WO2011004345A1 - Upstream binding protein 1 polymorphisms and their use for prognosing or diagnosing arterial blood pressure - Google Patents

Abstract

The present invention is directed to methods for diagnosis and prognosis using polymorphic variants of Ubp 1 s and related probes and kits.

Description

UPSTREAM BINDING PROTEIN 1 POLYMORPHISMS AND THEIR USE FOR PROGNOSING OR DIAGNOSING ARTERIAL BLOOD PRESSURE

FIELD OF THE INVENTION

The present invention relates to biomarkers for diseases or disorders related to or 5 associated with the control of arterial blood pressure, such as hypertension and cardiovascular disorders biomarkers and use thereof.

BACKGROUND OF THE INVENTION

Elevated arterial blood pressure (BP) or hypertension, defined as systolic blood pressure higher or equal to 140 mmHg or diastolic blood pressure higher or equal to 90 mmHg, io is a prevalent health problem worldwide {Braunwald et al., 2008, Harrison's Principles of Internal Medicine. McGraw-Hill, New York, U.S.A.). The prevalence of hypertension is a worldwide health issue. For the US only, it is of 29% in U.S. adults 18 years and older and an additional 37% of U.S. adults have pre-hypertensiveBP values, defined as systolic BP between 120 to 139 mmHg or diastolic BP between 80 to 89 mmHg is (McDowell et al., 2008, Blood folate levels: The latest NHANES results. NCHS data briefs, no. 6, Hyattsville, MD: National Center for Health Statistics) . Hypertension represents an independent risk factor for development of cardiovascular disease, including coronary heart disease, congestive heart failure, ischemic and hemorrhagic stroke, renal failure, and peripheral arterial disease.

20 BP is determined by both genetic and environmental factors, which include dietary NaCl intake, alcohol consumption, physical inactivity, stress. Several genes responsible for the rare Mendelian forms of hypertension have been identified (CYPIlBl, CYP11B2, HSDIlBl, MR, SCNNlB, SCNNlG, WNKl, WNK4) and were shown to play an important role in the renal control of blood pressure (Lifton et al., 2001, Cell, 104,

25 545; Cowley, 2006, Nat. Rev. Genet., Vol. 7, 11). In addition, rare independent mutations in salt handling genes SLC2A3, SLC 12Al and KCNJl were described to reduce BP and protect from development of hypertension (Ji et al, 2008, Nat. Genet., 40, 592). However, common genetic variant underlying the blood pressure variation remains to be identified.

30 UBP 1 gene belongs to the grainyhead family of transcription factors, has been cloned in 2002 and maps to chromosome 3p22.3. UBPl is expressed in adrenal gland, placenta and in mouse heart and aorta. Its role has been described as important modulator of placental P450scc expression. UBPl regulates expression of CYPIlA, the gene encoding the rate-limiting enzyme in steroidogenesis, and is expressed in placenta and adult adrenals (Huang et al, 2000, J. Biol. Chem, 275, 2852). However, the role of CYPl IA, and the 3β-HSD2, CYP21, CYPl 1B2 cascade in human heart and aorta is a matter of debate. The sequence of the UBP 1 gene is known in the art. The coding nucleic acid sequence of said gene can be retrieved under the number NM O 14517 at the NCBI Nucleotide Database. A contiguous genomic sequence of the UBP 1 gene (SEQ ID NO: 1) can be gained from the Homo sapiens chromosome 3 genomic contig. NC 000003 at the NCBI Nucleotide database. The derived protein sequence can be retrieved under the number NP 055332 at the National Center for Biotechnology Information (NCBI) Protein Database (National Center for Biotechnology Information, National Library of Medicine, Bethesda, MD 20894, USA; web address : http://www.ncbi.nlm.nih.gov/).

Although therapies for hypertension have improved in recent years, those treatments are expensive and do not prevent development of all cardiovascular disorders. Therefore, methods useful to efficiently identify propensity to develop diseases or disorders related to or associated with the control of arterial blood pressure, notably hypertension, especially in young subjects, before or at the early onset of the development of the disease and its symptoms would be particularly desirable.

SUMMARY OF THE INVENTION

The present invention is based on the finding that the type of nucleotide C/T, which is defined by SNP rsl7030583 is present at the position 33415322 and on the UBPl gene (according to NC 000003, Fig.l) is indicative for the risk of said individual to suffer from or develop cardiovascular and/or thrombotic disorders. The present invention is directed towards a new and advantageous method for risk assessment and/or diagnosis and/or prognosis of diseases or disorders related to or associated with the control of arterial blood pressure, notably hypertension or a cardiovascular disorder in a subject. In a first aspect, the invention provides an in vitro method for risk assessment and/or diagnosis and/or prognosis of a disease or a disorder related to or associated with the control of arterial blood pressure in a subject, comprising the following steps:

(a) Detecting in a nucleic acid sample from said subject the presence or absence of at least one polymorphic variant in human Ubpl gene or a homologue thereof, wherein the polymorphic variant is in a nucleic acid sequence that encodes for the UBP-I or homologue thereof mRNA/protein, controls expression of Ubpl gene or homologue thereof or encodes a Ubpl or homologue thereof controlled protein; and

(b) Comparing the variant data obtained in step (a) to Ubpl or homologue thereof variant data from healthy and/or diseased subjects, wherein the variant data are correlated with a disease or a disorder related to or associated with the control of arterial blood pressure status in said subject.

According to a second aspect, the invention provides an isolated polynucleotide, a vector and oligonucleotide probes according to the invention.

According to a third aspect, the invention provides a diagnostic kit according to the invention.

BRIEF DESCRIPTION OF THE FIGURE

Figure 1. Schematic representation (not on scale) of exon intron organization of the UBPl and Fbxl2 genes. The positions of rs2291897 (SEQ ID NO: 17), rsl7030583 (SEQ ID NO: 4) and rs2272152 (SEQ ID NO: 46) SNPs are shown by arrowheads. The lower panel represents intron exon 4 border of the UBPl gene with the polymorphic nucleotide shown in majuscule.

Figure 2. Sequences represented by SEQ IDs NO: 1-78/78'.

DETAILED DESCRIPTION OF THE INVENTION

The term "Ubpl controlled protein" includes but is not limited to CYPl IAl, 3β-HSD2,

CYP21, CYP11B2.

The term "Ubpl homologue" includes genes that are homologous to Ubpl gene and include for example the LBP-9 or Transcription factor CP2-Like-l (TFCP2L1) gene.

The coding nucleic acid sequence of said gene can be retrieved under the number NM_014553 at the NCBI Nucleotide Database. A contiguous genomic sequence of the

LBP9 gene (SEQ ID NO: 72) can be gained from the Homo sapiens chromosome 2 genomic contig NC 000002.10 in the NCBI Nucleotide database. The derived protein sequence can be retrieved under the number NP 055368. 1 in the NCBI Protein Database.

The term "promoter sequence" includes any in vitro transcription promoter known to the skilled person such as the promoter of the CYPl IAl gene. Its nucleic acid sequence can be retrieved under the number M60421 at the NCBI Nucleotide Database (SEQ ID NO: 2). Particularly relevant in the content of the CYPl IAl promoter is the binding site of UBP-I and LBP-9 (SEQ ID NO: 3).

The term "polymorphic site" refers to a region in a nucleic acid at which two or more alternative nucleotide sequences are observed in a significant number of nucleic acid samples from a population of individuals. A polymorphic site may be a nucleotide sequence of two or more nucleotides, an inserted nucleotide or nucleotide sequence, a deleted nucleotide or nucleotide sequence, or a microsatellite, for example. A polymorphic site that is two or more nucleotides in length may be 3, 4, 5, 6, 7, 8, 9, 10, 11 , 12, 13, 14, 15 or more, 20 or more, 30 or more, 50 or more, 75 or more, 100 or more, 500 or more, or about 1000 nucleotides in length, where all or some of the nucleotide sequences differ within the region. A polymorphic site is often one nucleotide in length, which is referred to herein as a "single nucleotide polymorphism" or a "SNP."

Where there are two, three, or four alternative nucleotide sequences at a polymorphic site, each nucleotide sequence is referred to as a "polymorphic variant" or "nucleic acid variant." Where two polymorphic variants exist, for example, the polymorphic variant represented in a minority of samples from a population is sometimes referred to as a "minor allele" and the polymorphic variant that is more prevalently represented is sometimes referred to as a "major allele." Many organisms possess a copy of each chromosome (e.g., humans), and those individuals who possess two major alleles or two minor alleles are often referred to as being "homozygous" with respect to the polymorphism, and those individuals who possess one major allele and one minor allele are normally referred to as being "heterozygous" with respect to the polymorphism. Individuals who are homozygous with respect to one allele are sometimes predisposed to a different phenotype as compared to individuals who are heterozygous or homozygous with respect to another allele. A polymorphic variant is statistically significant and often biologically relevant if it is represented in 5% or more of a population, sometimes 10% or more, 15% or more, or 20% or more of a population, and often 25% or more, 30% or more, 35% or more, 40% or more, 45% or more, or 50% or more of a population. Polymorphic variants are often reported in a database without determining whether the variant is represented in a significant fraction of a population.

Because a subset of these reported polymorphic variants are not represented in a statistically significant portion of the population, some of them are sequencing errors and/or not biologically relevant. Thus, it is often not known whether a reported polymorphic variant is statistically significant or biologically relevant until the presence of the variant is detected in a population of individuals and the frequency of the variant is determined. Methods for detecting a polymorphic variant in a population are described herein. A polymorphic variant according to the invention may be detected on either or both strands of a double-stranded nucleic acid. For example, a rsl7030583 having the sequence:

CTTTTTCTATGTGCTATGCTTTTCAT[CZT]TGCCTTCCATACAACAGTGCAAG

AC (SEQ ID NO: 4) at a particular position with a C or T being the polymorphic nucleotide at position 33415322 in SEQ ID NO: 1 can be reported as the following sequence:

GTCTTGCACTGTTGTATGGAAGGCAIA/GJATGAAAAGCATAGCACATAGAA AAAG (SEQ ID NO: 4') from the complementary strand.

In an exemplary embodiment, polymorphic variants of UBPl include an C/T variant of the UBPl genomic sequence at positions 33415322 or the UBPl genomic sequence (SEQ ID NO: I)) also as referred as SNP rsl7030583 (SEQ ID NO: 4) and a G/A variant of within the UBPl Fbxl2 genomic sequence also as referred as SNP rs2291897 (SEQ ID NO: 17).

Also, a polymorphic variant may be located within an intron or exon of a gene or within a portion of a regulatory region such as a promoter, a 5' untranslated region (UTR), a 3' UTR, and in DNA (e.g., genomic DNA (gDNA) and complementary DNA (cDNA)), RNA (e.g., mRNA, tRNA, and rRNA), or a polypeptide. Polymorphic variations may or may not result in detectable differences in gene expression (mRNA and/or protein expression), polypeptide structure, polypeptide sequence, or polypeptide function. Preferred polymorphic variations of Ubpl do result in detectable differences in gene expression (mRNA and/or protein expression), polypeptide structure, polypeptide sequence, or polypeptide function. Provided herein are polymorphic variants of UBPl that are associated with a blood pressure and cardiovascular diseases or disorders. A total of 67 variants (SNPs) in the UBPl gene region (BP 33380933-33477747) have been genotyped in p h as e I o r I I of the HapMap project (as described on www.hapmap.org) and are shown in Table 1 below:

Table 1

CHR SNP BP MAF ALLELES SEQ ID NO:

3 rs491875 33380933 0 T:T 5/5'

3 rsl7192791 33381129 0.035 G:T 6/6'

3 rs6809590 33382661 0.017 A:G 7/7'

3 rs3915062 33384615 0.292 C:T 8/8'

3 rs4387922 33384783 0 G:G 9/9'

3 rs9866197 33385994 0 T:T 10/10'

3 rs3863985 33388626 0.28 C:T 11/11'

3 rs6550220 33389915 0 C:C 12/12'

3 rs2291898 33389927 0.302 C:T 13/13'

3 rs6807399 33390520 0 T:T 14/14'

3 rsl7805850 33391144 0.092 C:T 15/15'

3 rs9854827 33392689 0.292 C:T 16/16'

3 rs2291897 33394426 0.167 G:A 17/17'

3 rs595695 33397420 0 G:G 18/18'

3 rsl7030489 33397779 0.275 T:C 19/19'

3 rsl3326976 33398969 0 T:T 20/20'

3 rs6783131 33399540 0.277 A:G 21/21'

3 rs6771847 33399724 0.167 T:C 22 / 22'

3 rsl3078580 33399757 0.142 C:G 23/23'

3 rs6783644 33400034 0.167 A:G 24 / 24'

3 rsl7030546 33401887 0.202 C:G 25/25'

3 rs563109 33403262 0 A:A 26/26'

3 rs6772365 33403377 0.292 C:G 27/27'

3 _rs4678946 33403569 0.092 A:G 28/28'

3 rs11260 33405097 0.017 G:A 29/29'

3 rs6783672 33407095 0.342 G:A 30/30'

3 rs4678951 33407311 0.467 CA 31/31'

3 rslO514687 33407546 0 T:T 32/32'

3 rsl3084502 33407955 0.466 C:T 33/33'

3 rs4678954 33408312 0.438 A:G 34/34'

3 rs2293250 33409835 0.457 C:T 35/35'

3 rs7627452 33411182 0.292 G:A 36/36'

3 rs3817476 33412548 0.143 A:G 37/37' 3 rsl7030583 33415322 0.259 C:T 4/ 4

3 rsl7029983 33417894 0.108 A:G 38 / 38'

3 rs590497 33417979 0.183 G:A 39 / 39'

3 rs590876 33418035 0.292 A:T 40 / 40'

3 rs9870206 33418260 0 A:A 41 / 41'

3 rs623244 33419290 0.292 G:T 42 / 42'

3 rs9811050 33421290 0 A:A 43 / 43'

3 rs4678957 33421495 0.167 T:C 44 / 44'

3 rs4678958 33422450 0.295 T:C 45 / 45'

3 rs2272152 33429346 0.167 G:A 46 / 46'

3 rs953707 33430793 0 G:G 47 / 47'

3 rs953708 33430917 0 C:C 48 / 48'

3 rs9814432 33431109 0 T:T 49 / 49'

3 rsl403460 33431164 0.292 C:T 50 / 50'

3 rs884796 33431631 0.167 C:G 51 / 51'

3 rs9874636 33431660 0 G:G 52 / 52'

3 rs2007236 33432385 0.008 T:C 53 / 53'

3 rsl1928797 33432497 0.138 C:A 54 / 54'

3 rsl7639203 33433079 0.085 T:G 55 / 55'

3 rs3736563 33433270 0.292 T:C 56 / 56'

3 rs5024716 33436158 0.292 A:G 57 / 57'

3 rs6765153 33436800 0.28 A:C 58 / 58'

3 rs2276710 33441823 0.167 T:G 59 / 59'

3 rs9311014 33443333 0.302 G:T 60 / 60'

3 rs7623887 33445650 0.302 A:G 61 / 61'

3 rsl807844 33447941 0.167 A:G 62 / 62'

3 rsl1706401 33449499 0 C:C 63 / 63'

3 rs4678584 33453270 0.292 G:A 64 / 64'

3 rsl357540 33454986 0.167 T:C 65 / 65'

3 rs4678999 33458748 0.108 T:G 66 / 66'

3 rs2102050 33466151 0.269 G:A 67 / 67'

3 rsl2495295 33470255 0.11 G:A 68 / 68'

3 rsl2486950 33475486 0.108 C:A 69 / 69'

3 rs4045765 33477747 0.293 A:G 70 / 70'

Table 2 below reports the SNPs which were genotyped as described in Example 1. Table 2

CHR : chromosome; SNP : Single nucleotide polymorphism; BP : base pair position; Al : major Allele; TEST ADD : additive model; NMISS : number of individuals tested; BETA : regression coefficient for the test; SE : standard error of the regression coefficient; L95 : lower confidence interval limit; U95 : upper confidence interval limit; STAT : test statistic; P : p-value; SEQ ID NO: x is for sense strand and x' is for antisense/complementary strand; MAF : Major Allele Frequency.

The term "genotyped" as used herein refers to a process for determining a genotype of one or more individuals, where a "genotype" is a representation of one or more polymorphic variants in a population. Genotypes may be expressed in terms of a "haplotype," which as used herein refers to two or more polymorphic variants occurring within genomic DNA in a group of individuals within a population. For example, two SNPs may exist within a gene where each SNP position includes a cytosine variation and an adenine variation. Certain individuals in a population may carry one allele

(heterozygous) or two alleles (homozygous) having the gene with a cytosine at each SNP position. As the two cytosines corresponding to each SNP in the gene travel together on one or both alleles in these individuals, the individuals can be characterized as having a cytosine/cytosine haplotype with respect to the two SNPs in the gene.

As used herein, the term "phenotype" refers to a trait which can be compared between individuals, such as presence or absence of a condition, a visually observable difference in appearance between individuals, metabolic variations, physiological variations, variations in the function of biological molecules, and the like. An example of a phenotype is occurrence of hypertension. The term "Ubpl mediated disease or disorder" includes diseases or disorders mediated by Ubpl gene or a homo log thereof.

The terms "Ubpl mediated disease or disorder" or "diseases or disorders related to or associated with the control of arterial blood pressure" include but is not limited to hypertensive vascular disease (both essential forms and forms of hypertension within the context of the metabolic syndrome), coronary artery disease, chronic heart failure, cerebro vascular disease, diseases of the aorta and vascular diseases of the extremities, pulmonary hypertension and eclampsy.

The term "suffering from a disease or condition" means that a person is either presently subject to the signs and symptoms, or is more likely to develop such signs and symptoms than a normal person in the population.

According to one embodiment, is provided an in vitro method for risk assessment and/or diagnosis and/or prognosis of a disease or a disorder related to or associated with the control of arterial blood pressure in a subject, comprising the following steps:

(a) Detecting in a nucleic acid sample from said subject the presence or absence of at least one polymorphic variant in human Ubpl gene or a homologue thereof, wherein the polymorphic variant is in a nucleic acid sequence that encodes for the UBP- 1 or homologue thereof mRNA/protein, controls expression of Ubp l gene or homologue thereof or encodes a Ubpl or homologue thereof controlled protein; and (b) Comparing the variant data obtained in step (a) to Ubpl or homologue thereof variant data from healthy and/or diseased subjects, wherein the variant data are correlated with a disease or a disorder related to or associated with the control of arterial blood pressure status in said subject.

According to a further embodiment, is provided a method according to the invention wherein at least one of the variants is a polymorphic site associated with at least one single nucleotide polymorphism (SNP) listed in Table 2, in particular wherein said at least one SNP is selected from rs2291897, rs2272152 and rsl7030583.

According to a further embodiment, is provided a method according to the invention comprising detecting an at-risk allele of a SNP associated with a disease or disorder related to or associated with the control of arterial blood pressure status in said subject, wherein the SNP is located within a sequence selected from the Table 1 consisting of sequences identified by SEQ ID NOs: 4 to 71 and the complements of sequences identified by SEQ ID NOs: 4' to 71 '.

According to a further embodiment, is provided a method according to the invention comprising assaying for the presence of a first polynucleotide having a SNP according to the invention in a sample, comprising contacting said sample with a second polynucleotide, wherein said second polynucleotide comprises a nucleotide sequence selected from the group consisting of sequences identified by SEQ ID NOs: 4 to 71 and the complements of sequences identified by SEQ ID NOs: 4' to 71 ', wherein said second polynucleotide hybridizes to said first polynucleotide under stringent conditions. According to a further embodiment, is provided a method according to the invention wherein said method is for monitoring the effect of a therapy administered to a subject having a disease or a disorder related to or associated with the control of arterial blood. According to a further embodiment, is provided a method according to the invention wherein an increase in the level of Ubpl (or homologue thereof) variants compared to healthy control indicates that said subject is suffering from or has a predisposition to develop a disease or a disorder related to or associated with the control of arterial blood pressure.

According to a further embodiment, is provided a method according to the invention wherein the said subject's age is lower or of about 55 years.

According to a further embodiment, is provided a method according to the invention wherein the disease or disorder is hypertension or a cardiovascular disorder.

According to another embodiment, is provided an isolated polynucleotide comprising a SNP located within a sequence selected from the group consisting of sequences identified by SEQ ID NOs: 4 to 71 and the complements of sequences identified by SEQ ID NOs: 4' to 71 '.

According to another embodiment, is provided an oligonucleotide probe an oligonucleotide probe according to the invention. In a particular embodiment, is provided an oligonucleotide probe according to the invention which is capable of detecting a polymorphism in the Ubpl gene (SEQ ID NO: 1).

In another particular embodiment, is provided an oligonucleotide probe according to the invention which is capable of detecting a polymorphism in the Ubpl gene homologue, LBP-9 (SEQ ID NO: 72). According to another embodiment, is provided a vector comprising an isolated polynucleotide containing a SNP located within a sequence selected from the group consisting of sequences identified by SEQ ID NOs: 4 to 71 and the complements of sequences identified by SEQ ID NOs: 4' to 71 ', wherein said isolated polynucleotide is operably linked to a regulatory sequence.

According to another embodiment, is provided a diagnostic kit comprising one or more probe or primer which is capable of hybridizing to a polymorphic variant of an Ubpl gene or homo log thereof thereby determining whether the Ubpl gene or homolog thereof contains a polymorphic variant.

According to further embodiment, is provided diagnostic kit according to the invention wherein the said probe or primer that binds to SEQ ID NO: 1 , or a sequence complementary thereto.

According to another further embodiment, is provided a diagnostic kit comprising one or more oligonucleotide probes according to the invention.

According to another further embodiment, is provided a diagnostic kit according to the invention for the detection of SNP haplotypes associated with a disease or a disorder related to or associated with the control of arterial blood pressure.

According to another further embodiment, is provided a diagnostic kit according to the invention comprising at least one primer selected from the group consisting of SEQ ID NOs: 4 to 71 and the complements of sequences identified by SEQ ID NOs: 4' to 71 '.

Methods for Detecting Polymorphic Variants

Methods for identifying a polymorphic variation associated with a disease according to the invention that is proximal to an incident polymorphic variation associated with a Ubpl mediated disease or disorder, comprises identifying a polymorphic variant proximal to the incident polymorphic variant associated with a Ubpl mediated disease or disorder, where the incident polymorphic variant is in a Ubpl gene or homolog thereof or regulatory sequence. The presence or absence of an association of the proximal polymorphic variant with the disease then is determined using a known association method, such as a method described herein. In one embodiment, the incident polymorphic variant is present in a Ubpl gene or regulatory sequence. The polymorphic variant is identified using a known method, including, but not limited to, sequencing a region surrounding the incident polymorphic variant in a group of nucleic acid samples. A proximal polymorphic variant often is identified in a region surrounding the incident polymorphic variant. In certain embodiments, this surrounding region is about 50 kb flanking the first polymorphic variant (e.g., about 50 kb 5' of the first polymorphic variant and about 50 kb 3' of the first polymorphic variant), and the region sometimes is composed of shorter flanking sequences, such as flanking sequences of about 40 kb, about 30 kb, about 25 kb, about 20 kb, about 15 kb, about 10 kb, about 7 kb, about 5 kb, or about 2 kb 5' and 3' of the incident polymorphic variant. In other embodiments, the region is composed of longer flanking sequences, such as flanking sequences of about 55 kb, about 60 kb, about 65 kb, about 70 kb, about 75 kb, about 80 kb, about 85 kb, about 90 kb, about 95 kb, or about 100 kb 5' and 3' of the incident polymorphic variant. In certain embodiments, polymorphic variants associated with an Ubpl mediated disease or disorder are identified iteratively. For example, a first proximal polymorphic variant is associated with a Ubpl mediated disease or disorder using the methods described herein and then another polymorphic variant proximal to the first proximal polymorphic variant is identified and the presence or absence of an association of one or more other polymorphic variants proximal to the first proximal polymorphic variant with a Ubpl mediated disease or disorder is determined.

The methods described herein are useful for identifying or discovering additional polymorphic variants that may be used to further characterize a gene, region or loci associated with an Ubpl mediated disease or disorder. For example, allelotyping or genotyping data from the additional polymorphic variants may be used to identify a functional mutation or a region of linkage disequilibrium.

In certain embodiments, polymorphic variants identified or discovered within a region comprising the first polymorphic variant associated with a Ubpl mediated disease or disorder are genotyped using the genetic methods and sample selection techniques described herein, and it can be determined whether those polymorphic variants are in linkage disequilibrium with the first polymorphic variant. The size of the region in linkage disequilibrium with the first polymorphic variant also can be assessed using these genotyping methods.

Methods for determining the presence or absence of a polymorphic variant include, for example, detection of a polymorphic variant in a nucleic acid sequence such as genomic DNA, cDNA, mRNA, tRNA, rRNA, etc. Variants may be located in any region of a nucleic acid sequence including coding regions, exons, introns, intron/exon borders and regulatory regions, such as promoters, enhancers, termination sequences, etc. Certain polymorphic variants may be associated with differences in gene expression (mRNA and/or protein), post-transcriptional regulation and/or protein activity. For such polymorphic variants, determining the presence or absence of the polymorphic variant may involve determining the level of transcription, mRNA maturation, splicing, translation, protein level, protein stability, and/or protein activity. Polymorphic variants that lead to a change in protein sequence may also be determined by identifying a change in protein sequence and/or structure.

The methods described herein may be used to determine the genotype of a subject with respect to both copies of the polymorphic site present in the genome. For example, the complete genotype may be characterized as -/-, as -/+, or as +/+, where a minus sign indicates the presence of the reference sequence at the polymorphic site, and the plus sign indicates the presence of a polymorphic variant other than the reference sequence. If multiple polymorphic variants exist at a site, this can be appropriately indicated by specifying which ones are present in the subject. Any of the detection means described herein may be used to determine the genotype of a subject with respect to one or both copies of the polymorphism present in the subject's genome.

According to certain embodiments of the invention it is preferable to employ methods that can detect the presence of multiple polymorphic variants (e.g., polymorphic variants at a plurality of polymorphic sites) in parallel or substantially simultaneously. Oligonucleotide arrays represent one suitable means for doing so. Other methods, including methods in which reactions (e.g., amplification, hybridization) are performed in individual vessels, e.g., within individual wells of a multi-well plate or other vessel may also be performed so as to detect the presence of multiple polymorphic variants (e.g., polymorphic variants at a plurality of polymorphic sites) in parallel or substantially simultaneously according to certain embodiments of the invention.

Diagnostic procedures may also be performed in situ directly upon tissue sections (fixed and/or frozen) obtained from a patient such that no nucleic acid purification is necessary. Nucleic acids may be used as probes and/or primers for such in situ procedures (e.g., Nuovo 1992, PCR in situ hybridization: protocols and applications, Raven Press, New York). Samples

Polymorphic variants may be detected in a sample from a subject using a biological sample from said patient such as, for example, samples of blood, serum, urine, saliva, cells (including cell lysates), tissue, hair, etc.. Biological samples suitable for use in accordance with the methods described herein will comprise an Ubpl (or homolog thereof) nucleic acid or polypeptide sequence. Biological samples may be obtained using known techniques such as venipuncture to obtain blood samples or biopsies to obtain cell or tissue samples.

Cells, tissue or clinical samples (herein referred to as sample) can be from heart, kidney, brain, liver, bone marrow, colon, breast, prostate, thyroid, gall bladder, lung, adrenals, muscle, fat, nerve fibers, pancreas, skin, etc. Preferred samples include blood, white blood cells, liver, muscle, kidney, fat and other tissues. The cells or tissues can be pretreated with a therapeutic substance useful for the control of arterial blood pressure or other pharmacological agents either in vivo or following isolation.

The genetic analysis of haplotypes, SNPs or alleles of the Ubpl gene or homolog thereof as described herein could be done on the samples collected above. It is of course understood that in general the genetic analysis need not be done on the same sample used for subsequent biochemical analysis. Any sample, tissue or biopsy obtained from the given patient should be sufficient to determine the genetic haplotype of the Ubpl gene or homolog thereof as well as genetic analysis of any other gene. The haplotype is schematically represented as +/+, +/- or -/- for the Ubpl or homolog thereof allele of interest.

The sample can then be subjected to a number of other biochemical and/or biological studies. These include quantitative measurement of mRNA or protein by methods known in the art and/or described herein, such as the measurement of Ubpl or homolog thereof mRNA or protein and the determination of mRNAs, protein and enzymes that are controlled by Ubpl or homolog thereof such as CYPl IAl , and hormones and signaling factors that are produced by CYPl IAl . In addition to the measurement of protein and mRNA of specific gene products as described above, the measurement of endogenous Ubpl or homolog thereof activity in various samples may be performed. Detection methods

Examples of techniques for detecting differences of at least one nucleotide between two nucleic acids include, but are not limited to, selective oligonucleotide hybridization, selective amplification, or selective primer extension.

A preferred detection method is allele specific hybridization using probes overlapping the polymorphic site and having about 5, 10, 20, 25, or 30 nucleotides around the polymorphic site. For example, oligonucleotide probes may be prepared in which the known polymorphic nucleotide is placed centrally (allele-specific probes) and then hybridized to target DNA under conditions which permit hybridization only if a perfect match is found (Saiki et al., 1989, Proc. Natl. Acad. Sci. USA, 86:6230). Such allele specific oligonucleotide hybridization techniques may be used for the simultaneous detection of several nucleotide changes in different polymorphic regions of gene. Examples of probes for detecting specific polymorphic variants of the polymorphic site located in the Ubpl gene or homo log thereof are probes comprising about 5, 10, 20, 25, 30, 50, 75 or 100 nucleotides of SEQ ID NO: 1 or about 5, 10, 20, 25, 30, 50, 75 or 100 nucleotides of a sequence complementary to SEQ ID NO: 1. In one embodiment, oligonucleotides having nucleotide sequences of specific polymorphic variants are attached to a hybridizing membrane and this membrane is then hybridized with labeled sample nucleic acid. Analysis of the hybridization signal will then reveal the identity of the polymorphic variants of the sample nucleic acid. In a preferred embodiment, several probes capable of hybridizing specifically to polymorphic variants are attached to a solid phase support, e.g., a "chip". Oligonucleotides can be bound to a solid support by a variety of processes, including lithography. For example, a chip can hold up to 250,000 oligonucleotides (GeneChip, Affymetrix). Mutation detection analysis using these chips comprising oligonucleotides, also termed "DNA probe arrays" is described e.g., in Cronin et al, 1996, Human Mutation, 7:244 and in Kozal et al., 1996, Nature Medicine, 2: 753. In one embodiment, a chip comprises all the polymorphic variants of at least one polymorphic region of a gene. The solid phase support is then contacted with a test nucleic acid and hybridization to the specific probes is detected. Accordingly, the identity of numerous polymorphic variants of one or more genes can be identified in a simple hybridization experiment. For example, the identity of the polymorphic variant at any of the polymorphic sites described herein can be determined in a single hybridization experiment. In an exemplary embodiment, the identity of the polymorphic variant at the SNPs from Table 1 (SEQ ID NOs: 4 to 71) and the complements of sequences identified by SEQ ID NOs: 4' to 71 'may be determined in a single hybridization experiment.

Alternatively, allele specific amplification technology which depends on selective PCR amplification may be used. Oligonucleotides used as primers for specific amplification may carry the polymorphic variant of interest in the center of the molecule (so that amplification depends on differential hybridization) (Gibbs et al., 1989, Nucleic Acids Res., 17:2437-2448) or at the extreme 3' end of one primer where, under appropriate conditions, a mismatch can prevent or reduce polymerase extension {Prossner, 1993, Tibtech, 11:238; Newton et al, 1989, Nucl. Acids Res., 17:2503). This technique is also termed "PROBE" for Probe Oligo Base Extension. In addition it may be desirable to introduce a novel restriction site in the region of the mutation to create cleavage-based detection (Gasparini et al, 1992, MoI. Cell Probes, 6:1).

Various detection methods described herein involve first amplifying at least a portion of a gene prior to identifying the polymorphic variant. Amplification can be performed, e.g., by PCR and/or LCR, according to methods known in the art. In one embodiment, genomic DNA of a cell is exposed to two PCR primers and amplification is carried out for a number of cycles that is sufficient to produce the required amount of amplified DNA. The primers may be about 5-50, about 10-50, about 10-40, about 10-30, about 10-25, about 15-50, about 15-40, about 15-30, about 15-25, or about 25-50 nucleotides in length and may be designed to hybridize to sites about 40-500 base pairs apart (e.g., to amplify a nucleotide sequence of about 40-500 base pairs in length).

Additional amplification methods include, for example, self-sustained sequence replication (Guatelli et al., 1990, Proc. Natl. Acad. Sci. U.S.A. 87:1874-1878), transcriptional amplification system (Kwoh et al., 1989, Proc. Natl. Acad. Sci. U.S.A. 86:1173-1177), Q-Beta Replicase (Lizardi et al, 1988, Bio/Technology, 6:1197), or any other nucleic acid amplification method, followed by the detection of the amplified molecules using techniques well known to those of skill in the art. These detection schemes are especially useful for the detection of nucleic acid molecules that may be present in very low numbers. Any of a variety of sequencing reactions known in the art can be used to directly sequence at least a portion of a gene and detect polymorphic variants by comparing the sequence of the sample sequence with the corresponding control sequence. Exemplary sequencing reactions include those based on techniques developed by Maxam and Gilbert, 1977, Proc. Natl. Acad. Sci. USA, 74:560 or Sanger et al, 1977, Proc. Nat.

Acad. Sci., 74:5463. It is also contemplated that any of a variety of automated sequencing procedures may be utilized to identify polymorphic variants (Naeve et al., 1995, Biotechniques, 19:448), including sequencing by mass spectrometry (U.S. 5,547,835, WO 94/16101, Cohen et al, 1996, Adv. Chromatogr., 36:127-162; Griffin et al., 1993, Appl. Biochem. Biotechnol., 38:147-159). It will be evident to one skilled in the art that, for certain embodiments, the occurrence of only one, two or three of the nucleic acid bases need be determined in the sequencing reaction. For instance, for a single nucleotide run, such as an A-track, only one nucleotide needs to be detected and therefore modified sequencing reactions can be carried out. Yet other suitable sequencing methods are disclosed, for example, in U.S. 5,580,732 and U.S. 5,571,676.

In some cases, the presence of a specific polymorphic variant in a DNA sample from a subject can be shown by restriction enzyme analysis. For example, a specific polymorphic variant can result in a nucleotide sequence comprising a restriction site which is absent from a nucleotide sequence of another polymorphic variant.

In other embodiments, alterations in electrophoretic mobility may be used to identify the polymorphic variant. For example, single strand conformation polymorphism (SSCP) may be used to detect differences in electrophoretic mobility between polymorphic variants {Cotton, 1993, Mutat. Res., 285:125-144). Single-stranded DNA fragments of sample and control nucleic acids are denatured and allowed to renature. The secondary structure of single-stranded nucleic acids varies according to sequence and the resulting alteration in electrophoretic mobility enables the detection of even a single base change. The DNA fragments may be labeled or detected with labeled probes. The sensitivity of the assay may be enhanced using RNA (rather than DNA), in which the secondary structure is more sensitive to a change in sequence. In another preferred embodiment, the subject method utilizes heteroduplex analysis to separate double stranded heteroduplex molecules on the basis of changes in electrophoretic mobility (Keen et al., 1991, Trends Genet, 7:5). In yet another embodiment, the identity of a polymorphic variant of a may be obtained by analyzing the movement of a nucleic acid comprising the polymorphic variant in polyacrylamide gels containing a gradient of denaturant, e.g., denaturing gradient gel electrophoresis (DGGE). When DGGE is used as the method of analysis, DNA will be modified to insure that it does not completely denature, for example by adding a GC clamp of approximately 40 bp of high-melting GC-rich DNA by PCR. In other embodiments, a temperature gradient may be used in place of a denaturing agent gradient to identify differences in the mobility of control and sample DNA (Rosenbaum and Reissner, 1987, Biophys. Chem., 265:1275).

In another embodiment, identification of the polymorphic variant is carried out using an oligonucleotide ligation assay (OLA), as described, e.g., in Landegren et al, 1988, Science, 241:1077-1080. The OLA protocol uses two oligonucleotides which are designed to be capable of hybridizing to abutting sequences of a single strand of a target. One of the oligonucleotides is linked to a separation marker, e.g., biotinylated, and the other is detectably labeled. If the precise complementary sequence is found in a target molecule, the oligonucleotides will hybridize such that their termini abut, and create a ligation substrate. Ligation then permits the labeled oligonucleotide to be recovered using a biotin ligand, such as avidin. Alternatively, some nucleic acid detection assays that combine attributes of PCR and OLA to achieve the exponential amplification of target DNA which is then detected using OLA.

Several techniques based on this OLA method have been developed and can be used to detect specific polymorphic variants of a gene, for example, using an oligonucleotide having 3 '-amino group and a 5'-phosphorylated oligonucleotide to form a conjugate having a phosphoramidate linkage or where OLA is combined with PCR permits typing of two alleles in a single microtiter well. By marking each of the allele-specific primers with a unique hapten, i.e., digoxigenin and fluorescein, each OLA reaction can be detected using hapten specific antibodies that are differently labeled, for example, with enzyme reporters such as alkaline phosphatase or horseradish peroxidase. This system permits the detection of the two alleles using a high throughput format that leads to the production of two different colors.

Polymorphic variants may also be identified using methods for detecting single nucleotide polymorphisms. Because single nucleotide polymorphisms constitute sites of variation flanked by regions of invariant sequence, their analysis requires no more than the determination of the identity of the single nucleotide present at the site of variation and it is unnecessary to determine a complete gene sequence for each patient. Several methods have been developed to facilitate the analysis of such single nucleotide polymorphisms.

In one embodiment, a single base polymorphism can be detected by using a specialized exonuclease-resistant nucleotide, as disclosed, e.g., in U.S. Patent No. 4,656,127. According to the method, a primer complementary to the allelic sequence immediately 3' to the polymorphic site is permitted to hybridize to a target molecule obtained from a subject. If the polymorphic site on the target molecule contains a nucleotide that is complementary to the particular exonuclease-resistant nucleotide derivative present, then that derivative will be incorporated onto the end of the hybridized primer. Such incorporation renders the primer resistant to exonuclease, and thereby permits its detection. Since the identity of the exonuclease-resistant derivative of the sample is known, a finding that the primer has become resistant to exonucleases reveals that the nucleotide present in the polymorphic site of the target molecule is complementary to that of the nucleotide derivative used in the reaction. This method has the advantage that it does not require the determination of large amounts of extraneous sequence data. In another embodiment of the invention, a solution-based method is used for determining the identity of a polymorphic variant (WO 91/02087). As in the Mundy method of U.S. 4,656,127, a primer is employed that is complementary to allelic sequences immediately 3' to a polymorphic site. The method determines the identity of the nucleotide at that site using labeled dideoxynucleotide derivatives, which, if complementary to the nucleotide of the polymorphic site will become incorporated onto the terminus of the primer.

An alternative method, known as Genetic Bit Analysis or GBA™ is described by Goelet et al. (WO 92/15712). The method uses mixtures of labeled terminators and a primer that is complementary to the sequence 3' to a polymorphic site. The labeled terminator that is incorporated is thus determined by, and complementary to, the nucleotide present in the polymorphic site of the target molecule being evaluated. In contrast to the method of Cohen et al. (WO 91/02087) the method of Goelet et al. is preferably a heterogeneous phase assay, in which the primer or the target molecule is immobilized to a solid phase.

Recently, several primer-guided nucleotide incorporation procedures for assaying polymorphic sites in DNA have been described (e.g., Kuppuswamy et al, 1991, Proc. Natl. Acad. ScL (U.S.A.), 88:1143-1147; Prezant et al, 1992, Hum. Mutat, 1:159-164; Nyren et al, 1993, Anal Biochem. 208:171-175). These methods differ from GBA™ in that they all rely on the incorporation of labeled deoxynucleotides to discriminate between bases at a polymorphic site. In such a format, since the signal is proportional to the number of deoxynucleotides incorporated, polymorphisms that occur in runs of the same nucleotide can result in signals that are proportional to the length of the run (Syvanen et al, 1993, Amer. J. Hum. Genet. 52:46-59).

If a polymorphic variant is located in an exon (either a coding or non-coding exon), the identity of the polymorphic variant can be determined by analyzing the molecular structure of the mRNA, pre-mRNA, or cDNA. The molecular structure can be determined using any of the above described methods for determining the molecular structure of the genomic DNA, e.g., sequencing and SSCP. In addition to methods which focus primarily on the detection of one nucleic acid sequence, profiles may also be assessed in such detection schemes. Fingerprint profiles may be generated, for example, by utilizing a differential display procedure, Northern analysis and/or RT- PCR.

Additional methods may be used for determining the identity of a polymorphic variant located in the coding region of a gene. For example, identification of a polymorphic variant which encodes a protein having a sequence variation can be performed using an antibody that specifically recognizes the protein variant, for example, using immunohisto chemistry, immunoprecipitation or immunoblotting techniques. Antibodies to protein variants may be prepared according to methods known in the art and as described herein.

In certain embodiments, polymorphic variants may be detected by determining variations in Ubpl protein expression and/or activity. The expression level (i.e., abundance), expression pattern (e.g., temporal or spatial expression pattern, which includes subcellular localization, cell type specificity), size, sequence, association with other cellular constituents (e.g., in a complex such as a UBPl complex), etc., of UBPl in a sample obtained from a subject may be determined and compared with a control, e.g., the expression level or expression pattern that would be expected in a sample obtained from a normal subject.

In general, such detection and/or comparison may be performed using any of a number of suitable methods known in the art including, but not limited to, immunoblotting (Western blotting), immunohistochemistry, ELISA, radioimmunoassay, protein chips (e.g., comprising antibodies to the relevant proteins), etc. Historical data (e.g., the known expression level, activity, expression pattern, or size in the normal population) may be used for purposes of the comparison. Such methods may utilize UBPl antibodies that can distinguish between UBPl variants that differ at sites encoded by polymorphic variants.

Generally applicable methods for producing antibodies are well known in the art and are described extensively in references cited above, e.g., Current Protocols in Immunology and Using Antibodies: A Laboratory Manual. Antibodies that specifically bind to antigenic determinants that comprise a region encoded by a polymorphic site of UBPl are useful in accordance with the methods described herein. According to certain embodiments, such antibodies are able to distinguish between UBPl polypeptides that differ by a single amino acid. Any of the antibodies described herein may be labeled. The methods described herein may also utilize panels of antibodies able to specifically bind to a variety of polymorphic variants of Ubp 1.

In general, preferred antibodies will possess high affinity, e.g., a IQ of <200 nM, and preferably, of <100 nM for a specific polymorphic variant of UBPl. Exemplary antibodies do not show significant reactivity (e.g., less than about 50%, 25%, 10%, 5%, 1%, or less, cross reactivity) with a different Ubpl polymorphic variant.

In other embodiments, polymorphic variants may be determined by determining a change in level of activity of a UBPl controlled protein. Such activity may be measured in a biological sample obtained from a subject. Methods for measuring UBPl controlled protein activity could include determination of the mRNA, proteins and enzyme activities that are controlled by UBPl . Methods of the invention

Provided herein are methods useful for for risk assessment and/or diagnosis and/or prognosis of a disease or a disorder related to or associated with the control of arterial blood pressure, notably hypertension or a cardiovascular disorder in a subject, using one or more polymorphic variants of Ubpl or a homolog thereof. The methods disclosed herein may be used, for example, to identify a subject suffering from or susceptible to develop hypertension or a cardiovascular disorder, e.g., to identify a subject that would benefit from a treatment with an agent useful for preventing or treating hypertension or a cardiovascular disorder or from a specific life style change (e.g., diet, exercise program) useful for preventing hypertension or a cardiovascular disorder to develop, based on the presence or absence of one or more polymorphic variants in a subject. In certain embodiments, a panel of polymorphic variants may be defined that predict the risk of an Ubpl mediated disease or disorder and/or predict drug response to a therapeutic agent. This predictive panel is then used for genotyping of patients on a platform that can genotype multiple polymorphic variants, such as SNPs, at the same time (Multiplexing). Preferred platforms include, for example, gene chips (Affymetrix) or the Luminex LabMAP reader. The subsequent identification and evaluation of a patient's haplotype can then help to guide specific and individualized therapy.

Kits and Screening Assays of the invention

Provided herein are kits that may be used to determine the presence or absence of one or more polymorphic variants of Ubpl or a homolog thereof. Such kits may be used to diagnose, or predict a subject's susceptibility to, an Ubpl mediated disease or disorder. This information could then be used, for example, to optimize treatment with an agent useful for treating a disease or a disorder related to or associated with the control of arterial blood pressure such as hypertension or a cardiovascular disorder for subjects having one or more polymorphic variants.

In preferred embodiments, the kit comprises a probe or primer which is capable of hybridizing to a polymorphic variant of an Ubpl gene or a homolog thereof thereby determining whether the Ubpl gene or homolog thereof contains a polymorphic variant that is associated with a risk of having or developing an Ubpl mediated disease or disorder. The kit may further comprise instructions for use in diagnosing a subject as having, or having a predisposition, towards developing an Ubpl mediated disease or disorder. The probe or primers of the kit can be a probe or primer that binds to SEQ ID NO: 1, or a sequence complementary thereto. Such probe or primers may bind, for example, at and/or flanking a polymorphic site of Ubpl or a homolog thereof, such as the sites set forth in Table 1 or as described herein above.

The design of probes according to the invention will be apparent to the molecular biologist of ordinary skill. Such probes are of any convenient length such as up to 50 bases, up to 40 bases, more conveniently up to 30 bases in length, such as for example 8-25 or 8-15 bases in length. In general such probes will comprise base sequences entirely complementary to the corresponding wild type or variant locus in the gene. However, if required one or more mismatches may be introduced, provided that the discriminatory power of the oligonucleotide probe is not unduly affected. The probes of the invention may carry one or more labels to facilitate detection.

Kits for amplifying a region of a gene comprising a polymorphic variant of Ubpl of interest may comprise one, two or more primers.

In an exemplary embodiment, a kit may comprise a microarray suitable for detection of a variety of Ubp l or homolog thereof polymorphic variants. Examples of such microarrays are described further herein above.

In other embodiments, the kits provided herein may comprise one or more antibodies that are capable of specifically recognizing a polypeptide variant of Ubpl or a homolog thereof arising from a polymorphic variant of an Ubpl nucleic acid sequence. In an exemplary embodiment, the kit may include a panel of antibodies able to specifically bind to a variety of polypeptide variants of Ubpl encoded by polymorphic variants of Ubpl nucleic acid sequences. The kits may further comprise additional components such as substrates for an enzymatic reaction. The antibodies may be used for research, diagnostic, and/or therapeutic purposes.

The diagnostic kits may comprise appropriate packaging and instructions for use in the methods of the invention. Such kits may further comprise appropriate buffer(s) and polymerase(s) such as thermostable polymerases, for example taq polymerase. Such kits may also comprise accompanying primers and/or control primers or probes. An accompanying primer is one that is part of the pair of primers used to perform PCR. Such primer usually complements the template strand precisely.

References cited herein are hereby incorporated by reference in their entirety. The invention now being generally described, it will be more readily understood by reference to the following examples which are included merely for purposes of illustration of certain aspects and embodiments of the present invention, and are not intended to limit the invention in any way.

EXAMPLES

The following abbreviations refer respectively to the definitions below:

GWA (Genome Wide Association analysis), BMI (body mass index), BP

(bloodpressure), T2DM (type-2 diabetes mellitus).

GENERAL PROCEDURES & CONDITIONS

It will be appreciated that while certain polymorphic variants may be responsible for disease or phenotypic variation by, for example, causing a functional alteration in an encoded protein, many polymorphisms appear to be silent in that no known detectable difference in phenotype exists between individuals having different alleles. However, polymorphisms (whether silent or not) may be physically and/or genetically linked to genes or DNA sequences in which mutations or variations confer susceptibility to and/or play a causative role in disease (i.e., they are located within a contiguous piece of DNA). In the absence of genetic recombination, polymorphisms that are physically linked to such mutations or variations will generally be inherited together with the mutation or alteration.

With increasing genetic recombination between any given polymorphism and a causative mutation or variation, the extent of co -inheritance will be reduced. Since the likelihood of genetic recombination between loci generally increases with increasing distance between the loci (though not necessarily in a linear fashion), co-inheritance of a particular polymorphism and a particular phenotype suggests that the polymorphism is located in proximity to a causative mutation or variation. Thus studying the co- inheritance of polymorphic variants, e.g., SNPs, allows identification of genomic regions likely to harbor a mutation or variation that, alone or in combination with other mutations or variations, causes or increases susceptibility to disease. Polymorphisms are thus useful for genetic mapping and identification of candidate genes, in which mutations or variations may play a causative role in disease. In addition, detection of particular polymorphic variants (alleles) is useful for diagnosis of disease or susceptibility to disease as described herein. Studies provided herein have linked increased systolic and diastolic blood pressure with polymorphic variants of UBPl. EXAMPLE 1: GENETIC ANALYSIS OF UBPl

The following example describes a clinical genetic study showing the association of genetic variations in the human UBPl gene is associated with blood pressure variation.

EUGENE2 genome wide association

The participants were healthy, non-diabetic offspring of patients with type 2 diabetes, as previously described in detail (Laakso et ah, 2008, Diabetologia, 51, 502). One of the parents had to have type 2 diabetes and the other parent normal glucose tolerance in an oral glucose tolerance test and/or no history of type 2 diabetes in the family. The probands were randomly selected among type 2 diabetic patients living in the regions of five centers in Europe. They were recruited over a 4-year period through advertisements in public media and in the hospitals. The acceptance rate of volunteers was at least 70% in the different centers. Altogether 869 offspring, having blood pressure (BP) measurements, were included in the study from the following centers: Copenhagen, Denmark (n=257), Gothenburg, Sweden (n=134), Kuopio, Finland (n=299) and Tubingen, Germany (n=179). The appropriate Institutional Review Boards approved the study protocol. All study participants gave informed consent.

Measurements

All centers followed the same protocol. BP was measured with a mercury sphygmomanometer in the sitting position after a 5 min rest. The average of two measurements was used in statistical analyses. BP of individuals who were on BP medication (8.6% of study subjects) was adjusted by adding 15 mmHg to systolic and 10 mmHg to diastolic BP. Height and weight were measured to the nearest 0.5 cm and 0.1 kg, respectively and BMI (kg/m²) calculated. Because the primary aim of the study was to investigate the genes associated with insulin secretion and insulin sensitivity, every participant underwent detailed metabolic studies, as described {Laakso et al.,

2008, above).

Sample preparation, genotyping and quality control

SNP genotyping was performed with the commercial release of the Infinium

HumanHap 550k version 3 chips (Illumina, San Diego, CA), containing SNPs derived from Phase I and II of the International HapMap project (http:/www.hapmap.org).

Briefly, 750 ng of DNA was used in genotyping according to the manufacturer's p r o t o c o l ( I l l u m i n a ) . S o f t w a r e p a c k a g e P L I N K (http://pngu.mgh.harvard.edu/~purcell/plink/) was used for quality control and association analysis of the GWA data.

Individual exclusion criteria

Gender calls from X chromosome genotype data was verified to be in concordance with the reported gender of each individual. To verify known familial relationships and to detect not reported first-degree cryptic relationships, pairwise identity-by-descent (IBD) analysis was performed. Individuals with genotyping call rates less than 95% were excluded, resulting in total of 903 out of 970 samples passing these criteria. Of these individuals, 869 had the required phenotype data and these individuals advanced to the actual association analysis. Total genotyping call rate in remaining individuals was 99.6%.

Marker exclusion criteria

Markers advanced to the actual association analysis if they passed the following quality control criteria 1) had a 95% genotype call rate (4007 markers excluded), 2) had a minor allelic frequency (MAF) >1% (23107 markers excluded) and 3) demonstrated Hardy- Weinberg Equilibrium (HWE) with a P > le-05 (890 markers excluded). Total of 534 287 markers passed these quality control criteria. In addition, for each marker, tests for MAF, HWE and missingness were performed, and this information was used when evaluating marker quality for replication.

Marker imputation

Phase 2 HapMap (release 23) CEU (Utah residents with Northern and Western European ancestry from the CEPH collection) founder population data (60 individuals with MAF > 0.01 and genotyping rate > 0.95) were used to impute markers that were not directly genotyped. PLINK' s discrete genotype calls imputation with confidence threshold of 0.8 was used for imputation. Same marker exclusion criteria that were used for filtering directly genotyped markers were used for imputed markers.

METSIM replication study

METSIM (METabolic Syndrome In Men) study is a study including 10,000 men, aged from 50 to 70 years, randomly selected from the population register of Kuopio town, Eastern Finland (population of 95,000). Every participating subject has one-day outpatient visit to the University of Kuopio, including an interview on the history of previous diseases and current drug treatment, and an evaluation of cardiovascular risk factors. Blood pressure (BP) was measured in subjects a sitting position after a 5-minute rest with a mercury sphygmomanometer. The average of 3 measurements was used to calculate systolic and diastolic BPs. Height and weight were measured to the nearest 0.5 cm and 0.1 kg, respectively. Body mass index was calculated as weight (kg) divided by height (m) squared. The study protocol was accepted by the Ethics Committee of the University of Kuopio and Kuopio University Hospital. Genotyping was performed using the TaqMan Allelic Discrimination Assays (Applied Biosystems) or using the iPLEX Sequenom MassARRAY platform.

RIAD replication study

A total of 622 subjects (284 men and 338 women), who were participants of the RIAD study is a prospective survey on the i?isk factors in impaired glucose tolerance for atherosclerosis and diabetes (Temelkova-Kurktschiev et al, 2004, J. Clin. Endocrinol.

Metab., Vol. 89, 4238). In brief, subjects from 40-7 Oyr of age were examined who had risk factors for the development of T2DM, such as a family history of T2DM, obesity, and/or hyper/ dyslipoproteinemia. Known diabetes, medication affecting glucose tolerance, liver and kidney diseases, thyroidgland functional disorders, and acute infections were exclusion criteria. Written consent was obtained from all participants. In this study subjects, aged < 55 years were included in the study (N=237). The study protocol included measurements of BP, weight, height, and waist measurements. Systolic and diastolic BP was measured in subjects a sitting position after a 5-minute rest with a mercury sphygmomanometer. The study was accepted by the local Ethics Committee. Genotyping was performed using the TaqMan Allelic Discrimination

Assays (Applied Biosystems).

Association analysis of genotyping results

Association analyses of the genotyping results were carried out using SPSS 15.0 for

Windows (Chicago, IL, USA). Association was tested for both systolic (SBP) and diastolic (DBP) blood pressures and variables with skewed distribution were logarithmically transformed for statistical analysis. For analysis of EUGENE2 genotyping results, mixed linear models were used. The family (sibship) and centre were included as random factors, the sex as a fixed factor, and both age and BMI as covariates. For analysis of the METSIM and RIAD genotyping results, linear regression models were used, and both SBP and BP were adjusted for significant covariates (age and BMI for METSIM, and age, BMI and gender for RIAD). Additive model was used for all analysis. Effect sizes were calculated in all of the studies by using linear regression, with non-log transformed BPs as dependent variables. BPs were adjusted for significant covariates. For both traits the pooled test of association was determined using fixed model inverse variance weighted meta-analysis from R's gap: Genetic analysis package version 1.0-17 (http://cran.r-project.org/web/packages/gap/).

Initial marker screening was directed to the genomic location indicated by a mouse model (human chromosome 3, 33.2-33.9 Mb region). After marker exclusion, there were 306 markers located on this region (76 directly genotyped, 230 imputed) on which association analysis for both systolic BP and diastolic BP was performed for these markers. Two SNPs in the region of UBP1-FBXL2 gave the strongest association (rsl7030583, UBPl, intron 11, G/A; rs2291897, FBXL2, intron 1 1, C/T; Fig. 1), and were replicated in two other cohorts, the Finnish METSIM (Metabolic Syndrome In Men) (N=2537) and the German RIAD (Risk factors in Impaired glucose tolerance for Atherosclerosis and Diabetes) (N=237) (Temelkova-Kurktschiev, et ah, 2004, above). Statistical analyses of the replication cohorts were also restricted to the age range of subjects < 55 years. Statistically significant associations of systolic and diastolic BP was observed with these two SNPs under the additive model (Table 2). SNP rs2291897 (G/A) in the pooled data was significantly associated with systolic (P = 0.00036) and diastolic BP (P = 0.0030). The pooled effect size of this SNP was 1.5 (0.4) for systolic and 0.8 (0.3) mmHg with diastolic BP. Similarly, rsl70305383 (C/T) was associated with systolic (P = 0.00099) and diastolic BP (P = 0.00036), with pooled effect size of 1.3 (0.4) for systolic and 0.8 (0.3) mmHg with diastolic BP. The association of rsl7030583 and rs2291897 with BP levels was determined in the entire cohort of the METSIM Study (N=7422) and RIAD Study (N=617), and no association with BP levels was found. This lack of association was limited to the age range > 55 years, and explained by a very strong interaction of rs 17030583 and rs2291897 with age on its effects on systolic BP (rs2291897: METSIM Study P=6A x 10^~87, RIAD Study P=I.3 x

10^~4).

The three SNPs giving the most significant P values in those association analyses

(rs2291897, rs2272152, rsl7030583) belong to the FBXL2/UBP1 gene locus (Fig. 1). This locus belongs to a haploblock including also other genes (CLASP2, PDC61P, SUSD5). Therefore, the SNPs genotyped in the METSIM cohort are those giving the most significant P value from CLASP2 (rs9841066), PDC61P (rs9311032, rs9858195), and SUSD5 (rs4678778, rs9836433, rsl0222597) loci (SEQ ID NO:73 to 78 and their reverse complement 73' to 78') to exclude the possibility that these genes could be responsible for the association signal. No association of these SNPs either with systolic or diastolic BP was found suggesting that the FBXL2/UBP1 gene locus represents the best association signal with systolic and diastolic BP. Rs2291897 (minor allele A, major allele G) is located on chromosome 3 (position 33394426) in intron 11 of FBXL2, and is almost in complete linkage disequilibrium (99.6%) with rs2272152 located 23 bp from the acceptor site of exon 4 of UBPl. A significant association of rsl7030583 (minor allele T, major allele C) in UBPl with systolic BP was also found, it is likely that these findings are explained by a signal from the UBPl region (linkage disequilibrium between rs2291897 and rsl7030583 was 75% in this study).

Claims

CLAIMS We claim:

1. An in vitro method for risk assessment and/or diagnosis and/or prognosis

of a disease or a disorder related to or associated with the control of arterial blood pressure in a subject, comprising the following steps:

(a) Detecting in a nucleic acid sample from said subject the presence or absence of at least one polymorphic variant in human Ubpl gene or a homologue thereof, wherein the polymorphic variant is in a nucleic acid sequence that encodes for the UBP-I or homologue thereof mRNA/protein, controls expression of Ubpl gene or homologue thereof or encodes an Ubpl or homologue thereof controlled protein; and

(b) Comparing the variant data obtained in step (a) to Ubp l or homologue thereof variant data from healthy and/or diseased subjects, wherein the variant data are correlated with a disease or a disorder related to or associated with the control of arterial blood pressure status in said subject.

2. The method according to claim 1, wherein the method comprises a step of detecting an at-risk allele of a SNP associated with a disease or disorder related to or associated with the control of arterial blood pressure status in said subject, wherein the SNP is located within a sequence selected from the Table 1.

3. The method according to claims 1 or 2 wherein at least one of the variants is a

polymorphic site associated with at least one single nucleotide polymorphism (SNP) listed in Table 2.

4. The method according to any one of claims 1 to 3 wherein at least one of the

variants is a polymorphic site associated with at least one SNP selected from rs2291897 (SEQ ID NO: 17), rs2272152 (SEQ ID NO: 46) and rsl7030583 (SEQ

ID NO: 4).

5. A method according to any one of claims 1 to 4 wherein said method is for

monitoring the effect of a therapy administered to a subject having a disease or a disorder related to or associated with the control of arterial blood pressure.

6. A method according to any one of claims 1 to 5 wherein an increase in the level of Ubpl or homologue thereof variants compared to healthy control indicates that said subject is suffering from or has a predisposition to develop a disease or a disorder related to or associated with the control of arterial blood pressure.

7. A method according to any one of claims 1 to 6 wherein the said subject's age is lower or of about 55 years.

8. A method according to any one of claims 1 to 7 wherein the disease or disorder is hypertension or a cardiovascular disorder.

9. An isolated polynucleotide comprising a SNP located within a sequence selected from the group consisting of sequences identified by SEQ ID NOs: 4 to 71 and the complements of sequences identified by SEQ ID NOs: 4' to 71 '.

10. An oligonucleotide probe comprising polynucleotide according to claim 9.

11. A vector comprising an isolated polynucleotide according to claim 9, wherein said isolated polynucleotide is operably linked to a regulatory sequence.

12. A diagnostic kit comprising one or more probe or primer which is capable of

hybridizing to a polymorphic variant of an Ubpl gene or homo log thereof thereby determining whether the Ubpl gene or homo log thereof contains a polymorphic variant.

13. A diagnostic kit according to claim 12 wherein the said probe or primer that binds to SEQ ID NO: 1, or a sequence complementary thereto.

14. A diagnostic kit according to claims 12 or 13 comprising one or more

polynucleotide according to claim 9 or oligonucleotide probe according to claim 10.

15. A diagnostic kit according to any one of claims 12 to 14 for the detection of SNP haplotypes associated with a disease or a disorder related to or associated with the control of arterial blood pressure.