WO2011045593A1

WO2011045593A1 - Novel macrocyles and methods for their production

Info

Publication number: WO2011045593A1
Application number: PCT/GB2010/051713
Authority: WO
Inventors: Steven James Moss; Matthew Alan Gregory; Ming-Qiang Zhang
Original assignee: Biotica Technology Limited
Priority date: 2009-10-12
Filing date: 2010-10-12
Publication date: 2011-04-21
Also published as: GB0917816D0

Abstract

There are provided compounds of formula (I) or a pharmaceutically acceptable salt thereof: wherein the variables R₁-R₃ are as described in the description, said compounds being useful as anti-inflammatory agents with reduced systemic effects.

Description

NOVEL MACROCYLES AND METHODS FOR THEIR PRODUCTION

Field of the Invention

The present invention relates to novel 31 -desmethoxy FK506 and FK520 ester analogues with potent local anti-inflammatory activity, but substantially reduced systemic activity. These analogues are effective for therapeutic indications requiring potent local, but reduced systemic activity, such as pulmonary diseases (e.g. Asthma), gastrointestinal diseases (e.g. Inflammatory Bowel Disease), ocular diseases (e.g. Uveitis) and skin diseases (e.g.

Psoriasis and Atopic Dermatitis).

Background of the invention

FK506 (tacrolimus/fujimycin/Prograf) (Schreiber and Crabtree, 1992) and FK520 (ascomycin or immunomycin) (Wu et al., 2000) (Figure 1 ) are lipophilic macrolides produced by a variety of actinomycetes, including Streptomyces tsukubuaensis No. 9993 (Hatanaka et al., 1989), Sirepfomyces sp. MA6858, Streptomyces sp. MA6548, Streptomyces kanamyceticus KCC S-0433, Streptomyces davuligerus CKD1 1 19 (Kim and Park, 2007) which have been shown to produce FK506 (Muramatsu et al., 2005), and Streptomyces hygroscopicus subsp. hygroscopicus (DSM 40822), which is equivalent to Streptomyces hygroscopicus var ascomyceticus (ATCC 14891 ), producing FK520 (Garrity et al., 1993). Other closely related macrolides include FK525 (Hatanaka H, et al., 1989), FK523 (Hatanaka, H., et al., 1988) and antascomicins (Fehr, T., et al., 1996). A number of semisynthetic derivatives of these molecules have also been shown to be of utility, including pimecrolimus (SDZ ASM 981 , Elidel), which is a derivative of FK520 (Meingassner ei a/., 1997).

CH=CH₂, R₂ = trans-OH CH₃, R₂ = trans-OH H, R₂ = trans-OH : R-, = -CH₃, R₂ = c/s-CI

BIOSYNTHESIS: FK506 and FK520 are synthesised by type I polyketide synthases (PKS). This biosynthesis involves a shikimate derived starter unit, followed by 10 extensions utilising malonyl thioesters, or substituted malonyl thioesters, and addition of a lysine derived pipecolate group and cyclization by a non-ribosomal peptide synthetase (NRPS). The structure is then finally completed by O-methylation at C-31 and oxidation at C-9 (Motamedi et al., 1996). FK520 and FK506 differ at the C-21 position. FK520 has a C-21 ethyl substituent, whereas FK506 has a C-21 allyl substituent. The biosynthetic pathway common to all known naturally produced FK506 and FK520 analogues leads to the necessity for an oxygen bound to the carbon at the C31 position.

It has been shown previously, that if fkbO is inactivated in an FK506 or FK520 producing strain, unnatural starter acids, such as hydroxy cyclohexane carboxylic acid, can be fed to the fermentation broth and are incorporated, leading to novel compounds such as 31 - desmethoxy FK506 and 31 -desmethoxy FK520 (WO 2004/007709). Previous to the publication of this patent application, methods for generating 31 -desmethoxy-31 -Hydrogen derivatives of FK506 and FK520 had not been described.

MECHANISM OF ACTION: FK506, FK520 and close analogues suppress the immune system by inhibiting signal transduction pathways required for T-cell activation and growth. In particular, they have been shown to inhibit Ca²⁺-dependent T-cell proliferation, via initial formation of a complex with an FK-binding protein (FKBP), which binds to and blocks calcineurin (CaN). This FK506-FKBP-CaN complex inhibits the activation of nuclear factor of activated t-cells (NF-AT), preventing its entrance into the nucleus, and subsequent activation of the promoter of lnterleukin-2 (IL-2), which initiates IL-2 production. Additionally, FK506 can interfere with the action of calcineurin on substrates other than NFAT, including ΙκΒ, Na-K- ATPase and nitric oxide synthase, which may lead to some of the side-effects (Kapturczak et a/., 2004).

Treatment with FK506 may also be associated with up-regulation of transforming growth factor beta (TGF-β). This cytokine not only has immunosuppressive properties, but may be associated with the development of allograft fibrosis, which can lead to serious complications after long term treatment with these agents (Kapurtzak et al., 2004).

USES: FK506, in particular, is an important immunosuppressant used to aid prevention of organ rejection after transplantation. For example, it is used intravenously and orally for the prevention of organ rejection after allogeneic liver or kidney transplantation and in bone marrow transplantation. It has been shown to have potential utility in a wide variety of autoimmune, inflammatory and respiratory disorders, including Crohn's disease, Behcet syndrome, uveitis, psoriasis, atopic dermatitis, rheumatoid arthritis, nephritic syndrome, aplastic anaemia, biliary cirrhosis, asthma, pulmonary fibrosis, chronic obstructive pulmonary disease (COPD) and celiac disease. Treatment of many of these disorders is currently limited to patients with severe disease that are either refractory or hypersensitive to standard treatments. This limitation is due to the side effects of administration of FK506, which include renal dysfunction, gastrointestinal effects, neurological effects, hyperthrichosis and gingival hyperplasia.

Chronic treatment with FK506 requires strict therapeutic monitoring due to its narrow therapeutic index and great inter-individual variability which leads to dangers of over (or under) dosing (Roy et al., 2006).

Pimecrolimus (Elidel® cream) and FK506 (Protopic® ointment) are both used in topical formulations, such as ointments and creams, as treatments for a variety of skin conditions, in particular atopic dermatitis (Nghiem et al., 2002). On January 19^th 2006, the FDA required a black box warning on both of these topical treatments, due to concerns over a risk of cancer (Rustin, 2007).

Cytochrome P450 3A4 (Cyp3A4) and Cyp3A5 are the most important contributors to FK506 metabolism while the P-glycoprotein pump (MDR-1 ) modulates its bioavailability (Roy et al., 2006). The complexity of FK506 dosing is therefore enhanced by significant drug-drug interactions, variable metabolism and permeability (Tamura et al., 2003; Kapturczak et al., 2004; Izuishi et al., 1997).

The mechanism of toxicity of FK506 and FK520 has been related to the mechanism of action of immunosuppression (Dumont et al., 1992). This strong link between the mechanism of action and the toxicity has presented significant challenges to improving the therapeutic index through chemical modification. Segregation of efficacy and toxicity of new analogues may be possible by altering distribution or metabolism (Sigal et al., 1991 ). By limiting the exposure of the compound to organs that are sensitive to such inhibition, such as the kidney, systemic toxicity can be avoided. Additionally, topical administration of the calcineurin inhibitor at the site of administration (such as skin, lungs, gut, eye etc.) can be maximized. One way this can be achieved is by using a 'soft drug' approach, which involves designing compounds to have limited systemic exposure such as through increased metabolism, higher blood/plasma protein binding, poor absorption or bioavailability (Bodor and Buchwald, 2001 ; Bodor and Buchwald, 2005).

Inhaled FK506 has been tested in humans and animal models for pulmonary obstructive diseases such as asthma by Astellas/Fujisawa (WO2005/063242). In human trials, pulmonary function was claimed to be better than placebo, but with a slightly higher number of adverse events (42% vs 37%) (Shimizu, 2005).

Drug transporters such as Pgp are expressed at the epithelium of the lung, and are thought to be a functionally important element in reducing tissue access of inhaled xenobiotics. In particular, inhaled products which are substrates for Pgp would be anticipated to have reduced or nonlinear adsorption pharmacokinetics (Lechapt-Zalcman et al., 1997; Campbell et al., 2003). This is a concern with FK506, which is widely known to be a substrate for Pgp (Saeki et al., 1993).

It has been suggested that, due to their different mechanism of action to steroids, calcineurin inhibitors such as FK506 could have potential benefits for the treatment of patients with steroid-dependent bronchial asthma, enabling either reduction or withdrawal of steroids (Sano et al., 1995). Indeed, in in vitro studies, both FK506 and cyclosporine have been shown to inhibit stimulated T-lymphocytes from both glucocorticoid resistant and sensitive patients (Corrigan et al., 1996).

Ester analogues of FK520 have been generated as part of a wide series of semisynthetic FK520 analogues for use as systemic immunosuppressants, with the aim to reduce direct toxicity and present structural variation at the FKBP/calcineurin interface (Wagner et al., 1998; US5.731 .320; US5.643.918; US5.563.172). These documents purport to disclose compounds containing two hydrogen atoms bound to the C-31 carbon, however such compounds cannot be considered enabled. In fact biosynthetic methods available at the time of the disclosures only permitted access to compounds having a hydroxyl at the C-31 position (or a derivative thereof). Specifically, there was no known method for achieving no substitution whatever at the C-31 position (i.e. to produce a methylene group), as the biosynthesis (as it is now understood) requires a carbon-oxygen bond at the C31 position and all of the exemplified compounds have a methoxy at this position, as do FK506 and FK520 (Wallace et al., 1994; Reynolds et al., 1997; Lowden et al., 2001 ). There was also no suggestion as to any benefit that removal of the C-31 methoxy may lend to the final product, for example by increasing tissue (in particular lung) permeability or reduction in drug-drug interactions, nor any suggestion that these compounds might be useful for topical use, with a reduction in systemic activity.

Therefore, there remains a need to identify novel FK506 and FK520 analogues, in particular those with reduced systemic toxicity, which may have utility for the treatment of inflammatory conditions. The present invention discloses novel FK506 and FK520 analogues which have reduced systemic activity compared with the currently available FK506 and FK520 analogues. The novel FK506 and FK520 analogues may be useful for therapies requiring local availability but with poor systemic availability, including, but not limited to, topically administered therapies for inflammatory disorders such as atopic dermatitis, asthma, uveitis, psoriasis and inflammatory bowel diseases, which in particular are expected to show improvements in respect of one or more of the following properties: decreased metabolic stability, decreased systemic bioavailability, decreased oral bioavailability, high plasma protein binding, reduced efflux by Pgp and similar transporters, leading to improved permeability, improved lung pharmacokinetics and exposure (for example as shown by an improved lung:blood ratio after aerosol dosing), reduced CyP450 inhibition and metabolism, leading to fewer drug-drug interactions, improved formulation ability, improved potency, increased FKBP binding, improved toxicological profile, reduced nephrotoxicity and neurotoxicity, improved crystallinity or improved lipophilicity.

Summary of the Invention

The present invention provides a strategy for generating anti-inflammatory drugs with potent local activity, but reduced systemic toxicity (via rapid systemic inactivation). The previously undescribed beneficial properties of 31 -desmethoxy FK506 and FK520 analogues, as compared with compounds having a 31 -methoxy group (which includes their improved ADME properties, such as a reduction in efflux by drug transporters, leading to greater permeability, and a reduction in P450 metabolism, leading to reduced drug-drug interactions) which the inventors have discovered are combined with an ester linked chain in the C-32 position which is rapidly cleaved by esterases to give the acid metabolite, which has reduced activity, leading to a reduction in systemic toxicity. This gives a series of 31 -desmethoxy FK506 and FK520 esters with potent local activity when dosed directly to organs such as the lung, gastrointestinal tract, eye or skin, which are then rapidly inactivated upon systemic exposure.

Therefore, in a first aspect the present invention provides analogues of FK506 and FK520 which are lacking the methoxy group at C-31 via a biosynthetic change, and then have an ester linked group attached to the C32 hydroxyl group.

In a more specific aspect, the present invention provides 31 -desmethoxy FK506 or FK520 ester analogues according to the formula (I) below, or a pharmaceutically acceptable salt thereof:

wherein R₂ represents -CH₃, -CH₂CH_3! or -CH₂CH=CH₂;

Ri represents C1 -10 alkyl (e.g. C1 -6 alkyl) wherein one or more carbon atoms are optionally replaced by a heteroatom selected from O, N and S and which is optionally substituted by one or more halogen atoms or =0 groups;

or Ri represents aryl, C1 -4alkylaryl, heteroaryl or C1 -4heteroaryl; and

R₃ represents a group -(CO)_XC1 -10 alkyl wherein one or more carbon atoms of the alkyl chain are optionally replaced by a heteroatom selected from O, N and S and which is optionally substituted by one or more halogen atoms or =0 groups and x represents 0 or 1 ;

or R₃ represents H, aryl, C1 -4alkylaryl, heteroaryl or C1 -4heteroaryl;

or Ri and R₃ are linked to form a lactone ring having 5 to 7 ring members which may optionally contain one or more additional heteroatoms selected from O, N and S.

The above structure shows a representative tautomer and the invention embraces all tautomers of the compounds of formula (I) for example keto compounds where enol compounds are illustrated and vice versa.

The invention embraces all stereoisomers of the compounds defined by structure (I) as shown above.

In a further aspect, the present invention provides 31 -desmethoxy FK506 or FK520 ester analogues such as compounds of formula (I) or a pharmaceutically acceptable salt thereof, for use as a pharmaceutical.

In a further aspect, the present invention provides processes for production of 31 - desmethoxy FK506 and FK520 ester analogues defined by formula (I) above.

Definitions:

The articles "a" and "an" are used herein to refer to one or to more than one (i.e. at least one) of the grammatical objects of the article. By way of example "an analogue" means one analogue or more than one analogue.

As used herein the term "analogue(s)" refers to chemical compounds that are structurally similar to another but which differ slightly in composition (as in the replacement of one atom by another or in the presence or absence of a particular functional group).

As used herein the terms "31 -desmethoxy FK506 and FK520 ester analogues" / "31 - desmethoxy FK506 or FK520 ester analogues" refer to esters of compounds related to FK506, FK520 and similar compounds in structure, but with the 31 methoxy group replaced by a hydrogen atom. Such compounds are 22-membered rings with one lactone and one amide bond. The N of the amide bond forms a 2-carboxyl piperidine or a 2-carboxyl pyrrolidine. This carboxyl group forms the lactone group, with an oxygen atom that is allylic to a double bond that is exo to the main 22-membered ring. Such compounds include, without limitation, 31 - desmethoxy FK520 esters and 31 -desmethoxy FK506 esters as well as compounds of formula (I)-

As used herein the term "FK506 or FK520 producing strain" refers to a strain (natural or recombinant) which is capable of producing one or more FK506 or FK520 analogues when fed appropriately.

As used herein the term "31 -desmethoxy FK506 or FK520 producing strain" refers to a recombinant strain based on a natural FK506 or FK520 producing strain which is capable of producing one or more 31 -desmethoxy FK506 or FK520 analogues when fed appropriately. As used herein the term "FK506 or FK520 cluster" means the PKS and associated enzymes responsible for production of FK506 or FK520 analogues.

As used herein the term "modifying gene(s)" includes the genes required for post- polyketide synthase modifications of the polyketide, for example but without limitation cytochrome P-450 monooxygenases, ferredoxins and SAM-dependent O-methyltransferases. In the FK520 system these modifying genes include fkbD and fkbM, but a person of skill in the art will appreciate that PKS systems related to FK520 (for example but without limitation:

FK506, antascomicin, FK523, FK525 and tsukubamycin) will have homologues of at least a subset of these genes, some of which are discussed further below.

As used herein the term "precursor supply gene(s)" includes the genes required for the supply of the natural or non-natural precursors, the genes required for the synthesis of any naturally or non-naturally incorporated precursors and the genes required for the incorporation of any naturally or non-naturally incorporated precursors. For example but without limitation in the FK506 and FK520 system these genes include fkbL, fkbO and fkbP but a person of skill in the art will appreciate that PKS systems related to FK506 and FK520 (for example but without limitation: antascomicin, FK523, FK525 and tsukubamycin) will have homologues of these genes, some of which are discussed further below.

As used herein, the term "auxiliary gene(s)" includes references to modifying genes, precursor supply genes or both modifying genes and precursor supply genes. One example of an auxiliary gene is an oxygenase which may hydroxylate the starter unit.

As used herein the term "basic product" refers to the initial product of the polyketide synthase enzyme before the action of any modifying genes.

As used herein, the term "precursor" includes the natural starter units (i.e. 4,5- dihydroxycyclohex-1 -ene carboxylic acid), non-natural starter units (e.g non-cyclic or heterocyclic starter units), and naturally incorporated amino acids (i.e. pipecolic acid) and non- naturally incorporated amino acids As used herein the term "non-natural starter unit" refers to any compounds which can be incorporated as a starter unit in polyketide synthesis that are not the starter unit usually incorporated by that PKS.

Alkyl groups may be straight chain or branched. Unless indicated otherwise, alkyl groups may be C1 -8alkyl, e.g. C1 -6alkyl, e.g. C1 -4 alkyl. Examples of C1 -4 alkyl groups include Me, Et, n-Pr, i-Pr, n-Bu, -CH₂CHMe₂ (isobutyl) and CHMeCH₂Me.

Alkoxy means -Oalkyl.

Aryl groups include carbocyclic rings which may be mono or bicyclic and contain at least one aromatic ring. Apart from the aromatic ring any other ring may be unsaturated or partially or fully saturated. Typically aryl groups have 6 to 10 ring members. Examples of aryl groups include fully aromatic ring systems such as phenyl, naphthyl and partially aromatic ring systems such as indane, indene and tetralin. The preferred aryl group is phenyl.

Heteroaryl groups are aryl groups containing one or more (e.g. 1 to 4 such as 1 to 3 e.g. 1 or 2) hetero atoms selected from O, N and S. Typically heteroaryl groups have 5 to 10 ring members. Examples of monocyclic heteroaryl groups include 5 membered rings such as pyrazole, pyrrole, furan, thiophene, thiazole and 6 membered rings such as pyridine and pyrimidine. Examples of bicyclic heteroaryl groups include fully aromatic ring systems such as quinoline, isoquinoline, indole, isoindole and benzofuran and partially aromatic ring systems such chromane and tetrahydroquinoline.

Aryl and heteroaryl groups may optionally be substituted by one or more (e.g. one to three) groups e.g. selected from halogen, hydroxyl, oxo, C1 -4alkyl, -COC1 -3alkyl, -N0₂, -CN, - NH₂, -NHC1 -4alkyl, N(C1 -4alkyl)₂, -NHCOC1 -3alkyl and C1 -4alkoxy.

Detailed Description of the Invention

The present invention provides 31 -desmethoxy FK506 or FK520 ester analogues, as set out above, methods for the preparation of these compounds, methods for the use of these compounds in medicine and the use of these compounds as intermediates or templates for further derivatisation.

Preferably R₂ represents -CH₂CH=CH₂

Suitably Ri represents C1 -10 alkyl (e.g. C1 -6 alkyl) wherein one or more carbon atoms are optionally replaced by a heteroatom selected from O, N and S and which is optionally substituted by one or more halogen atoms or =0 groups.

In one embodiment, R-i represents C1 -10 alkyl e.g. C1 -6 alkyl without any optional replacement of a carbon atom by a heteroatom.

When R-i and/or R₃ represents C1 -10 alkyl (e.g. C1 -6 alkyl) wherein one or more carbon atoms are optionally replaced by a heteroatom selected from O, N and S, examples of resultant groups include ethers and thioethers in which a CH₂ within an alkylene chain is replaced by O or S respectively and alcohols in which a terminal CH₃ is replaced by OH. Amines may also be formed following replacement of -CHR- with-NR- or -CHRR' with -NRR'. Formation of unstable groups (e.g. -0-CH₂-0-) should be avoided.

Examples of substitution with halogen atoms include substitution with F atoms e.g. replacement of CH₃with CF₃.

Examples of substitution with =0 groups include replacement of -CH₂- with -CO- which carbonyl group may, for example, be part of a ketone, ester or amide functionality depending on the nature of neighbouring atoms.

When R-i represents C1 -4alkylaryl or C1 -4alkylheteroaryl, suitably it represents C1 - 2alkylaryl or C1 -2alkylheteroaryl e.g. -CH₂aryl or -CH₂heteroaryl.

When R₃ represents C1 -4alkylaryl or C1 -4alkylheteroaryl, suitably it represents C1 - 2alkylaryl or C1 -2alkylheteroaryl e.g. -CH₂aryl or -CH₂heteroaryl.

When R-i and R₃ are joined for form a lactone ring, for example Ri and R₃ together may represent -(CH₂)_2-3- thereby to form a 5-6 membered lactone ring.

Preferably Ri represents C1 to C4 alkyl.

Preferably R₃ represents H

In one example embodiment, R-i represents methyl, R₂ represents -CH₂CH=CH₂ and R₃ represents H as shown in the following structure:

In another example embodiment, R-i represents ethyl, R₂ represents -CH₂CH=CH₂ and R₃ represents H as shown in the following structure:

In another example embodiment, R-i represents isopropyl, R₂ represents -CH₂CH=CH2 and R₃ represents H as shown in the following structure:

In another example embodiment, R-i represents n-propyl, R₂ represents -CH₂CH=CH2 and R₃ represents H as shown in the following structure:

In another example embodiment, R-i represents isobutyl, R₂ represents -CH₂CH=CH2 and R₃ represents H as shown in the following structure:

In another example embodiment, R-i represents n-butyl, R₂ represents -CH₂CH=CH₂ and R₃ represents H as shown in the following structure:

The above structures show a representative tautomer and the invention embraces all tautomers of the compounds of formula (I) for example keto compounds where enol compounds are illustrated and vice versa.

The invention embraces all stereoisomers of the compounds defined by formula (I) as shown above.

In a further aspect, the present invention provides processes for production of 31 - desmethoxy FK506 or FK520 ester analogues defined by formula (I) above by culturing a 31 - desmethoxy FK506 or FK520 analogue producing strain, optionally with feeding and optionally isolating the compounds produced, then semisynthetically adding an ester group to the C32 hydroxyl.

In a further aspect, the present invention provides a pharmaceutical composition comprising a 31 -desmethoxy FK506 or FK520 ester analogue such as a compound of formula (I) or a pharmaceutically acceptable salt thereof together with one or more pharmaceutically acceptable diluents or carriers.

In a further aspect, the present invention provides 31 -desmethoxy FK506 or FK520 ester analogues such as compounds of formula (I) or a pharmaceutically acceptable salt thereof, for use in the treatment or prevention of immune disorders, inflammatory diseases, fungal diseases and/or rejection of transplants.

In a further aspect, the present invention provides use of 31 -desmethoxy FK506 or FK520 ester analogues such as compounds of formula (I) or a pharmaceutically acceptable salt thereof, in the manufacture of a medicament for the treatment or prevention of immune disorders, inflammatory diseases, fungal diseases and/or rejection of transplants.

In a further aspect, the present invention provides a method for the treatment or prevention of immune disorders, inflammatory diseases, fungal diseases and/or rejection of transplants which comprises administering to a subject (especially a human subject) in need thereof a therapeutically effective amount of a 31 -desmethoxy FK506 or FK520 ester analogue such as a compound of formula (I) or a pharmaceutically acceptable salt thereof.

In a further aspect, the present invention provides 31 -desmethoxy FK506 or FK520 ester analogues such as compounds of formula (I) or a pharmaceutically acceptable salt thereof, for use in the treatment or prevention of atopic dermatitis, asthma, uveitis, psoriasis and inflammatory bowel diseases.

In a further aspect, the present invention provides use of 31 -desmethoxy FK506 or FK520 ester analogues such as compounds of formula (I) or a pharmaceutically acceptable salt thereof, in the manufacture of a medicament for the treatment or prevention of atopic dermatitis, asthma, uveitis, psoriasis and inflammatory bowel diseases.

In a further aspect, the present invention provides a method for the treatment or prevention of atopic dermatitis, asthma, uveitis, psoriasis and inflammatory bowel diseases which comprises administering to a subject (especially a human subject) in need thereof a therapeutically effective amount of a 31 -desmethoxy FK506 or FK520 ester analogue such as a compound of formula (I) or a pharmaceutically acceptable salt thereof.

Pharmaceutically acceptable salts include the non-toxic acid addition salt forms of the compounds of formula (I). The pharmaceutically acceptable acid addition salts can conveniently be obtained by treating the base form with such appropriate acid. Appropriate acids comprise, for example, inorganic acids such as hydrohalic acids, e.g. hydrochloric or hydrobromic acid, sulphuric, nitric, phosphoric and the like acids; or organic acids such as, for example, acetic, propanoic, hydroxyacetic, lactic, pyruvic, oxalic (i.e. ethanedioic), malonic, succinic (i.e.

butanedioic acid), maleic, fumaric, malic (i.e. hydroxylbutanedioic acid), tartaric, citric, methanesulfonic, ethanesulfonic, benzenesulfonic, p-toluenesulfonic, cyclamic, salicylic, p-aminosalicylic, pamoic and the like acids. Conversely said salt forms can be converted by treatment with an appropriate base into the free base form.

The invention embraces compounds of formula (I) or a pharmaceutically acceptable salt thereof in the form of a pharmaceutically acceptable solvate, such as a hydrate. Compounds of formula (I) may be produced either by total synthesis or by semi- synthesis from a compound of formula (II). Suitable analogues for semi-synthesis include 31 - desmethoxy FK506, 31 -desmethoxy FK520 or 31 -desmethoxy FK523. Compounds of formula

(II) can be synthesised by total synthesis or by fermentation. To generate compounds of formula (II) by fermentation the producing organism can be supplemented with a suitable acid, or acid derivative, that will be incorporated by the biosynthetic machinery for FK506 or FK520 production in competition with the natural starter unit. A suitable acid or acid derivative is 4- hydroxycyclohexanecarboxylic. An alternative method is by genetic manipulation of the FK506 or FK520 producing organisms so that the the biosynthesis of the natural starter unit is disrupted. The resultant strain can then be supplemented with a suitable acid, or acid derivative, including 4-hydroxylcyclohexanecarboxylic acid. A method for doing so is described in WO2004/007709.

Compound of formula (II) produced by fermentation may be isolated using standard methods known to those of skill in the art, including, without limitation, those described in the methods of the examples below. Alternatives to these methods which may also be considered by a person of skill in the art include those as described in Natural Products Isolation (Cannell et ai, 1998).

In one embodiment, the host strain is a selected from the group consisting of

Streptomyces tsukubaensis No. 9993 (Ferm BP-927), Streptomyces hygroscopicus subsp. hygroscopicus (DSM 40822), Streptomyces sp. AA6554, Streptomyces hygroscopicus var. ascomyceticus MA 6475 ATCC 14891 , Streptomyces hygroscopicus var. ascomyceticus MA 6678 ATCC 55087, Streptomyces hygroscopicus var. ascomyceticus MA 6674, Streptomyces hygroscopicus var. ascomyceticus ATCC 55276, Streptomyces hygroscopicus subsp.

ascomyceticus ATCC 14891 , Streptomyces kanamyceticus KCC S-0433, Streptomyces c!avu!igerus CKD1 1 19, Streptomyces hygroscopicus subsp. yakushimaensis, Streptomyces sp. DSM 7348, Micromonospora n.sp. A92-306401 DSM 8429 Streptomyces sp. MA 6548 and Streptomyces sp. MA 6858 ATCC 55098. In a preferred embodiment the host strain is selected from the group consisting of: S. hygroscopicus var. ascomyceticus ATCC 14891 , Streptomyces hygroscopicus subsp. hygroscopicus (DSM 40822) or Streptomyces tsukubaensis No. 9993 (Ferm BP-927).

The compounds of formula (II) can then be derivatised by further chemical synthetic steps, by methods known to one skilled in the art (for example see March, Wiley Interscience) to compounds of formula I. The 32-hydroxyl group of compounds of formula (II) is modified by reaction with a suitable compound of formula (III). The etherification can be achieved by many methods known to one skilled in the art but preferably by reaction with a compound of formula

(III) in the presence of a rhodium-acetate catalyst (Wagner et ai 1998). Optionally other reactive centres on compounds of formula (II) may be protected by methods known to one skilled in the art.

(III)

Compounds of formula (III) may be made by many methods known to those skilled in the art. When R₃ = H they can be synthesised in two steps from 2-bromoacetyl bromide.

Reaction with the correct alcohol for R-i (e.g. reaction with n-butanol for R-i = n-butyl) yields an alkyl 2-bromoacetate. This can in turn be reacted with Ν,Ν'-ditosyl hydrazine to generate the alkyl diazoacetate. Suitable modification on the alcohol can lead to the diversity in R-i

(optionally a deprotection step may be required, either in the formation of the compound of formula (III) or once it has been coupled to a compound of formula (II) in order to generate a compound of formula I). When R₃ is not H then the prerequisite bromoacyl bromide or alkyl 2- bromoalkanoate may be commercially available or may be prepared by methods known to the skilled person. Alternatively, compounds of formula (I) may be prepared by reacting a corresponding compound of formula (I) in which R-i represents H and reacting it with an alcohol of formula R OH under ester forming conditions (e.g. acid or base catalysis).

Compounds of formula (I) are useful as pharmaceuticals for example, but without limitation, having potential as agents for the treatment of inflammatory diseases, in particular, those where local action is more relevant than systemic activity, such as the lung (eg asthma, COPD), gastrointestinal tract (eg Inflammatory Bowel Disease), eye (eg Uveitis) or skin (eg psoriasis, atopic dermatitis). In a further aspect, the invention provides for the use of a compound of formula (I) as disclosed herein, in the preparation of a medicament for the prophylaxis and/or treatment of organ rejection after transplantation, autoimmune diseases, inflammatory disorders, fungal infections, cancer, neurodegeneration, psoriasis, rheumatoid arthrisis, fibrosis and/or other hyperproliferative disorders. In a further aspect, the invention provides for a method of treatment or prophylaxis of organ rejection after transplantation, autoimmune diseases, fungal infections, cancer, neurodegeneration, psoriasis, rheumatoid arthritis, fibrosis and/or other hyperproliferative disorders comprising administering a compound of formula (I) to a subject in need thereof. Additionally, the compounds of formula (I) disclosed herein may be used in the preparation of a medicament for the prevention of organ allograft rejection. In a preferred embodiment the compounds of formula (I) are used in the preparation of a medicament for the topical treatment of autoimmune diseases or inflammatory disorders.

One skilled in the art would be able by routine experimentation to determine the ability of these compounds to inhibit fungal growth (e.g. Baker, H., et al., 1978; NCCLS Reference method for broth dilution antifungal susceptibility testing for yeasts: Approved standard M27-A, 17(9). 1997). In a further aspect the compounds of this invention are useful for inducing immunosuppression and therefore relate to methods of therapeutically or prophylactically inducing a suppression of a human's or an animal's immune system for the treatment or prevention of rejection of transplanted organs or tissue, the treatment of autoimmune, inflammatory, proliferative and hyperproliferative diseases (examples include but are not inclusively limited to autoimmune diseases, diabetes type I, acute or chronic rejection of an organ or tissue transplant, asthma, tumours or hyperprolific disorders, psoriasis, eczema, rheumatoid arthritis, fibrosis, allergies and food related allergies). Such assays are well known to those of skill in the art, for example but without limitation: Immunosuppressant activity - eg Kahan et al., 1991 ; Allografts - eg Kirchner et al. 2000; Autoimmune / Inflammatory / Asthma - eg Carlson, R.P. et al., 1993; Diabetes I - Rabinovitch, A. et al., 2002; Psoriasis - Reitamo, S. et al., 2001 ; Rheumatoid arthritis - Foey, A., et al., 2002; Fibrosis - eg Gregory et al. 1993.

The ability of the compounds of this invention to induce immunosuppression may be demonstrated in standard tests used for this purpose. One of skill in the art would be able by routine experimentation to determine the utility of these compounds in stents (e.g. Morice,

M.C., et al., 2002). Additionally, one of skill in the art would be able by routine experimentation to determine the neuroregenerative ability of these compounds (e.g. Steiner ei a/. 1997).

The compounds of formula (I) are also, or in particular, expected to be useful as a therapeutic or prophylactic agents for one or more of the following conditions: rejection reactions after transplantation of organs or tissues (for example heart, kidney, liver, bone marrow, skin, cornea, lung, pancreas, small intestine, limb, muscle, nerve, intervertebral disc, trachea, myoblast and cartilage); graft-versus-host reactions following bone marrow transplantation; autoimmune diseases (for example rheumatoid arthritis, systemic lupus erythematosus, Hashimoto's thyroiditis, multiple sclerosis, myasthenia gravis, type I diabetes); infections caused by pathogenic microorganisms, in particular fungal infections; inflammatory or hyperproliferative skin diseases or cutaneous manifestations of immunologically-mediated diseases (for example psoriasis, atopic dermatitis, contact dermatitis, eczematoid dermatitis, pyoderma gangrenosum, seborrhoeic dermatitis, lichen planus, pemphigus, bullous

pemphigoid, epidermolysis bullosa, rosacea, urticaria, angioedema, vasculitides, erythema, dermal eosinophilia, lupus erythematosus, acne, Netherton syndrome, and alopecia areata); autoimmune or allergic diseases of the eye (for example keratoconjunctivitis, vernal

conjunctivitis, allergic conjunctivitis, uveitis associated with Behcet's disease, keratitis, herpetic keratitis, conical keratitis, corneal epithelial dystrophy, keratoleukoma, ocular pemphigus, Mooren's ulcer, scleritis, Graves' ophthalmopathy, Vogt-Koyanagi-Harada syndrome, keratoconjunctivitis sicca (dry eye), phlyctenule, iridocyclitis, sarcoidosis affecting the eye, endocrine ophthalmopathy); reversible obstructive airway diseases or asthma, in particular chronic or inveterate asthma (for example late asthma, airway hyperresponsiveness, bronchial asthma, allergic asthma, intrinsic asthma, extrinsic asthma, and dust asthma), mucosal or vascular inflammations (for example gastric ulcers, ischaemic or thrombotic vascular injury, ischaemic bowel diseases, enteritis, necrotizing enterocolitis, intestinal damage associated with thermal burns, leukotriene B4-mediated diseases); intestinal inflammations or allergies (for example coeliac disease, proctitis, eosinophilic gastroenteritis, mastocytosis, Crohn's disease and ulcerative colitis); food-related allergic diseases with symptomatic manifestation remote from the gastrointestinal tract (for example migraine, rhinitis and eczema); renal diseases (for example interstitial nephritis, Goodpasture's syndrome, haemolytic uraemic syndrome, nephrotic syndrome (for example glomerulonephritis) and diabetic nephropathy); nervous system diseases (for example multiple myositis, Guillain-Barre syndrome, Meniere's disease, multiple neuritis, solitary neuritis, cerebral infarction, Alzheimer's disease, Parkinson's disease, amyotrophic lateral sclerosis and radiculopathy); ischaemic diseases (for example head injury, brain haemorrhage, cerebral thrombosis, cerebral embolism, cardiac arrest, stroke, transient ischemic attack, hypertensive encephalopathy, cerebral infarction); endocrine diseases (for example hyperthyroidism and Basedow's disease); haematic diseases (for example pure red cell aplasia, aplastic anemia, hypoplastic anemia, idiopathic thrombocytopenic purpura, autoimmune hemolytic anaemia, agranulocytosis, pernicious anaemia, megaloblastic anaemia, and anerythroplasia); bone diseases (for example osteoporosis); respiratory diseases (for example sarcoidosis affecting the respiratory tract, pulmonary fibrosis, chronic obstructive pulmonary disease (COPD), Bronchiolitis Obliterans Syndrome (BOS) and idiopathic interstitial pneumonia); skin diseases (for example dermatomyositis, leukoderma vulgaris, ichthyosis vulgaris, photosensitivity, and cutaneous T-cell lymphoma); circulatory diseases (for example arteriosclerosis, atherosclerosis, aortitis syndrome, polyarteritis nodosa, and myocardosis); collagen diseases (for example scleroderma, Wegener's granulomatosis, and Sjogren's syndrome); adiposis; eosinophilic fasciitis; periodontal diseases (for example damage to gingiva, periodontium, alveolar bone or substantia ossea dentis); male pattern alopecia, alopecia senile; muscular dystrophy; pyoderma and Sezary syndrome; chromosome abnormality-associated diseases (for example Down's syndrome); Addison's disease; Human Immunodeficiency Virus (HIV) infection or AIDS; hypertrophic cicatrix and keloid due to trauma, burn, or surgery.

The aforementioned compounds of the invention or a formulation thereof may be administered by any conventional method including topically (for example by inhalation, vaginally, intranasally, or by eye or ear drop), enterally (for example orally or rectally) or parenterally (for example by intravenous, intracavernosal, subcutaneous, intramuscular, intracardiac or intraperitoneal injection) or via a medical device (for example via a stent). The treatment may consist of a single dose or a plurality of doses over a period of time.

Whilst it is possible for a compound of the invention to be administered alone, it is preferable to present it as a pharmaceutical formulation, together with one or more physiologically acceptable diluents or carriers. The diluents or carrier(s) must be "physiologically acceptable" in the sense of being compatible with the compound of the invention and not deleterious to the recipients thereof. In some cases, the diluent or carrier will be water or saline which will be sterile and pyrogen free.

The formulations may conveniently be presented in unit dosage form and may be prepared by any of the methods well known in the art of pharmacy. Such methods include the step of bringing into association the active ingredient (compound of the invention) with the carrier which constitutes one or more accessory ingredients. In general the formulations are prepared by uniformly and intimately bringing into association the active ingredient with liquid carriers or finely divided solid carriers or both, and then, if necessary, shaping the product.

Tablets may contain excipients such as microcrystalline cellulose, lactose, sodium citrate, calcium carbonate, dibasic calcium phosphate and glycine, disintegrants such as starch (preferably corn, potato or tapioca starch), sodium starch glycollate, croscarmellose sodium and certain complex silicates, and granulation binders such as polyvinylpyrrolidone, hydroxypropylmethylcellulose (HPMC), hydroxy-propylcellulose (HPC), sucrose, gelatin and acacia. Additionally, lubricating agents such as magnesium stearate, stearic acid, glyceryl behenate and talc may be included. Solid compositions of a similar type may also be employed as fillers in gelatin capsules. Preferred excipients in this regard include lactose, starch, a cellulose, milk sugar or high molecular weight polyethylene glycols. For aqueous suspensions and/or elixirs, the

compounds of the invention may be combined with various sweetening or flavouring agents, colouring matter or dyes, with emulsifying and/or suspending agents and with diluents such as water, ethanol, propylene glycol and glycerin, and combinations thereof.

A tablet may be made by compression or moulding, optionally with one or more accessory ingredients. Compressed tablets may be prepared by compressing in a suitable machine the active ingredient in a free-flowing form such as a powder or granules, optionally mixed with a binder (eg povidone, gelatin, hydroxypropylmethyl cellulose), lubricant, inert diluent, preservative, disintegrant (eg sodium starch glycolate, cross-linked povidone, cross-linked sodium

carboxymethyl cellulose), surface-active or dispersing agent. Moulded tablets may be made by moulding in a suitable machine a mixture of the powdered compound moistened with an inert liquid diluent. The tablets may optionally be coated or scored and may be formulated so as to provide slow or controlled release of the active ingredient therein using, for example,

hydroxypropylmethylcellulose in varying proportions to provide desired release profile.

Formulations in accordance with the present invention suitable for oral administration may be presented as discrete units such as capsules, cachets or tablets, each containing a

predetermined amount of the active ingredient; as a powder or granules; as a solution or a suspension in an aqueous liquid or a non-aqueous liquid; or as an oil-in-water liquid emulsion or a water-in-oil liquid emulsion. The active ingredient may also be presented as a bolus, electuary or paste.

Aerosol formulations suitable for administering via inhalation can also be made using methods known in the art. Examples of this include administration of the compounds of the invention by inhalation in the form of a powder (e.g. micronized powder) delivered as a dry powder or in an aerosol formulation or in the form of atomized solutions or suspensions.

Exemplary dry powder inhalers include DISKUS, TURBUHALER, DISKHALER and

CLICKHALER. The aerosol formulation may comprise the drug suspended or dissolved in a suitable pressurized propellant (e.g. HFA134a and/or HFA227). Other equipment such as nebulizer or inhaler may be used (eg see Chan et al., 2003; Smyth et al., 2003; Dalby et al., 2003; Corcoran et al., 2006; Cryan et al., 2007; WO04/1 10335).

For applications to external tissues, for example the mouth and skin, the compositions are preferably applied as a topical ointment or cream. When formulated in an ointment, the active agent may be employed with either a paraffinic or a water-miscible ointment base.

Alternatively, the active agent may be formulated in a cream with an oil-in-water cream base or a water-in-oil base. There are many examples in the literature of topical formulations for natural products such as FK506, FK520 and analogues (eg see US 6,352,998; US6,598,153;

US6,673,808; US6,515,016; US6,403,122).

The compounds of the invention may also be administered using medical devices known in the art. For example, in one embodiment, a pharmaceutical composition of the invention can be administered with a needleless hypodermic injection device, such as the devices disclosed in U.S. 5,399,163; U.S. 5,383,851 ; U.S. 5,312,335; U.S. 5,064,413; U.S. 4,941 ,880; U.S. 4,790,824; or U.S. 4,596,556. Examples of well-known implants and modules useful in the present invention include : US 4,487,603, which discloses an implantable micro- infusion pump for dispensing medication at a controlled rate; US 4,486,194, which discloses a therapeutic device for administering medicaments through the skin; US 4,447,233, which discloses a medication infusion pump for delivering medication at a precise infusion rate; US 4,447,224, which discloses a variable flow implantable infusion apparatus for continuous drug delivery; US 4,439,196, which discloses an osmotic drug delivery system having multi-chamber compartments; and US 4,475,196, which discloses an osmotic drug delivery system. Many other such implants, delivery systems, and modules are known to those skilled in the art.

The compounds can be administered as the sole active agent, or in combination with other pharmaceutical agents, such as other agents that stimulate or inhibit cell proliferation or immune responses. These agents include e.g. cyclosporine, rapamycin, FK506, leflunomide, butenamides, corticosteroids, Doxorubicin, and the like. In such combinations, each active ingredient can be administered either in accordance with its usual dosage range, or at a lower dose level.

It should be understood that in addition to the ingredients particularly mentioned above the formulations of this invention may include other agents conventional in the art having regard to the type of formulation in question, for example those suitable for oral administration may include flavouring agents.

Pharmaceutical compositions of the invention may optionally contain further active ingredients.

Also claimed as an aspect of the invention are compounds of formula (IA) or a salt thereof (such as a pharmaceutically acceptable salt):

wherein

R₂ represents -CH₃, -CH₂CH_3! or -CH₂CH=CH₂;

Ri represents H; and

R₃ represents a group -(CO)_XC1 -10 alkyi wherein one or more carbon atoms of the alkyi chain are optionally replaced by a heteroatom selected from O, N and S and which is optionally substituted by one or more halogen atoms or =0 groups and x represents 0 or 1 ;

or R₃ represents H, aryl, C1 -4alkylaryl, heteroaryl or C1 -4heteroaryl.

Suitable and preferred x, R₂ and R₃ groups are as described above for compounds of formula (I).

An example compound of formula (IA) is a compound in which R-i represents H, R₂ represents -CH₂CH=CH₂ and R₃ represents H as shown in the following structure:

above for compounds of formula (I). Suitably the alcohol function represented by Ri = H in a compound of formula (lll)is protected e.g. as an ester by a tnmethylsilylalkylene group or other hydroxyl protecting group which may be removed (e.g. by hydrolysis) following reaction with the compound of formula (II).

Compounds of formula (IA) may be used as intermediates in the preparation of compounds of formula (I). Compounds of formula (IA) are also produced by hydrolysis in vivo following administration of compounds of formula (I) therefore it may be useful to monitor the presence of compounds of formula (IA) during therapy. Isolated compound of formula (IA) in various concentrations may therefore be used a reference standard for comparison of levels in the plasma (or urine or other body fluid) of treated subjects. Brief description of the Figures

Figure 1 : ¹H NMR of Compound 7

Figure 2: ¹H NMR of Compound 8

Figure 3: ¹H NMR of Compound 9

Figure 4: ¹H NMR of Compound 10

Figure 5: ¹H NMR of Compound 11

Figure 6: Plot of data from LCMS analysis of blood samples from pharmacokinetic study in male CD1 mice after (A) p.o. dosing at 10mg/kg and (B) i.v. dosing at 1 mg/kg with compounds 7, 8, 9 and 10 and FK506, 1.

Figure 7: Plot of data from LCMS analysis of samples ofter incubation of compounds 7, 9 and

10 and FK506, 1 with human whole blood.

Figure 8: Plot of data from analysis of (A) lung samples and (B) blood samples from pharmacokinetic study in male CD1 mice after aerosol dosing (20mg to groups of 9 mice over 10 minutes) with compounds 7, 9 and FK506, 1.

Materials and Methods

Materials

All molecular biology enzymes and reagents were from commercial sources. Vector pUC19 was obtained from New England Biolabs. Cosmid Supercos-1 was obtained from Stratagene. Vector pKC1 139B01was obtained by inserting a linker into pKC1 139 (Bierman et al., 1992). The 674bp BglW PvuW fragment of pKC1 139 was replaced by the annealing product of oligos B01 and B02 to give the plasmid pKC1 139B01 (5789bp) containing the polylinker below:

Primers 5' gatccactagttcggacgcatatgctggatatccaagtatctagaac B01 (SEQ ID NO: 21)

5' gttctagatacttggatatccagcatatgcgtccgaactagtg B02 (SEQ ID NO:

22)

Resulting polylinker

Spel Ndel EcoRV Xbal

5' gatccactagttcggacgcatatgctggatatccaagtatctagaac 3'

3 ' gtgatcaagcctgcgtatacgacctataggttcatagatcttg 5'

Starter materials

All of the feeds used for starting units were obtained from commercial sources. 4-trans- hydroxycyclohexanecarboxylic acid was purchased from TCI Europe.

Bacterial strains and growth conditions

Escherichia coli DH10B (GibcoBRL) and £ coli JM1 10 (New England Biolabs) were grown in 2xTY medium as described by Sambrook et al. (2001 ). £. coli ET12567(pUZ8002) was grown as described by Paget et al. (1999) in 2xTY medium with kanamycin (25 mg/L) and chloramphenicol (12.5 mg/L). £ coli VCS257 was used for transfection of in vitro packaged cosmids. According to the instructions of Stratagene's Gigapack® III XL Packaging Extract the strain was kept on LB medium and grown on LB plus 0.2% maltose and 10mM MgS0₄ for transfection. £ coli transformants were selected for with ampicillin (100 mg/L), kanamycin (50 mg/L), apramycin (50 mg/L).

The FK506 producer Streptomyces tsukubaensis no. 9993 (FERM BP-927) (International Patent Organism Depositary, Tsukuba, Japan) and its derivatives were maintained on medium 1 agar plates or ISP4, ISP3, or ISP2 (see below) at 28 °C.

The FK520 producer, Streptomyces hygroscopicus subsp. hygroscopicus (DSM 40822, purchased from DSMZ, Braunschweig, Germany) (known to be equivalent to Streptomyces hygroscopicus subsp. ascomyceticus ATCC 14891 ) and its derivatives were maintained on medium 1 agar plates, ISP2, ISP3 or ISP4 (see below) at 28 °C.

Production of FK520 was carried out by fermentation of Streptomyces hygroscopicus subsp. hygroscopicus (DSM 40822), also termed BIOT-4081. Streptomyces tsukubaensis no. 9993 (FERM BP-927), also termed BIOT-31 19 was used for producing FK506. Single spore isolates of both strains, termed BIOT-4168 (containing the genes for FK520 biosynthesis) and BIOT-4206 (containing the genes for FK506 biosynthesis), were used for strain construction.

Strains were grown on MAM, ISP4, ISP3 or ISP2 agar at 28 °C for 5 - 21 days and used to inoculate seed medium NGY. The inoculated seed medium was incubated with shaking between 200 and 300 rpm at 5.0 or 2.5 cm throw at 28 °C for 48 h. For production of FK520 or FK506 the fermentation medium PYDG or PYDG+MES buffer (PYDM) were inoculated with 2.5%-10% of the seed culture and incubated with shaking between 200 and 300 rpm with a 5 or 2.5 cm throw at 28 °C for six days. The culture was then harvested for extraction.

Other actinomycete strains were generated from these available strains using methods described below.

5

Production of FK520, FK506 or analogues in Tubes

Spore stocks of BIOT-4081 , BIOT-4168, BIOT-31 19, BIOT-4206 or strains which are described below, such as BIOT-4131 , BIOT-4132 and BIOT-4254 were cultured on MAM, ISP4, ISP3 or ISP2 plates, and preserved in 20% (w/v) glycerol and stored at -80 °C. Spores were

10 recovered on plates of MAM, ISP4, ISP3 or ISP2 and incubated for 5-21 days at 28 °C. Vegetative cultures (seed culture) were prepared by removing one agar plug (6 mm in diameter) from the MAM, ISP4, ISP3 or ISP2 plate and transferring into 7 mL medium NGY in 50 mL polypropylene centrifuge tubes (cat no. 227261 , purchased from Greiner Bio-One Ltd, Stonehouse, Gloucestershire, UK) with foam plugs, or in Erlenmeyer flasks as described below. The culture tubes were incubated at 28 °C,

15 300 rpm, 2.5 cm throw for 48 h. From the seed culture 0.5 mL were transferred into 7 mL production medium PYDG or PYDG+MES in 50 mL centrifuge tubes with foam plugs. Cultivation was carried out for 6 days at 28 °C and 300 rpm (2.5 cm throw). When necessary a selected precursor was fed to the production medium 24 h post inoculation. The feed compound was dissolved in 0.05 - 0.1 mL methanol and added to the culture to give a final concentration of 2.12 mM of the feed compound. 0

Production of FK520, FK506 or analogues in Flasks

Spore stocks of BIOT-4081 , BIOT-4168, BIOT-31 19, BIOT-4206 or strains which are described below, such as BIOT-4131 , BIOT-4132 and BIOT-4254 were cultured on MAM, ISP4, ISP3 or ISP2 plates, and preserved in 20% (w/v) glycerol and stored at -80 °C. Spores were 5 recovered on plates of MAM, ISP4, ISP3 or ISP2 and incubated for 5 - 21 days at 28 °C. Vegetative cultures (seed culture) were prepared by removing 4 - 10 agar plugs (6 mm in diameter) from the MAM, ISP4, ISP3 or ISP2 plate and inoculating into 50 - 250 mL medium NGY in 250 mL or 2000 mL Erlenmeyer flasks with foam plugs. The seed flasks were incubated at 28 °C, 200 - 250 rpm (5 or 2.5 cm throw) for 48 h. From the seed culture 2 - 10% (v/v) was transferred into 50 or 250 mL

30 production medium PYDG (or PYDG + MES) in 250 mL or 2000 mL Erlenmeyer flasks respectively with foam plugs. Cultivation was carried out for 6 days at 28 °C and 200 - 250 rpm (5 or 2.5 cm throw). If necessary a selected precursor was fed to the production medium 24 h post inoculation. The feed compound was dissolved in 0.375 - 1 mL methanol and added to the culture to give final concentration of 2.12 mM of the feed compound.

35

Production of FK520, FK506 or analogues in stirred bioreactors Spore stocks of BIOT-4081 , BIOT-4168, BIOT-31 19, BIOT-4206 or strains which are described below, such as BIOT-4131 , BIOT-4132 and BIOT-4254 were prepared after growth on MAM, ISP4, ISP3 or ISP2 agar medium, and preserved in 20% (w/v) glycerol and stored at -80 °C. Spores were recovered on plates of MAM, ISP4, ISP3 or ISP2 medium and incubated for 5-21 days at 28 °C.

Vegetative cultures (seed culture) were prepared by removing 5-10 agar plugs (6 mm in diameter) from the MAM, ISP4, ISP3 or ISP2 plate and inoculation of 200 - 350 mL medium NGY in 2 L Erlenmeyer flasks with foam plug. Cultivation was carried out for 48 h at 28 °C, 250 rpm (2.5 cm throw). The entire seed culture in one flask was transferred into 5 L PYDG containing 0.01 -0.05% antifoam SAG 471 , in 7 L Applikon Fermentor. The fermentation medium was pre-adjusted at pH 6.0-7.0 post-sterilization. The fermentation was carried out for 6 days at 28 °C, with starting agitation set at 300-450 rpm, aeration rate at 0.5-0.8 v/v/m and dissolved oxygen (DO) level controlled with the agitation cascade at 20 - 40% air saturation. If required the pH may be maintained using acid or base addition on demand. For production of analogues of FK520 or FK506, the selected feed (providing the starter unit for biosynthesis of target compound) was fed to the production medium 12 - 24 h post inoculation. The feed compound was dissolved in 3 - 5 mL methanol and added to the culture to give final concentration of 2 mM of the feed compound, the amount of methanol not exceeding 1 % of the total volume. Fermentation was continued for further five days post-feeding. Media Recipes

Water used for preparing media was prepared using Millipore Elix Analytical Grade Water Purification System.

Medium 1: Modified A-medium (MAM)

Component Source per L

Wheat starch Sigma 10 g

Corn steep powder Sigma 2.5 g

Yeast extract Difco 3 g

Calcium carbonate Sigma 3 g

Iron sulphate Sigma 0.3 g

BACTO agar Difco 20 g

No pH adjustment is made. Sterilised by autoclaving 121 °C, 15 min. Medium 9: R6 (Kieser et al., 2000) Component Source per L

Sucrose Fisher 200 g

Dextrin Avedex 10 g

Casamino acids Difco g

MgS0₄.7H₂0 Sigma 0.05 g

ISP Trace Element See below 1 mL

Solution

K₂S0₄ Sigma 0.1 g

Water to 700 mL

Add 20 g BACTO agar and a stirrer bar to each 1 L Duran and

autoclave at 121 °C for 15 min.

After autoclaving add:

Component Source per L

(previously sterilised individually

by autoclaving 121 °C, 15 min)

0.65 M L-glutamic acid, mono Sigma 100 mL (10.99 g)

sodium salt

0.48 M CaCI₂.2H₂0 Sigma 100 mL (7.06 g)

0.1 M MOPS pH 7.2 Fisher 100 mL (2.09 g)

ISP3

Component Source per L

Oatmeal Tesco 20 g

BACTO agar Difco 18 g

ISP Trace Element See 1 mL

Solution below

Oatmeal is cooked/steamed in the water for 20 min, strained through a muslin and more water added to replace lost volume. ISP Trace Elements Solution is added and pH adjusted to 7.2 with NaOH. Agar is added before autoclaving at 121 °C, 15 min.

ISP Trace Elements Solution

Component Source per L

FeS0₄.7H₂0 Sigma 0.1 g

MnCI₂.4H₂0 Sigma 0.1 g

ZnS0₄.7H₂0 Sigma 0.1 g

Distilled water 100

mL Stored in the dark at 4 °C.

2xTY

Component Source per L

Tryptone Difco 16 g

Yeast extract Difco 10 g

NaCI Sigma 5 g

BACTO agar Difco 15 g

Sterilised by autoclaving 121 °C, 15 min.

LB

Component Source per L

Tryptone Difco 10 g

Yeast extract Difco 5 g

NaCI Sigma 10 g

BACTO agar Difco 15 g

Sterilised by autoclaving 121 °C, 15 min.

TSB

Component Source per L

Bacto Tryptic Soy BD 30 g

Broth

Sterilised by autoclaving 121 °C, 15 min.

NGY

Component Source per L

Difco Nutrient Broth Difco 8 g

Glucose Sigma 10 g

Yeast Extract Difco 5 g

The medium is adjusted to pH 7.0, with NaOH and then sterilised by autoclaving 121 °C, 15 min. PYDG

Component Source per L

Peptone from Milk Sigma 15 g

Solids

Yeast Extract Difco 1 .5 g

Dextrin Avedex 45 g Glucose Sigma 5 g

The medium is adjusted to pH 7.0 with NaOH, and then sterilised by autoclaving 121 °C, 15 min. When MES is added to PYDG (PYDG + MES) it is added 21 .2 g/L prior to pH adjustment.

ISP4

Component Source per L

Soluble Starch BDH 10 g

K₂HP0₄ Sigma 1 .0 g

MgS0₄.7H₂0 Sigma 1 .0 g

NaCI RDH 1 .0 g

(NH₄)₂S0₄ RDH 2.0 g

CaC0₃ Caltec 2.0 g

BACTO agar Difco 20 g

ISP Trace Elements See 1 mL

Solution above

A paste is made using a little cold water and the starch. This is brought up to a volume of 500 mL. All other ingredients are then added, and the pH of the media is adjusted to pH 7.0 - 7.4. Sterilise by autoclaving 121 °C, 15 min.

ISP2

Component Source per L

Yeast extract Difco 4 g

Malt extract Difco 10 g

Glucose Sigma 4 g

Bacto agar Difco 20 g

Sterilise by autoclaving 121 °C, 15 min.

FK Seed Medium

component Source per L

1 .0 % Soy Peptone 10.0 g

2.0 % Glucose 20.0 g

0.5 % Bakers Yeast 5.0 g

0.2 % NaCI 2.0 g

1 % Trace Elements 10 mL

Solution The medium is adjusted to pH 7.0 with NaOH, and then sterilised by autoclaving 121°C, 15 minutes.

FK Production Medium

component Source per L

2.0 % Nutrisoy Soy 20.0 g

Bean Flour

2.0 % Glucose 20.0 g

0.6 % Bakers Yeast 6.0 g

0.25 % K₂HP0₄ 2.5 g

0.25 % KH₂P0₄ 2.5 g

0.5 % NaCI 5.0 g

3.0 % Glycerol 30.0 g

2.0% Soybean Oil 20.0 g

1 .0 % Trace 10 mL

Elements Solution

The medium is adjusted to pH 6.4 with NaOH, and then sterilised by autoclaving 121°C, 15 minutes.

FK Trace Elements Solution

component Source per L of

distilled

H₂0

ZnS0₄.7H₂0 0.05 g

MgS0₄.7H₂0 0.125 g

MnS0₄.H₂0 0.01 g

FeS0₄.7H₂0 0.02 g

Store in the dark at 4 °C

DNA manipulation and sequencing

DNA manipulations and electroporation procedures were carried out as described in Sambrook et al. (2001 ). PCR was performed according to the instructions of the KOD Polymerase kit (Novagen). DNA sequencing was performed as described previously (Gaisser et al., 2000). Genome sequencing was carried out using 454 pyrosequencing technology (Margulies et al., 2005) at Cogenics and the University of Cambridge.

Genomic DNA preparation

Strains were grown in shake flasks containing 25 mL TSB or ISP2 medium at 250 - 300 rpm and 28 °C and harvested after 2 to 3 days. Cell pellets were washed with 10.3% sucrose and frozen at -20 °C until used. The following method was most successful for genomic DNA isolation from S. hygroscopicus, S. tsukubaensis and S. avermitilis. A pellet originating from 12.5 mL of culture was resuspended in 1 mL STE buffer (100 mM NaCI, 10 mM Tris HCI pH8, 1 mM EDTA). 20 mL STE buffer supplemented with 2 mg/mL lysozyme were added and the resuspension incubated for 30 min at 37 °C. 20 μί of RNaseA (10 mg/mL) were added and the mixture incubated for another 30 min at 37 °C. 4.8 mL EDTA (0.1 M final concentration) were added to stop the reaction. 1 .4 mL 20% SDS were added. After careful mixing the lysate was incubated on ice for 5 min, then extracted with one volume of phenol/chloroform/isoamylalcohol (25:24:1 ) and centrifuged at 2300 g and 4 °C for at least 15 min up to 1 h. Extractions were repeated until no more protein was visible at the interface, followed by a final chloroform/isoamylalcohol (49:1 ) extraction. The upper phase was precipitated with 1/10 vol. 5 M NaCI and 1 vol. cold isopropanol. After a few min, the DNA was spooled out with a glass rod and washed in ice cold 70% EtOH. After brief drying, the recovered DNA was dissolved in 0.5 - 1 mL TE 10:1. The proteinase K method (Kieser et al., 1999) was also applied successfully to recover genomic DNA from S. tsukubaensis.

Cosmid library preparation for S. tsukubaensis

A cosmid library of genomic DNA of S. tsukubaensis, was constructed. High molecular weight DNA from several genomic DNA preps was partially digested with BfuC\, an isoschizomer of Sau3A, to a mean size of 30 - 60 kb, ligated to Supercos-1 , packaged into A phage using Gigapack® III XL Packaging Extract (Stratagene) and transfected into Escherichia coli VCS257. The titre was 6.7 x 10⁵ cfu / μg vector. DNA of 10 cosmids was isolated and digested with EcoRI to check the insert size which was 40 kb on average. 2000 clones were grown in 96-well microtitre plates (150 μί LB Amp100 Kan50 per well) at 37 °C and frozen at -80 °C after mixing wells with 50μί LB/glycerol 1 :1 .

FkbO probe preparation

A DIG labeled fkbO probe was used to detect cosmids containing this region of the FK506 biosynthetic cluster. The probe was prepared by PCR using DIG labeled dNTP mix (Roche). It comprises 410 bp of 3'-terminal fkbO sequence. Sequence information for primer design had been obtained by 454 sequencing of BIOT-31 19 - see Figure 1 and SEQ ID NO: 1 . Primer sequences were:

UES2for (SEQ ID NO: 2) 5'-CACTCCTTCGATCTCCACGAGCAGGTCGCCACGGGC-3' and UES2rev (SEQ ID NO: 3) 5'-ACCCTGCCGTCCTCACGGCACACCACTACCCCACGG-3'.

Annealing temperatures between 66 and 71 °C and extension for 20 sec at 68 °C proved to be successful.

Colony hybridization

Thawed microplate-cultures were stamped onto positively charged filter membranes (Roche) which had been placed on LB Amp100 Kan50 plates. After overnight growth at 37 °C membranes were taken off. Cells were lysed and cell debris removed according to the DIG Application Manual for Filter Hybridization (Roche). DNA was crosslinked by exposing membranes to UV (302nm) for 5 min. Membranes were kept between two sheets of filter paper soaked with 2xSSC (300 mM NaCI, 15 mM Sodium citrate) at 4 °C or used immediately for hybridization. Hybridization was carried out using standard hybridization buffer and DIG labeled fkbO probe (see above) at a hybridization temperature of 68 °C. Stringent washes were performed at 68 °C. The nonradioactive DIG Nucleic Acid Detection kit from Roche was used to identify 5 positive clones on 4 library plates. The procedure followed the instructions of the DIG Application Manual for Filter Hybridization (Roche).

Conjugation of Streptomyces hygroscopicus subsp. hygroscopicus and Streptomyces tsukubaensis

Escherichia coli ET12567 (pUZ8002) (Macneil et al., 1992, Paget et al., 1999) was transformed with pKC1 139B01 -derived plasmids by electroporation to generate the £ coli donor strains for spore conjugation (Kieser et al., 2000). Fresh spores were harvested in water from plates of Streptomyces hygroscopicus (BIOT-4168) or Streptomyces tsukubaensis (BIOT- 4206). Spore suspensions were heat-shocked at 50 °C for 10 min. They were then mixed with the £ coli donor strain, which had been washed twice with 2xTY, in a ratio of 3:1 Streptomycete to £. coli, and the mixture shaken at 37 °C, 300 rpm, 2.5 cm throw for 1 .5 - 2 h. The conjugation mixture was then plated on R6 medium and incubated at 37 °C. After -20 h, the plates were overlaid with 2xTY containing apramycin sulphate and nalidixic acid and incubation continued at 37 °C. Plasmids with pKC1 139B01 backbone are not able to self- replicate in Streptomycetes at 37 °C and are forced to integrate into the genome. For more details on the screening procedure for conjugants see below.

Culture broth sample extraction and analysis Culture broth (0.9 ml.) were extracted with ethyl acetate (0.9 ml.) in a 2 mL Eppendorf tube. The broth was mixed with the solvent for 15 min on a shaking platform (vibrax) at 400 rpm. The phases are then separated by centrifugation (2 min, 13,200 rpm). An aliquot of the organic layer (0.1 mL) is then transferred to either a clean glass LC-vial or a vial containing 5 μ g of pimecrolimus (as an internal standard for quantification). The solvent is removed in vacuo (3 min) and then re-dissolved in methanol (1 mL) by gentle agitation on a shaking platform (5 min).

Analysis by LCMS

The HPLC system comprised an Agilent HP1 100 equipped with a Hyperclone ODS2,

C18, 3 micron 4.6 ^χ 150 mm column (Phenomonex). Injection volume 10 μί, oven 50°C, A: 0.1 % formic acid, B: 0.1 % formic acid in MeCN. 1 mL/min; 0-1 min 65% B; 6.5 min 100% B; 10 min 100% B; 10.05 min 65% B, 12 min 65% B. The HPLC system described above was coupled to a Bruker Daltonics Esquire3000 electrospray mass spectrometer. Positive-negative switching was used over a scan range of 500 to 1000 Dalton.

Alternatively, LC samples that have been spiked with 0.005 mg/mL pimecrolimus were analysed on the same instrument and with the same chromatographic conditions. However the MS was conducted in multiple reaction monitoring mode (MRM mode) in order to quantify the amount of FK analog in the sample. Details of the quantification are: negative scan mode, m/z = 450-850

MRM setup:

transitions [Da] fragmentation amplitude [V] pimecrolimus (IS): 808.4→ 548.3 1 .15

FK520 790.5→ 548.3 1 .15

FK506 802.4→ 560.3 1 .15 positive scan mode,

MRM setup:

transitions [Da]

pimecrolimus (IS): 827.7→ 774.5

FK506 821 .7→ 768.5 (or 774.6)

7 878.0→ 824.7 8 906.0→ 720.6

9 891 .9→ 720.4

10 906.0→ 720.6

11 850.0→ 796.7 all parent ions are isolated with a width of 3 amu.

All FK520 and FK506 analogues can be quantified in this manner, for example, with the parent ion isolated as [M-H]^" and the transition to 548.2 (for FK520 analogues) or 560.2 (for FK506 analogues) used.

The amount of analyte present is then calculated by dividing the integral for the analyte transition (as detailed above) with that for the internal standard, pimecrolimus. This ratio is then compared with a standard calibration curve for FK520 or FK506 up to 100 ng on column with 50 ng on column pimecrolimus. NMR spectra (¹H, ¹³C, DQF-COSY, HMQC and HMBC) of purified material were recorded on a Bruker Advance DRX500 spectrometer, fitted with a Bruker Avance 500 Cryo Ultrashield, which operated at 500 MHz (for proton derived spectra, pro rata for other nuclei) at 27 °C. Chemical shifts are described in parts per million (ppm) and are referenced to solvent signal e.g. CHCI₃ at δ_Η 7.26 (¹H) and CHCI₃ at δ₀ 77.0 (¹³C). J values are given in Hertz (Hz).

LC-MS analysis of compounds prepared by synthesis: Samples were run on an Agilent 1200 coupled to a single-quad mass spectrometer and separate runs recorded positive and negative MS data. Method A: Xbridge, C18, 3.5 micron 4.6 ^χ 150 mm column (Waters). Oven 40°C, A:

0.1 % formic acid, B: 0.1 % formic acid in MeCN. 1 ml_/min; 0-1 min 65% B; 6.5 min 100% B; 10 min 100% B; 10.05 min 65% B, 12 min 65% B.

Method B: Xbridge, C18, 3.5 micron 4.6 ^χ 150 mm column (Waters). Oven 40°C, A: 0.1 % formic acid, B: 0.1 % formic acid in MeCN. 1 ml_/min; 0-2 min 10% B; 15 min 100% B; 17 min 100% B; 17.1 min 10% B, 20 min 10% B.

Method C: Xbridge, C18, 3.5 micron 4.6 ^χ 50 mm column (Waters). Oven 40°C, A: 0.01 % ammonium hydroxide, B: MeCN. 1 .7 mL/min; 0 min 5% B; 1 .5 min 95% B

LCMS analysis of FK506 and FK520 analogues in biological assays: Samples were run on an API 4000.

Method D: Ultimate AQ-C18 (2.1 x 50mm, 3 micron). A: 0.025%FA/1 mM NH₄OAc/H₂0; B: 0.025%FA/1 mM NH₄OAc/MeOH. 0.4mL/min; 0.2min 10% B; 0.7min 60% B; 1.1 min 60% B; 1.4min 95% B; 2.3min 95% B; 2.4min 10%B, 3.5min 10%B.

Method E: Ultimate AQ-C18 (2.1 x 50mm, 3 micron). A: 0.025%FA/1 mM NH₄OAc/H₂0; B: 0.025%FA/1 mM NH₄OAc/MeOH. 0.4mL/min; 0.2min 20% B; 0.7min 60% B; 1.1 min 60% B; 1.4min 98% B; 2.3min 98% B; 2.4min 20%B, 3.5min stop.

Method F: Ultimate AQ-C 18 (2.1 x 50mm, 3 micron). A: 0.025%FA/1 mM NH₄OAc/H₂0; B: 0.025%FA/1 mM NH₄OAc/MeOH. 0.4mL/min; 0.3min 5% B; 0.5min 95% B; 1.7min 95% B; 1 .8min 5% B; 3.0min stop. Assessment of effect on NFA T gene expression

To assess the effect of compounds on inhibition of the IL-2 pathway, the Invitrogen GENEblazer NFAT gene reporter assay was used (Hanson, 2006; Qureshi, 2007) .

The general process of carrying out the assay was as follows: NFAT-bla Jurkat cells were thawed and resuspended in Assay Media (OPTI-MEM, 0.5% dialyzed FBS, 0.1 mM NEAA, 1 mM Sodium Pyruvate, 100 U/mL/100 g/mL Pen/Strep) to a concentration of 781 ,250 cells/mL. 4 μΙ_ of a 10X serial dilution of the test compounds were added to appropriate wells of a TC-Treated assay plate. 32 μΙ_ of cell suspension was added to the wells and pre- incubated at 37°C/5% C0₂ in a humidified incubator with test compounds for 30 minutes. Anti CD4:CD8 activator at the pre-determined EC80 concentration was added to wells containing the test compounds. The plate was incubated for 5 hours at 37°C/5% C0₂ in a humidified incubator. 8 μΙ_ of 1 μΜ Substrate Loading Solution was added to each well and the plate was incubated for 2 hours at room temperature. The plate was read on a fluorescence plate reader.

Assessment of water solubility

Water solubility may be tested as follows: A 10 mM stock solution of the FK506 or FK520 analogue is prepared in 100% DMSO at room temperature. Triplicate 0.01 mL aliquots are made up to 0.5 mL with either 0.1 M PBS, pH 7.3 solution or 100% DMSO in amber vials. The resulting 0.2 mM solutions are shaken, at room temperature on an IKA® vibrax VXR shaker for 6 h, followed by transfer of the resulting solutions or suspensions into 2 mL Eppendorf tubes and centrifugation for 30 min at 13200 rpm. Aliquots of the supernatant fluid are then analysed by the LCMS method as described above. Assessment of mouse plasma and human blood stability

In general, compounds were dissolved in DMSO, then spiked to a final concentration of 0.1 or 2μΜ into either human whole blood, or murine plasma and incubated at 25°C. Samples were then taken at 0, 0.25, 0.5, 2, 8 and 24 hours after addition, and analysed for levels of compound using LCMS methods described above.

Specific methods were as follows: 40μΙ_ of ultrapure H₂0 were added into a 96-well deep plate (plate A), then kept at 4°C. 10μΙ_ of prewarmed spiking solution B, containing test compound at 10x the necessary concentration in DMSO:MeOH:H₂0 (1 :4.5:4.5, v/v) (eg 100μΙ_ of 0.01 mM test compound in DMSO was added to 900μΙ_ of MeOH:H₂0 (1 :1 ) to give a spiking solution to generate a final test compound concentration in the blood or plasma of 0.1 μΜ) was added to all wells designated for timepoints in another 96 well plate (plate B), this was prewarmed at 37°C for 10 minutes. 90μΙ_ of prewarmed blood or plasma was then added to each of the wells of plate B. Triplicate 40μΙ_ aliquots were then removed immediately for the 0 h timepoint, then sequentially at 0.25, 0.5, 2, 8 and 24 hours after adding the blood or plasma, and transferred to the wells in plate A and mixed. 80μΙ_ of 50% MeOH in dH₂0 was added to each of the wells in plate A, mixed, then 380μΙ_ of pimecrolimus in acetonitrile (100ng/ml_) was added and mixed. Plate A was then kept at -70°C until analysis.

For analysis, plate A was thawed, vortexed for 10 minutes at 300rpm in a shaker, then centrifuged at 4000rpm for 15 minutes. The supernatant was transferred to a new 96-well plate for LC/MS analysis (using method F).

Assessment of cell permeability and efflux

Cell permeability was tested using the BIOCOAT® HTS Caco-2 Assay System developed by BD Biosciences as follows: The test compound was dissolved in DMSO and then diluted further in buffer to produce a final 1 μΜ dosing concentration. The fluorescence marker lucifer yellow was also included to monitor membrane integrity. Test compound was then applied to the apical surface of Caco-2 cell monolayers and compound permeation into the basolateral compartment is measured. This is performed in the reverse direction (basolateral to apical) to investigate active transport. LC-MS/MS was used to quantify levels of both the test and standard control compounds (such as Propanolol and Acebutolol). Standard criteria for compounds to be classified as showing efflux-limited permeability were:

P_app (B→A) / P_app (A→B) > 3, and P_app (B→A) > 1 .0 x 10^"6 cm/s

Assessment of effect on murine cytokine release To look at the effect of compounds on cytokine production from mouse spleen cells, an in vitro murine cytokine release T-cell assay was used. Female BALB/c mice aged between 5 and 8 weeks were obtained from Harlan Olac (Shaw's Farm, Blackthorn, Bicester, Oxon, 0X25 1 TP, England). Animals were sensitised intra-peritoneally (i.p.) with 10C^g OVA in alum on day 0 to skew their immune profiles towards Th2. On day 7 animals were terminated by cervical dislocation and spleens were removed to ice-cold HBSS containing 10% HEPES. Spleens were processed under aseptic conditions to obtain a single cell suspension. Cells were then pooled, washed, the red blood cells lysed and a cell count performed to determine cell numbers and viability. Cells were resuspended at a density of 2x10⁷/ml in RPMI with supplements. Two million cells were removed prior to culture for flow cytometry to assess levels of T and B lymphocytes present. This was determined using fluorescently conjugated antibodies to Thy1 .2 & B220 (CD45R). The remaining cells were cultured in triplicate in 96-well tissue culture plates with inhibitors at 3 concentrations (as determined by client) for 1 hour prior to the addition of OVA to the cultures (final concentration 200μg ml). Test compounds were reconstituted from the powdered form by addition of 100% DMSO to achieve concentrated stock solutions of equivalent molarity, based on the molecular weights provided for each compound. Compounds were then diluted 1 ,000 fold in culture media, resulting in a background level of 0.1 % DMSO in all wells. Subsequent 10-fold dilution of compounds was performed in RPMI/0.1 % DMSO. The final concentrations of test compounds in the wells were 2nM, 0.2nM & 0.02nM. Cells were incubated at a density of 106 per well. Positive control cultures were stimulated with a polyclonal activator of T cells (con A, 5μg ml), in order to confirm the health of the starting population. All cultures were incubated for 72 hours at 37°C, 5% C0₂. Supernatants were then removed and frozen down for subsequent measurement of key cytokines, IL-5 and IL-13, by Luminex.

Culture supernatants were thawed and centrifuged at 1 ,000g for 5 minutes at room temperature. Luminex analysis performed to determine the concentration of IL-5 and IL-13 in each sample. Samples were analysed using multiplex xMAP bead technology. Cytokines were measured according to the manufacturer's instructions. Briefly, aliquots of samples, standards and quality controls were incubated overnight with cytokine antibody-coated capture beads at 4°C in 96 well filter plates. Washed beads were further incubated with biotin-labelled cytokine- specific antibodies for 1 hour at room temperature. Beads were washed to remove excess biotinylated antibody, followed by 30 minute incubation with streptavidin conjugated to PE. After final washing, the mean fluorescence intensity of PE bound to each individual

microsphere was quantified using a Luminex machine (dual laser flow analyzer) and xPonent software (Luminex corporation). A standard curve of quantified recombinant cytokines, ranging from 3.2 - 10,000pg/ml, was used to convert detected PE fluorescence values to cytokine concentrations (pg/ml). All standards were run in duplicate and at least 50 microspheres are analysed per cytokine. The cytokines present in the supernatants taken from spleen cultures were determined in each of the triplicates by comparison to the values observed with the recombinant cytokine standards. The cytokine concentration in each sample and the mean of replicates was noted. Cytokine production from splenocytes after OVA stimulation in vitro was compared in the presence and absence of inhibitors.

Assessment of effect on human PBMC cytokine release

Blood was collected into standard lithium-heparin vacutainers from one healthy donor and subsequently diluted 1 :5 with RPMI media. The donor was not atopic and was not receiving any medication.

PBMCs were separated from whole blood using the AccuSpin System utilising

Histopaque 1077 (Sigma). Following the appropriate washing steps, PBMCs were counted and then divided into relevant fractions for CD3/CD28 stimulation. Compounds were dissolved in DMSO, and diluted further in RPMI media to the working concentration. Final DMSO in the assay was 0.1 % in all samples.

Two 96 well plates were coated with 0^g per well anti-CD3 antibody (clone UCHT1 , Calbiochem) at 4°C overnight with the exception of wells for unstimulated controls. After washing off unbound anti-CD3 antibody, 20μΙ of compound or medium containing DMSO was added to the plates. PBMCs were diluted in RPMI containing 10% dialysed FBS to yield a concentration of 100,000 cells per 180μΙ. For unstimulated control wells, 180μΙ of cell suspension was added to relevant wells. To the remaining cell suspension, anti-CD28 antibody (Calbiochem) was added to yield a final concentration of 2μg ml in the assay and 180μΙ of this cell suspension was immediately added to the plates.

The plates were then placed in a humidified 37°C incubator for 24 hours. At this time, the plates were centrifuged at 400 x g for 5 minutes and 100μΙ supernatant transferred to clean 96 well plates. Supernatants were frozen rapidly at -80oC and stored until required for cytokine analysis by Bio-Plex assay.

Levels of cytokines were analysed by means of a Human Th1/Th2 multiplex assay kit (Bio-Rad) utilising a Bioplex platform. Cell supernatants were thawed on ice before being added directly to the assay plate. The cytokine analysis was carried out as per manufacture's instructions. Standard curves and quantification of samples were generated using Bioplex Manager software (BioRad). Assessment of Pgp efflux There are many methods which may be employed to investigate the rates of efflux by drug transporters such as Pgp. Many of these are reviewed in Szakacs et al., 2008 and

Hegedus et al., 2009, and include ATPase assays. Assessment of CyP450 metabolism and inhibition

CyP450 metabolism and inhibition may be analysed by incubating compounds of interest with isolated hepatocytes, microsomes or isolated CyP450 enzymes, then measuring rate of metabolism of the test compound over a short period of time, such as 0-60 minutes, or using a fluorometric inhibition assay or microsomal inhibition assay to measure P450 inhibition (see Yan and Caldwell, 2001 ).

In vivo assessment of pharmacokinetics

In vivo assays may also be used to measure the bioavailability of a compound.

Generally, a compound is administered to a test animal (e.g. mouse) both intravenously (i.v.) and orally (p.o.) and blood samples are taken at regular intervals to examine how the plasma (or whole blood) concentration of the drug varies over time. Alternatively, the compounds may be dosed by aerosol using a nebulizer. The time course of plasma (or whole blood)

concentration over time can be used to calculate the PK parameters (using software such as Kinetica, Thermo Scientific) such as absolute bioavailability of the compound as a percentage using standard models.

In vivo assessment of oral and intravenous pharmacokinetics

For FK506 and FK520 analogues, whole blood was analysed. Compounds were formulated in 5% ethanol / 5% cremophor EL / 90% saline for both p.o. and i.v. administration. Groups of 3 male CD1 mice were dosed with either 1 mg/kg i.v. or 10mg/kg p.o. Blood samples (40μΙ_) were taken via saphenous vein, pre-dose and at 0.25, 0.5, 2, 8, and 24 hours, and diluted with an equal amount of dH₂0 and put on dry ice immediately. Samples were stored at - 70°C until analysis. The concentration of the compound of the invention or parent compound in the sample was determined via LCMS as follows:20 μΙ_ of blood:H₂0 (1 :1 , v/v)/PK sample was added with 20 μΙ_ Internal standard (pimecrolimus) at 100 ng/mL, 20 μΙ_ working solution/MeOH and 150 μΙ_ of ACN, vortexed for 1 minute at 1500 rpm, and centrifuged at 12000 rpm for 5 min. The supernatant was then injected into LC-MS/MS. The time-course of blood concentrations was plotted and used to derive area under the whole blood concentration-time curve (AUC - which is directly proportional to the total amount of unchanged drug that reaches the systemic circulation). These values were used to generate the oral bioavailability (F%) and other PK parameters where possible. Where possible, the levels of the presumed primary metabolite, 11 , were analysed.

In vivo assessment of aerosol pharmacokinetics

For FK506 and FK520 analogues, whole blood was analysed. Compounds were formulated in 100% ethanol for aerosol administration. Mice were dosed 20mg over 10 minutes to groups of 9 animals in a chamber using a nebulizer. At 0.25, 0.5, 2, 8, and 24 hours, three mice per timepoint were euthanized under anaesthesia with isofulrane. The animals were placed on ice and the chest cavity opened immediately to expose heart and lung. 100μΙ_ of blood sample was collected from each animal by cardial puncture into K₂EDTA tubes. This blood sample was diluted with the same volume of diH₂0 and put on dry ice immediately. After collection of the blood sample, lung tissue was rapidly collected, washed with cold saline, dried, weighed and snap frozen with dry ice. The whole process was completed in 2 minutes. Blood and lung samples were then stored at -70°C until analysis.

For analysis, lung tissue was homogenized for 2 min with 3 volumes (v/w) of

homogenizing solution (PBS: ACN=1 :9). 40 μΙ_ of blank blood:H₂0 (1 :1 , v/v)/lung

homogenate/unknown PK sample was added to 30 μΙ_ internal standard (pimecrolimus,100 ng/mL), 40 μΙ_ of working solution/MeOH and 160 μΙ_ of ACN, vortexed for 1 min at 1500 rpm, and centrifuged at 12000 rpm for 5 min. The supernatant was diluted with MeOH (1 :1 , v/v), vortexed and then injected into the LC-MS/MS system. Blood samples were prepared for analysis as described for intravenous and oral pharmacokinetics. The concentration of the relevant compound/s in the lung and blood samples was then determined via LCMS (see materials and methods, using LCMS methods D or E). The time-course of lung and blood concentrations was plotted and used to derive area under the whole blood concentration-time curve (AUC - which is directly proportional to the total amount of unchanged drug that reaches the systemic circulation). These values were used to generate the ratio of lung concentration to blood concentration. Where possible, the levels of the presumed primary metabolite, 11 , were also analysed.

Example 1 - Generation of a Streptomyces hygroscopicus subsp. hygroscopicus strain in which the fkbO gene has been inactivated by introducing a small deletion inducing a frameshift.

1 .1 Cloning of DNA homologous to the upstream flanking region of fkbO disruption.

Oligos SG165 (SEQ ID NO: 1 ) and SG166 (SEQ ID NO: 2) were used to amplify a 1727 bp region of DNA, aesFK520A (SEQ ID NO: 10) from Streptomyces hygroscopicus subsp. hygroscopicus (DSM 40822) in a standard PCR reaction (Sambrook and Russell, 2001 ) using genomic DNA (Kieser et al., 2000) as the template and hot start KOD DNA polymerase. A 5' extension was designed in each oligo to include the restriction sites present in the genomic sequence to aid cloning of the amplified fragment (Figure 1 ). This 1727 bp fragment was cloned into pUC19 that had been linearised with Sma\, resulting in plasmid pAESA5 and the insert verified by sequencing.

SG165 CCAGATCTCGTCGGGCACCTTGAAGTAGGCGAGCCG

(SEQ ID NO: 1 )

SG166 CCCTCGAGGTCCGGTGATCCGGTCTTCTCGAAGC

Xho\

(SEQ ID NO: 2)

1 .2 Cloning of DNA homologous to the downstream flanking region of fkbO disruption.

Oligos SG167 (SEQ ID NO: 3) and SG168 (SEQ ID NO: 4) were used to amplify a 2034 bp region of DNA, termed aesFK520B (SEQ ID NO: 1 1 ) from Streptomyces hygroscopicus subsp. hygroscopicus (DSM 40822) in a standard PCR reaction (Sambrook and Russell, 2001 ) using genomic DNA (Kieser et al., 2000) as the template and hot start KOD DNA polymerase. A 5' extension was designed in oligo SG167 to introduce the restriction site to aid cloning of the amplified fragment (Figure 1 ) and SG168 included the restriction site present in the genomic sequence. This 2034 bp fragment was cloned into pUC19 that had been linearised with Sma\, resulting in plasmid pAESBI and the insert verified by sequencing.

SG167 CCCTCGAGCGCACAGCGCCCTGTCGAGTCCGGCATG

Xho\

(SEQ ID NO: 3)

SG168 CCGAATTCGAGGTCGAAGCGGGTGAACCAGCGTC

EcoRI

(SEQ ID NO: 4)

The -1 .7 kb Bgl\\IXho\ fragment from pAESA5 and -2.0 kb Xho\IEcoR\ fragment from pAESBI were cloned into the -5.9 kb Bgl\\/EcoR\ fragment of pKC1 139 (Bierman et al., 1992) to make pAESABI . pAESABI therefore contained the upstream and downstream regions such that the double crossover event would result in the desired small deletion, introducing a frameshift in the fkbO gene.

1 .3 Transformation of Streptomyces hygroscopicus subsp. hygroscopicus

Escherichia coli ET12567, harbouring the plasmid pUZ8002, was transformed with pAESABI by electroporation to generate the E. coli donor strain for conjugation. This strain was used to transform Streptomyces hygroscopicus subsp. hygroscopicus (DSM 40822) by spore conjugation (as described in Materials and Methods). Exconjugants were plated on R6 agar and incubated at 28°C. pAESABI is able to self-replicate in Streptomyces hygroscopicus subsp. hygroscopicus (DSM 40822) at 28°C. Transformants were subcultured onto MAM plates with apramycin (0.050 mg/mL) at 28°C to ensure the pAESABI plasmid with resistance marker was present. Subculturing to allow secondary recombination was carried out as follows: the transformants were subcultured again on to MAM plates with apramycin at 37°C to induce the plasmid to integrate, as the plasmid cannot self-replicate at 37°C. The transformants were then subcultured for four subsequent rounds at 37°C on MAM plates with no antibiotic. The transformants from the fourth subculture on antibiotic free plates were plated for spore harvest on ISP3 medium at 28°C. Serial dilutions were made from the filtered collected spores and were plated on MAM plates to achieve single colonies.

1 .4 Screening for secondary crosses

Single colonies were patched in duplicate onto MAM supplemented with 0.050 mg/mL apramycin and MAM containing no antibiotics, and grown at 28 ^°C for 3-4 days. Patches that grew on the no antibiotic plate but did not grow on the apramycin plate were screened to test if the desired double recombination effect had occurred. A 6 mm circular plug from each patch that had lost the marker was used to inoculate individual 50 mL falcon tubes containing 7 mL FK seed medium (See Media Recipes) without antibiotics and grown for 2 days at 28°C, 300 rpm with a 1 inch throw. These were then used to inoculate (0.5 mL into 7 mL - 7% inoculum) FK production medium (See Media Recipes) in a 50 mL falcon tube at 28°C, 300 rpm with a 1 inch throw. After 24 hours, each falcon tube was fed with 0.050 mL 0.32 M A-trans- hydroxycyclohexane carboxylic acid to give a final concentration of 2.12 mM acid and shaking incubation was continued as before. The cultures were sampled after 6 days growth and analysed by LC-MS, using the methods described above.

14 out of 79 apramycin sensitive strains tested had undergone the desired recombination event to give the disruption of the fkbO gene. These strains produced a metabolite that was 30 amu less than FK520 itself. This compound was shown to be 31 - desmethoxyFK520 following isolation and characterisation of that compound. One strain was ultimately selected, designated "AB5-10". This strain was later renamed "BIOT-4131 ".

Example 2 - Generation of a Streptomyces hygroscopicus subsp. hygroscopicus strain in which the fkbO gene has been inactivated by introducing a large in-frame deletion. 2.1 Cloning of DNA homologous to the upstream flanking region of fkbO disruption.

Oligos SG165 (SEQ ID NO: 1 ) and SG166 (SEQ ID NO: 2) were used to amplify a 1727 bp region of DNA, termed aesFK520A (SEQ ID NO: 10) from Streptomyces hygroscopicus subsp. hygroscopicus (DSM 40822) in a standard PCR reaction (Sambrook and Russell, 2001 ) using genomic DNA (Kieser et al. 2000) as the template and hot start KOD DNA polymerase. A 5' extension was designed in each oligo to include the restriction sites present in the genomic sequence to aid cloning of the amplified fragment (Figure 2). This 1727 bp fragment was cloned into pUC19 that had been linearised with Sma\, resulting in plasmid pAESA5 and the insert verified by sequencing.

SG165 CCAGATCTCGTCGGGCACCTTGAAGTAGGCGAGCCG

fig/i I

(SEQ ID NO: 1 )

SG166 CCCTCGAGGTCCGGTGATCCGGTCTTCTCGAAGC

Xho\

(SEQ ID NO: 2)

2.2 Cloning of DNA homologous to the downstream flanking region of fkbO disruption.

Oligos SG169 (SEQ ID NO: 5) and SG168 (SEQ ID NO: 6) were used to amplify a 1460 bp region of DNA, termed aesFK520C (SEQ ID NO: 12) from Streptomyces hygroscopicus subsp. hygroscopicus (DSM 40822) in a standard PCR reaction (Sambrook and Russell, 2001 ) using genomic DNA (Kieser et al., 2000) as the template and hot start KOD DNA polymerase. A 5' extension was designed in oligo SG169 to introduce the restriction site to aid cloning of the amplified fragment (Figure 2) and SG168 included the restriction site present in the genomic sequence. This 1460 bp fragment was cloned into pUC19 that had been linearised with Sma\, resulting in plasmid pAESC8 and the insert verified by sequencing.

SG169 CCCTCGAGAACATGGCCCGGGTCATCGGCGCGG

Xho\

(SEQ ID NO: 5)

SG168 CCGAATTCGAGGTCGAAGCGGGTGAACCAGCGTC

EcoRI

(SEQ ID NO: 4)

The -1 .7 kb Bgl\\/Xho\ fragment from pAESA5 and -1 .5 kb Xho\/EcoR\ fragment from pAESBI were cloned into the -5.9 kb Bgl\\IEcoR\ fragment of pKC1 139 (Bierman et al., 1992) to make pAESAC4. pAESAC4 therefore contained the upstream and downstream regions such that the double crossover event would result in the desired large deletion of the fkbO gene. 2.3 Transformation of Streptomyces hygroscopicus subsp. hygroscopicus

Escherichia coli ET12567, harbouring the plasmid pUZ8002, was transformed with pAESAC4 by electroporation to generate the E. coli donor strain for conjugation. This strain was used to transform Streptomyces hygroscopicus subsp. hygroscopicus (DSM 40822) by spore conjugation (as described in Materials and methods). Exconjugants were plated on R6 agar and incubated at 28°C. pAESAC4 is able to self-replicate in Streptomyces hygroscopicus subsp. hygroscopicus (DSM 40822) at 28°C. Transformants were subcultured onto MAM plates with apramycin (0.050 mg/mL) at 28°C to ensure the pAESAC4 plasmid with resistance marker was present. Subculturing to allow secondary recombination was carried out as follows: the transformants were subcultured on to MAM plates with apramycin at 37°C to induce the plasmid to integrate, as the plasmid cannot self-replicate at 37°C. The transformants were then subcultured for four subsequent rounds at 37°C on MAM plates with no antibiotic. The transformants from the fourth subculture on antibiotic free plates were plated for spore harvest on ISP3 medium at 28°C. Serial dilutions were made from the filtered collected spores and were plated on MAM plates to achieve single colonies.

2.4 Screening for secondary crosses

Single colonies were patched in duplicate onto MAM supplemented with 0.050 mg/mL apramycin and MAM containing no antibiotics, and grown at 28 ^°C for 3-4 days. Patches that grew on the no antibiotic plate but did not grow on the apramycin plate were screened to test if the desired double recombination effect had occurred. A 6 mm circular plug from each patch that had lost the marker was used to inoculate individual 50 mL falcon tubes containing 7 mL FK seed medium (See Media Recipes) without antibiotics and grown for 2 days at 28°C, 300 rpm with a 1 inch throw. These were then used to inoculate (0.5 mL into 7 mL - 7% inoculum) FK production medium (See Media Recipes) in a 50 mL falcon tube at 28°C, 300 rpm with a 1 inch throw. After 24 hours, each falcon tube was fed with 0.050 mL 0.32 M 4-irans-hydroxy cyclohexane carboxylic acid to give a final concentration of 2.12 mM acid and shaking incubation was continued as before. The cultures were sampled after 6 days growth and analysed by LC-MS using the methods described above.

15 out of 59 apramycin sensitive strains tested had undergone the desired recombination event to give the disruption of the fkbO gene. When fed as described above these strains produced a metabolite that was 30 amu less than FK520 itself. This compound was shown to be 31 -desmethoxyFK520 by comparison with isolated and charaterised material. One of these strains was designated as "AC1 -5" and later renamed to BIOT-4132. Example 3 - Generation of a Streptomyces tsukubaensis strain in which the fkbO gene has been inactivated by introducing a small deletion inducing a frameshift.

3.1 Cloning of DNA homologous to the upstream flanking region of fkbO disruption.

Oligos AES43 (SEQ ID NO: 6) and AES40 (SEQ ID NO: 7) were used to amplify a 2057 bp region of DNA, termed aesFK506D1 1 (SEQ ID NO: 13) from Streptomyces tsukubaensis no. 9993 (FERM BP-927) in a standard PCR reaction (Sambrook and Russell, 2001 ) using genomic DNA (Kieser et al., 2000) as the template and hot start KOD DNA polymerase. A 5' extension was designed in each oligo to introduce the restriction sites to aid cloning of the amplified fragment (Figure 3). This 2057 bp fragment was cloned into pUC19 that had been linearised with Sma\, resulting in plasmid pAES8 and the insert verified by sequencing.

AES43 CCAAGCTTGAGCGCCTCGTCCCAGAGCGCGGCCTGGTC

Hind\\\

(SEQ ID NO: 6)

AES40 CCATGCATCGGGACACCGTCCGTGAGCGACACCTCGGCATGACC

Λ/s/^'l

(SEQ ID NO: 7) 3.2 Cloning of DNA homologous to the downstream flanking region of fkbO disruption.

Oligos AES41 (SEQ ID NO: 8) and AES42 (SEQ ID NO: 9) were used to amplify a 1985 bp region of DNA, termed aesFK506E3 (SEQ ID NO: 14) from Streptomyces tsukubaensis no. 9993 (FERM BP-927) in a standard PCR reaction (Sambrook and Russell, 2001 ) using genomic DNA (Kieser et al., 2000) as the template and hot start KOD DNA polymerase. A 5' extension was designed in each oligo to introduce the restriction sites to aid cloning of the amplified fragment (Figure 3). This 1985 bp fragment was cloned into pUC19 that had been linearised with Sma\, resulting in plasmid pAES9 and the insert verified by sequencing.

AES41 CCATGCATCCGATGCCGTCGCGGCGCTCTACACGCGGG

Λ/s/^'l

(SEQ ID NO: 8)

AES42 CCAGATCTGAAGGGCTCGGCGGTCACACCGGGCAGCGC

fig/i I

(SEQ ID NO: 9)

The -2.0 kb Hind\\\/Nsi\ fragment from pAES8 and -2.0 kb NsiUBglW I fragment from pAES9 were cloned into the -6.0 kb H/ndlll/Sg/ll fragment of pKC1 139 (Bierman et al., 1992) to make pAES10. pAES10 therefore contained the upstream and downstream regions such that the double crossover event would result in the desired small deletion, introducing a frameshift in the fkbO gene. 3.3 Transformation of Streptomyces tsukubaensis

Escherichia coli ET12567, harbouring the plasmid pUZ8002, was transformed with pAESI O by electroporation to generate the E. coli donor strain for conjugation. This strain was used to transform Streptomyces tsukubaensis no. 9993 (FERM BP-927) by spore conjugation (as described in Materials and methods). Exconjugants were plated on R6 agar and incubated at 37°C. pAESI O is not able to self-replicate in Streptomyces tsukubaensis no. 9993 (FERM BP-927) at 37°C and must integrate into the genome. Transformants were subcultured onto MAM plates with apramycin (0.050 mg/mL) at 37°C two to three times, to ensure that the pAESI O plasmid with resistance marker had integrated. Subculturing to allow secondary recombination was carried out as follows: the transformants were subcultured for two subsequent rounds at 37°C on MAM plates with no antibiotic and then a final time at 28°C. The transformants from the fourth subculture on antibiotic free plates were plated for spore harvest on ISP4 medium at 28°C. Serial dilutions were made from the filtered collected spores and plated on ISP4 plates at 28°C to achieve single colonies.

3.4 Screening for secondary crosses

Single colonies were patched in duplicate onto ISP4 supplemented with 0.050 mg/mL apramycin and ISP4 containing no antibiotics, and grown at 28 ^°C for 3-4 days. Patches that grew on the no antibiotic plate but did not grow on the apramycin plate were screened to test if the desired double recombination effect had occurred. A 6 mm circular plug from each patch that had lost the marker was used to inoculate individual 50 mL falcon tubes containing 7 mL NGY (See Media Recipes) without antibiotics and grown for 2 days at 28°C, 300 rpm with a 1 inch throw. These were then used to inoculate (0.5 mL into 7 mL - 7% inoculum) PYDG+MES (See Media Recipes) in a 50 mL falcon tube at 28°C, 300 rpm with a 1 inch throw. After 24 hours, each falcon tube was fed with 0.050 mL 0.32 M 4-irans-hydroxy cyclohexane carboxylic acid to give a final concentration of 2.12 mM acid and shaking incubation will be continued as before. The cultures were sampled after 6 days growth and analysed by LC-MS by the methods described above. Of the 93 patches that were screened, 49 had undergone the desired double recombination event. One of these strains was designated BIOT-4254.

Example 4 - Isolation of 5 (31 -desmethoxy FK506)

Spore stocks of BIOT-4254 were recovered onto plates of ISP4 medium and incubated for 2 weeks at 28°C. Vegetative cultures (seed culture) were prepared by adding 0.2 ml of BIOT-4254 working stock and inoculating into 400 ml NGY medium in 2 litre Erlenmeyer flasks with a foam bung. Cultivation was carried out for 48 hours at 28°C, 250 rpm (2.5 cm throw). The entire seed culture in one flask was transferred into 15 litres of medium PYDG pre- adjusted at pH 7.0 in 22 L Braun Biostat Fermentors. The fermentation was carried out at 28 °C, with starting agitation at 200 rpm, aeration rate at 0.5 VA /M (7.5 SL/min) and dissolved oxygen (DO) level controlled with the agitation cascade at 30% air saturation. At 24 hours post- inoculation 5ml of 0.2 M irans-4-hydroxycyclohexanecarboxylic acid in methanol was added to the vessel. After 24 hours post inoculation the aeration rate was increased to 0.7 V/V/M (10.5 litres/min) and control ph 6.4 ± 0.8 with 1 .0M NaOH and 0.5 M H₂S0₄. The culture was harvested after 93 hours post-inoculation.

The broths were combined and the cells harvested by centrifugation. The cells were extracted with EtOAc/MeOH (50:50) and the organics were dried in vacuo to yield a crude extract (19.5 g). The extract was subjected to normal phase column chromatography (on Silica Gel 60 (40 x 2.5 cm)) eluted with CHCI₃/MeOH (from 100:0 to 95:5 in incremental changes). Fractions containing the target compound were combined and reduced in vacuo. The enriched extract was then subjected to normal phase column chromatography (on Silica Gel 60 (25 x 2 cm)) eluted with 50:50 Hexane and EtOAc. Fractions containing the target compound were combined and taken to dryness, to yield the target compound as an off-white solid (667 mg)

Example 5 - Isolation of 6 (31 -desmethoxy FK520)

Spore stocks of BIOT-4131 were recovered onto plates of MAM medium and incubated for 5 days at 28°C. Vegetative cultures (seed culture) were prepared by removing 4 agar plugs (5 mm in diameter) from the MAM plate and inoculating into 250 ml FK seed medium in 2 litre Erlenmeyer flasks with foam bung. Cultivation was carried out for 50 hours at 28°C, 250 rpm (2.5 cm throw). The entire seed culture in one flask was transferred into 5 litres of FK production medium (pre-sterilisation pH adjusted at pH 6.4) in 7 L Applikon Fermentor. The fermentation was carried out at 28 °C, with starting agitation at 350 RPM, aeration rate at 0.5 V/V/M (2.5 SL/min) and dissolved oxygen (DO) level controlled with the agitation cascade at 30% air saturation. At 24 hours post-inoculation 5 ml from a 2M stock solution of trans-4- hydroxycyclohexane carboxylic acid in methanol was added to the vessel. The culture was harvested after 1 16 hours post-inoculation.

A second fermentation batch was run as above except: NGY seed medium, PYDG production medium (pre-sterilisation pH adjusted at pH 7.0) and harvested after 1 17 hours. The combined broths were extracted with ethyl acetate (2 x 1 volume equivalent) and the resultant organics reduced in vacuo to a crude extract (16 g). This extract was dissolved in acetonitrile (1000 ml) and silica added (30 g). The solvent was removed in vacuo and the adsorbed silica added to the top of a packed silica column (170 mm x 55 mm diameter). The column was eluted with ethyl actate / hexanes (1 :2, 0.9 L; 1 :1 , 1 L; 3:2, 1 L; 2:1 , 1.8 L) and fractions containing the target compound combined and taken to dryness (190 mg). This enriched extract was then purified by preparative HPLC over C18 to yield the target compound (37 mg).

Example 6 - Preparation of Λ/,Λ/'-ditosylhydrazine

To a mixture of p-toluenesulfonyl hydrazide (9.32 g, 50 mmol) and p-toluenesulfonyl chloride (14.3 g, 75 mmol) in CH₂CI₂ (50 ml) was added pyridine (6 ml, 75 mmol). The mixture was stirred for 1.5 h at room temperature. Et₂0 (200 ml) and H₂0 (100 ml) were added and stirred at 0 ^°C for 15 min. The mixture was filtered, and washed with Et₂0. The solid was recrystallized from CH₃OH to give Λ/,Λ/'-ditosylhydrazine as a white solid (1 1.5 g, 68% yield).

Example 7 - Synthesis of 7

To a solution of 5 (150 mg, 0.19 mmol) and rhodium acetate dimer (2.2 mg, 0.0038 mmol) in CH₂CI₂ (3 ml) was added dropwise a solution of ethyl diazoacetate (21 μΙ, 0.19 mmol) in CH₂CI₂ (1 ml) at 30 ^°C under N₂. After the addition was completed, the reaction was stirred for 30 min at 30 ^°C and then additional ethyl diazoacetate (42 μΙ, 0.38 mmol) in CH₂CI₂ (2 ml) was added dropwise. After the addition, stirring was continued at 30 ^°C for 30 min under N_2. Then the solvent was removed in vacuo and the residue was purified by preparative TLC (petroleum ether / acetone =3:1 ) to give 7 as a white solid (85 mg, 51 % yield) (see figure 1 for NMR). LCMS data (method A): retention time = 7.8 minutes, [M+Na]⁺ = 882.5.

Example 8 - Synthesis of 8

8.1 The preparation of intermediate n-butyl diazoacetate

To a solution of butanol (2.8 ml, 30 mmol) in CH₂CI₂ (30 ml) was added Et₃N (14 ml, 60 mmol). Bromoacetyl bromide (3.9 ml, 45 mmol) was added dropwise at 0 ^°C . The mixture was stirred for 30 min at room temperature, and then water was added, and extracted with CH₂CI_2. The combined organic extracts were washed with NaHC0₃ and brine, dried (Na₂S0₄), filtered and concentrated to give butyl 2-bromoacetate as a brown oil (5.9 g) which was used without further purification.

Butyl 2-bromoacetate (0.98 g, 5 mmol) and Ν,Ν'-ditosyl hydrazine (3.4 g, 10 mmol, see example 6) were dissolved in THF (25 ml) and cooled to 0 ^°C . DBU (3.7 ml, 25 mmol) was added dropwise and the mixture was stirred for 30 min at room temperature, then quenched by the addition of saturated NaHC0₃ solution, and extracted with Et₂0. The combined organic extracts were washed with water and brine, dried (Na₂S0₄), filtered and concentrated to give a residue which was purified by flash chromatography (petroleum ether / ethyl acetate =10:1 ) to give n-butyl diazoacetate as a yellow oil (0.4 g, 57% yield).

8.2 The preparation of 8

A stirred solution of 5 (100 mg, 0.13 mmol) in CH₂CI₂ (2 ml) containing rhodium acetate dimer (1 .5 mg, 0.0026 mmol) under N₂ was heated to 30 ^°C , while n-butyl diazoacetate (18 mg, 0.13 mmol) in CH₂CI₂ (1 ml) was added dropwise. After the addition was completed, the reaction was stirred for 30 min at 30 ^°C and additional n-butyl diazoacetate (37 mg, 0.26 mmol) in CH₂CI₂ (2 ml) was added dropwise. Stirring was continued at 30 ^°C for 30 min under N₂ after the addition was completed_. The solvent was removed in vacuo and the residue was purified by preparative TLC (petroleum ether / acetone =3:1 ) to give 8 as a white solid (45 mg, 39% yield) (see figure 2 for NMR).

LCMS data (method B): retention time = 17.5 minutes, [M+Na]⁺ = 910.5. Example 9 - Synthesis of 9

9.1 The preparation of intermediate isopropyl diazoacetate

To a solution of 'PrOH (2.3 ml, 30 mmol) in CH₂CI₂ (30 ml) was added Et₃N (14 ml, 60 mmol). Bromoacetyl bromide (3.9 ml, 45 mmol) was added dropwise at 0 ^°C . The mixture was stirred for 30 min at room temperature, and then water was added, and extracted with CH₂CI_2. The combined organic extracts were washed with NaHC0₃ and brine, dried (Na₂S0₄), filtered and concentrated to give isopropyl 2-bromoacetate as a brown oil (5.9 g) which was used without further purification.

Isopropyl 2-bromoacetate (0.91 g, 5 mmol) and Ν,Ν'-ditosyl hydrazine (3.4 g, 10 mmol; see example 6) were dissolved in THF (25 ml) and cooled to 0 ^°C . DBU (3.7 ml, 25 mmol) was added dropwise and the mixture was stirred for 30 min at room temperature. The reaction was quenched by the addition of saturated NaHC0₃ solution, and extracted with Et₂0. The combined organic extracts were washed with water and brine, dried (Na₂S0₄), filtered and concentrated to give a residue which was purified by flash chromatography (petroleum ether / ethyl acetate =10:1 ) to give isopropyl diazoacetate as a yellow oil (0.3 g, 47 % yield).

9.2 The preparation of 9

A stirred solution of 5 (100 mg, 0.13mmol) in CH₂CI₂ (2 ml) containing rhodium acetate dimer (1.5 mg, 0.0026 mmol) under N₂ was heated to 30 ^°C, while isopropyl diazoacetate (20 mg, 0.13 mmol) in CH₂CI₂ (1 ml) was added dropwise. After the addition was completed, the reaction was stirred for 30 min at 30 ^°C and additional isopropyl diazoacetate (40 mg, 0.26 mmol) in CH₂CI₂ (2 ml) was added dropwise. Stirring was continued at 30 ^°C under N₂for 30 min after addition was completed. The solvent was removed in vacuo and the residue was purified by preparative TLC (petroleum ether / acetone =3:1 ) to give 9 as a yellow oil (50 mg, 44 % yield) (see figure 3 for NMR)..

LCMS data (method A): retention time = 8.0 minutes, [M+Na]⁺ = 896.5 Example 10 - Synthesis

10

10.1 The preparation of isobutyl diazoacetate

To a solution of isobutyl alcohol (2.75 ml, 30 mmol) in CH₂CI₂ (30 ml) was added Et₃N (14 ml, 60 mmol). The bromoacetyl bromide (3.9 ml, 45 mmol) was added dropwise at 0 ^°C. The mixture was stirred for 30 min at room temperature, water was added, and extracted with

CH₂CI_2. The combined organic extracts were washed with NaHC0₃ and brine, dried (Na₂S0₄), filtered and concentrated to give isobutyl 2-bromoacetate as a brown oil (6 g) which was used without further purification.

Isobutyl 2-bromoacetate (0.195 g, 1 mmol) and Ν,Ν'-ditosyl hydrazine (0.68 g, 2 mmol, see example 6) were dissolved in THF (5 ml) and cooled to 0 ^°C. DBU (0.74 ml, 5 mmol) was added dropwise and the mixture was stirred for 30 min at room temperature. The reaction was quenched by the addition of saturated NaHC0₃ solution, and extracted with Et₂0. The combined extracts were washed with water and brine, dried (Na₂S0₄), filtered and concentrated to give a residue which was purified by flash chromatography (petroleum ether / ethyl acetate =10:1 ) to give isobutyl diazoacetate as a yellow oil (78 mg, 55% yield).

10.2 Preparation of 10

A stirred solution of 5 (1 10 mg, 0.141 mmol) in CH₂CI₂ (2 ml) containing rhodium acetate dimer (1.5 mg, 0.0026 mmol) under N₂ was heated to 30 ^°C, while isobutyl diazoacetate (20 mg, 0.141 mmol) in CH₂CI₂ (1 ml) was added dropwise. After the addition was completed, the reaction was stirred for 30 min at 30 ^°C and additional isobutyl diazoacetate (40 mg, 0.282 mmol) in CH₂CI₂ (2 ml) was added dropwise. Stirring was continued at 30 ^°C under N₂for 30 min after the addition was completed_. The solvent was removed in vacuo and the residue was purified by preparative TLC (petroleum ether / acetone =3:1 ) to give 10 as a yellow oil (28 mg, 22% yield) (see figure 4 for NMR)..

LCMS data (method B): retention time = 17.0 minutes, [M+Na]⁺ = 910.4

Example 11 - preparation of 11

TAS-F

DMF, rt

11.1 The preparation of 2-(trimethylsilyl)ethyl diazoacetate

To a solution of 2-(trimethylsilyl)ethanol (4.3 ml, 30 mmol) in CH₂CI₂ (30 ml) was added Et₃N (14 ml, 60 mmol). Bromoacetyl bromide (3.9 ml, 45 mmol) was added dropwise at 0 ^°C. The mixture was stirred for 30 min at room temperature, and then water was added, and extracted with CH₂CI_2. The combined organic extracts were washed with NaHC0₃ and brine, dried (Na₂S0₄), filtered and concentrated to give 2-(trimethylsilyl)ethyl 2-bromoacetate as a brown oil (7.2 g) which was used without further purification.

2-(trimethylsilyl)ethyl 2-bromoacetate (1 .2 g, 5 mmol) and Ν,Ν'-ditosyl hydrazine (3.4 g, 10 mmol, see example 6) were dissolved in THF (25 ml) and cooled to 0 ^°C . DBU (3.7 ml, 25 mmol) was added dropwise and the mixture was stirred for 30 min at room temperature. The reaction was quenched by the addition of saturated NaHC0₃ solution, and extracted with Et₂0. The combined extracts were washed with water and brine, dried (Na₂S0₄), filtered and concentrated to give a residue which was purified by flash chromatography (petroleum ether / ethyl acetate =10:1 ) to give 2-(trimethylsilyl)ethyl diazoacetate as a yellow oil (0.55 g, 59% yield).

11.2 Synthesis of 11

To a stirred solution of 5 (100 mg, 0.13 mmol) and rhodium acetate dimer (1 .5 mg, 0.0026 mmol) in CH₂CI₂ (2 ml) was added dropwise 2-(trimethylsilyl)ethyl diazoacetate (24 mg, 0.13 mmol) in CH₂CI₂ (1 ml) at 30 ^°C under N₂. After the addition was completed, the reaction was stirred for 30 min at 30 ^°C , then additional 2-(trimethylsilyl)ethyl diazoacetate (48 mg, 0.26 mmol) in CH₂CI₂ (2 ml) was added dropwise and stirring was continued for 30 min at 30 ^°C under N_2. The solvent was removed in vacuo and the residue was purified by preparative TLC (petroleum ether / acetone =3:1 ) to give a yellow oil (60 mg). To a solution of this yellow oil (30 mg, 0.032 mmol) in DMF (1 ml) was added tris(dimethylamino)sulfonium

difluorotrimethylsilicate (35 mg, 0.129 mmol). The resulting solution was stirred overnight, then partitioned between NaH₂P0₄ (1 M, 5 ml) and Et₂0 (10 ml). The organic phase was washed with Na₂HP0₄ (1 .0 M, 2 x 3 ml), dried over sodium sulfate, filtered and concentrated to afford a light yellow oil. The crude acid was purified by preparative-TLC (DCM: i-PrOH=20 ml: 1 ml, 2 drops AcOH) to give pure 11 (17 mg) (see figure 5 for NMR)..

LCMS data (method C): retention time = 1 .27 minutes, [M+Na]⁺ = 849.3

Example 12 - Biological data - NFAT gene reporter

To assess direct effect of the compounds on inhibition of the IL-2 pathway, the Invitrogen GENEblazer NFAT gene reporter assay was used as described in the materials and methods. IC50 values are displayed in table 1 for all compounds tested, the limits of ranges are shown.

Table 1.

Example 13 - Biological data - inhibition of murine cytokine release

To assess effect of the compounds on inhibition of the asthma-relevant cytokines, such as

IL-5 and IL-13, a mouse spleen cytokine release assay was used, as described in the materials and methods.

Data for three concentrations of test article is shown in tables 2 and 3. The data displayed below was obtained from a mean of triplicate values and shows the percentage inhibition of IL5 or IL13 at three concentrations compared to OVA alone. This data confirms the action of FK506, 1 and 7 on cytokines that are thought to be important in asthma progression, and also the reduced activity of 11 , the presumed primary metabolite of the ester series.

Table 2.

Percentage inhibition of IL-5 compared to OVA control

Test article 2μΜ 0.2μΜ 0.02μΜ

FK506, 1 73.9 59.4 25.5

7 48.4 34.3 34.4

11 1 1.2 17.7 2.2 Table 3.

Example 14 - Biological data - mouse in vivo oral and iv PK

To assess the pharmacokinetics of the compounds in an in vivo setting, compounds were dosed po at 10mg/kg and iv at 1 mg/kg to groups of male CD1 mice. Pharmacokinetic analysis was carried out as described in the materials and methods. Plots of the data are shown in figure 6, and the PK parameters are shown in table 4. As can be seen from this data, the systemic bioavailability of the ester series 7, 8, 9 and 10 are substantially reduced from FK506. Levels of 11 , the presumed primary metabolite, were also analysed, and revealed that substantial amounts of this compound were present in samples from the 7, 8, 9 and 10 PK studies (data not shown).

Table 4.

Example 15 - Biological data - caco-2 permeability and efflux

To look at the permeability of the compounds in vitro, a caco-2 permeability assay was used with 1 μΜ of test compounds, as described in the materials and methods. Attempts were made to analyse the ester series, 7, 8, 9 and 10, but difficulties were encountered with nonspecific binding, leading the results to be uninterpretable. As such, and to analyse the effect of removal of the 31 -H on the compounds being a substrate for Pgp, FK506 (1 ) and 31 - desmethoxy FK506 (5) were compared in the caco-2 assay. Data is shown in table 5, and suggests that removal of the 31 -H is beneficial in reducing the efflux of compounds, possibly via a reduced interaction with transporters such as Pgp. Table 5.

Example 16 - Mouse plasma stability

To confirm that the action of plasma enzymes (presumed to be esterases) was an important part of the rapid metabolism in mice, and to assess the relative rates of metabolism, mouse plasma stability studies were carried out, as described in the materials and methods, by spiking mouse plasma with test compounds at 2μΜ, to generate half lives for a series of compounds.

As seen in table 6, all of the ester compounds tested showed rapid metabolism, whereas FK506, 1 was relatively stable in mouse plasma.

Table 6.

Example 17 - Human blood stability

To look at the stability of the ester series of compounds in human blood, human blood stability studies were carried out, as described in the materials and methods, by spiking whole human blood with test compounds at 0.1 μΜ. The data from analysis was then plotted to compare the stability in human blood.

Once again, as seen in figure 7, all of the ester compounds tested showed rapid metabolism, with no parent remaining after 4 hours, whereas FK506, 1 was relatively stable in human blood.

Example 18 - Biological data - mouse in vivo aerosol PK

To assess the pharmacokinetics of the compounds when dosed topically to the lungs in an in vivo setting, 20mg of the test articles was dosed in a 100% ethanol vehicle by aerosol using a nebuliser to groups of 9 male CD1 mice (see materials and methods) for 10 minutes at 3ml_/10min. At the designated time points, lung and blood samples were taken and pharmacokinetic analysis was carried out as described in the materials and methods. Plots of the data are shown in figure 8, and the PK parameters are shown in table 8, with data generated using AUC calculations based on 0-24 hour timepoints (AUCi_ast)- As can be seen from this data, the lung:blood ratio is substantially improved in the ester series as compared to FK506. Levels of 11 , the presumed primary metabolite, were also analysed, and revealed that substantial amounts of this compound were also present in lung samples from the 7 and 9 PK studies, with much less in the blood samples.

Table 8 11, 11,

Parent Parent Parent metabolite 11, metabolite metabolite Blood AUC Lung AUC ratio Blood AUC Lung AUC ratio

Compound (ng*hi7ml_) (ng*hr/ml_) Blood:Lung (ng*hr/ml_) (ng*hr/mL) Blood:Lung

FK506, 1 9.3 476 51 x N/A N/A N/A

9 1 .55 862 556x <1 228 >228x

7 <1 310 >310x 5.23 382 73x

References

Aparicio, J. F., I. Molnar, et al. (1996). "Organization of the biosynthetic gene cluster for

rapamycin in Streptomyces hygroscopicus: analysis of the enzymatic domains in the modular polyketide synthase." Gene 169(1 ): 9-16.

Armstrong, V. W. and M. Oellerich (2001 ). "New developments in the immunosuppressive drug monitoring of cyclosporine, tacrolimus, and azathioprine." Clin Biochem 34(1 ): 9-16. Baker, H., A. Sidorowicz, et al. (1978). "Rapamycin (AY-22,989), a new antifungal antibiotic.

III. In vitro and in vivo evaluation." Journal of Antibiotics 31 (6): 539-545.

Bierman, M., R. Logan, et al. (1992). "Plasmid cloning vectors for the conjugal transfer of DNA from Escherichia coli to Streptomyces spp." Gene 116(1 ): 43-49.

Blanc, V., P. Gil, et al. (1997). "Identification and analysis of genes from Streptomyces

pristinaespiralis encoding enzymes involved in the biosynthesis of the 4-dimethylamino- L-phenylalanine precursor of pristinamycin I." Molecular Microbiology 23(2): 191 -202.

Blanc, V., D. Lagneaux, et al. (1995). "Cloning and analysis of structural genes from

Streptomyces pristinaespiralis encoding enzymes involved in the conversion of pristinamycin ll_B to pristinamycin ll_A (PIU): PI synthase and NADH:riboflavin 5'- phosphate oxidoreductase." Journal of Bacteriology 177(18): 5206-5214.

Bodor, N. and P. Buchwald (2001 ). "Drug targeting by retrometabolic design: soft drugs and chemical delivery systems." J Recept Signal Transduct Res 21 (2-3): 287-310.

Bodor, N. and P. Buchwald (2005). "Ophthalmic drug design based on the metabolic activity of the eye: soft drugs and chemical delivery systems." AAPS J 7(4): E820-33.

Brizuela, L., G. Chrebet, et al. (1991 ). "Antifungal properties of the immunosuppressant FK- 506: identification of an FK-506-responsive yeast gene distinct from FKB1." Mol Cell

Biol 11 (9): 4616-26. Campbell, L, A. N. Abulrob, et al. (2003). "Constitutive expression of p-glycoprotein in normal lung alveolar epithelium and functionality in primary alveolar epithelial cultures." J

Pharmacol Exp Ther 304(1 ): 441 -52.

Cannell, R., Ed. (1998). Natural Products Isolation, Humana Press.

Cao, W., P. Mohacsi, et al. (1995). "Effects of rapamycin on growth factor-stimulated vascular smooth muscle cell DNA synthesis. Inhibition of basic fibroblast growth factor and platelet-derived growth factor action and antagonism of rapamycin by FK506."

Transplantation 59(3): 390-5.

Carlson, R. P., W. L. Baeder, et al. (1993). "Effects of orally administered rapamycin in animal models of arthritis and other autoimmune diseases." Ann N Y Acad Sci 685: 86-1 13.

Carlson, R. P., D. A. Hartman, et al. (1993). "Rapamycin, a potential disease-modifying

antiarthritic drug." J Pharmacol Exp Ther 266(2): 1 125-38.

Chambraud, B., C. Radanyi, et al. (1996). "FAP48, a new protein that forms specific complexes both immunophilins FKBP59 and FKBP12. Prevention by the immunosuppressant drugs FK506 and rapamycin." Journal of Biological Chemistry 271 (51 ): 32923-32929.

Chan, H. K. and N. Y. Chew (2003). "Novel alternative methods for the delivery of drugs for the treatment of asthma." Adv Drug Deliv Rev 55(7): 793-805.

Chang, J. Y., S. N. Sehgal, et al. (1991 ). "FK506 and rapamycin: novel pharmacological probes of the immune response." Trends in Pharmacological Sciences 12(6): 218-223.

Chen, J., X. F. Zheng, et al. (1995). "Identification of an 1 1 -kDa FKBP12-rapamycin-binding domain within the 289-kDa FKBP12-rapamycin-associated protein and characterization of a critical serine residue." Proceedings of the National Academy of Sciences of the

United States of America 92(1 1 ): 4947-4951 .

Choi, S. S., Y. A. Hur, et al. (2007). "Isolation of the biosynthetic gene cluster for tautomycetin, a linear polyketide T cell-specific immunomodulator from Streptomyces sp. CK4412."

Microbiology 153(Pt 4): 1095-102.

Corcoran, T. E. (2006). "Inhaled delivery of aerosolized cyclosporine." Adv Drug Deliv Rev

58(9-10): 1 1 19-27.

Cryan, S. A., N. Sivadas, et al. (2007). "In vivo animal models for drug delivery across the lung mucosal barrier." Adv Drug Deliv Rev 59(1 1 ): 1 133-51 .

Dalby, R. and J. Suman (2003). "Inhalation therapy: technological milestones in asthma

treatment." Adv Drug Deliv Rev 55(7): 779-91 .

DiLella, A. G. and R. J. Craig (1991 ). "Exon organization of the human FKBP-12 gene:

correlation with structural and functional protein domains." Biochemistry 30(35): 8512-7. Du, L, C. Sanchez, et al. (2000). "The biosynthetic gene cluster for the antitumor drug

bleomycin from Streptomyces verticillus ATCC15003 supporting functional interactions between nonribosomal peptide synthetases and a polyketide synthase." Chem Biol 7(8): 623-42.

Dudkin, L, M. B. Dilling, et al. (2001 ). "Biochemical correlates of rmTOR inhibition by the

rapamycin ester CCI-779 and tumor growth inhibition." Clin Cancer Res 7(6): 1758-64. Dumont, F. J., M. J. Staruch, et al. (1992). "The immunosuppressive and toxic effects of FK-

506 are mechanistically related: pharmacology of a novel antagonist of FK-506 and rapamycin." J Exp Med 176(3): 751 -60.

Dutton, C. J., S. P. Gibson, et al. (1991 ). "Novel avermectins produced by mutational

biosynthesis." Journal of Antibiotics 44(3): 357-365.

Egorin, M. J., T. F. Lagattuta, et al. (2002). "Pharmacokinetics, tissue distribution, and

metabolism of 17-(dimethylaminoethylamino)-17-demethoxygeldanamycin (NSC

707545) in CD2F1 mice and Fischer 344 rats." Cancer Chemother Pharmacol 49(1 ): 7-

19.

Fang, J., Y. Zhang, et al. (2008). "Cloning and characterization of the tetrocarcin A gene cluster from Micromonospora chalcea NRRL 1 1289 reveals a highly conserved strategy for tetronate biosynthesis in spirotetronate antibiotics." J Bacteriol 190(17): 6014-25.

Fehr, T., J. J. Sanglier, et al. (1996). "Antascomicins A, B, C, D and E. Novel FKBP12 binding compounds from a Micromonospora strain." J Antibiot (Tokyo) 49(3): 230-3.

Foey, A., P. Green, et al. (2002). "Cytokine-stimulated T cells induce macrophage IL-10

production dependent on phosphatidylinositol 3-kinase and p70S6K: implications for rheumatoid arthritis." Arthritis Res 4(1 ): 64-70.

Gaisser, S., J. Reather, et al. (2000). "A defined system for hybrid macrolide biosynthesis in

Saccharopolyspora erythraea." Molecular Microbiology 36(2): 391 -401 .

Garrity, G. M., B. K. Heimbuch, et al. (1993). "Genetic relationships among actinomycetes that produce the immunosuppressant macrolides FK506, FK520/FK523 and rapamycin." J

Ind Microbiol 12(1 ): 42-7.

Gregory, C. R., P. Huie, et al. (1993). "Rapamycin inhibits arterial intimal thickening caused by both alloimmune and mechanical injury. Its effect on cellular, growth factor, and cytokine response in injured vessels." Transplantation 55(6): 1409-18.

Hanson, B. J. (2006). "Multiplexing Fluo-4 NW and a GeneBLAzer transcriptional assay for high-throughput screening of G-protein-coupled receptors." J Biomol Screen 11 (6): 644- 51 .

Hatanaka, H., T. Kino, et al. (1989). "FK-506 related compounds produced by Streptomyces tsukubaensis No. 9993." J Antibiot (Tokyo) 42(4): 620-2. Hatanaka, H., T. Kino, et al. (1988). "FR-900520 and FR-900523, novel immunosuppressants isolated from a Streptomyces. II. Fermentation, isolation and physico-chemical and biological characteristics." J Antibiot (Tokyo) 41 (1 1 ): 1592-601 .

Hegedus, C, G. Szakacs, et al. (2009). "Ins and outs of the ABCG2 multidrug transporter: an update on in vitro functional assays." Adv Drug Deliv Rev 61 (1 ): 47-56.

Izuishi, K., H. Wakabayashi, et al. (1997). "Effects of an immunosuppressive agent, tacrolimus (FK-506), on the activities of cytochrome P-450-linked monooxygenase systems in rat liver microsomes." Int J Biochem Cell Biol 29(6): 921 -8.

Kahan, B. D., J. Y. Chang, et al. (1991 ). "Preclinical evaluation of a new potent

immunosuppressive agent, rapamycin." Transplantation 52(2): 185-191 .

Kapturczak, M. H., H. U. Meier-Kriesche, et al. (2004). "Pharmacology of calcineurin

antagonists." Transplant Proc 36(2 Suppl): 25S-32S.

Kieser, T., M. J. Bibb, et al., Eds. (1999). Practical Streptomyces Genetics, John Innes

Foundation.

Kim, H. S. and Y. I. Park (2007). "Lipase activity and tacrolimus production in Streptomyces clavuligerus CKD 1 1 19 mutant strains." J Microbiol Biotechnol 17(10): 1638-44.

Kirchner, G. I., M. Winkler, et al. (2000). "Pharmacokinetics of SDZ RAD and cyclosporin

including their metabolites in seven kidney graft patients after the first dose of SDZ RAD." Br J Clin Pharmacol 50(5): 449-54.

Lechapt-Zalcman, E., I. Hurbain, et al. (1997). "MDR1 -Pgp 170 expression in human

bronchus." Eur Respir J 10(8): 1837-43.

Lowden, P. A. S. (1997). Studies on the Biosynthesis of Rapamycin. Churchill College,

University of Cambridge.

Lowden, P. A. S., B. Wilkinson, et al. (2001 ). "Origin and true nature of the starter unit for the rapamycin polyketide synthase." Angewandte Chemie-lnternational Edition 40(4): 777-

779.

Macian, F. (2005). "NFAT proteins: key regulators of T-cell development and function." Nat Rev Immunol 5(6): 472-84.

Margulies, M., M. Egholm, et al. (2005). "Genome sequencing in microfabricated high-density picolitre reactors." Nature 437(7057): 376-80.

Meingassner, J. G., M. Grassberger, et al. (1997). "A novel anti-inflammatory drug, SDZ ASM 981 , for the topical and oral treatment of skin diseases: in vivo pharmacology." Br J Dermatol 137(4): 568-76.

Morice, M. C, P. W. Serruys, et al. (2002). "A randomized comparison of a sirolimus-eluting stent with a standard stent for coronary revascularization." N Engl J Med 346(23): 1773-

80. Motamedi, H., A. Shafiee, et al. (1996). "Characterization of methyltransferase and hydroxylase genes involved in the biosynthesis of the immunosuppressants FK506 and FK520."

Journal of Bacteriology 178(17): 5243-5248.

Muramatsu, H., M. SI, et al. (2005). "Phylogenetic Analysis of Immunosuppressant FK506- Producing Streptomycete Strains." Actinomycetologica 19: 33-39.

Qureshi, S. A. (2007). "Beta-lactamase: an ideal reporter system for monitoring gene

expression in live eukaryotic cells." Biotechniques 42(1 ): 91 -6.

Rabinovitch, A., W. L. Suarez-Pinzon, et al. (2002). "Combination therapy with sirolimus and interleukin-2 prevents spontaneous and recurrent autoimmune diabetes in NOD mice." Diabetes 51 (3): 638-45.

Reitamo, S., P. Spuls, et al. (2001 ). "Efficacy of sirolimus (rapamycin) administered

concomitantly with a subtherapeutic dose of cyclosporin in the treatment of severe psoriasis: a randomized controlled trial." Br J Dermatol 145(3): 438-45.

Reynolds, K. A., K. K. Wallace, et al. (1997). "Biosynthesis of the shikimate-derived starter unit of the immunosuppressant ascomycin: stereochemistry of the 1 ,4-conjugate

elimination." Journal of Antibiotics 50(8): 701 -703.

Roy, J. N., A. Barama, et al. (2006). "Cyp3A4, Cyp3A5, and MDR-1 genetic influences on tacrolimus pharmacokinetics in renal transplant recipients." Pharmacogenet Genomics

16(9): 659-65.

Rustin, M. H. (2007). "The safety of tacrolimus ointment for the treatment of atopic dermatitis: a review." Br J Dermatol 157(5): 861 -73.

Saeki, T., K. Ueda, et al. (1993). "Human P-glycoprotein transports cyclosporin A and FK506."

J Biol Chem 268(9): 6077-80.

Sambrook, J. and D. Russel, Eds. (2001 ). Molecular Cloning: A laboratory manual (third

edition), Cold Spring Harbor Laboratory Press.

Schreiber, S. L. and G. R. Crabtree (1992). "The mechanism of action of cyclosporine A and

FK506." Immunology Today 13(4): 136-142.

Shimizu, M. (2005). Astellas R&D Meeting - Clinical Development.

Sigal, N. H., F. Dumont, et al. (1991 ). "Is cyclophilin involved in the immunosuppressive and nephrotoxic mechanism of action of cyclosporin A?" J Exp Med 173(3): 619-28.

Smyth, H. D. (2003). "The influence of formulation variables on the performance of alternative propellant-driven metered dose inhalers." Adv Drug Deliv Rev 55(7): 807-28.

Steiner, J. P., G. S. Hamilton, et al. (1997). "Neurotrophic immunophilin ligands stimulate

structural and functional recovery in neurodegenerative animal models." Proc Natl Acad Sci U S A 94(5): 2019-24. Szakacs, G., A. Varadi, et al. (2008). "The role of ABC transporters in drug absorption, distribution, metabolism, excretion and toxicity (ADME-Tox)." Drug Discov Today 13(9- 10): 379-93.

Tamura, S., Y. Tokunaga, et al. (2003). "The site-specific transport and metabolism of

tacrolimus in rat small intestine." J Pharmacol Exp Ther 306(1 ): 310-6.

Wagner, R., T. A. Rhoades, et al. (1998). "32-Ascomycinyloxyacetic acid derived

immunosuppressants. Independence of immunophilin binding and immunosuppressive potency." J Med Chem 41 (1 1 ): 1764-76.

Wallace, K. K., K. A. Reynolds, et al. (1994). "Biosynthetic studies of ascomycin (FK520): formulation of the (1 R,3R4R)-3,4-dihydroxycyclohexanecarboxylic acid-derived moiety."

JACS 116(25): 1 1600-1 1601 .

Wu, K., L. Chung, et al. (2000). "The FK520 gene cluster of Streptomyces hygroscopicus var. ascomyceticus (ATCC 14891 ) contains genes for biosynthesis of unusual polyketide extender units." Gene 251 (1 ): 81 -90.

Yan, Z. and G. W. Caldwell (2001 ). "Metabolism profiling, and cytochrome P450 inhibition & induction in drug discovery." Curr Top Med Chem 1 (5): 403-25.

Throughout the specification and the claims which follow, unless the context requires otherwise, the word 'comprise', and variations such as 'comprises' and 'comprising', will be understood to imply the inclusion of a stated integer, step, group of integers or group of steps but not to the exclusion of any other integer, step, group of integers or group of steps.

All documents referred to herein, including patents and patent applications, are incorporated by reference in their entirety.

Claims

1. A compound of formula (I) or a pharmaceutically acceptable salt thereof:

wherein

R₂ represents -CH₃, -CH₂CH_3! or -CH₂CH=CH₂;

Ri represents C1 -10 alkyi wherein one or more carbon atoms are optionally replaced by a heteroatom selected from O, N and S and which is optionally substituted by one or more halogen atoms or =0 groups;

or Ri represents aryl, C1 -4alkylaryl, heteroaryl or C1 -4heteroaryl; and

or R₃ represents H, aryl, C1 -4alkylaryl, heteroaryl or C1 -4heteroaryl;

2. A compound according to claim 1 wherein R₂ represents -CH₂CH=CH₂.

3. A compound according to claim 1 or claim 2 wherein R-i represents C1 -4alkyl.

4. A compound according to any one of claims 1 to 3 wherein R₃ represents H.

5. A compound according to claim 1 selected from: WO 2011/045593

and pharmaceutically acceptable salts of any one thereof.

6. A compound according to any one of claims 1 to 5 or a pharmaceutically acceptable salt thereof for use as a pharmaceutical.

7. A pharmaceutical composition comprising a compound of formula (I) according to any one of claims 1 to 5 or a pharmaceutically acceptable salt thereof together with one or more pharmaceutically acceptable diluents or carriers.

8. A compound of formula (I) according to any one of claims 1 to 5 or a pharmaceutically acceptable salt thereof for use in the treatment or prevention of immune disorders, inflammatory diseases, fungal diseases, rejection of transplant, atopic dermatitis, asthma, uveitis, psoriasis and/or inflammatory bowel diseases.

9. Use of a compounds of formula (I) according to any one of claims 1 to 5 or a

pharmaceutically acceptable salt thereof, in the manufacture of a medicament for the treatment or prevention of immune disorders, inflammatory diseases, fungal diseases, rejection of transplant, atopic dermatitis, asthma, uveitis, psoriasis and/or inflammatory bowel diseases.

10. A method for the treatment or prevention of immune disorders, inflammatory diseases, fungal diseases, rejection of transplant, atopic dermatitis, asthma, uveitis, psoriasis and/or inflammatory bowel diseases which comprises administering to a subject (especially a human subject) in need thereof a therapeutically effective amount of a compound of formula (I) according to any one of claims 1 to 5 or a pharmaceutically acceptable salt thereof.

11. A process for the preparation of a compound of formula (I) or a pharmaceutically acceptable salt thereof which comprises reacting a compound of formula (II)

(II)

with a compound of formula (III)

wherein R₂ represents -CH₃, -CH₂CH_3! or -CH₂CH=CH₂;

Ri represents H; and

or R₃ represents H, aryl, C1 -4alkylaryl, heteroaryl or C1 -4heteroaryl.

13. A compound according to claim 12 wherein R-i represents C1 -4alkyl.

14. A compound according to claim 12 which is:

or a salt thereof.