background levels. Consistent with the specific detection achieved using the method of the invention in solution (see Example II), lacZ mRNA present in galactose-induced cultures was specifically detectable using the present method in the context of presentation on a solid matrix. The minimal levels of lacZ mRNA present in glucose cultures (due to leaky expression) were also detectable, but at a level not significantly above background levels. Addition of RNA24 (positive control RNA) to the glucose sample, however, produced a strong signal, indicating that the presence of non-specific RNA in a sample does not interfere with detection of a specific RNA.

[0137] The experimental results have, therefore, demonstrated that both RNase H and Klenow are able to function on solid phase. Using enzyme labeling and chemiluminescence, direct detection of a specific mRNA on a micro titer plate have been successfully

demonstrated, which provides guidelines for the design and development of RNA

microchips. This new strategy dramatically advances the ability to detect infectious disease, diagnose disease, and analyze gene expression patterns. The method of the present invention also provides a powerful new tool for the biodefense arsenal.

D. Example IV: Applications Directed to Microchip Technology

1. General Procedure

[0138] The general experimental flowchart involved in utilizing the present invention in the context of a solid matrix is shown in FIG. 6. Not only is the microtiter plate platform inexpensive to develop and manufacture, but it also benefits from its ready applicability to high-throughput screening and profiling. The following guidelines are set forth to illustrate how the methods of the invention may be used to design and develop RNA microchip technology.

[0139] Templates, for example hybrid templates as described herein above, are first immobilized on a microchip, after which an RNA sample is added to the microchip matrix and incubated. After washing to remove unbound RNA, bound RNA is digested by RNase H to expose internal intrinsic sequences and then extended by Klenow DNA polymerase to incorporate antigen-labeled dNTPs. Bound RNA is subsequently labeled with enzymes by treating the microchip with antibody-enzyme conjugate. After washing the microchip to remove the non-specifically bound enzymes, substrate is added to generate chemiluminescent signals. Since DNA microarray technologies have demonstrated that the detection of emitted fluorescent light from microspots or even nanospots is possible using a microarray reader (scanner) or high-resolution imaging system (Lockhart and Winzeler, 2000, supra; Trottier et al., 2002, supra), the detection of chemiluminescent light emitted from microspots on a RNA microchip is well within the capabilities of imaging technology. Of note, the distance between the template-containing microspots on the RNA microchip should be large enough to prevent spot-to-spot interference during RNA sample binding, enzymatic steps, and chemiluminescent signal detection.

2. Design of the Microchip

[0140] The microchip may be designed and prepared using glass chips (2.2.times.2.2 cm) surface-functionalized with COOH functional groups, which can be activated with N- hydroxylsuccinimide (NHS) for coupling with templates (e.g., hybrid templates) comprising 3'-terminal N¾ groups. Such preparations may be achieved using established protocols known in the art (Zhou and Huang. (1993) Indian Journal of Chemistry 32B:35-39; Zhao et al. (2001) Nucleic Acids Res. 29:955-959; Manning et al. (2003) Materials Science and Engineering C 23:347-351). Alternatively, gold-coated glass chips can be utilized for microchip preparation (Medalia et al. (2002) Ultramicroscopy 90:103-112; Fan et al. (2001) J. Am. Chem. Soc. 123:2454-2455; Hopfner et al. (1999) Applied Surface Science 152:259- 265).

[0141] To demonstrate direct RNA detection on a microchip, a low-density chip containing 16 templates on an area of 1.6 x 1.6 centimeters may be prepared. Subsequently, a microchip comprising 144 different templates on an area of 1.2 x 1.2 centimeters may be prepared using a microarrayer. It is anticipated that spot size on such a microchip will be approximately 600μ in diameter and the spot-spot gap approximately 400μ. If, for example, eighteen fingerprint RNAs are assessed for each microorganism, it is possible to monitor eight microorganisms simultaneously on a single microchip. Eight non-pathogenic microorganisms, including bacteria, viruses, yeasts, and fungi, may also be evaluated using the RNA microchip technology. Eight sets of eighteen fingerprint RNAs, for example, may be chosen based on their high expression levels, a determination of which can be obtained via gene expression profiling. Such genes are good positive indicators for the presence of the microorganism in question. Such gene expression profiles can be purchased (Invitrogen, for example provides such services), determined experimentally, or potentially identified by reviewing the scientific literature germane to the microorganisms to be detected. A skilled artisan would be aware of these approaches and such considerations would be well within his/her capabilities. The immobilized templates (e.g., hybrid templates) immobilized on the microchip are designed based on the fingerprint RNAs, and each spot on the microchip can represent a different template recognizing a different fingerprint RNA.

[0142] Gene expression profiles of cells or organisms, including pathogens, may vary due to cell cycle stage, nutrient availability, and/or environmental conditions. In order to accurately and specifically detect pathogens and diseases without false positive or negative results, 100 fingerprint RNAs or more may be chosen from each organism or cell subtype to prevent misleading results associated with potential gene expression variation. The long-term goal of this application of the method of the invention is to spot 10,000 templates on a microchip (2.5 x 2.5 cm), which would enable the detection of approximately 100 of the most virulent viruses, bacteria, and other pathogens. Such microchips are ideally suited for biodefense applications and/or detection of pathogen-caused disease. The RNA microchip technology may also be used in non-pathogenic disease analysis, disease classification, and microbial contaminant detection in food and/or water supplies for example.

3. Design of the Template

[0143] Since Klenow DNA polymerase recognizes both DNA and DNA-2'-0-Me-RNA templates, hybrid templates are designed according to the following strategy. A hybrid template (e.g., 5'-DNA-2'-0-Me-RNA-3') is designed to comprise two regions: a 5' DNA and a 3' 2'-0-methylated-RNA sequence. See FIG. 4. The 5'-DNA sequence allows RNase H to cleave in the 3' region of target RNAs prior to the Klenow extension step. This is a particularly important step when analyzing eukaryotic mRNA which generally comprise a 3'- poly(A) tail and 3'-UTR. This design was demonstrated to be effective for the specific detection of lacZ mRNA in a large population of different RNA transcripts. The successful execution of lacZ mRNA detection also demonstrates that the designed lengths of the regions of the LacZ hybrid template were sufficient to prevent adverse interactions between the solid matrix and the enzymes.

[0144] To improve the detection efficiency of the method, the 5 '-region of the target RNA can also be removed by the RNaseH digestion. See FIG. 6. For this purpose, the template [5'-DNA-(2'-I-Me-RNA)-DNA-3'] is designed to contain three regions: a 5'-DNA sequence, a middle 2'-0-methyl-RNA sequence, and a 3'-DNA sequence. The 5'- and 3'-

DNA sequences allow RNase H to cleave both 3' and 5' regions of target RNAs, such as, for example, mRNAs. After the RNase H digestion and washing, only the target RNA fragment complementary to the 2'-0-Me-RNA sequence remains on the template, thus creating an RNA microchip for labeling and detection. The 2'-0-Me-RNA region of the template is 4-78 nucleotides long, which provides sufficient sequence specificity while allowing stable RNA- RNA duplex formation capable of surviving the treatments involved in the present method. The DNA regions of the template are 1-30 nucleotides long, which allows RNase H recognition of the RNA-DNA duplexes.

Table 1

L — (XXiH

:·. .". i ^'<. ·· :·. · i o

11

[0145] The sequence of the template is designed based on the fingerprint RNA sequence, which can be determined based on nucleic acid sequence data banks (e.g., GenBank), sequence projects, or genomic research. The RNA sequence region (-6-80 nucleotides) used for the template design is chosen after examination of the RNA secondary structure using computer folding programs, such as Mfold (Genetics Computer Group, Madison, Wis.). As all four types of antigen-labeled dNTPs (dA, dC, dG, and dU) are commercially available, the 5' -DNA region of the template, which serves as a template for Klenow extension, can be any sequence. To enhance target RNA binding and Klenow extension, it may be advantageous to use a three-region template [5'-DNA-(2'-0-Me-RNA)-DNA-3'], which allows RNase H cleavage of both 5' and 3' regions of target RNAs, and leaves just the complementary RNA fragment for labeling and detection.

4. Immobilization of the Template on Solid Phase

[0146] In the step directed to template immobilization and surface inactivation, which prevents non-specific binding of the antibody-enzyme conjugate, the 3 '-termini of the templates is immobilized on the solid phase. This arrangement allows the DNA polymerase to extend target RNA 3 '-ends on the hybrid templates. Glass and polystyrene microchip functionalized with COOH or NH₂ groups, or gold plating can be used as the solid support. The hybrid template may be immobilized on the microchip using several conventional systems (see Table I), including, (I) well-established protocols for immobilizing the 3'-NH₂- template on a COOH-functionalized surface (Manning et al., 2003, supra). In this method, an amino group (NH₂) is introduced into the 3 '-terminal of the template during solid phase synthesis, and this NH₂ group is coupled with the activated -COOH group (such as— CO— NOS). (II) An alternate procedure which can be used to immobilize the template on an NH₂- functionalized surface involves the introduction of a ribonucleotide residue into the 3'- terminal of the template during solid phase synthesis. The diol functionality on this residue is converted to two aldehyde functional groups by NaIO.sub.4 oxidation, prior to coupling with the amino group on the solid surface (Lemaitre et al. (1987) Proc Natl Acad Sci USA 84:648- 652). (Ill) Likewise, a sulfide- or selenide-modified template can be immobilized on a gold surface based on a number of strategies known in the art (Medalia et al., 2002, supra;

Hopfner et al., 1999, supra; Du et al. (2002) J. Am. Chem. Soc. 124:24-25).

[0147] In order to minimize nonspecific retention of antibody-enzyme conjugate on the solid surface, which can lead to high background, the surface of the microchip may be capped with a variety of capping reagents. See Table 1. Such protocols are known to skilled artisans familiar with experimental variations designed to investigate the positive, negative, or neutral surface best suited for minimizing background noise. For instance, after immobilization of the sulfide- or selenide-modified templates on a gold surface, sulfide- or selenide-containing reagents are generally used to saturate the surface, which prevents sulfide and mercapto functionalities of the enzyme from binding to the gold surface.

5. RNase H Digestion and Klenow Extension on a Solid Matrix

[0148] As described herein above, RNase H digestion is used to remove the 3 '-region of target RNA thereby exposing internal intrinsic sequences for Klenow extension. Unlike site specific cleavage of DNA sequences, which is routine, site specific cleavage of RNA sequences is technically challenging. It has, however, been reported that RNase H is able to digest RNA strands when bound to DNA sequences. Although RNase H cleaves RNA non- specifically with regard to sequence, a bound DNA sequence can serve as a guide that directs RNase H to digest a specific region of RNA (i.e., the DNA bound region). Thus, the bound DNA transforms RNase H into a site-specific RNA endonuclease. By utilizing this feature of RNase H mediated digestion of DNA/RNA duplexes, the present inventor has developed an approach to remove the 3 '-region of target RNA, including the poly(A) tail and 3'-UTR located in the 3'-region of most eukaryotic mRNAs.

[0149] In order to simplify the experimental procedure, a DNA-RNA hybrid template is designed to facilitate use of the same template for both RNase H digestion and Klenow extension. As shown herein, both RNaseH and Klenow DNA polymerase recognize the hybrid 5'-DNA-2'-0-Me-RNA-3' templates. Moreover, Klenow polymerase recognizes the hybrid template of the invention as well as a DNA template. A hybrid template 5'-DNA-2'- O-Me-RNA-3', comprising 5' DNA and 3' 2'-0-methylated-RNA sequences, allows RNase H to cleave the 3' region of target RNAs prior to the Klenow extension step. The hybrid template 5'-DNA-(2'-0-Me-RNA)-DNA-3', comprising 5'-DNA, middle 2'-0-methyl-RNA, and 3'-DNA sequences, enables RNase H to cleave both 3' and 5' regions of target RNAs. After the RNase H digestion and washing steps, only a target RNA fragment complementary to the 2'-0-Me-RNA sequence remains on the template. Such bound target RNA fragments are, therefore, available for Klenow extension and are consequently "tagged" for detection by incorporation of labeled nucleotide. As demonstrated by the successful detection of lacZ mRNA on a well-plate platform, template immobilization is enzymatically compatible with both RNase H and Klenow polymerase activity. As described herein, reaction conditions compatible with the RNase H digestion and Klenow extension were developed that enabled these reactions to be performed simultaneously.

6. Antigen and Enzyme Labels

[0150] As shown herein, the disclosed methods are compatible with a variety of labeling systems, including but not limited to radioactive labeling, fluorophore labeling, and enzyme labeling. Enzyme labeling, however, was chosen as a preferred labeling system because it is sensitive, safe and accessible method (Pollard-Knight et al. 1990, supra; Reddy et al., 1999, supra). Klenow polymerase mediated extension may be used to integrate antigen labels via the incorporation of antigen-labeled-dNTPs, such as 12-biotin-dATP. The length of the 5'- region DNA sequence of the template may be used to control the number of the antigen- dNTPs incorporated into the bound RNAs (Huang and Szostak. (1996) Nucleic Acids

Research 24:4360-4361). Moreover, since all four types of antigen-labeled dNTPs (dA, dC, dG, and dU) are commercially available, the 5'-DNA region of the template can be any sequence. The antigen labeling is converted to enzyme labeling via treating a chip, for example, with an antibody-enzyme conjugate, such as an anti-biotin antibody- alkaline phosphatase conjugate. To optimize sensitivity of enzyme labeling, various aspects of the reaction can be varied, including the length of the 5 '-region DNA of the template, antigen linker size, and the purity of the antibody-enzyme conjugate. Such considerations are well known in the art and familiar to skilled artisans. Systems that utilize small molecules and binder-enzyme conjugates, such as biotin and avidin- alkaline phosphatase conjugates are also envisioned as compatible with the method of the present invention.

7. Signal Detection and Background Noise Removal

[0151] There are many enzyme-substrate systems available for generating detectable chemiluminescence. For instance, the alkaline phosphatase and dioxetane derivative substrate (e.g. CDP-Star.TM., Sigma) system yields stable chemiluminescent light emission for over 24 hours. In the event that the signal should decline due to enzyme depletion of substrate, additional substrate can be supplemented or added continuously to maintain steady signal emission. Notably, the RNA microchip of the present invention can be placed in a chamber, which facilitates supplementation with fresh substrate. Since DNA microchip technologies have demonstrated that the detection of emitted light (fluorescence after excitation) from microspots or even nanospots is possible using a microarray reader (scanner) or high- resolution imaging system, the detection of chemiluminescent light emitted from microspots on an RNA microarray is within reasonable parameters for detection. Although the current dynamic range of chemiluminescent detection (4-5 orders of magnitude) is not as large as that of the real-time PCR (6-7 order of magnitude), the chemiluminescent detection sensitivity of this RNA direct detection system is comparable with the real-time PCR.

[0152] Since the RNA detection signal produced by the present method is amplified through the enzyme-catalyzed reaction (Pollard-Knight et al. 1990, supra; Reddy et al., 1999, supra), enzymatic labeling of target RNAs offers high sensitivity. The present inventor has determined that the detection sensitivity of alkaline phosphatase RNA labeling may reach as high as 10.sup.-22 moles on a microspot using the dioxetane substrate. Thus, approximately one hundred alkaline phosphatase molecules are detectable. If every bound RNA is labeled on average with several enzyme molecules, therefore, dozens of the target RNA are detectable. If more than a hundred cells can be obtained, in principle, a single copy of RNA per cell can be detected. This degree of sensitivity can be achieved using standard equipment for chemiluminescence detection, such as a high-resolution imaging system or microarray reader. It is also noteworthy that, unlike microarray and real time-PCR technologies, wherein partial degradation of an RNA sample can occur during processing and compromise profiling and detection accuracy, the RNA microchip detection does not suffer from similar partial degradation problems.

[0153] Background noise associated with chemiluminescence detection systems, which is caused by non-specific binding of the enzyme conjugate to the chip, can be minimized by extensive washing which can be used to remove essentially all of the non-specifically bound enzyme molecules. Various methods for chip surface capping and protein blocking may also be utilized to further reduce background noise. Capping reagents and blocking proteins, such as bovine serum albumin (BSA), are known in the art and compatible with the method of the present invention. To reduce the background noise during chemiluminescent detection, a microchip may be placed in a "virgin" detection chamber, which has not been exposed to any of the method steps of the invention.

8. Experimental Procedures

[0154] The following illustrates an example of an RNA chip of the invention. Sixteen designed templates with 3'-NH2 groups may be immobilized on sixteen DNA-binding spots (each one 2.5 mm in diameter) on a glass microchip (1.6 x 1.6 cm) activated with NHS groups. To each DNA-binding spot, 1 μL· of coupling buffer (2x) and 1 μL· of the template (1 pmole) are added. After the chip is incubated for 0.5 hour at 37° C, the chip is washed with post-coupling washing buffer (3 x 1 mL) to remove the unbound templates. After heat denaturing, 1 of RNA sample is added to the SSC buffer (200 μί). The solution is then quickly loaded onto the chip surface, and the chip is incubated with shaking at 50° C. for 10 minutes. Subsequently, unbound RNA is removed by washing the chip three times, each time with 1 mL of SSC buffer. One microliter of RNase H (2 U/μί) and RNase H buffer (200 uL) are added to the chip surface, and the chip is incubated with shaking for 15 minutes at 37.degree. C. After draining the RNase H digestion solution from the chip, a solution of 1 μί of Klenow (5 U/pL), 1 μΐ. of dATP-Biotin (50 mM), and Klenow buffer (200 uL) is added to the chip surface, and the chip is incubated with shaking for 15 minutes at 37° C.

Subsequently, the unbound dATP is washed away with blocking buffer (3 x 1 mL). A solution of anti-biotin antibody- AP conjugate (1 μL·, 1 μg/μL) and blocking buffer (200 μί) is added to the chip surface, and the chip is incubated with shaking for 10 minutes at room temperature. After washing the chip with washing buffer (5 x 1 mL), alkaline phosphatase buffer (1 mL) is used to wash the chip. Finally, the solution of 180 μL· of the CDP substrate (Sigma) and 20 of the alkaline phosphatase buffer (lOx) is added to the chip surface, followed by chemiluminescent detection with a high-resolution imaging system or microchip reader. If the enzyme consumes most of the substrate before detection completion, which can affect detection and profiling accuracy, the substrate may be re-added or supplemented continuously to maintain a steady signal emission. The compatibility of an RNA microchip of the invention with manipulations in a chamber facilitates such substrate supplementation. The protocol for the microchip containing 100 templates is analogous to the protocol described here.

[0155] The blocking buffer, washing buffer, and alkaline phosphatase buffer (lO.times.) are available commercially (Sigma). Other solutions are as follows: Coupling Buffer (lO.times.): 50 mM Na₂HP0₄. 10 mM EDTA, pH 9.0; Post-coupling Washing Buffer: 150 mM NaCl, 100 mM Maleate, pH=7.5; Standard Saline Citrate (SSC, 20x): 0.3 M Sodium Citrate, 3.0 M NaCl, pH=7.0; RNase H Buffer (lOx): 500 mM Tris-HCl, 400 mM KC1, 60 mM MgCl₂, 10 mM DTT, 1.0 mg/mL BSA, pH 7.5; and Klenow Buffer (lOx): 100 mM Tris- Cl, 50 mM MgCl₂, 75 mM DTT, pH 7.5.

E. Example V: Direct Detection of a Specific Cellular mRNA on a Functionalized Microplate

[0156] As described herein above in Example III, for instance, the system has been utilized successfully for RNA detection and quantification on a solid phase via

immobilization of the template to a surface such as a microplate or microchip. The data presented in this example confirm and extend the applicability of the present system for the detection of RNA transcripts in the context of solid phase presentation.

1. Materials and Methods

i. Immobilization of the RNA-DNA hybrid template containing 3'-NH₂ group on the DNA-binding plate

[0157] Coupling buffer (10 μΕ, 50 mM Na₂HP0₄, 10 mM EDTA, pH 9.0), RNase-free water (89 μΕ), and the 3'-NH.sub.2-template (1 μΕ, 0.1-0.6 mM) is added to the DNA- binding 96-well plate (Corning), and the plate is incubated for one hour at 37° C. Each well is then washed three times with post-coupling washing buffer (250 μΕ, 150 mM NaCl, 100 mM Maleate, pH 7.5) to remove the non-immobilized templates. ii. RNA binding and washing

[0158] After addition of 5xSSC buffer (50 ί, 3.0 M NaCl, 0.3 M sodium citrate, pH=7.0) to each well, RNA samples (1 each) are added to wells. The plate is then incubated at room temperature for 30 minutes. Subsequently, the unbound RNAs are removed by washing each well three times with 2xSSC buffer (250 μί, 1.2 M NaCl, 0.12 M sodium citrate, pH=7.0).

iii. RNase H Digestion

[0159] After addition of RNase H buffer [50 μί, 50 mM Tris-HCl (ph 7.5), 40 mM KC1, 6 mM MgCl₂, 1 mM DTT, 0.1 mg/mL BSA] to each well, RNase H (1.0 μί, 0.2 units/uL) is added to each well, followed by 30 minute incubation at 37° C.

iv. Klenow Extension

[0160] After draining the RNase H solution from each well, Klenow buffer [50 μί, 10 mM Tris-Cl (pH 7.5), 5 mM MgCl₂, 7.5 mM DTT] is added to each well, followed by addition of Klenow fragment (1 μί, 5 units^L) and Biotin-7-dATP (1 μί, 1 mM). The plate is incubated for 1 hour at 37° C. Subsequently, the unincorporated biotin-dATP is removed from each well by washing twice with blocking buffer (250 μί, lx, Sigma). Moreover, blocking buffer (250 μί, 5x, Sigma) is used to wash each well.

v. Enzyme Binding and chemiluminescence detection

[0161] After the polymerase extension, blocking buffer (100 μL·, lx, Sigma) is added to each well, followed by addition of the antibiotin-AP conjugate [1 μL·, 300 fold-diluted conjugate with blocking buffer (lx, Sigma)]. The plate is then incubated for 20 minutes at room temperature. After the incubation, each well is washed 4 times with washing buffer (250 μί, lx, Sigma) and once with alkaline phosphatase buffer (250 μί, lx, Sigma). Finally, the CDP substrate (90 μί, Sigma) and alkaline phosphatase buffer (10 μL·, lOx, Sigma) are added to each well. Film is exposed on the transparent bottom of the DNA-binding plate to record chemiluminescence emitted. Chemiluminescence may also be recorded by luminometer microplate reader.

2. Results

[0162] Although mRNA with a 3'-poly(A) can be labeled and detected in a total RNA sample using a poly(T) template [Huang and Szostak (2003) supra] labeling and detection of a specific mRNA transcript has heretofore proven challenging due to shared 3 '-sequences, such as the 3 '-untranslated region (3'-UTR) and 3'-poly(A) tail of mRNA transcripts of eukaryotic organisms. Thus, in order to perform detection and quantification of a specific mRNA on solid phase, its 3 '-region is preferably removed to expose its unique internal sequences for selective labeling and detection. Unlike DNA restriction endonucleases, however, RNA endonucleases capable of selectively cutting RNA are not readily available. The present inventor has, however, discovered that RNase H can be used as an "RNA endonuclease" in the presence of a DNA guiding sequence since RNase H is capable of cutting RNA in an RNA/DNA duplex [Nakamura and Oda (1991) supra; Hayase et al. (1990) supra].

[0163] An additional level of control is accorded by the enzymatic properties of RNase H, which is not capable of digesting RNA/RNA duplexes, including RNA/2 ' -Me-RNA duplexes [Nakamura and Oda (1991) supra; Hayase et al. (1990) supra]. To take advantage of this property, the present inventor designed a 5'-DNA-(2'-Me-RNA)-3' hybrid template, wherein the DNA and RNA sequences serve as a guiding sequence and a protecting sequence, respectively. The 5'-DNA sequence also serves as the template for Klenow extension.

[0164] Immobilization of the 3 '-terminus of the DNA-RNA hybrid template on a microplate allows immediate Klenow labeling following RNase H digestion of the mRNA 3'- region. Since the undigested 5 '-region of mRNA may interfere with the reactivity of the solid surface and enzyme function, 5'-DNA-(2'-Me-RNA)-DNA-3' templates were also designed. As shown in FIG. 14, the 3'-DNA sequence can also guide RNase H to cut off the RNA 5'- region. Double digestion of the RNA target leaves a short RNA fragment hybridized to its template on solid phase for detection and quantitation. This template design also enables detection of partially degraded mRNAs in real-life samples. In addition, to avoid interference of the microplate surface on enzymatic activity, the size of the template should be sufficiently long. Experiments by the present inventor show that a 10 nucleotide 3' -DNA sequence facilitates effective removal of the RNA 5 '-region by RNase H.

[0165] The hybrid template can be immobilized through a 3'-N¾ group on a microplate via N-hydroxylsuccinimide (NHS) displacement to produce a functionalized microplate

[Benters et al. (2002) supra]. Incubation of a mixed RNA population on a functionalized microplate results in hybridization of a specific RNA to the template and the unbound RNAs can subsequently be removed by washing. Hapten labels (such as biotin) can be introduced via Klenow-mediated extension following RNase H digestion of bound/hybridized RNA. The enzyme-binder conjugate [e.g., anti-biotin antibody-alkaline phosphate (AP) conjugate] specifically binds to the immobilized RNA target via binding of the hapten label. An immobilized enzyme may be capable of, for example, catalyzing a chemiluminescence reaction in the presence of substrates (e.g., a dioxetane substrate) [Young et al. (2002) supra], which allows detection of a specific bound RNA. Unlike the DNA microchip and real-time PCR technologies, the signal detected in the present system is amplified via enzyme- catalyzed substrate turnover [Saghatelian et al. J. Am. Chem. Soc. 2003, 125, 344-345; Liu et al. J. Am. Chem. Soc. 2003, 125, 6642-6643].

[0166] Incorporation of multiple labels, such as biotinylated dATPs, can further enhance the signal. In this example, RNA24.1 (5 ' - AUGUGGAUUGGCGAUAAAAAAC AA-3 ' (SEQ ID NO: 8), a section of the lacZ mRNA sequence) is used as the target RNA, and DNA35.2 [5'-d(GTTGTTTTTT)-2'-Me-RNA(AUCGCCAAUCCACAU)-d(CTGTGAAAGA)-NH₂-3'] (SEQ ID NO: 9) is utilized as the template for RNA 24.1 and the double digestion template for lacZ mRNA. For FIG. 15 A, the experiments were conducted with RNase H digestion and Klenow extension followed by incubation with the antibody- AP conjugate, and the film was exposed on the microplate for one hour after the dioxetane substrate addition. See Materials and Methods section herein above for details. As expected, in the absence of substrate RNA24.1, template, enzyme, or label, there is no chemiluminescent signal (Wells 1-4, FIG. 15A). A signal is, however, observed when all reagents are properly used (Well 5, FIG. 15A); the detection of a signal serves as a positive indicator of the presence of the target RNA24.1. Moreover, by varying the RNA quantity, it is shown that the RNA detection sensitivity can reach as high as 1 fmole (10-15 mole) of RNA (FIG. 15B). For FIG. 15B, the film was exposed on the microplate for five hours after the dioxetane substrate addition. As a consequence of the longer exposure time used to visualize RNA at such a low concentration, however, background signals also increase. As expected, signal due to background is reduced with shorter exposure times (FIG. 15A).

[0167] The signal/noise ratio and sensitivity can be significantly increased using smaller micro-well plates or microchips. To further reduce background signals, which are generated by non-specific binding of the conjugate, the washing steps were increased to reduce the amount of non-specifically bound conjugate. A skilled artisan would appreciate that washing steps can be altered to change the number of washing cycles and/or the stringency of the wash conditions. Other approaches, such as protein blocking and chemical coating [Stratis- Cullum et al. Anal. Chem. 2003, 75, 275-280], can also reduce and/or prevent non-specific sticking of enzyme conjugates. Other adaptations useful for optimizing the present invention with regard to a preferred signal/noise ratio and desired sensitivity are also known to a skilled artisan.

[0168] To investigate further detection specificity, two yeast mRNA samples were prepared. One sample contains lacZ mRNA isolated from a yeast strain (CWXY2) containing galactose-inducible lacZ-expressing plasmids (PEG202/Ras, PJG4-5/Raf, pCWX24) [Xu et al. Proc. Natl. Acad. Sci. USA 1997, 94, 12473-12478; Huang and Alsaidi, Analytical Biochemistry, 2003, 322, 269-274], and the other is isolated from glucose-repressed cells that do not express lacZ mRNA [Barkley and Bourgeois, 1978, supra; Khodursky et al. (2003) supra; Lin et al., 1996, supra]. The experimental results show that galactose-induced lacZ mRNA generates a strong signal in the present assay (Well 1, FIG. 16), whereas glucose- repressed lacZ mRNA generates a signal comparable to that of background levels (Well 2 and 3, FIG. 16). As yeast comprise thousands of mRNAs [Ross-Macdonald et al. (1999) supra], these experimental results reveal that lacZ mRNA can be selectively labeled and detected when immobilized to a microplate in the presence of large population of diverse mRNA transcripts. In addition, comparison of Wells 2 and 4, wherein RNA24.1 is added to glucose- repressed mRNA, reveals that detection of the specific RNA is not altered by the presence of other yeast mRNAs. Well 5 is the positive control with RNA24.1.

[0169] In conclusion, the present inventor has developed a novel system for specific RNA detection on a microplate by immobilizing the hybrid templates and using enzyme labeling for detection (e.g., AP). Unlike DNA microarray and real-time PCR [Freeman et al. (1999) supra], the system of the present invention is direct, simple, cost-effective and rapid and does not require reverse transcription, PCR, transcription, laser excitation and fluorescence detection. This method is exquisitely selective, in that only lacZ mRNA was specifically detected among all of the mRNA molecules present in the pool of cellular RNA transcripts, and sensitive, exhibiting an ability to detect a specific RNA at the fmole level. The detection sensitivity can be further increased by using a smaller plate or a microchip (see Example IV for details). Moreover, experimental time and steps are further reduced when the present system involves utilization of a microchip as a solid phase. Reduction of background signals can also be used effectively to increase the detection sensitivity [Stratis-Cullum et al. 2003, supra]. [0170] The present method is also particularly well suited to analyses of environmental samples, wherein mRNAs are frequently present in a partially degraded state, since only a short portion of an mRNA molecule is needed for detection in this method. This novel strategy has great potential for use in rapid on-site detection of bacteria and viruses via identification of their signature RNAs. As indicated herein above, this strategy is applicable to RNA microarray technology achieved by systematic template immobilization on microchips. This approach facilitates rapid detection of pathogens and diseases in emergency situations, for point-of-care diagnosis, and for direct gene expression profiling.

F. Example VI: RNA Microchip for Rapid, Direct and Specific Detection of Biological RNA

[0171] Rapid and accurate RNA detection is essential for monitoring, prevention and control of pathogen-caused epidemics. Disclosed herein is a novel RNA microchip strategy, which can rapidly and directly detect any RNA sequences without RT-PCR and transcription amplification. Based on the DNA lagging synthesis in the gene replication, this simple approach is developed via DNA polymerase polymerization of a RNA primer on a DNA template and RNase H digestion of RNA on a DNA guide to expose unique sequence for specific detection. The chimeric probe [5'-DNA-(2'-Me-RNA)-DNA-3'] is specifically designed to allow RNase H digestion and DNA polymerase extension on the same detecting probe. Biotin-labeled dNTPs are incorporated by DNA polymerase to the targets for direct RNA detection with chemiluminescent signal by a sensitive CCD camera. Using the RNA microchip (spot size: 75 micron), single-nucleotide specificity, high sensitivity (at the low fmole level), and rapidness (approximately 20-min detection time) have been demonstrated. Furthermore, direct detection of a specific RNA from a biological sample has been achieved, without the need for the time-consuming amplification and hybridization steps. The rapid and accurate RNA microchip technology can be effective in fast epidemic monitoring, field detection, clinical diagnosis, and food processing monitoring.

[0172] The present Example describes a rapid and accurate methodology for RNA direct detection in order to avoid the target amplification (such as RT-PCR) and fluorescent detection, which requires laser excitation. Herein we report for the first time a novel RNA microchip strategy for rapid and direct detection of specific RNAs, which is fundamentally different from the existing technologies. This simple approach is fast (approximately 20-min detection time), and has high specificity (single-nucleotide discrimination) and high sensitivity. Furthermore, a specific mRNA has successfully been detected in E. coli total RNA.

[0173] The methodology takes advantage of the DNA lagging synthesis in the gene replication,^[Okazaki et al. 1969^] where a DNA polymerase naturally extends a RNA primer with dNTPs on a DNA template. DNA polymerase is used to incorporate labels directly into a target RNA on a DNA template immobilized on a microchip (Fig. 6). Prior to the polymerase extension, the RNA is cleavage by RNase H, which opens an internal sequence of RNA (such as mRNA) for the specific extension of the hapten-labeled dNTPs (such as biotin- dNTPs)[Alsaidi et al. 2004; Spencer et al. 2010]. Through the specific binding of a binder- enzyme conjugate (e.g., streptavidine-horse radish peroxidase), the hapten labels are subsequently converted to enzymatic labels that catalyze chemiluminescent reactions for detection by a CCD camera with high sensitivity [Ronaghi et al. 1998]. Furthermore, to simplify the cleavage and extension procedures, chimeric probes [5'-DNA-(2'-Me-RNA)- DNA-3', or 5'-DNA-(2'-Me-RNA)-3')] were designed and synthesized to consolidate the target RNA hybridization, RNase H digestion and DNA polymerase extension (Fig. 6 and

Fig. 22). The 5' -DNA sequence serves as both the DNA guide for RNase H digestion and the DNA template for DNA polymerase extension. The 3' -DNA sequence serves as another DNA guide for RNase H digestion to cleave 5 '-region of target RNAs. Since RNase H does not digest RNA/RNA duplex[Hayase et al. 1990], the 2'-Me-RNA portion in the chimeric probe prevents the excessive digestion of the target RNA, which retains the target on the probe for the DNA polymerization. The 2'-methylation of the probe RNA portion also stabilizes the probe RNA sequence against RNases. The chimeric probes with 3'-NH2 groups were immobilized on the NHS -activated silicon surface via microarrayer spotting with typical 75 micron in size.[Benters et al. 2002] Any RNAs can be specifically detected by designing complementary probes. The novel RNA microchip technology has been successfully demonstrated herein by using biotin-labeled dATP and RNAs containing a few consecutive As (Fig. 22).

[0174] In general, the hybridization step is the major rate-limiting step among DNA microchip technologies [Xiao et al. 2006, Rothlingshofer et al. 2008, Barken et al. 2007, Liu et al. 2003, Sakamoto et al. 2005], which usually requires overnight hybridization. Shorter oligonucleotides may hybridize to their complementary sequences faster than the longer ones. Since short target RNAs (normally 15-25 nt.) are used in the RNA microchip detection, fast kinetics of the target RNA/probe hybridization are expected. By synthesizing a fluorescent dye-labeled RNA, a series of time-course experiments are able to be performed to investigate the formation and kinetics of the target RNA/probe hybridization (a 24-bp duplex; Figure 17). Excitingly, the experimental results show that the hybridization process on solid surface is fast for the target RNA binding to the chimeric probe. The formation of the short target/probe duplex is rapid and almost reaches a plateau in 10 minutes. This fast hybridization kinetics lays a solid foundation for the rapidness of this RNA microchip technology.

[0175] In addition to the hybridization, these two enzymatic reactions have been taken advantage of to increase the detection specificity. Because the RNase H digestion is DNA guide-dependent, and the polymerase extension is DNA template-dependent, these two enzymatic reactions can further increase specificity. Thus, mismatches in the 5'-DNA/target duplex can generate additional discrimination in both enzymatic reactions. Consistently, the experimental results support that the target RNA mismatches with the 5'-DNA region have resulted in more discrimination (BA3 and BA5) than those with the 2'-Me-RNA region (BAl and BA2; Figure 18). In addition, the previous DNA polymerase study shows that a dinucleotide overhang facilitates dNTP incorporation. [Huang et al. 1996] Thus, a dinucleotide (5'-GA) was incorporated as the overhang and found that the overhang can largely increase the incorporation or signal (BAl and BA3 in Figure 18A).

[0176] Interestingly, mismatch discrimination of the probes with the overhang is strong. The signal ratio of the perfectly-matched and single nucleotide-mismatch is approximately 9: 1 (BA3 vs BA4). Furthermore, the signal of the double nucleotide-mismatch one (BA5) is no longer detectable. As expected, the high specificity of the RNA microchip was observed at the elevated temperature. Fortunately, RNase H and Klenow are still active, during the short reaction period, even at a higher temperature (60° C). The single-nucleotide discrimination at the high temperature is most likely attributed to the combination of the 5'-DNA/RNA duplex destabilization and RNase H digestion and Klenow extension disruption.

[0177] To demonstrate the potential of this RNA microchip strategy in real-life applications, a chimeric probe [5'-d(GTTGTTTTTT)-2'-Me-

RNA(AUCGCCAAUCCACAU)-d(CTGTGAAAGA-NH₂-3'] was designed to target lacZ mRNA (the target fragment: 5'-AUGUGGAUUGGCGAUAAAAAACAA-3'). Using the RNA microchip, a high sensitivity for the RNA detection was demonstrated, and detected target RNA at the level as low as 1 fmol (Figure 19A). Excitingly, lacZ mRNA was specifically detected in the total RNA isolated from wild- type E coli (Figure 19B) grown in the presence of IPTG, which induces lacZ mRNA expression. Total RNA contains several thousands of different mRNAs. The chemiluminescent signal was not detected in the total RNA isolated from wild-type E coli. grown in the presence of glucose, which suppresses lacZ mRNA expression. When the synthetic lacZ RNA fragment was added to the glucose- suppressed total RNA sample, the signal was detected specifically (Figure 3B). The presence of the total RNA doesn't significantly interfere with detection and sensitivity of the synthetic RNA analysis. These results indicate that this novel RNA microchip can be useful for real- life applications.

[0178] In summary, a novel and unique RNA microchip strategy are disclosed, which can rapidly and directly detect specific RNAs without RT-PCR and transcription

amplification. We have also demonstrated a rapid hybridization kinetics on the solid phase, which lays a solid foundation for this rapid RNA detection strategy. Moreover, by taking the advantages of the probe hybridization and enzymatic reaction specificities, this approach was found to be of high specificity and able to conveniently distinguish a single-nucleotide difference. Furthermore, using the RNA microchip (spot size: 75 micron), the high sensitivity (the low fmole level) was demonstrated and the direct detection of specific RNAs from biological samples, without the need for the time-consuming amplification and hybridization steps. This RNA microchip methodology is simple, and the entire detection can be completed in approximately 20 minutes. These features in specificity, sensitivity, and rapidness are desired in many applications, such as SNP analysis, pathogen detection and cancer subtype identification, and make RNA microchip technology well suited for point-of-care detection with a wide range of potential applications, such as fast epidemic monitoring, field detection, clinical diagnosis, and food processing monitoring.

[0179] Rapid and accurate RNA detection is essential for monitoring, prevention and control of pathogen-caused epidemics. Figure 20 demonstrates a novel RNA detection strategy with the enzymatic reactions on RNA microchip (spot size: 75 micron), which offers single-nucleotide specificity, rapidness (approximately 20-min detection time), and high sensitivity (at the low fmole level), and which allows direct detection of specific RNAs from biological samples. 1. Materials and Methods for mRNA Detection

i. Chip Activation

[0180] The silicon chips (0.5 x 0.5 cm) were first degreased by treatment in CH₂CI₂ for 30 min with gentle shaking, followed by cleaning in concentrated H₂SO₄ for 1 h. The chips were rinsed in RNase free water several times until the wash was at pH 7.0. The chips were covered with a mixture of 3% 3-aminopropyltrimethoxysilane (Aldrich, St. Louis, MO) in a ethanokwater (19:1) solution for 30 min at RT. The chips were washed sequentially with methanol and RNase free water and were dried at room temperature before activation.

Activation was performed by incubating in a solution containing 10 mM 1 ,4-phenylene diisothiocyanate (PDITC, Fluka, Buchs, Switzerland) in CH₂CI₂ with 1% pyridine for 2 h.

The chips were washed with CH₂CI₂ three times and dried at RT and were stored in an argon atmosphere at RT. A step- wise representation of the activation steps is shown in Figure 21.

ii. Probe Immobilization and RNA detection.

[0181] The synthesized DNA-RNA-DNA chimeric probe was diluted to 200 μΜ in 100 mM sodium phosphate (pH 8.5) and was printed on the activated microchip (0.5 x 0.5 cm) with the OmniGrid Micro, followed by 30 min incubation in a water bath at 37 °C. The microchips were incubated with 5X SSC buffer (3.0 M NaCl, 3.0 M sodium citrate, pH 7.0) and RNA samples at room temperature for 15 min. Subsequently, the unbound RNAs were removed by washing each chip three times with 2X SSC buffer (1.2 M NaCl, 1.2 M sodium citrate, pH 7.0). The microchips were incubated with RNase H buffer (20 μL·, 1 X, New

England BioLabs, Ipswich, MA) and RNase H (0.5 μί, 5,000 u mL^"1, New England Biolabs), followed by 30 min incubation at 37 °C. After draining the RNase H solution from each incubation chamber, the surface was blocked with StartingBlock (TBS) Blocking Buffer (Pierce, Rockford, IL) for 20 min. The microchips were then incubated with Klenow buffer (20 μί, 1 X, New England Biolabs), the Klenow fragment (0.5 μΐ,, 5,000 umL^"1, New

England Biolabs), and biotin-7-dATP (1.0 μΐ,, 0.4 mM, Invitrogen, Carlsbad, CA) for 1 h at 37 °C. Subsequently, the unincorporated biotin-dATP was removed from each well by washing three times with StartingBlock (TBS) Blocking Buffer (Pierce). The microchips were incubated for 15 min with Poly-HRP-streptavidin conjugate (Thermo Scientific, Rockford, IL) diluted 5,000x in StartingBlock (TBS) Blocking Buffer. The microchips were rinsed several times to remove unbound enzymes. SuperSignal ELISA Femto Maximum Sensitivity Substrate (Invitrogen) was added and the chemiluminescent signal was detected with a sensitive CCD camera.

iii. RNA rapid detection

[0182] The prepared microchips immobilized with the chimeric probes were incubated with 5X SSC buffer (3.0 M NaCl, 3.0 M sodium citrate, pH 7.0) and RNA samples at room temperature for 5 min. Subsequently, the unbound RNAs were removed by washing each chip three times with 2X SSC buffer (1.2 M NaCl, 1.2 M sodium citrate, pH 7.0). The chips were incubated with RNase H buffer (20 μί, 1 X, New England BioLabs, Ipswich, MA) and RNase H (0.5 μΕ, 5,000 u mL ¹, New England Biolabs), followed by 5 min incubation at 37 °C. After draining the RNase H solution from each incubation chamber, the microchip surface was rinsed with StartingBlock (TBS) Blocking Buffer (Pierce, Rockford, IL). The chips were then incubated with Klenow buffer (20 μL·, 1 X, New England Biolabs), the Klenow fragment (0.5 μί, 5,000 u mL^"1, New England Biolabs), and biotin-7-dATP (1.0 μί, 0.4 mM Invitrogen, Carlsbad, CA) for 5 min at 37 °C. Subsequently, the unincorporated biotin-dATP was removed from each well by washing three times with StartingBlock (TBS) Blocking Buffer (Pierce). The chips were incubated with Poly-HRP-streptavidin conjugate (Thermo Scientific, Rockford, IL) diluted 5,000x in StartingBlock (TBS) Blocking Buffer for 5 min. The chips were rinsed several times to remove unbound enzymes. SuperSignal ELISA Femto Maximum Sensitivity Substrate (Invitrogen) was added and the chemiluminescent signal was detected with a sensitive CCD camera.

iv. Oligonucleotide Library

[0183] The chimera probes were synthesized in our laboratory by using the standard DNA phosphoramidites and regular 2'-MeO-RNA phosphoramidites, which are

commercially available.

[0184] Swine Flu RNA [SF, Swine Influenza (H1N1) matrix protein 1 (Ml) mRNA: 44- 82 nt]: 5 '- AGAUCGCGCAGAGACUGGAAAGUGU-3 ' (SEQ ID NO:31)

[0185] SF Probe:5^,-d(ACACTTTCC)-2^,-Q-Me-(AGUCUCUGCGCGAUCU)- d(CGGCTTTGAGGG)-NH₂-3 ' (SEQ ID NO:32)

[0186] lacZ mRNA (lacZ, E. coli lacZ mRNA: 724-748 nt): 5'- AUGUGGAUUGGCGAUAAAAAACAA-3 ' (SEQ ID NO:8) [0187] lacZ probe: 5'-d(GTTGTTTTTT)-2'-0-Me-RNA(AUCGCCAAUCCACAU)- d(CTGTGAAAGA)-NH₂-3 ' (SEQ ID NO: 9)

[0188] Bacillus anthraces RNA (BA, B. anthraces lethal factor mRNA: 855-892 nt) : 5 ' - AUCUUUAGAAGCAUUAUCUGAAGAUAAGAAAAAAA-3 ' (SEQ ID NO:33)

[0189] BA Probe: 5'-d(GATTTTTTT)-2'-0-Me-RNA(CUUAUCUUCAGAUAA)- d(TGCTTCTAAAGAT)-NH2-3 ' (SEQ ID NO:34)

[0190] Bird Flu RNA [BF, Avian Influenza (H5N1) matrix protein 1 (Ml) mRNA: 692- 729 nt]: 5'-AAUCUUCUUGAAAAUUUGCAGACCUACCAAAAACGA-3' (SEQ ID NO:35)

[0191] BF Probe: 5 ' -d(TCGTTTTT)-2 ' -Q-Me(GGUAGGUCUGC AAAAUUUU)- d(CAAGAAGATT)-NH₂-3 ' (SEQ ID NO:36) [0192] Target RNA for hybridization kinetics : 5 ' -

AUGUGG AUUGGCG AU A A A A AAC A A-biotin- Cy 3 - 3 ' ; DNA for hybridization kinetic study: : 5'-ATGTGGATTGGCGATAAAAAACAA-biotin-Cy3-3'

[0193] RNA for specificity study [the Bacillus anthraces RNA (BA) is B. anthraces lethal factor mRNA: 855-892 nt] :

5'-AUCUUUAGAAGCA UU AUCUG A AG AU A AG-—A A A A A A A- 3 '

(SEQ ID NO:37)

Probe 1 (BA1): 3'-d(TAGAAATCTTCGT)-2'-0-Me-RNA(AAUAGACUUCUAUUC)- d(TTTTTTT)-5' (SEQ ID NO:38)

Probe 2 (BA2): 3'-d(TAGAAATCTTCGT)-2'-0-Me-RNA(AAUAGCCUUCUAGUC)- d(TTTTTTT)-5' (SEQ ID NO:39)

Probe 3 (BA3): 3'-d(TAGAAATCTTCGT)-2'-0-Me-RNA(AAUAGACUUCUAUUC)- d(TTTTTTTAG)-5 ' (SEQ ID NO:40)

Probe 4 (BA4): 3'-d(TAGAAATCTTCGT)-2'-0-Me-RNA(AAUAGACUUCUAUUC)- d(TTTT ATTAG) - 5 ' (SEQ ID NO:41)

Probe 5 (BA5): 3'-d(TAGAAATCTTCGT)-2'-0-Me-RNA(AAUAGACUUCUAUUC)- d(TATTATTAG)-5' (SEQ ID NO:42) v. Microscope, camera and imaging software:

[0194] The imaging system for RNA detection on microchip was assembled with a microscope (Nikon Eclipse 80i) and an ultra-sensitive CCD camera (VersArray System from Princeton Instruments, Princeton, NJ) with a software (ImagePro Plus). The RNA rapid detection is normally performed by using 2x2 image binning, 10-30 second exposure (usually 15 seconds), 2X lens, and object distance of 1.5 cm.

vi. RNA Hybridization Kinetics

[0195] The synthesized DNA-RNA-DNA chimeric probe was diluted to 200 μΜ in 100 mM sodium phosphate (pH 8.5) and was printed on the activated chip with the OmniGrid

Micro, followed by 30 min incubation in a water bath at 37 °C. The biotin-labeled RNA (500 fmol) was allowed to hybridize with the chip-immobilized probes in 5X SSC buffer (20 μί, 3.0 M NaCl, 3.0 M sodium citrate, pH 7.0) for the indicated amount of time (from 0 to 40 minutes). After the chip washing, the microchip was then incubated with Poly-HRP- streptavidin conjugate (Thermo Scientific, Rockford, IL) diluted 5,000x in StartingBlock

(TBS) Blocking Buffer for 15 min. The microchip was rinsed three times to remove unbound enzymes. SuperSignal ELISA Femto Maximum Sensitivity Substrate (Invitrogen) was finally added and the chemiluminescent signal was immediately detected with an ultra- sensitive CCD camera.

vii. Specificity of RNA detection on the microchip

[0196] The synthesized DNA-RNA-DNA chimeric probe was diluted to 200 μΜ in 100 mM sodium phosphate (pH 8.5) and was printed on the activated chip with the OmniGrid Micro, followed by 30 min incubation in a water bath at 37 °C. The chips were incubated with 5X SSC buffer (3.0 M NaCl, 3.0 M sodium citrate, pH 7.0) and RNA samples at room temperature for 15 min. Subsequently, the unbound RNAs were removed by washing each chip three times with 2X SSC buffer (1.2 M NaCl, 1.2 M sodium citrate, pH 7.0). The chips were incubated with RNase H buffer (20 μί,, 1 X, New England BioLabs, Ipswich, MA) and RNase H (0.5 μΐ,, 5,000 u mL ¹, New England Biolabs), followed by 30 min incubation at temperatures (37-65 °C). After draining the RNase H solution from each incubation chamber, the surface was blocked with StartingBlock (TBS) Blocking Buffer (Pierce, Rockford, IL) for 20 min. The chips were then incubated with Klenow buffer (20 μί,, 1 X, New England Biolabs), the Klenow fragment (0.5 μL·, 5,000 u mL^"1, New England Biolabs), and biotin-7- dATP (1.0 μί, 0.4 mM Invitrogen, Carlsbad, CA) for 1 h at temperatures (37-65 °C).

Subsequently, the unincorporated biotin-dATP was removed from each well by washing three times with StartingBlock (TBS) Blocking Buffer (Pierce). The chips were incubated with Poly-HRP-streptavidin conjugate (Thermo Scientific, Rockford, IL) diluted 5,000x in StartingBlock (TBS) Blocking Buffer for 15 min. The chips were rinsed several times to remove unbound enzymes. SuperSignal ELISA Femto Maximum Sensitivity Substrate (Invitrogen) was added and the chemiluminescent signal was detected with a sensitive CCD camera.

viii. Sensitivity of RNA detection on the microchip

[0197] The synthesized DNA-RNA-DNA chimeric probe was diluted to 200 μΜ in 100 mM sodium phosphate (pH 8.5) and was printed on the activated chip with the Omni Grid Micro, followed by 30 min incubation in a water bath at 37 °C. The chips were incubated with 5X SSC buffer (3.0 M NaCl, 3.0 M sodium citrate, pH 7.0) and RNA samples at room temperature for 15 min. Subsequently, the unbound RNAs were removed by washing each chip three times with 2X SSC buffer (1.2 M NaCl, 1.2 M sodium citrate, pH 7.0). The chips were incubated with RNase H buffer (20 ί, 1 X, New England BioLabs, Ipswich, MA) and RNase H (0.5 μΕ, 5,000 u mL^"1, New England Biolabs), followed by 30 min incubation at 37 °C. After draining the RNase H solution from each incubation chamber, the surface was blocked with StartingBlock (TBS) Blocking Buffer (Pierce, Rockford, IL) for 20 min. The chips were then incubated with Klenow buffer (20 μL·, 1 X, New England Biolabs), the

Klenow fragment (0.5 μί,, 5,000 u mL^"1, New England Biolabs), and biotin-7-dATP (1.0 μί,, 0.4 mM Invitrogen, Carlsbad, CA) for 1 h at 37 °C. Subsequently, the unincorporated biotin- dATP was removed from each well by washing three times with StartingBlock (TBS) Blocking Buffer (Pierce). The chips were incubated with Poly-HRP-streptavidin conjugate (Thermo Scientific, Rockford, IL) diluted 5,000x in StartingBlock (TBS) Blocking Buffer for 15 min. The chips were rinsed several timed to remove unbound enzymes. SuperSignal ELISA Femto Maximum Sensitivity Substrate (Invitrogen) was added and the

chemiluminescent signal was detected with a sensitive CCD camera. G. Example VII: Combination of Hybridization, Digestions and Extension Steps in a Single Solution

1. HYBRIDIZATION BUFFER

[0198] The hybridization buffer can comprise a salt, such as, for example, NaCl and sodium citrate. The NaCl or sodium citrate can be at 1.0, 1.5, 2.0, 2.5, 3.0, 3.5, 4.0, 4.5, or 5.0 M, or any amount in between. The pH of the hybridization buffer can be 5.0, 5.5, 6.0, 6.5, 7.0, 7.5, 8.0, 8.5, or 9.0, or any amount above, below, or in between. A specific example includes the hybridization buffer at 3.0 M NaCl, 3.0 M sodium citrate, pH 7.0.

2. RNase DIGESTION BUFFER

[0199] The RNase digestion buffer can be comprised of, for example, comprised of Tris- HC1, KC1, MgCl₂, and/or dithiothreitol. The Tris-HCl can be at 20, 30, 40, 50, 60, 70, 80, 90, or 100 mM, or any amount above, below, or in between. KC1 can be at 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, or 100 mM, or any amount above, below, or in between. The MgCl₂ concentration can be 1, 2, 2.5, 3, 3.5, 4, or any amount above, below, or in between. The dithiothreitol concentration can be at 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 mM, or any amount above, below, or in-between. The pH of the solution can be be

5.0, 5.5, 6.0, 6.5, 7.0, 7.5, 8.0, 8.1, 8.2, 8.3, 8.4, 8.5, or 9.0, or any amount above, below, or in between. A specific example of RNase H digestion buffer is 50 mM Tris-HCl, 75 mM KC1, 3 mM MgCl₂, 10 mM Dithiothreitol, pH 8.3.

3. KLENOW BUFFER

[0200] The Klenow buffer can be comprised of, for example, Tris-HCl, NaCl, MgCl₂, and dithiothreitol. The Tris-HCl can be at 0, 1, 2, 3 ,4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 30, 40, 50, 60, 70, 80, 90, or 100 mM, or any amount above, below, or in between. NaCl can be at 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, or 100 mM, or any amount above, below, or in between. The MgCl₂ concentration can be 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or any amount above, below, or in between. The dithiothreitol concentration can be at 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 mM, or any amount above, below, or in- between. The pH of the solution can be be 5.0, 5.5, 6.0, 6.5, 7.0, 7.5, 7.6, 7.7, 7.8, 7.9, 8.0,

8.1, 8.2, 8.3, 8.4, 8.5, or 9.0, or any amount above, below, or in between. A specific example of Klenow digestion buffer is 50 mM Tris-HCl, 75 mM KC1, 3 mM MgCl₂, 10 mM

Dithiothreitol, pH 8.3. 4. RATIO

[0201] For one pot detection, the RNase H and Klenow buffers can be mixed at a ratio of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 parts Klenow buffer to 1, 2, 3, 4 ,5, 6, 7, 8, 9, or 10 parts RNase buffer, or any ratio above, below, or in between this range. In one specific example, they were mixed in a ratio of 8 parts Klenow buffer and 2 parts Rnase H buffer.

5. TEMPERATURE

[0202] The temperature for these enzymatic reactions can be 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 28, 29, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, or 100°C or any amount above, below, or in between. In one example, the temperature was 37°C.

6. Procedure for One-Pot Detection in Solution:

[0203] A cocktail was prepared containing 2.4 μΐ. BA RNA (5 μΜ) 4 μΐ. RNase H, 4 μΐ. Klenonw, 8 μί α-dATP³², and 2:8 RNase H : Klenow buffer (New England Biolabs). In each reaction tube, 4 μΕ of the cocktail was added to 1 μΕ of hybrid probe (1 μΜ) and allowed to react for 60 min. After the polymerization reactions were completed, samples were cooled to room temperature. The samples were then diluted 1:1 with Gel loading dye (7.5 μΕ, containing 0.1% bromphenol blue, 0.1% xylene cyanol, 100 mM EDTA, and saturated urea) and run on 15% PAGE and visualized by autoradiography

7. Procedure for One-Pot Detection on the Microchip:

[0204] A cocktail was prepared containing ΙμΕ BA RNA (1 μΜ) 0.5 μΕ RNase H, 0.5 μΕ Klenonw, 0.5 μΕ biotin-dATP (0.4 mM), and 20 μΕ of 2:8 RNase H : Klenow buffer (New England Biolabs). The cocktail was pipetted on top of a microchip with immobilized BA probes on the surface and allowed to react for 60 min at 37°C. The microchip was then washed three times with StartingBlock(TBS) Blocking Buffer (Pierce). The chips were incubated with Poly-HRP Streptavidin (Thermo Scientific, Rockford, IL) diluted 5,000x in StartingBlock (TBS) Blocking Buffer for 15 min. The chips were rinsed several timed to remove unbound enzymes. SuperSignal ELISA Femto Maximum Sensitivity Substrate (Invitrogen) was added and the chemiluminescent signal was detected with a CCD camera.

Rapid Detection of RNA

30 30 60 60 180

15 30 60 60 165

10 30 60 60 160

5 30 60 60 155

5 15 60 60 140

5 10 60 60 135

5 5 60 60 130

5 5 45 60 115

5 5 30 60 100

5 5 15 60 85

5 5 10 60 80

5 5 5 60 75

5 5 5 45 60

5 5 5 50 45

5 5 5 15 30

5 5 5 10 25

5 5 5 5 20

;nal was detected in 10 s with CCD camera.

[0205] There is one hybridization step and three enzymatic steps which can be optimized for a short detection time: RNase H digestion, Klenow extension, and horseradish peroxidase- streptavidin binding. Five minutes for each step was sufficient to detect RNA, resulting in a detection time of approximately 20 min.

H. Example VIII: Combination of Hybridization, Digestions and Extension Steps in a Single Reaction Vessel

[0206] Because the present method can combine the hybridization, digestion and extension steps in a single buffer, the present method can, alternatively, combine these steps in a single reaction vessel wherein the hybridization buffer, the digestion buffer and the extension buffer described herein (e.g., Example VII) are added sequentially to the vessel to perform each step. The reaction buffers can be provided sequentially to the reaction vessel with or without rinses between the addition of each buffer.

I. Example IX: Microfluidic Device

[0207] As described in Example VII, the RNA detection microchip can be used with very small quantities of buffer solution. Thus, the RNA detection methods and chips described herein are usable in microfluidic devices. Among the devices that are compatible with the present methods and chips are the following: (1) microarrays, as exhibited in U.S. Pat. No. 6,607,886 and U.S. Pat. No. 5,807,522, where each array has an RNA probe that is attached to a solid surface and specifically responsive to target analyte;

(2) digital microfluidics, as represented in U.S. Pat. No. 7,329,545 and U.S. Pat. No.

7,010,391, according to the teachings of which unit-volume microdroplets containing, for example, each of several buffers in our invention, can move in confined microfluidic channels to unit cells of different RNA probes; and

(3) continuous-flow microfluidics, as described in U.S. Pat. No. 6,468,761, where one or more liquids containing such enzyme assays in a chosen buffer as used in our invention, are manipulated in a continuous flow through micro-channels.]

[0208] While certain of the preferred embodiments of the present invention have been described and specifically exemplified above, it is not intended that the invention be limited to such embodiments. Various modifications may be made thereto without departing from the scope and spirit of the present invention, as set forth in the following claims.

References

[1] C. W. Potter, /. Appl. Microbiol. 2001, 91, 572-579.

[2] G. Vana, K. M. Westover, Mol. Phylogenet. Evol. 2008, 47, 1100- 1110.

[3] L. L. Poon, K. H. Chan, G. J. Smith, C. S. Leung, Y. Guan, K. Y. Yuen, J. S. Peiris, Clin. Chem. 2009, 55,1555-1558.

[4] C. R. Taitt, G. P. Anderson, B. M. Lingerfelt, M. J. Feldstein, F. S. Ligler, Anal. Chem.

2002, 74, 6114-6120.

[5] X. Zhao, L. R. Hilliard, S. J. Mechery, Y. Wang, R. P. Bagwe, S. Jin, W. Tan, Proc.

Natl. Acad. Sci. U. S. A. 2004, 101, 15027-15032.

[6] D. R. Blais, R. A. Alvarez-Puebla, J. P. Bravo- Vasquez, H. Fenniri, J. P. Pezacki, Biotechnol. J. 2008, 3, 948-953.

[7] D. Wang, L. Coscoy, M. Zylberberg, P. C. Avila, H. A. Boushey, D. Ganem, J. L.

DeRisi, Proc. Natl. Acad. Sci. U. S. A. 2002, 99, 15687-15692.

[8] K. Stegmaier, K. N. Ross, S. A. Colavito, S. O'Malley, B. R. Stockwell, T. R. Golub, Nat. Genet. 2004, 3(5,257-263. [9] D. R. Call, Crit. Rev. Microbiol. 2005, 31, 91-99.

[10] Y. Xiao, A. A. Lubin, B. R. Baker, K. W. Plaxco, A. J. Heeger, Proc. Natl. Acad. Sci.

U. S. A. 2006,705,16677-16680.

[11] N. A. Leal, M. Sukeda, S. A. Benner, Nucleic Acids Res. 2006, 34, 4702-4710.

[12] K. B. Barken, J. A. Haagensen, T. Tolker-Nielsen, Clin. Chim. Acta 2007, 384,1-11.

[13] B. L. Ziober, M. G. Mauk, E. M. Falls, Z. Chen, A. F. Ziober, H. H. Bau, Head Neck

2008, 30,111-121.

[14] S. Nakayama, L. Yan, H. O. Sintim, /. Am. Chem. Soc. 2008, 130, 12560-12561.

[15] T. G. Fernandes, M. M. Diogo, D. S. Clark, J. S. Dordick, J. M. Cabral, Trends

Biotechnol. 2009, 27, 342-349.

[16] S. Draghici, P. Khatri, A. C. Eklund, Z. Szallasi, Trends Genet. 2006, 22, 101-109.

[17] A. Chagovetz, S. Blair, Biochem. Soc. Trans. 2009, 37, 471-475.

[18] T. Okazaki, R. Okazaki, Proc. Natl. Acad. Sci. U. S. A. 1969, 64,1242-1248.

[19] M. Alsaidi, E. Lum, Z. Huang, Chembiochem 2004, 5, 1136-1139.

[20] M. Ronaghi, M. Uhlen, P. Nyren, Science 1998, 281, 363-365.

[21] Y. Hayase, H. Inoue, E. Ohtsuka, Biochemistry 1990, 29, 8793-8797.

[22] R. Benters, C. M. Niemeyer, D. Drutschmann, D. Blohm, D. Wohrle, Nucleic Acids Res. 2002, 30, E10.

[23] R. H. Liu, R. Lenigk, R. L. Druyor-Sanchez, J. Yang, P. Grodzinski, Anal. Chem. 2003,

75, 1911-1917.

[24] T. Sakamoto, A. Mahara, R. Iwase, T. Yamaoka, A. Murakami, Anal. Biochem. 2005,

340, 369-372.

[25] Z. Huang, J. W. Szostak, Nucleic Acids Res. 1996, 24, 4360-4361.

[26] Sarah M. Spencer, Una Lin, Cheng-Feng Chiang, Zhengchun Peng, Peter Hesketh, Jozef Salon, and Zhen Huang^*, 'Direct and Rapid Detection of RNAs on Novel RNA Microchip", ChemBioChem, 2010, 11, 1378-1382.

Huang et al., Selective labeling and detection of specific RNAs in an RNA mixture.

Analytical Biochemistry. 315 : 129-133 (Apr. 2003). Huang et al., A simple method for 3'-labeling of RNA. Nucleic Acids Research 24(21): 4360-4361 (1996). cited by examiner.

Duck et al., Probe Amplifier System Based on Chimeric Cycling Oligonucleotides,

Biotechniques 9(2): 142-47 (1990).

Bhatt et al., Detection of Nucleic Acids by Cycling Probe Technology on Magnetic particles: High Sensitivity and Ease of Separation, Nucleosides & Nucleotides 18(6&7): 1297-99 (1999).

U.S. Patent Documents

4876187 October 1989 Duck et al.

5011769 April 1991 Duck et al.

5660988 August 1997 Duck et al.

5731146 March 1998 Duck et al.

5830664 November 1998 Rosemeyer et al.

6077668 June 2000 Kool

6114117 September 2000 Hepp et al.

6238865 May 2001 Huang et al.

6274316 August 2001 Modrusan

6297016 October 2001 Egholm et al.

6380377 April 2002 Dattagupta

6503747 January 2003 Kathariou et al.

6933117 August 2005 Wolf et al.

2002/0001810 January 2002 Farrell

2002/0137709 September 2002 Lin et al.

2002/0160401 October 2002 Nozaki et al.

2003/0055016 March 2003 Huang

2004/0209291 October 2004 Uematsu et al.

2006/0148746 July 2006 Niu et al.

2006/0183108 August 2006 Melkonyan et al.

Claims

CLAIMS The invention claimed is:

1. A method for detecting at least one specific RNA molecule in a population comprising a plurality of different RNA molecules, said method comprising:

a. making a hybrid template comprising a first portion and a second portion, wherein said first and second portion of said hybrid template are operably linked, and wherein the first portion is an RNA sequence complementary to an internal sequence of said specific RNA molecule and said second portion is a DNA sequence complementary to a region proximal to the internal sequence of said specific RNA molecule;

b. in a single buffer solution

i) binding said hybrid template to said specific RNA molecule, wherein said binding produces a complex comprising said specific RNA molecule and said hybrid template and said binding results in formation of a double stranded RNA/RNA duplex at the internal sequence of said specific RNA molecule and a double stranded RNA/DNA duplex at the region proximal to the internal sequence of said specific RNA molecule;

ii) digesting said complex with a riboendonuclease capable of digesting double-stranded RNA/DNA duplexes, wherein said digesting cleaves said specific RNA molecule at the region proximal to the internal sequence and leaves intact double stranded RNA/RNA duplex at the internal sequence to produce a digested complex comprising a truncated specific RNA molecule and bound hybrid template;

iii) performing an extension of said digested complex, wherein said hybrid template acts as a template for extension of the truncated specific RNA molecule and said extension incorporates at least one detectable label into an extended RNA molecule; and

c. detecting a presence of the at least one detectable label in said extended RNA molecule, wherein said presence of said at least one detectable label in said extended RNA molecule provides a positive indicator for detecting a specific RNA molecule in a population comprising a plurality of different RNA molecules.

2. The method of claim 1, wherein said specific RNA molecule is a messenger RNA (mRNA) molecule.

3. The method of claim 1, wherein said population of a plurality of different RNA molecules is derived from a sample.

4. The method of claim 3, wherein said sample is a biological sample.

5. The method of claim 3, wherein said detecting said specific RNA molecule is a positive indicator of a presence of a microorganism, pathogen, gene, or gene product in said sample.

6. The method of claim 1 , wherein said riboendonuclease is RNase H.

7. The method of claim 1, wherein the extension is performed by a polymerase.

8. The method of claim 7, wherein said polymerase is Klenow DNA polymerase.

9. The method of claim 1, wherein said hybrid template is bound to a solid matrix.

10. A method for detecting at least one specific RNA molecule in a population comprising a plurality of different RNA molecules, said method comprising:

a) making a hybrid template comprising a middle portion and two portions flanking the middle portion, wherein said middle and flanking portions of said hybrid template are operably linked, and wherein the middle portion comprises an RNA sequence complementary to an internal sequence of said specific RNA molecule and said flanking portions comprise DNA sequences complementary to regions flanking the internal sequence of said specific RNA molecule;

(b) in a single buffer solution:

(i) binding said hybrid template to said specific RNA molecule, wherein said binding produces a complex comprising said specific RNA molecule and said hybrid template and said binding results in formation of a double stranded RNA/RNA duplex at the internal sequence of said specific RNA molecule and double stranded

RNA/DNA duplexes at the regions flanking the internal sequence of said specific RNA molecule;

(ii) digesting said complex with a riboendonuclease capable of digesting double- stranded RNA/DNA duplexes, wherein said digesting cleaves said specific RNA molecule at the regions flanking the internal sequence and leaves intact double stranded RNA/RNA duplex at the internal sequence to produce a digested complex comprising a truncated specific RNA molecule and bound hybrid template;

(iii) performing an extension of said digested complex, wherein said hybrid template acts as a template for extension of the truncated specific RNA molecule and said extension incorporates at least one detectable label into an extended RNA molecule; and

(c) detecting a presence of the at least one detectable label in said extended RNA molecule, wherein said presence of said at least one detectable label in said extended RNA molecule provides a positive indicator for detecting a specific RNA molecule in a population comprising a plurality of different RNA molecules.

11. The method of claim 10, wherein said specific RNA molecule is a messenger RNA (mRNA) molecule.

12. The method of claim 10, wherein said population of a plurality of different RNA molecules is derived from a sample.

13. The method of claim 12, wherein said sample is a biological sample.

14. The method of claim 12, wherein said detecting said specific RNA molecule is a positive indicator of a presence of a microorganism, pathogen, gene, or gene product in said sample.

15. The method of claim 10, wherein said riboendonuclease is RNase H.

16. The method of claim 10, wherein the extension is performed by a polymerase.

17. The method of claim 16, wherein said polymerase is Klenow DNA polymerase.

18. The method of claim 10, wherein said hybrid template is bound to a solid matrix.

19. A method of using an RNA chip produced by the method of claim 18 for detecting a specific RNA molecule in a sample, wherein detecting a specific RNA molecule in a sample is a positive indicator of a presence of a microorganism, pathogen, gene, or gene product in said sample.

20. The method of claim 1, wherein the extension of said digested complex is a polymerase mediated extension.

21. The method of claim 10, wherein the extension of said digested complex is a polymerase mediated extension.

22. The method of claim 1, wherein at least one of the DNA sequences of the hybrid template is modified.

23. The method of claim 1, wherein at least one of the RNA sequences of the hybrid template is modified by a 3' amino group.

24. The method of claim 10, wherein at least one of the DNA sequences of the hybrid template is modified.

25. The method of claim 24, wherein at least one of the DNA sequences of the hybrid template is modified by a 3' amino group.

26. The method of claim 1, wherein the RNA sequence of the hybrid template is modified.

27. The method of claim 26, wherein the RNA sequence of the hybrid template is modified by a 2'-0-methyl group.

28. The method of claim 10, wherein the RNA sequence of the hybrid template is modified.

29. The method of claim 28, wherein the RNA sequence of the hybrid template is modified by a 2'-0-methyl group.

30. A method for labeling an RNA molecule, said method comprising: in a single buffer solution a.) binding a hybrid template to said RNA molecule, wherein said hybrid template comprises a first portion and a second portion, wherein said first and second portion of said hybrid template are operably linked, and wherein said first portion is an RNA sequence complementary to an internal sequence of said RNA molecule and said second portion is a DNA sequence complementary to a region proximal to the internal sequence of said RNA molecule, and wherein said binding produces a complex comprising said RNA molecule hybridized to said hybrid template and said binding results in formation of a double stranded RNA/RNA duplex at the internal sequence of said RNA molecule and a double stranded RNA/DNA duplex at the region proximal to the internal sequence of said RNA molecule; b.) digesting said complex with a riboendonuclease capable of digesting RNA of double- stranded RNA/DNA duplexes, wherein said digesting removes a portion of said RNA molecule, said portion comprising a sequence of said RNA that was hybridized to said DNA sequence of said hybrid template and proximal to the internal sequence, and wherein said digesting leaves intact said double stranded RNA/RNA duplex at the internal sequence of said RNA to produce a digested complex comprising a truncated RNA molecule and partially bound hybrid template;

c.) performing an extension of said truncated RNA, wherein said partially bound hybrid template acts as a template for extension of said truncated RNA molecule and said extension incorporates at least one detectable label into an extended RNA molecule.

31. The method of claim 30 further comprising detecting at least one detectable label in said extended RNA molecule, wherein said detection of said at least one detectable label in said extended RNA molecule provides a positive indicator for detecting said RNA molecule.

32. The method of claim 30, wherein said RNA molecule is in a population comprising a plurality of different RNA molecules.

33. The method of claim 30, wherein said RNA molecule is a messenger RNA (mRNA) molecule.

34. The method of claim 32, wherein said population comprising a plurality of different RNA molecules is derived from a sample.

35. The method of claim 34, wherein said sample is a biological sample.

36. The method of claim 34, wherein said detecting said RNA molecule is a positive indicator of a presence of a microorganism, pathogen, gene, or gene product in said sample.

37. The method of claim 30, wherein said riboendonuclease is RNase H.

38. The method of claim 30, wherein the extension is performed by a polymerase.

39. The method of claim 38, wherein said polymerase is Klenow DNA polymerase.

40. The method of claim 30, wherein said hybrid template is bound to a solid matrix.

41. A method for labeling an RNA molecule, said method comprising: in a single buffer solution

a. ) binding a hybrid template to said RNA molecule, wherein said hybrid template comprises a middle portion and two portions flanking the middle portion, wherein said middle and flanking portions of said hybrid template are operably linked, and wherein said middle portion comprises an RNA sequence complementary to an internal sequence of said RNA molecule and said flanking portions comprise DNA sequences complementary to regions flanking the internal sequence of said RNA molecule, and wherein said binding produces a complex comprising said RNA molecule hybridized to said hybrid template and said binding results in formation of a double stranded RNA/RNA duplex at the internal sequence of said RNA molecule and double stranded RNA/DNA duplexes at the regions flanking the internal sequence of said RNA molecule;

b. ) digesting said complex with a riboendonuclease capable of digesting RNA of double- stranded RNA/DNA duplexes, wherein said digesting removes a portion of said RNA molecule, said portion comprising one or more sequences of said RNA that were hybridized to said DNA sequences of said hybrid template and flanking the internal sequence, and wherein said digesting leaves intact said double stranded RNA/RNA duplex at the internal sequence to produce a digested complex comprising a truncated RNA molecule and partially bound hybrid template;

c) performing an extension of said truncated RNA, wherein said partially bound hybrid template acts as a template for extension of said truncated RNA molecule and said extension incorporates at least one detectable label into an extended RNA molecule.

42. The method of claim 41, further comprising detecting at least one detectable label in said extended RNA molecule, wherein said detection of said at least one detectable label in said extended RNA molecule provides a positive indicator for detecting said RNA molecule.

43. The method of claim 41, wherein said RNA molecule in a population comprising a plurality of different RNA molecules.

44. The method of claim 41, wherein said RNA molecule is a messenger RNA (mRNA) molecule.

45. The method of claim 43, wherein said population comprising a plurality of different RNA molecules is derived from a sample.

46. The method of claim 45, wherein said sample is a biological sample.

47. The method of claim 45, wherein said detecting said RNA molecule is a positive indicator of a presence of a microorganism, pathogen, gene, or gene product in said sample.

48. The method of claim 41, wherein said riboendonuclease is RNase H.

49. The method of claim 41, wherein the extension is performed by a polymerase.

50. The method of claim 49, wherein said polymerase is Klenow DNA polymerase.

51. The method of claim 41, wherein said hybrid template is bound to a solid matrix.

52. The method of claim 1, wherein step c), detecting a presence of at least one detectable label, is done using ELISA.

53. The method of claim 10, wherein step c), detecting a presence of at least one detectable label, is done using ELISA.

54. The method of claim 30, further comprising step (d), detecting the presence of at least one detectable label.

55. The method of claim 54, wherein the step of detecting is done using ELISA.

56. The method of claim 41, further comprising step (d), detecting the presence of at least one detectable label.

57. The method of claim 56, wherein the step of detecting is done using ELISA.

58. A method for detecting at least one specific RNA molecule in a population comprising a plurality of different RNA molecules, said method comprising:

a. ) making a hybrid template comprising a first portion and a second portion, wherein said first and second portion of said hybrid template are operably linked, and wherein the first portion is an RNA sequence complementary to an internal sequence of said specific RNA molecule and said second portion is a DNA sequence complementary to a region proximal to the internal sequence of said specific RNA molecule;

b. ) in a single reaction vessel

i.) binding said hybrid template to said specific RNA molecule, wherein said binding produces a complex comprising said specific RNA molecule and said hybrid template and said binding results in formation of a double stranded RNA/RNA duplex at the internal sequence of said specific RNA molecule and a double stranded RNA/DNA duplex at the region proximal to the internal sequence of said specific RNA molecule;

ii. ) digesting said complex with a riboendonuclease capable of digesting double- stranded RNA/DNA duplexes, wherein said digesting cleaves said specific RNA molecule at the region proximal to the internal sequence and leaves intact double stranded RNA/RNA duplex at the internal sequence to produce a digested complex comprising a truncated specific RNA molecule and bound hybrid template; iii. ) performing an extension of said digested complex, wherein said hybrid template acts as a template for extension of the truncated specific RNA molecule and said extension incorporates at least one detectable label into an extended RNA molecule; and

c.) detecting a presence of the at least one detectable label in said extended RNA molecule, wherein said presence of said at least one detectable label in said extended RNA molecule provides a positive indicator for detecting a specific RNA molecule in a population comprising a plurality of different RNA molecules.

59. The method of claim 58, wherein step c), detecting a presence of at least one detectable label, is done using ELISA.

60. A buffer solution for the performance of the hybridization, digestion and extension steps of claim 1, the buffer solution comprising a digestion buffer, a hybridization buffer, and an extension buffer.

61. The method of claim 1, wherein the single buffer solution comprises a hybridization buffer.

62. The method of claim 61, wherein the hybridization buffer can comprise a salt, such as, for example, NaCl and sodium citrate.

63. The method of claim 62, wherein the NaCl or sodium citrate can be at 1.0, 1.5, 2.0, 2.5, 3.0, 3.5, 4.0, 4.5, or 5.0 M, or any amount in between.

64. The method of claim 61, wherein the pH of the hybridization buffer can be 5.0, 5.5, 6.0, 6.5, 7.0, 7.5, 8.0, 8.5, or 9.0, or any amount above, below, or in between.

65. The method of claim 1, wherein the single buffer solution comprises a RNase digestion buffer.

66. The method of claim 65, wherein the RNase digestion buffer comprises one or more of Tris-HCl, KC1, MgCl₂, and dithiothreitol.

67. The method of claim 66, wherein the KC1 can be at 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, or 100 mM or any amount above, below, or in between.

68. The method of claim 66, wherein the MgCl₂ concentration can be 1, 2, 2.5, 3, 3.5, 4, or any amount above, below, or in between.

69. The method of claim 66, wherein the dithiothreitol concentration can be at 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20mM, or any amount above, below, or in- between.

70. The method of claim 65, wherein the pH of the solution can be 5.0, 5.5, 6.0, 6.5, 7.0, 7.5, 8.0, 8.1, 8.2, 8.3, 8.4, 8.5, or 9.0, or any amount above, below, or in between.

71. The method of claim 1, wherein the single buffer solution comprises a Klenow buffer.

72. The method of claim 71, wherein the Klenow buffer can be comprised of Tris-HCl, NaCl, MgCl₂, and dithiothreitol.

73. The method of claim 72, wherein the Tris-HCl can be at 0, 1, 2, 3 ,4, 5, 6, 7, 8, 9, 10, 11,12, 13, 14, 15, 16, 17, 18, 19, 20, 30, 40, 50, 60, 70, 80, 90, or 100 mM, or any amount above, below, or in between.

74. The method of claim 72, wherein the NaCl can be at 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, or 100 mM, or any amount above, below, or in between.

75. The method of claim 72, wherein the MgCl₂ concentration can be 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or any amount above, below, or in between.

76. The method of claim 72, wherein the dithiothreitol concentration can be at 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 mM, or any amount above, below, or in-between.

77. The method of claim 71, wherein the pH of the solution can be 5.0, 5.5, 6.0, 6.5, 7.0, 7.5, 7.6, 7.7, 7.8, 7.9, 8.0, 8.1, 8.2, 8.3, 8.4, 8.5, or 9.0, or any amount above, below, or in between.

78. The method of claim 1, wherein the single buffer solution comprises a hybridization buffer, a Klenow buffer, and an RNase H buffer.

79. The method of claim 78, wherein the RNase H and Klenow buffers can be mixed at a ratio of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 parts Klenow buffer to 1, 2, 3, 4 ,5, 6, 7, 8, 9, or 10 parts RNase buffer, or any ratio above, below, or in between this range.

80. The method of claim 1, wherein the temperature of the reaction can be carried out at 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 28, 29, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, or 100°C or any amount above, below, or in between.

81. The method of claim 78, wherein the buffers are added to the reaction sequentially.

82. The method of claim 1, wherein the reaction is carried out in a microfluidics device.