WO2010138908A1 - Igfir gene copy number as a prognostic marker in a non-small cell lung cancer - Google Patents

Abstract

Disclosed herein are methods of predicting prognosis of a neoplastic disease (such as lung cancer, for example NSCLC), including determining the IGF1R gene copy number in a biological sample from a patient having a neoplastic disease; wherein an increase in IGF1R gene copy number predicts a good prognosis of the neoplastic disease in the patient. Also disclosed herein are methods of scoring copy number of a gene of interest in a biological sample. The method includes identifying individual cells in the sample having highest number of signals for the gene of interest detected by in situ hybridization, counting the number of signals for the gene of interest in the identified individual cells and determining an average number of signals per cell.

Description

IGFlR GENE COPY NUMBER AS A PROGNOSTIC MARKER IN A NON- SMALL CELL LUNG CANCER

CROSS REFERENCE TO RELATED APPLICATION This claims the benefit of U.S. Provisional Application No. 61/217,390, filed

May 29, 2009, which is incorporated by reference herein in its entirety.

FIELD

This disclosure relates to the field of cancer and particularly to methods for determining the prognosis of patients with cancer. This disclosure also relates to methods for scoring gene copy number detected by in situ hybridization.

ACKNOWLEDGMENT OF GOVERNMENT SUPPORT

This invention was made with government support under SPORE grant No. P50 CA058187 awarded by the National Institutes of Health. The government has certain rights in the invention.

JOINT RESEARCH AGREEMENT

This application describes and claims certain subject matter that was developed under a written joint collaborative research agreement between Ventana Medical

Systems, Inc. and The Regents of the University of Colorado, a body corporate, for and on the behalf of the University of Colorado at Denver Health and Science Center, having an effective date of December 11, 2007, as amended on July 31, 2008.

BACKGROUND

Non-small cell lung cancer (NSCLC) accounts for almost 80% of all lung cancers. This group of cancers includes adenocarcinomas, which account for approximately 50% of all cases of non-small cell lung cancer; squamous cell carcinomas, which include approximately 30% of all cases of non-small cell lung cancer; and large cell carcinomas, which account for about 10% of all non-small cell lung cancers.

Current advances in molecular cancer therapeutics provide unique opportunities to identify prognostic indicators for specific patient populations. Gene amplification and/or overexpression have been identified as an indicator of patient prognosis in a variety of tumors. For example, amplification and/or overexpression of the human epidermal growth factor receptor 2 (HER2, also known as ERBB2) tyrosine kinase is detected in 20-25% of human breast cancers. This alteration is an independent prognostic factor predictive of poor clinical outcome and a high risk of recurrence. Similarly, amplification or overexpression of the epidermal growth factor receptor (EGFR) is detected in numerous cancers (such as NSCLC, breast cancer, glioma, and head and neck cancer) and may be associated with poor prognosis. Additional markers that can predict prognosis, such as patient survival, continue to be identified.

SUMMARY

Disclosed herein are methods of predicting prognosis of a neoplastic disease (such as lung cancer, for example NSCLC), including determining the insulin-like growth factor 1 receptor (IGFlR) gene copy number in a biological sample from a patient having a neoplastic disease; wherein an increase in IGFlR gene copy number predicts a good prognosis of the neoplastic disease in the patient. In some examples, an increased IGFlR gene copy number includes an IGFlR gene copy number per nucleus in the sample of greater than about two copies of the IGFlR gene per nucleus (such as greater than 2, 3, 4, 5, 10, or 20 copies). In other examples, an increased IGFlR gene copy number includes a ratio of IGFlR gene copy number to Chromosome 15 gene copy number in the sample of greater than about 1 (such as a ratio of greater than 2, 3, 4, 5, 10, or 20). In some method embodiments, a good prognosis is greater than 1-year survival (such as greater than 2-year survival, greater than 3-year survival, or greater than 5-year survival) of the patient after initial diagnosis of the neoplastic disease.

- ? - Other prognostic method embodiments involve detecting the IGFlR gene copy number in a biological sample from a patient having a neoplastic disease (such as lung cancer, for example NSCLC), wherein substantially no increase or a decrease in IGFlR gene copy number (such as an IGFlR gene copy number of about 2 or less) predicts a poor prognosis of the neoplastic disease in the patient.

Also disclosed herein are methods of scoring copy number of a gene of interest in a biological sample, such as gene copy number detected by an in situ hybridization assay. The method includes identifying individual cells in the sample having highest number of signals for the gene of interest detected by in situ hybridization, such that individual copies of the gene are distinguishable in cells in the sample. The number of signals for the gene is then counted in the identified individual cells and an average number of signals per cell is determined. In some examples, the biological sample includes a tumor sample (such as a breast cancer sample or a lung cancer sample). In particular examples, the number of cells identified for counting is at least 20 cells (such as at least 25, 30, 40, 50, 100, 200, 500, or 1000 cells).

In other examples the method also includes counting the number of signals for a reference (such as a chromosomal locus known not to be abnormal, for example, centromeric DNA) detected by in situ hybridization in the identified cells and determining an average ratio of the number of signals for the gene of interest to the number of signals for the reference. In particular examples, the reference and the gene of interest are on the same chromosome.

The foregoing and other features will become more apparent from the following detailed description, which proceeds with reference to the accompanying figures.

BRIEF DESCRIPTION OF THE DRAWINGS

FIG. 1 is a histogram showing the distribution of IGFlR gene copy number in a population of NSCLC patients.

FIG. 2 is a pair of digital images showing dual IGFlR and chromosome 15 ISH in NSCLC adenocarcinoma (left) and squamous cell carcinoma (right). FIG. 3 is a Kaplan-Meier plot showing progression- free survival by IGFlR gene copy number.

FIG. 4 is a Kaplan-Meier plot showing overall survival by IGFlR gene copy number. FIG. 5 A is a series of digital images showing IGFlR SISH (top) and IHC

(bottom) in NSCLC squamous cell carcinoma samples.

FIG. 5B is a series of digital images showing IGFlR SISH (top) and IHC (bottom) in NSCLC adenocarcinoma samples.

FIG. 6 is a histogram showing IGFlR protein expression (H score) determined by IHC according to IGFlR gene copy number.

FIG. 7 is a schematic of exemplary methods of scoring gene copy number. Optional steps are enclosed in dashed lines.

FIG. 8 is a series of graphs showing overall survival according to IGFlR gene copy number by FISH (cutoffs according to EGFR criteria; Cappuzzo et al, J. Natl. Cancer Inst. 97:643-655, 2005; FIG. 8A), IGFlR immunochemistry score (cutoff by median; FIG. 8B), and IGFlR mRNA expression (cutoff by median; FIG. 8C).

FIG. 9 is a series of digital images showing IGFlR gene copy number assessment by FISH; FIG. 9A, low IGFlR gene copy number; FIG. 9B, IGFlR high gene polysomy; FIG. 9C, IGFlR gene amplification. FIG. 10 is a plot showing IGFlR IHC score according to IGFlR gene copy number by FISH.

SEQUENCE LISTING

Any nucleic acid and amino acid sequences listed herein or in the accompanying sequence listing are shown using standard letter abbreviations for nucleotide bases, and three letter code for amino acids, as defined in 37 C.F.R. § 1.822. In at least some cases, only one strand of each nucleic acid sequence is shown, but the complementary strand is understood as included by any reference to the displayed strand. SEQ ID NOs: 1 and 2 are forward and reverse primers, respectively, used to amplify IGFlR.

SEQ ID NOs: 3 and 4 are forward and reverse primers, respectively, used to amplify β-actin.

DETAILED DESCRIPTION /. Abbreviations

CISH: chromogenic in situ hybridization

FISH: fluorescent in situ hybridization IGFlR: insulin-like growth factor 1 receptor

IHC: immunohistochemistry

ISH: in situ hybridization

NSCLC: non-small cell lung cancer

OS: overall survival PFS: progression-free survival

SISH: silver in situ hybridization

TMA: tissue microarray

//. Terms Unless otherwise explained, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which a disclosed invention belongs. The singular terms "a," "an," and "the" include plural referents unless context clearly indicates otherwise. Similarly, the word "or" is intended to include "and" unless the context clearly indicates otherwise. "Comprising" means "including." Hence "comprising A or B" means "including A" or "including B" or "including A and B.

Suitable methods and materials for the practice and/or testing of embodiments of a disclosed invention are described below. Such methods and materials are illustrative only and are not intended to be limiting. Other methods and materials similar or equivalent to those described herein can be used. For example, conventional methods well known in the art to which a disclosed invention pertains are described in various general and more specific references, including, for example, Sambrook et al., Molecular Cloning: A Laboratory Manual, 2d ed., Cold Spring Harbor Laboratory Press, 1989; Sambrook et ah, Molecular Cloning: A Laboratory Manual, 3d ed., Cold Spring Harbor Press, 2001; Ausubel et ah, Current Protocols in Molecular Biology, Greene Publishing Associates, 1992 (and Supplements to 2000); Ausubel et ah, Short Protocols in Molecular Biology: A Compendium of Methods from Current Protocols in Molecular Biology, 4th ed., Wiley & Sons, 1999; Harlow and Lane, Antibodies: A Laboratory Manual, Cold Spring Harbor Laboratory Press, 1990; and Harlow and Lane, Using Antibodies: A Laboratory Manual, Cold Spring Harbor Laboratory Press, 1999.

All sequences associated with the GenBank Accession Nos. mentioned herein are incorporated by reference in their entirety as were present on May 29, 2009, to the extent permissible by applicable rules and/or law.

In order to facilitate review of the various embodiments of the disclosure, the following explanations of specific terms are provided:

Copy number (gene copy number): The number of copies of a nucleic acid molecule in a cell. The gene copy number includes the number of copies of one or more genes or portions thereof in genomic (chromosomal) DNA of a cell. In a normal cell (such as a non-tumor cell), the copy number of a gene (or any genomic DNA) is usually about two (one copy on each member of a chromosome pair). In some examples, the copy number of a gene or nucleic acid molecule includes an average copy number taken from a population of cells.

DNA (deoxyribonucleic acid): DNA is a long chain polymer which comprises the genetic material of most living organisms (some viruses have genes comprising ribonucleic acid (RNA)). The repeating units in DNA polymers are four different nucleotides, each of which comprises one of the four bases, adenine, guanine, cytosine and thymine bound to a deoxyribose sugar to which a phosphate group is attached. Triplets of nucleotides (referred to as codons) code for each amino acid in a polypeptide, or for a stop signal (termination codon). The term codon is also used for the corresponding (and complementary) sequences of three nucleotides in the mRNA into which the DNA sequence is transcribed.

Unless otherwise specified, any reference to a DNA molecule is intended to include the reverse complement of that DNA molecule. Except where single- strandedness is required by the text herein, DNA molecules, though written to depict only a single strand, encompass both strands of a double-stranded DNA molecule. Thus, a reference to the nucleic acid molecule that encodes IGFlR, or a fragment thereof, encompasses both the sense strand and its reverse complement. Thus, for instance, it is appropriate to generate probes or primers from the reverse complement sequence of the disclosed nucleic acid molecules.

Hybridization: To form base pairs between complementary regions of two strands of DNA, RNA, or between DNA and RNA, thereby forming a duplex molecule. Hybridization conditions resulting in particular degrees of stringency will vary depending upon the nature of the hybridization method and the composition and length of the hybridizing nucleic acid sequences. Generally, the temperature of hybridization and the ionic strength (such as the Na concentration) of the hybridization buffer will determine the stringency of hybridization. Calculations regarding hybridization conditions for attaining particular degrees of stringency are discussed in Sambrook et al., (1989) Molecular Cloning, second edition, Cold Spring Harbor Laboratory, Plainview, NY (chapters 9 and 11) and Ausubel et al., Short Protocols in Molecular

Biology: A Compendium of Methods from Current Protocols in Molecular Biology, 4th ed., Wiley & Sons, 1999.

In situ hybridization (ISH): A type of hybridization using a labeled complementary DNA or RNA strand {i.e., probe) to localize a specific DNA or RNA sequence in a portion or section of tissue (in situ), or, if the tissue is small enough (e.g., plant seeds, Drosophila embryos), in the entire tissue (whole mount ISH). This is distinct from immunohisto chemistry, which localizes proteins in tissue sections. DNA ISH can be used to determine the structure of chromosomes, such as for use in medical diagnostics to assess chromosomal integrity. RNA ISH (hybridization histochemistry) is used to measure and localize mRNAs and other transcripts within tissue sections or whole mounts.

For hybridization histochemistry, sample cells and tissues are usually treated to fix the target transcripts in place and to increase access of the probe to the target molecule. As noted above, the probe is either a labeled complementary DNA or a complementary RNA (riboprobe). The probe hybridizes to the target sequence at elevated temperature, and then the excess probe is washed away (after prior hydrolysis using RNase in the case of unhybridized, excess RNA probe). Solution parameters, such as temperature, salt and/or detergent concentration, can be manipulated to remove most or all non-identical interactions (e.g. only sequences that are substantially identical or exact sequence matches will remain bound). Then, the labeled probe having been labeled effectively, such as with either radio-, fluorescent- or antigen-labeled bases (e.g. , digoxigenin), is localized and potentially quantitated in the tissue using autoradiography, fluorescence microscopy or immunohistochemistry, respectively. ISH can also use two or more probes, labeled with radioactivity or non-radioactive labels, such as hapten labels, and typically differentially labeled to simultaneously detect two or more nucleic acid molecules.

Insulin-like growth factor 1 receptor (IGFlR): A tyrosine kinase receptor that binds insulin-like growth factor with high affinity. IGFlR is a heterotetramer of two extracellular α subunits and two membrane spanning β subunits which include a tyrosine kinase domain. Upon ligand binding, IGFlR becomes phosphorylated and signals via the MAP kinase and Akt/mTOR pathways.

Nucleic acid and protein sequences for IGFlR are publicly available. For example, GENBANK® Accession No. NC_000015 (nucleotides 97010284-97325282) discloses an exemplary human IGFlR genomic sequence (incorporated by reference as provided by GENBANK® on May 29, 2009). In other examples, GENBANK® Accession Nos.: NM_000875, BCl 13610, and X04434 disclose exemplary IGFlR nucleic acid sequences, and GENBANK® Accession Nos.: NP_000866, AAI13611, and CAA28030 disclose exemplary IGFlR protein sequences, all of which are incorporated by reference as provided by GENB ANK® on May 29, 2009. In certain examples, IGFlR has at least 80% sequence identity, for example at least 85%, 90%, 95%, or 98% sequence identity to a publicly available IGFlR sequence, and is an IFGlR whose gene copy number can predict the prognosis of a patient with neoplastic disease, such as NSCLC.

In vitro amplification: Techniques that increase the number of copies of a nucleic acid molecule in a sample or specimen by in vitro, or laboratory techniques. An example of in vitro amplification is the polymerase chain reaction, in which a biological sample collected from a subject is contacted with a pair of oligonucleotide primers, under conditions that allow for the hybridization of the primers to nucleic acid template in the sample. The primers are extended under suitable conditions, dissociated from the template, and then re-annealed, extended, and dissociated to amplify the number of copies of the nucleic acid.

The product of in vitro amplification may be characterized by electrophoresis, restriction endonuclease cleavage patterns, oligonucleotide hybridization or ligation, and/or nucleic acid sequencing, using standard techniques.

Other examples of in vitro amplification techniques include strand displacement amplification (see U.S. Patent No. 5,744,311); transcription-free isothermal amplification (see U.S. Patent No. 6,033,881); repair chain reaction amplification (see WO 90/01069); ligase chain reaction amplification (see EP-A-320 308); gap filling ligase chain reaction amplification (see U.S. Patent No. 5,427,930); coupled ligase detection and PCR (see U.S. Patent No. 6,027,889); andNASBA™ RNA transcription- free amplification (see U.S. Patent No. 6,025,134).

Label: An agent capable of detection, for example by ELISA, spectrophotometry, flow cytometry, or microscopy. For example, a label can be attached to a nucleic acid molecule or protein (such as IGFlR nucleic acid or protein), thereby permitting detection of the nucleic acid molecule or protein. Examples of labels include, but are not limited to, radioactive isotopes, enzyme substrates, co-factors, ligands, chemiluminescent agents, fluorophores, haptens, enzymes, and combinations thereof. Methods for labeling and guidance in the choice of labels appropriate for various purposes are discussed for example in Sambrook et al. (Molecular Cloning: A Laboratory Manual, Cold Spring Harbor, New York, 1989) and Ausubel et al. (In Current Protocols in Molecular Biology, John Wiley & Sons, New York, 1998). Lung cancer: A neoplastic condition of lung tissue that can be benign or malignant. The majority of lung cancers are non-small cell lung cancer (such as adenocarcinoma of the lung, squamous cell carcinoma, and large cell cancer). Most other lung cancers are small cell lung carcinomas. In particular examples, lung cancer includes non-small cell lung cancer. Probe: An isolated nucleic acid molecule attached to a detectable label or reporter molecule. Typical labels include radioactive isotopes, enzyme substrates, co- factors, ligands, chemiluminescent or fluorescent agents, haptens (including, but not limited to, DNP), and enzymes. Methods for labeling and guidance in the choice of labels appropriate for various purposes are discussed, e.g., in Sambrook et al. (In Molecular Cloning: A Laboratory Manual, CSHL, New York, 1989) and Ausubel et al. (In Current Protocols in Molecular Biology , Greene Publ. Assoc, and Wiley- Intersciences, 1992).

One of ordinary skill in the art will appreciate that the specificity of a particular probe increases with its length. Thus, probes can be selected to provide a desired specificity, and may comprise at least 17, 20, 23, 25, 30, 35, 40, 45, 50 or more consecutive nucleotides of desired nucleotide sequence. In particular examples, probes can be at least 100, 250, 500, 600 or 1000 consecutive nucleic acids of a desired nucleotide sequence (such as an IGFlR gene sequence).

Prognosis: A prediction of the course of a disease, such as cancer (for example, non-small cell lung cancer). The prediction can include determining the likelihood of a subject to develop aggressive, recurrent disease, to develop one or more metastases, to survive a particular amount of time {e.g., determine the likelihood that a subject will survive 1, 2, 3, 4, or 5 years), to survive a particular amount of time without disease progression {e.g., determine the likelihood that a subject will survive 1, 2, 3, 4, or 5 years without progression), to respond to a particular therapy (e.g., chemotherapy), or combinations thereof.

Sample: A biological specimen containing genomic DNA, RNA (including mRNA), protein, or combinations thereof, obtained from a subject. Examples include, but are not limited to, peripheral blood, urine, saliva, fine needle aspirate, tissue biopsy, surgical specimen, and autopsy material. In one example, a sample includes a tumor sample (for example a NSCLC sample), such as a tumor biopsy, tumor core, lymph node tissue from a subject with a tumor, or a metastasis from a tumor. In other examples, a sample includes a control sample, such as a non-tumor cell or tissue sample.

Subject: Living multi-cellular vertebrate organisms, a category that includes human and non-human mammals.

Therapeutically effective amount: A dose sufficient to prevent advancement, delay progression, or to cause regression of a disease, or which is capable of reducing symptoms caused by the disease, such as cancer, for example lung cancer.

Tumor: A neoplasm that may be either malignant or non-malignant (benign). Tumors of the same tissue type are tumors originating in a particular organ (such as breast, prostate, bladder or lung). Tumors of the same tissue type may be divided into tumors of different sub-types (a classic example being lung tumors, which can be small cell or non-small cell tumors).

Tumors include original (primary) tumors, recurrent tumors, and metastases (secondary) tumors. A tumor recurrence is the return of a tumor, at the same site as the original (primary) tumor, after the tumor has been removed surgically, by drug or other treatment, or has otherwise disappeared. A metastasis is the spread of a tumor from one part of the body to another. Tumors formed from cells that have spread are called secondary tumors and contain cells that are like those in the original (primary) tumor. There can be a recurrence of either a primary tumor or a metastasis. ///. Methods of Predicting Prognosis of Cancer

Methods are provided herein for determining or predicting prognosis of a neoplastic disease (such as lung cancer, for example, NSCLC) by determining IGFlR gene copy number in a biological sample obtained from a patient with a neoplastic disease. The disclosed methods include determining the copy number of the IGFlR gene in a biological sample (such as a tumor sample, for example, a NSCLC sample). In particular examples, an increase in IGFlR gene copy number predicts a good prognosis of the neoplastic disease in the patient. In other examples, no substantial change or a decrease in IGFlR gene copy number predicts a poor prognosis of the neoplastic disease in the patient.

In some examples, an increased IGFlR gene copy number includes IGFlR gene copy number per nucleus (such as average IGFlR gene copy number per nucleus) in the sample of greater than about two copies of the IGFlR gene per nucleus (such as greater than about 2.1, 2.2, 2.3, 2.4, 2.5, 2.6, 2.7, 2.8, 2.9, 3.0, 3.1, 3.2, 3.3, 3.4, 3.5, 4, 5, 10, 20, or more copies). In one particular example, an increased IGFlR gene copy number is 4 or more copies of the IGFlR gene per nucleus. In other examples, an increased IGFlR gene copy number includes a ratio of IGFlR gene copy number to Chromosome 15 gene copy number (such as an average IGF IR: Chromosome 15 ratio) in the sample of greater than about 1 (such as a ratio of greater than 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, or more).

In additional examples, an increased IGFlR gene copy number includes low trisomy (<2 copies in >40% of cells, 3 copies in 10-40% of cells, >4 copies in <10% of cells), high trisomy (<2 copies in >40% of cells, 3 copies in >40% of cells, >4 copies in <10% of cells), low polysomy (>4 copies in 10-40% of cells), high polysomy (>4 copies in >40% of cells), or gene amplification (presence of IGFlR gene clusters and ratio of IGFRlR to chromosome 15 of >2, or >15 copies of IGFlR in >10% of cells). In some examples, an increased IGFlR gene copy number includes high polysomy or gene amplification. In further examples, an increased IGFlR gene copy number includes an

IGFlR gene copy number greater than the median IGFlR gene copy number in a population of samples, such as a reference population of tumor samples. In some examples, the median IGFlR gene copy number is greater than about 2.4 (for examples, about 2.4, 2.5, 2.6, 2.7, 2.8, 2.9, 3.0, 3.1, 3.2, 3.3, 3.4, 3.5, or more).

In further examples, an increased IGFlR gene copy number includes an increase in IGFlR gene copy number relative to a control (such as an increase of about 1.5-fold, about 2-fold, about 3-fold, about 5-fold, about 10-fold, about 20-fold, or more). Therefore, in some examples, the method includes comparing the IGFlR gene copy number in the sample from the subject to the IGFlR gene copy number in a control, such as a non-neoplastic sample of the same tissue type as the neoplastic sample, or a reference value or range of values expected for IGFlR gene copy number in an appropriate normal tissue. Thus, for example, if the sample from the subject is a NSCLC sample, the control can be a normal lung sample, for example from the same subject, or a reference value representing IFGlR gene copy number expected in a normal lung sample. In some embodiments, the control is a sample obtained from a healthy patient or a non-tumor tissue sample obtained from a patient diagnosed with cancer. In other embodiments, the control is a historical control or standard reference value or range of values (such as a previously tested control sample, such as a group of samples that represent baseline or normal values, such as the IGFlR gene copy number in non-tumor tissue). In another example, the control is a reference value that is a median IGFlR gene copy number or median IGF1R/Chrl5 ratio in a sample population (for example, a population of NSCLC tumor samples). In further examples, the control is a control NSCLC sample from a subject with a known outcome, such as a known poor prognosis, wherein IGFlR gene copy number less than or equal to the control NSCLC sample indicates a poor prognosis and IGFlR gene copy number greater than the control

NSCLC sample indicates a good prognosis. In other examples, the control is a control NSCLC sample from a subject with a known good prognosis, wherein IGFlR gene copy number less than the control NSCLC sample indicates a poor prognosis and IGFlR gene copy number greater than or equal to the control NSCLC sample indicates a good prognosis.

In other examples, no substantial change or a decrease in IGFlR gene copy number includes IGFlR gene copy number per nucleus (such as average IGFlR gene copy number per nucleus) in the sample of about two or less copies of the IGFlR gene per nucleus (such as less than 2, 1.5, or 1 copies). In other examples, no substantial change or a decrease in IGFlR gene copy number includes a ratio of IGFlR gene copy number to Chromosome 15 copy number (such as an average IGF IR: Chromosome 15 ratio) in the sample of about 1 or less (such as a ratio of less than 1). In additional examples, no substantial change or a decrease in IGFlR gene copy number includes disomy (<2 copies in >90% of cells). In further examples, no substantial change or a decrease in IGFlR gene copy number includes no substantial increase or a decrease in IGFlR gene copy number relative to a control.

Prognosis for a subject can be characterized by any parameter known in the art, including, for instance, actual survival after initial diagnosis (such as 6-month survival, 1-year survival, 2-year survival, or 5-year survival), and/or actual survival relative to the average survival for similarly situated patients. A good prognosis entails, e.g., survival of a patient for more than 1 year after initial diagnosis (such as more than 2 years or more than 5 years), or survival of a patient for more than 6 months longer (e.g., more than 1 year longer, more than 2 years longer, more than 5 years longer) than the average survival for similarly situated patients. A poor prognosis entails, e.g., survival of a patient for less than 5 years after initial diagnosis (such as less than 2 years or less than 1 year), or survival of a patient less than the average survival for similarly situated patients (such as, about 3 months less than average survival, about 6 months less than average survival, or about 1 year less than average survival).

In other examples, a good prognosis further predicts that a neoplasm may be less aggressive (e.g., less rapidly growing, and/or less likely to metastasize). A good prognosis may entail progression-free survival (such as lack of recurrence of the primary tumor or lack of metastasis) of a patient for more than 1 year after initial diagnosis (such as more than 2 years or more than 5 years), or progression-free survival of a patient for more than 6 months longer (e.g., more than 1 year longer, more than 2 years longer, more than 5 years longer) than the average survival for similarly situated patients. A poor prognosis may predict that a neoplasm may be more aggressive (e.g., more rapidly growing and/or more likely to metastasize). A poor prognosis may entail, e.g., progression- free survival of a patient for less than 5 years after initial diagnosis (such as less than 2 years or less than 1 year), or progression-free survival of a patient less than the average survival for similarly situated patients (such as, about 3 months less than average survival, about 6 months less than average survival, or about 1 year less than average survival).

For example, a good prognosis includes a greater than 40% chance that the subject will survive to a specified time point (such as one, two, three, four or five years), and/or a greater than 40% chance that the tumor will not metastasize. In several examples, a good prognosis indicates that there is a greater than 50%, 60%, 70%, 80%, or 90% chance that the subject will survive and/or a greater than 50%, 60%, 70%, 80% or 90% chance that the tumor will not metastasize. Similarly, a poor prognosis includes a greater than 50% chance that the subject will not survive to a specified time point (such as one, two, three, four or five years), and/or a greater than 50% chance that the tumor will metastasize. In several examples, a poor prognosis indicates that there is a greater than 60%, 70%, 80%, or 90% chance that the subject will not survive and/or a greater than 60%, 70%, 80% or 90% chance that the tumor will metastasize.

Methods of determining the copy number of a gene or chromosomal region are well known to those of skill in the art. In some examples, the methods include in situ hybridization (such as fluorescent, chromogenic, or silver in situ hybridization), comparative genomic hybridization, or polymerase chain reaction (such as real-time quantitative PCR). Exemplary methods are discussed in more detail below. A. Biological samples

Exemplary samples include, without limitation, blood smears, cytocentrifuge preparations, cytology smears, core biopsies, fine-needle aspirates, and/or tissue sections (e.g., cryostat tissue sections and/or paraffin-embedded tissue sections). Methods of obtaining a biological sample from a subject are known in the art. For example, methods of obtaining lung tissue or lung cells are routine. Exemplary biological samples may be isolated from normal cells or tissues, or from neoplastic cells or tissues. Neoplasia is a biological condition in which one or more cells have undergone characteristic anaplasia with loss of differentiation, increased rate of growth, invasion of surrounding tissue, and which cells may be capable of metastasis. In particular examples, a biological sample includes a tumor sample, such as a sample containing neoplastic cells.

Exemplary neoplastic cells or tissues may be isolated from solid tumors, including lung cancer (e.g., non-small cell lung cancer, such as lung squamous cell carcinoma), breast carcinomas (e.g. lobular and duct carcinomas), adrenocortical cancer, ameloblastoma, ampullary cancer, bladder cancer, bone cancer, cervical cancer, cholangioma, colorectal cancer, endometrial cancer, esophageal cancer, gastric cancer, glioma, granular call tumor, head and neck cancer, hepatocellular cancer, hydatiform mole, lymphoma, melanoma, mesothelioma, myeloma, neuroblastoma, oral cancer, osteochondroma, osteosarcoma, ovarian cancer, pancreatic cancer, pilomatricoma, prostate cancer, renal cell cancer, salivary gland tumor, soft tissue tumors, Spitz nevus, squamous cell cancer, teratoid cancer, and thyroid cancer.

For example, a sample from a tumor that contains cellular material can be obtained by surgical excision of all or part of the tumor, by collecting a fine needle aspirate from the tumor, as well as other methods known in the art. In particular examples, a tissue or cell sample is applied to a substrate and analyzed to determine IGFlR gene copy number. A solid support useful in a disclosed method need only bear the biological sample and, optionally, but advantageously, permit the convenient detection of components (e.g., proteins and/or nucleic acid sequences) in the sample. Exemplary supports include microscope slides (e.g., glass microscope slides or plastic microscope slides), coverslips (e.g., glass coverslips or plastic coverslips), tissue culture dishes, multi-well plates, membranes (e.g., nitrocellulose or polyvinylidene fluoride (PVDF)) or BIACORE™ chips. In particular examples, a NSCLC sample obtained from a subject is analyzed to determine the IGFlR gene copy number.

The samples described herein can be prepared using any method now known or hereafter developed in the art. Generally, tissue samples are prepared by fixing and embedding the tissue in a medium. In other examples, samples include a cell suspension which is prepared as a monolayer on a solid support (such as a glass slide) for example by smearing or centrifuging cells onto the solid support. In further examples, fresh frozen (for example, unfixed) tissue sections may be used in the methods disclosed herein.

In some examples an embedding medium is used. An embedding medium is an inert material in which tissues and/or cells are embedded to help preserve them for future analysis. Embedding also enables tissue samples to be sliced into thin sections. Embedding media include paraffin, celloidin, OCT™ compound, agar, plastics, or acrylics.

Many embedding media are hydrophobic; therefore, the inert material may need to be removed prior to histological or cytological analysis, which utilizes primarily hydrophilic reagents. The term deparaffinization or dewaxing is broadly used herein to refer to the partial or complete removal of any type of embedding medium from a biological sample. For example, paraffin-embedded tissue sections are dewaxed by passage through organic solvents, such as toluene, xylene, limonene, or other suitable solvents. The process of fixing a sample can vary. Fixing a tissue sample preserves cells and tissue constituents in as close to a life-like state as possible and allows them to undergo preparative procedures without significant change. Fixation arrests the autolysis and bacterial decomposition processes that begin upon cell death, and stabilizes the cellular and tissue constituents so that they withstand the subsequent stages of tissue processing, such as for ISH.

Tissues can be fixed by any suitable process, including perfusion or by submersion in a fixative. Fixatives can be classified as cross-linking agents (such as aldehydes, e.g., formaldehyde, paraformaldehyde, and glutaraldehyde, as well as non- aldehyde cross-linking agents), oxidizing agents (e.g., metallic ions and complexes, such as osmium tetroxide and chromic acid), protein-denaturing agents (e.g., acetic acid, methanol, and ethanol), fixatives of unknown mechanism (e.g., mercuric chloride, acetone, and picric acid), combination reagents (e.g., Carnoy's fixative, methacarn, Bouin's fluid, B5 fixative, Rossman's fluid, and Gendre's fluid), microwaves, and miscellaneous fixatives (e.g., excluded volume fixation and vapor fixation). Additives may also be included in the fixative, such as buffers, detergents, tannic acid, phenol, metal salts (such as zinc chloride, zinc sulfate, and lithium salts), and lanthanum. The most commonly used fixative in preparing samples for IHC is formaldehyde, generally in the form of a formalin solution (4% formaldehyde in a buffer solution, referred to as 10% buffered formalin). In one example, the fixative is 10% neutral buffered formalin.

IV. Methods of Determining Gene Copy Number The disclosed methods include determining the copy number of the IGFlR gene in a biological sample (such as a tumor sample, for example, a NSCLC sample) from a subject. If the sample has increased IGFlR gene copy number relative to a control (such as an increase of about 1.5-fold, 2-fold, 3-fold, 5-fold, 10-fold, 20-fold, or more relative to a normal non- neoplastic sample or reference value), or alternatively, if the copy number of the IGFlR gene is greater than about two (such as greater than 2.1, 2.2, 2.3, 2.4, 2.5, 2.6, 2.7, 2.8, 2.9, 3.0, 3.1, 3.2, 3.3, 3.4, 3.5, 4, 5, 10, 20, or more), or the ratio of IGFlR gene copy number to Chromosome 15 copy number is greater than about 1 (such as greater than about 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, or more), the sample is considered to have an increased IGFlR gene copy number, and thus the subject has a good prognosis. In other examples, if the IGFlR gene copy number is categorized as low trisomy, high trisomy, low polysomy, high polysomy, or gene amplification (see, e.g., Cappuzzo et ah, J. Natl. Cancer Inst. 97:643-655, 2005), the sample is considered to have an increased IGFlR gene copy number, and thus the subject has a good prognosis. Conversely, if the sample has no change or a decrease in IGFlR gene copy number relative to a control (such as a normal non-neoplastic sample or reference value), or if the IGFlR gene copy number is less than about two, or the ratio of IGFlR gene copy number to Chromosome 15 copy number is less than about one, or the IGFlR gene copy number is categorized as disomy (see, e.g., Cappuzzo et al, J. Natl. Cancer Inst. 97:643-655, 2005), the subject has a poor prognosis.

Methods of determining the copy number of a gene or chromosomal region are well known to those of skill in the art. In some examples, the methods include in situ hybridization (such as fluorescent, chromogenic, or silver in situ hybridization), comparative genomic hybridization, or polymerase chain reaction (such as real-time quantitative PCR).

In particular examples, IGFlR gene copy number is determined by in situ hybridization (ISH), such as fluorescence in situ hybridization (FISH), chromogenic in situ hybridization (CISH), or silver in situ hybridization (SISH). For example, using FISH, a DNA probe (such as an IGFlR probe) is labeled with a fluorescent dye or a hapten (usually in the form of fluor-dUTP or hapten-dUTP that is incorporated into the DNA using enzymatic reactions, such as nick translation or PCR). The labeled probe is hybridized to chromosomes or nuclei on slides under appropriate conditions. After hybridization, the labeled chromosomes or nuclei are visualized either directly (in the case of a fiuor-labeled probe) or indirectly (using fluorescently labeled anti-hapten antibodies to detect a hapten-labeled probe). In the case of CISH, the probe is labeled with a hapten (such as digoxigenin, biotin, or fluorescein) and hybridized to chromosome or nuclear preparations under appropriate conditions. The probe is detected with an anti-hapten antibody, which is either conjugated to an enzyme (such as horseradish peroxidase or alkaline phosphatase) that produces a colored product at the site of the hybridized probe in the presence of an appropriate substrate (such as DAB, NBT/BCIP, etc.), or with a secondary antibody conjugated to the enzyme. SISH is similar to CISH, except that the enzyme (such as horseradish peroxidase) conjugated to the antibody (either anti-hapten antibody or a secondary antibody) catalyzes deposition of metal nanoparticles (such as silver or gold) at the site of the hybridized probe. For ISH methods, IGFlR gene copy number may be determined by counting the number of fluorescent, colored, or silver spots on the chromosome or nucleus.

In some examples, the number of spots per cells is distinguishable in the identified cells and the number of spots are counted (or enumerated) and recorded. In other examples, one or more of the identified cells may include a cluster, which is the presence of multiple overlapping signals in a nucleus that cannot be counted (or enumerated). In particular examples, the number of copies of the gene (or chromosome) may be estimated by the person (or computer, in the case of an automated method) scoring the slide. For example, one of skill in the art of pathology may estimate that a cluster contains a particular number of copies of a gene (such as 10, 20, or more copies) based on experience in enumerating gene copy number in a sample. In other examples, the presence of a cluster may be noted as a cluster, without estimating the number of copies present in the cluster.

In other examples, both the IGFlR gene and Chromosome 15 DNA (such as Chromosome 15 centromeric DNA) are detected in a sample from the subject, for example by ISH. Chromosome 15-specific probes are well known in the art and include commercially available probes, such as Vysis CEP 15 (D 15Zl) probe (Abbott Molecular, Des Plaines, IL). The IGFlR gene and Chromosome 15 DNA may be detected on the same sample (for example, on a single slide or tissue section, such as a dual color assay) or in different samples from the same subject (for example, IGFlR gene is detected on one slide and Chromosome 15 DNA is detected on a matched slide from the same subject, such as a single color assay). The IGFlR and Chromosome 15 DNA are detected with two different detectable labels for dual color assay (such as two different fluorophores, two different chromogens, or a chromogen and metal nanoparticles). The IGFlR gene and Chromosome 15 DNA may be detected with the same label for single color assay. IGFlR and Chromosome 15 copy number may be determined by counting the number of fluorescent, colored, or silver spots on the chromosome or nucleus. A ratio of IGFlR gene copy number to Chromosome 15 number is then determined.

In another example, IGFlR gene copy number is determined by comparative genomic hybridization (CGH). See, e.g., Kallioniemi et al, Science 258:818-821, 1992; U.S. Pat. Nos. 5,665,549 and 5,721,098. In one example, CGH includes the following steps. DNA from tumor tissue (such as a lung cancer sample) and from normal control tissue (reference, such as a non-tumor sample) is labeled with different detectable labels, such as two different fiuorophores. After mixing tumor and reference DNA along with unlabeled human Cot-1 DNA to suppress repetitive DNA sequences, the mix is hybridized to normal metaphase chromosomes. The fluorescence intensity ratio along the chromosomes is used to evaluate regions of DNA gain or loss in the tumor sample.

In a further example, IGFlR gene copy number is determined by array CGH (aCGH). See, e.g., Pinkel and Albertson, Nat. Genet. 37:S11-S17, 2005; Pinkel et al, Nat. Genet. 20:207-211, 1998; Pollack et al, Nat. Genet. 23:41-46, 1999. Similar to standard CGH, tumor and reference DNA are differentially labeled and mixed. However, for aCGH, the DNA mixture is hybridized to a slide containing hundreds or thousands of defined DNA probes (such as probes that are homologous to portions of the IGFlR gene). The fluorescence intensity ratio at each probe in the array is used to evaluate regions of DNA gain or loss in the tumor sample, which can be mapped in finer detail than CGH, based on the particular probes which exhibit altered fluorescence intensity. In one example, the array is an Agilent Human Genome CGH 44B Oligo Microarray (Agilent Technologies, Santa Clara, CA). In another example, the CGH array is a Whole Genome Tiling, Custom, or Chromosome specific Tiling Array (for example, a Chromosome 15 Tiling Array) as provided by Roche NimbleGen, Inc.

(Madison, WI). In general, CGH (and aCGH) does not provide information as to the exact number of copies of a particular genomic DNA or chromosomal region. Instead, CGH provides information on the relative copy number of one sample (such as a tumor sample, for example a lung cancer sample) compared to another (such as a control sample, for example a non-tumor cell or tissue sample). Thus, CGH is most useful to determine whether IGFlR gene copy number of a sample is increased or decreased as compared to a control sample (such as a non-tumor cell or tissue sample or a reference value).

In another example, IGFlR gene copy number is determined by real-time quantitative PCR (RT-qPCR). See, e.g., U.S. Pat. No. 6,180,349. In general the method measures PCR product accumulation through a dual-labeled fluorogenic probe (e.g., TAQMAN® probe). Although the PCR step can use a variety of thermostable DNA-dependent DNA polymerases, it typically employs the Taq DNA polymerase, which has a 5'-3' nuclease activity but lacks a 3'-5' proofreading endonuclease activity. TaqMan® PCR typically utilizes the 5'-nuclease activity of Taq or Tth polymerase to hydrolyze a hybridization probe bound to its target amplicon, but any enzyme with equivalent 5' nuclease activity can be used. Two oligonucleotide primers are used to generate an amplicon typical of a PCR reaction. A third oligonucleotide, or probe, is designed to detect nucleotide sequence located between the two PCR primers. The probe is non-extendible by Taq DNA polymerase enzyme, and is labeled with a reporter fluorescent dye and a quencher fluorescent dye. Any laser-induced emission from the reporter dye is quenched by the quenching dye when the two dyes are located close together as they are on the probe. During the amplification reaction, the Taq DNA polymerase enzyme cleaves the probe in a template-dependent manner. The resultant probe fragments disassociate in solution, and signal from the released reporter dye is free from the quenching effect of the second fluorophore. One molecule of reporter dye is liberated for each new molecule synthesized, and detection of the unquenched reporter dye provides the basis for quantitative interpretation of the data. The DNA copy number is determined relative to a normalization gene contained within the

- ?? - sample, which has a known copy number (see Heid et al., Genome Research 6:986-994, 1996). Quantitative PCR is also described in U.S. Pat. No. 5,538,848. Related probes and quantitative amplification procedures are described in U.S. Pat. No. 5,716,784 and U.S. Pat. No. 5,723,591. Additional methods that may be used to determine copy number of the IGFlR gene are known to those of skill in the art. Such methods include, but are not limited to Southern blotting, multiplex ligation-dependent probe amplification (MLPA; see, e.g., Schouten et al., Nucl. Acids Res. 30:e57, 2002), and high-density SNP genotyping arrays (see, e.g. WO 98/030883). A person of ordinary skill in the art will appreciate that embodiments of the method disclosed herein for detection of one or more molecules, such as by in situ hybridization, can be automated. Ventana Medical Systems, Inc. is the assignee of a number of United States patents disclosing systems and methods for performing automated analyses, including U.S. Patent Nos. 5,650,327; 5,654,200; 6,296,809; 6,352,861; 6,827,901; and 6,943,029, and U.S. published application Nos. 2003/0211630 and 2004/0052685.

V. Method of Scoring Gene Copy Number

Also disclosed herein is a method of scoring (for example, enumerating) copy number of a gene in a sample from a subject (such as a subject with neoplastic disease), wherein the sample is stained by ISH (such as FISH, SISH, CISH, or a combination of two or more thereof) for the gene of interest and wherein individual copies of the gene are distinguishable in cells in the sample. In particular examples, the sample is a biological sample from a subject, such as a tumor sample (for example, a tumor biopsy or fine needle aspirate). Methods of determining gene copy number by ISH are well known in the art. Exemplary methods are described in Section IV (such as for determining IGFlR gene copy number).

In some embodiments, the method includes identifying individual cells in a sample with the highest number of signals per nucleus for the gene (such as the strongest signal in the sample), counting the number of signals for the gene in the identified cells, and determining an average number of signals per cell, thereby scoring the gene copy number in the sample. In additional embodiments, the method further includes counting the number of signals for a reference (such as a chromosomal locus known not to be abnormal, for example, centromeric DNA) and determining an average ratio of the number of signals for the gene to the number of signals for the reference per cell. FIG. 7 provides a schematic of exemplary methods of scoring gene copy number.

The scoring method includes identifying individual cells in the sample (such as a tissue section or tumor core) having the highest number of signals (such as the highest number of spots per cell or the brightest intensity of staining) for the gene of interest in the cells in the sample. Thus, the disclosed method does not determine gene copy number in a random sampling of cells in the sample. Rather, the method includes specifically counting gene copy number in those cells that have the highest gene copy number in the sample. In some examples, identifying the individual cells having the highest number of signals for the gene includes examining a sample stained by ISH for the gene under low power microscopy (such as about 2OX magnification). Cells with the strongest signal (for example, highest amplification signal under higher power) are identified for counting by eye or by an automated imaging system. In some examples, such as when the sample is a tissue section, the sample is examined (for example, visually scanned) to identify a region that has a concentration of tumor cells that has amplification of the gene. Gene copy number in the cells with highest amplification in the selected region is then counted. In other examples, such as when the sample is a tumor core (such as a tumor microarray), most of the sample is visible in the field of view under low power magnification and the individual cells (such as tumor cells) with the strongest signal (for example, highest amplification signal under high power) are separately identified for counting. In particular examples, the cells chosen for counting the gene copy number may be non-consecutive cells, such as cells that are not adjacent to or in contact with one another. In other examples, at least some of the cells chosen for counting the gene copy number may be consecutive cells, such as cells that are adjacent to or in contact with one another.

The disclosed methods include counting the number of ISH signals (such as fluorescent, colored, or silver spots) for the gene in the identified cells. The methods may also include counting the number of ISH signals (such as fluorescent, colored or silver spots) for a reference (such as a chromosome-specific probe) in the identified cells. In some examples, the number of spots per cells is distinguishable in the identified cells and the number of spots are counted (or enumerated) and recorded. In other examples, one or more of the identified cells may include a cluster, which is the presence of multiple overlapping signals in a nucleus that cannot be counted (or enumerated). In particular examples, the number of copies of the gene (or chromosome) may be estimated by the person (or computer, in the case of an automated method) scoring the slide. For example, one of skill in the art of pathology may estimate that a cluster contains a particular number of copies of a gene (such as 10, 20, or more copies) based on experience in enumerating gene copy number in a sample. In other examples, the presence of a cluster may be noted as a cluster, without estimating the number of copies present in the cluster.

The number of cells identified for counting is a sufficient number of cells that provides for detecting a change (such as an increase or decrease) in gene copy number. In some examples, the number of cells identified for counting is at least about 20, for example, at least 25, 30, 40, 50, 75, 100, 200, 500, 1000 cells, or more. In a particular example, about 50 cells are counted. In other examples, every cell in the sample or every cell in a microscope field of vision, or in a number of microscope fields (such as at least 2 microscope fields, at least 3, at least 4, at least 5, at least 6 microscope fields, and the like) which contains 3 or more copies of the gene of interest (such as 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, or more) is counted.

In some examples, the biological sample is a tumor sample, such as a tumor which potentially includes increased gene copy number or a gene amplification.

Exemplary biological samples include neoplastic cells or tissues, which may be isolated from solid tumors, including lung cancer (e.g., non-small cell lung cancer, such as lung squamous cell carcinoma), breast carcinomas (e.g. lobular and duct carcinomas), adrenocortical cancer, ameloblastoma, ampullary cancer, bladder cancer, bone cancer, cervical cancer, cholangioma, colorectal cancer, endometrial cancer, esophageal cancer, gastric cancer, glioma, granular call tumor, head and neck cancer, hepatocellular cancer, hydatiform mole, lymphoma, melanoma, mesothelioma, myeloma, neuroblastoma, oral cancer, osteochondroma, osteosarcoma, ovarian cancer, pancreatic cancer, pilomatricoma, prostate cancer, renal cell cancer, salivary gland tumor, soft tissue tumors, Spitz nevus, squamous cell cancer, teratoid cancer, and thyroid cancer. In particular examples, the gene for which copy number is determined or scored is a gene which has increased copy number (for example, has an increased gene copy number, such as gene copy number greater than about 2, or gene amplification), for example, in a disease state, such as cancer. Examples of genes for which copy number may be scored by the methods disclosed herein include genes which are known to have increased gene copy number (e.g., amplified) in cancer (such as NSCLC, breast cancer, head and neck cancer, gastric cancer, or colorectal cancer). Examples include, but are not limited to IGFlR (15q26.3; e.g., GENBANK™ Accession No. NC_000015, nucleotides 97010284-97325282), EGFR (7pl2; e.g., GENBANK™ Accession No. NC_000007, nucleotides 55054219-55242525), HER2 (17q21.1; e.g., GENBANK™ Accession No. NC_000017, nucleotides 35097919-35138441), C-MYC (8q24.21; e.g., GENBANK™ Accession No. NC_000008, nucleotides 128817498-128822856), TOP2A (17q21-q22; e.g., GENBANK™ Accession No. NC_000017, complement, nucleotides 35798321-35827695), MET (7q31; e.g., GENBANK™ Accession No. NC_000007, nucleotides 116099695-116225676), FGFRl (8pl 1.2-pl 1.1; e.g., GENBANK™ Accession No. NC_000008, complement, nucleotides 38387813-38445509), FGFR2 (10q26; e.g., GENBANK™ Accession No. NCJ)OOOlO, complement, nucleotides 123227845-123347962), MDM2 (12ql4.3-ql5; e.g., GENBANK™ Accession No. NC_000012, nucleotides 67488247-67520481),

KRAS (12pl2.1; e.g. GENBANK™ Accession No. NC_000012, complement, nucleotides 25249447-25295121), and TYMS (18pl l .32; e.g., GENBANK™ Accession No. NC_000018, nucleotides 647651-663492).

In additional examples, the method also includes scoring the number of copies per cell or nucleus of a reference, such as a chromosomal locus known not to be abnormal, for example a centromere. In some examples, the reference is on the same chromosome as the gene of interest. For example, the reference locus may be on Chromosome 15 (such as Chromosome 15 centromeric DNA) if the gene of interest is located on Chromosome 15 (such as IGFlR), the reference locus may be on Chromosome 17 if the gene of interest is located on Chromosome 17 (such as HER2 or TOP2A), and so on. Exemplary reference chromosomes that can be used for particular human genes of interest are provided in Table 1. In particular examples, the reference locus is detected by using a centromere-specific probe. Such probes are known in the art and are commercially available, for example, Vysis CEP probes (Abbott Molecular, Des Plaines, IL) and SPOTLIGHT centromeric probes (Invitrogen, Carlsbad, CA).

Table 1. Exemplary reference chromosomes for particular genes of interest

In additional embodiments, the method also includes obtaining a sample from the subject (for example, obtaining a tumor sample, such as a tumor biopsy or fine needle aspirate). The method may also include processing the sample, including one or more of, fixing the sample, embedding the sample, sectioning the sample, and performing ISH. In further embodiments, the method may also include providing an output (such as gene copy number or ratio of gene copy number to a reference gene copy number) to a user. In particular examples, the output includes, but is not limited to, reports, charts, tables, or images (for example, a representation of a field on a slide). In some examples, the output is in digital format, such as computer-readable files or records.

In some embodiments, some or all of steps of the disclosed scoring method may be performed by automation, such as by an automated microscopy system. In particular examples, an automated method may include automatically imaging label(s) bound to chromosomal sequences (such as by in situ hybridization), automatically analyzing the image for the distribution and/or intensity of the label(s), and providing a result of the analysis (such as gene copy number per cell). Such methods are known in the art, e.g., U.S. Pat. Publication Nos. 2003/0170703 and 2008/0213769; Stevens et al, J. MoI. Diagn. 9: 144-150, 2007. In one example, the analysis may be performed using the Ventana Image Analysis System (VIAS, Ventana Medical Systems, Tucson, AZ).

In additional embodiments, the method further includes selecting a treatment for the subject, based on the gene copy number determined by the disclosed methods. The disclosed methods may further include administering the selected treatment to the subject. It is well known in the art that treatment may be selected for a subject (such as subject with a neoplastic disease) based on copy number of particular genes (such as a gene with increased copy number or amplification in a particular cancer) in a sample from the subject. For example, if the gene for which copy number is scored is HER2, and the sample has an increased (or amplified) HER2 gene copy number, the selected therapy may include HER2 antibodies or inhibitors, such as trastuzumab, bevacizumab, or lapatinib. In other examples, if the gene for which copy number is scored is EGFR, and the sample has an increased (or amplified) EGFR gene copy number, the selected therapy may include EGFR antibodies or inhibitors, such as cetuximab, panitumumab, gefitinib, and/or erlotinib. Other treatments that may be selected and/or administered to a subject with an increase or amplification in a particular gene copy number may be selected by one of skill in the art.

The disclosure is further illustrated by the following non-limiting Examples.

Examples Example 1

IGFlR Gene Copy Number in NSCLC - SISH Analysis This example describes analysis of IGFlR gene copy number by silver in situ hybridization and prognosis in subjects with non-small cell lung carcinoma.

Tissue microarrays (TMAs) were constructed containing triplicate samples from 189 patients surgically treated for NSCLC. Characteristics of the patients are presented in Table 2. Median follow-up of the cohort was 4 years with five-year survival probability of 40% (95% CI: 31-48%). Three tissue cores of 1.5 mm diameter were obtained from different areas of primary tumor of each patient. The TMAs were created using MaxArray™ customized tissue microarray service (Invitrogen, South San Francisco, CA).

Table 2. Patient Characteristics

An IGFlR probe was generated using the method of Farrell (International Publication No. WO 2008/028156). The probe targeted sequence between nucleotides 96869643-97413930 of human chromosome 15. This probe was used in SISH to evaluate IGFlR gene copy number on the TMAs. SISH was performed using

ULTRAVIEW SISH kit and BENCHMARK XT automated slide processing system following the manufacturer's protocols (Ventana Medical Systems, Tucson, AZ). The mean number of IGFlR gene copies/nucleus/core was determined by a certified pathologist counting at least 50 representative nuclei per core. If necessary, the slides were first examined by hematoxylin and eosin staining to locate areas rich in tumor cells. The SISH stained slides were examined to confirm that the majority of cells in the area displayed a hybridization signal that was not hampered by background noise and for the presence of internal positive control adjacent to the tumor displaying one to two copies of IGFlR in normal cells. Nuclei were selected for counting IGFlR gene copies by the following criteria: 1) cells with unambiguous borders and objective interpretable signal; and 2) nuclei that were representative of the population of invasive carcinoma nuclei with the highest average number of signals, irrespective of the size of the nuclei. The number of IGFlR signals was counted in each selected nucleus. The number of signals in nuclei containing a cluster (multiple overlapping signals that cannot be enumerated) was estimated by the pathologist.

The median IGFlR gene copy number/nucleus was 2.46 (FIG. 1). The core with the highest mean IGFlR gene copy number/nucleus from each patient was used for all subsequent models. The association of IGFlR gene copy number with the patient characteristics was analyzed (Table 3). IGFlR gene copy number of >2.46/nucleus was significantly associated with squamous cell carcinoma. IGFlR and chromosome 15 copy numbers were also analyzed by dual ISH. IGFlR was detected using SISH, as described above. Chromosome 15 was detected using a chromosome 15 centromeric probe (Choo et al, Genomics 7:143-151, 1990) and CISH. As shown in FIG. 2, copies of IGFlR and chromosome 15 could be distinguished, making it possible to determine an IGFlR/chromosome 15 ratio.

Table 3. Gene copy number vs. patient characteristics

Cox proportional hazards models were used to model progression-free survival (PFS) and overall survival (OS) as a function of mean IGFlR gene copy number, providing the primary evidence for prognostic utility. The Cox models also contained the following variables as statistical controls: age, sex, smoking status (ever vs. never), tumor histology, and tumor stage. Due to data being missing on some of these variables, only 165 patients were used in the Cox models. The proportional hazards assumption of the models was tested by assessing cumulative martingale residuals plots, with the results showing that the assumption was not violated. For PFS, the Cox model yielded an estimated hazard ratio of 0.626 (95% confidence interval of 0.471 to 0.833) with a p-value of 0.0014 (Table 4). The low p- value indicated that this finding was highly unlikely to be due to chance, supporting the prognostic value for IGFlR. Since the hazard ratio was less than one, IGFlR had a protective effect with respect to survival. Specifically, for every one -unit increase in mean IGFlR gene copy number, the hazard of relapsing decreased by, on average, 37.4%. This effect was above and beyond any effects of age, sex, smoking status, tumor histology, and tumor stage, since those variables were statistically controlled for in the model.

Table 4. Cox regression analysis - progression-free survival

For OS, the results were similar to PFS, with the Cox model yielding an estimated hazard ratio of 0.644 (95% confidence interval of 0.481 to 0.862) with a p- value of 0.0032 (Table 5). For every one-unit increase in mean IGFlR gene copy number, the hazard of dying decreased by, on average, 35.6%, above and beyond any effects of the other variables included in the model (as noted above).

Table 5. Cox regression analysis - overall survival

For both survival outcomes, the Kaplan-Meier plots were consistent with and supportive of the results obtained by the Cox models (FIGS. 3 and 4). For each outcome, Kaplan-Meier survival functions were constructed, stratified by three levels of mean IGFlR gene copy number: (a) <2, (b) >2 and <3, and (c) >3 copies per nucleus. In both cases, a monotonic relationship was observed, with higher mean IGFlR gene copy number resulting in greater probability of survival at any given time point. In both cases, these differences were statistically significant at p<0.05 using the logrank test. Immunohistochemistry evaluation of the TMAs was done using the Ventana GI l anti-IGF 1 R antibody (CONFIRM anti-IGF 1 R antibody, Ventana Medical Systems, Tucson, AZ). Staining was performed according to the manufacturer's protocol using BENCHMARK XT and the ULTRAVIEW-D AB detection kit (Ventana Medical Systems, Tucson, AZ). Samples were incubated with the primary antibody for 16 minutes. For all assays, scoring was based on assessment of staining intensity (0-4) and the percentage of positive cells (0-100%). Each intensity level was multiplied by the percentage of positive cells displaying that intensity and all values were added to obtain a final IHC (H) score (total score range: 0-400). For each patient, the core with the highest H score was utilized for final analysis.

Examples of SISH analysis of IGFlR gene copy number and IGFlR IHC staining and scores are shown for squamous cell carcinoma (FIG. 5A) and adenocarcinoma (FIG. 5B) samples. The IHC scores generally correlated with the IGFlR gene copy number (FIG. 6).

Example 2 IGFlR Gene Copy Number in NSCLC - FISH Analysis

This example describes analysis of IGFlR gene copy number by fluorescent in situ hybridization and prognosis in subjects with non-small cell lung carcinoma.

This study included 189 consecutive patients who underwent pulmonary resection at the Medical University of Gdansk. The patients were staged with chest x- ray, chest and upper abdominal computed tomography, and mediastinoscopy if mediastinal lymphadenopathy was suspected on chest computed tomography (short lymph node axis > 1 cm). Other examinations were done if clinically indicated. Positron emission tomography was not available in this period, thus relatively high proportion of pathologic stage III patients (32%) and eight stage IV patients (4%) were included. Surgery consisted of lobectomy (56%), bilobectomy (7%), pneumonectomy (34%), or limited lung resection (3%). Systematic lymph node dissection was performed in all patients. Adjuvant chemotherapy was not routinely administered in the analyzed period per institutional guidelines. Pathologic stage III patients had unsuspected mediastinal involvement and were not managed with chemotherapy except for seven patients who received platinum-based induction chemotherapy and three patients who received adjuvant chemotherapy. Pathologic stage IV patients were treated with palliative chemotherapy. Postoperative radiotherapy was administered in eight patients with positive postsurgical margins. Median follow-up was 5.3 years (range, 1.1 to 6.9 years). Five-year survival probability in this patient cohort was 38% (95% CI, 31% to 45%).

Material for analysis was derived from primary tumor tissue. Tissue microarrays were created using MaxArray customized tissue microarray service (Invitrogen, South San Francisco, CA). Three tissue cores of 1.5 mm diameter were obtained from different areas of primary tumor.

IGFlR gene copy number was analyzed by fluorescent in situ hybridization (FISH) using probes developed in the University of Colorado Cytogenetics Core Facility. The scoring was tentatively carried out in 50 non-overlapping nuclei per core. The following data were recorded: mean IGFlR gene and centromere 15 (CEP 15) copy number per cell, number of cells with two or fewer, three, and four or more copies of IGFlR and CEP15 signals, and IGFIR/CEP 15 ratio. The reading was done for each core in the tissue microarray and the core with highest average IGFlR gene copy number per cell was selected for each patient. Data were also analyzed using criteria established previously for EGFR gene copy number, with six categories according to ascending number of gene copies per cell (Cappuzzo et al, J. Natl. Cancer Inst. 97:643- 655, 2005). Valid results were obtained for 181 patients (96%).

Categoric variables were compared using χ or Fisher's exact test, where appropriate. Continuous variables were compared using Mann- Whitney U test.

Correlations between two continuous variables were analyzed using Spearman's rank correlation. Median follow-up time was calculated according to Schemper et al. (Contr. Clin. Trials 17:343-346, 1996). Survival curves were plotted using Kaplan-Meier method starting from date of surgery to date of death or last follow-up. Disease-free survival was defined from date of pulmonary surgery to date of local or distant progression, death of any cause, or date of last follow-up. Univariate survival analysis was performed with log-rank test and Cox proportional hazard regression. In multivariate Cox model, variables with p< 0.20 from Wald's test of univariate model were included. In an exploratory analysis, maximum log-likelihood function was used to select the most discriminative survival cutoff point of average IGFIR gene copy number per cell (Hosmer and Lemeshow in Applied Survival Analysis, p. 87-112, John Wiley and Sons, 1999; Thorpe et al, Cancer Res. 47:6126-6133, 1987). Significance level of α<0.05 was used without adjustment for multiple testing.

The median value of average IGFlR gene copy number per cell was 2.68. The pattern of IGFlR gene copy number was relatively homogenous throughout the cores obtained from the same tumor (average upper and lower 95% CIs for mean IGFlR gene copy number per cell represent 14% of this value), justifying the use of tissue microarray for gene copy number assessment. The median value of IGF1R/CEP15 ratio was 1.17. Average IGFlR gene copy number per cell analyzed as a continuous variable in the univariate Cox model showed positive significant association with survival (HR, 0.76; 95% CI, 0.61 to 0.95; P = 0.014). In the exploratory analysis, a maximum log- likelihood function was used to select the most discriminative cutoff of average IGFlR gene copy number for survival difference. The best discrimination was observed with cutoff of 4.0 gene copies per cell (HR, 0.38 for subset of patients with tumors with average of 4 or more copies per cell (21 patients; 12%) as compared with all other patients, 95% CI, 0.17 to 0.82, P = .014). Applying the same criteria developed for EGFR gene copy number, five tumors (3%) were classified as carrying IGFlR gene amplification, 43 tumors (24%) showed high polysomy, 87 tumors (48%) had low polysomy, and 46 tumors (25%) had low gene copy number. Comparing tumors with high copy numbers (gene amplification and high polysomy) and other tumors, there was no difference in patient characteristics (Table 6). There was also no difference in clinical or pathologic characteristics when tumors with low polysomy, high polysomy, and gene amplification were grouped for comparison with tumors with low gene copy number.

Table 6. Patient Characteristics According to IGFlR Gene Copy Number

Note: Missing data were excluded from the analysis NOS, not otherwise specified

Patients with tumors harboring high IGFlR gene copy numbers (amplification and high polysomy) had 3-year survival of 58% (95% CI, 44% to 72%) versus 47% (36% to 57%) for tumors with low polysomy and 35% (21% to 49%) for tumors with trisomy/disomy (log-rank P = 0.024; FIG. 8A). Prognostic value of IGFlR gene copy number was confirmed in the multivariate analysis (Table 7) and was also observed for disease-free survival. Examples of images with IGFlR gene amplification, high polysomy, and disomy are shown in FIG. 9.

Table 7. Univariate and Multivariate Analysis of Survival

HR, hazard ratio

Example 3 Analysis of IGFlR Protein and mRNA Expression

This example describes analysis of IGFlR protein and mRNA expression and prognosis in subjects with non-small cell lung carcinoma.

Immunohistochemistry: Immunohistochemistry (IHC) evaluation was done using the Ventana GI l (CONFIRM, Ventana Medical Systems, Tucson, AZ) anti- IGF 1 R antibody. The Ventana G 11 staining took place on the BENCHMARK XT

(Ventana Medical Systems) utilizing the ULTRAVIEW detection kit (Ventana Medical Systems); the primary antibody was incubated for 16 minutes. Scoring was done according to the University of Colorado IHC scoring criteria (semi-quantitative system with total score range 0 to 400; Hirsch et al, J. CHn. Oncol. 24:5034-5042, 2006). Two observers independently scored each sample. Discrepant cases (IHC score >50) were reassessed by consensus meeting. For each patient, results from three cores (or fewer if depleted) were averaged. Results for each observer were averaged to obtain the final IGFIR IHC score. A tumor sample was considered positive if the score was above median and negative otherwise. mRNA Analysis: Samples of primary tumors were fresh-frozen at the time of surgery and stored at -80⁰C. Total RNA was prepared from primary NSCLC tumors using the AllPrep® DNA/RNA kit (Qiagen, Valencia, CA). From the initial cohort of 189 paraffin-embedded tumors, there were 114 corresponding fresh-frozen tumors with sufficient tumor cell content, quality, and quantity of extracted RNA. cDNA was transcribed from 1 μg RNA of each sample using AffinityScript™ QPCR cDNA Synthesis Kit (Stratagene, La Jolla, CA). Quantitative real-time polymerase chain reaction was performed in l/20th of the cDNA reaction using the Brilliant® SYB R® Green QPCR Core Reagent Kit (Stratagene) in triplicates using StepOne™ real-time PCR System (Applied Biosystems, Foster City, CA). Primer sequences were as follows: IGF1R-1514F: TGAAAGTGACGTCCTGCATTTC (SEQ ID NO: 1), IGFlR- 1587R: GGTACCGGTGCCAGGTTATG (SEQ ID NO: 2); β-actin-667F: GAGCGCGGCTACAGCTT (SEQ ID NO: 3), β-actin-1081R: TCCTTAATGTCACGCACGATTT (SEQ ID NO: 4). Amplification data were analyzed by StepOne™ software (Applied Biosystems, Foster City, CA), quantified according to a relative standard curve, normalized to β-actin expression, and multiplied by 1 ,000 for easier readout.

Results of IHC staining were obtained for 179 patients (95%). The pattern of immunostaining with Ventana GI l anti-IGFIR antibody showed predominantly membranous but also weak cytoplasmic staining. A significant correlation was observed between levels of staining with Ventana antibody and IGFlR mRNA (r = 0.37; P< 0.001; n = 109).

Median IGFlR IHC score was 86 (range, 0 to 354). One hundred fifty samples (84%) showed IGFlR IHC score higher than 10. Associations of IGFlR protein expression and clinical and pathologic characteristics are presented in Table 8. IGFlR IHC score above median was found in 67% of squamous cell carcinomas as compared with 24% of adenocarcinomas (P < 0.001). Higher levels of expression were found in patients with more advanced stage (P = 0.03). In subset analyses by histology, the correlation was significant for squamous cell carcinomas (P = 0.028) and for nonsquamous NSCLC types (P = 0.040).

Table 8. Patient Characteristics According to IGFlR IHC Score

NOS, not otherwise specified

Overall survival of patients with tumors showing high versus low IGFlR protein expression was similar (log-rank P = 0.40, hazard ratio [HR] adjusted for stage, age, sex, and histology, 0.92; 95% CI, 0.60 to 1.42; P = .72; FIG. 8B). In exploratory analysis with other cutoff points to define IGFlR positivity, there was no difference in overall survival according to IGFlR protein expression (all P values not significant). When tested as a continuous variable, IGFlR IHC score was not associated with survival difference (adjusted HR, 1.000; 95% CI, 0.997 to 1.002; P = .74). Patients with tumors showing high IGFlR expression (above median, n = 54) had outcome similar to all other patients (n = 125, log-rank P = 0.71). IGFlR protein expression was not associated with disease- free survival.

Median relative IGFlR mRNA expression was 23.4 (range, 0.1 to 1.280). There was no association of IGFlR mRNA expression and clinical or pathologic characteristics when the expression was divided by median, except for a tendency toward higher proportion of patients with squamous cell histology in the subset with high IGFIR expression (P = 0.089). When analyzed as continuous variable, IGFlR expression was significantly higher in squamous cell carcinomas versus other histologies (median relative expression 32.3 v 11.6; P = 0.006). In the survival analysis, there was no difference according to median IGFlR mRNA expression (log-rank P = 0.25; FIG. 8C). Survival HR for IGFlR mRNA expression when tested as a continuous variable and adjusted for sex, age, stage, and histology was 1.000 (95% CI, 0.999 to 1.001; P= 0.35).

Median IGFIR IHC score in tumors showing IGFlR gene disomy or trisomy was 60, for tumors with low polysomy was 93, and for tumors with high polysomy or gene amplification was 98 (P = 0.007; FIG. 10). The proportion of tumors with IGFIR IHC score above median (> 86) for these three FISH categories with ascending IGFlR gene copy number was 36%, 52%, and 62%, respectively (P = 0.038).

Example 4

Determining Prognosis of a Subject with Cancer

This example describes particular methods that can be used to determine a prognosis of a subject diagnosed with cancer. However, one skilled in the art will appreciate that methods that deviate from these specific methods can also be used to successfully provide the prognosis of a subject with cancer.

A tumor sample (such as a tumor biopsy) is obtained from the mammalian subject, such as a human. Tissue samples are prepared for ISH, including deparaffinization and protease digestion. In one example, the prognosis of a tumor (for example, a lung tumor, such as a NSCLC) is determined by determining IGFlR gene copy number in a tumor sample obtained from a subject by in situ hybridization, such as SISH. For example, the sample, such as a tissue or cell sample present on a substrate (such as a microscope slide) is incubated with an IGFlR genomic probe. Hybridization of the IGFlR probe to the sample is detected, for example, using microscopy. The

IGFlR gene copy number is determined by counting the number of IGFlR signals per nucleus in the sample and calculating an average IGFlR gene copy number/cell. An increase in IGFlR gene copy number/cell in the tumor sample (such as an IGFlR gene copy number of more than 2, 3, 4, 5, 10, 20, or more, for example, IGFlR gene copy number greater than 4) or an increase in IGFlR gene copy number relative to a control (such as a non-neoplastic sample or a reference value) indicates a good prognosis, such as an increase in the likelihood of survival, for the subject. In contrast, no substantial change or a decrease in IGFlR gene copy number (such as an IGFlR gene copy number of about 2 or less) or no substantial change or a decrease in IGFlR gene copy number relative to a control (such as a non-neoplastic sample or a reference value) indicates a poor prognosis, such as a decrease in the likelihood of survival, for the subject.

In another example, the prognosis of a tumor (for example, a lung tumor, such as a NSCLC) is determined by determining a ratio of IGFlR gene copy number to Chromosome 15 centromere copy number in a tumor sample obtained from a subject by in situ hybridization, such as SISH. For example, the sample, such as a tissue or cell sample present on a substrate (such as a microscope slide) is incubated with an IGFlR genomic probe. The same sample or a matched sample from the same subject is incubated with a Chromosome 15 centromere probe. Hybridization of the IGFlR probe to the sample is detected, for example, using microscopy. Hybridization of the Chromosome 15 centromere probe is also detected, for example, using microscopy. The IGFlR gene copy number is determined by counting the number of IGFlR probe signals per nucleus in the sample and the Chromosome 15 centromere number is determined by counting the number of Chromosome 15 centromere probe signals per nucleus in the sample. An increase in the ratio of IGFlR gene copy number to

Chromosome 15 centromere copy number per cell in the tumor sample (such as a ratio of more than 1, 2, 3, 4, 5, 10, 20, or more) or an increase in the ratio of IGFlR gene copy number to Chromosome 15 centromere copy number relative to a control (such as a non-neoplastic sample or a reference value) indicates a good prognosis, such as an increase in the likelihood of survival, for the subject. In contrast, no substantial change or a decrease in the ratio of IGFlR gene copy number to Chromosome 15 centromere copy number (such as an IGFlR gene copy number to Chromosome 15 copy number ratio of about 1 or less) or no substantial change or a decrease in the ratio of IGFlR gene copy number to Chromosome 15 centromere copy number relative to a control (such as a non-neoplastic sample or a reference value) indicates a poor prognosis, such as a decrease in the likelihood of survival, for the subject.

Example 5 Enumeration of Gene Copy Number This example describes an exemplary method of scoring copy number of a gene of interest detected by in situ hybridization.

A sample is obtained that has been stained by in situ hybridization for the gene of interest. The sample may be a tumor sample, such as a tumor that potentially has an increased gene copy number or amplification in the gene of interest, such as a breast tumor, lung tumor (for example, a NSCLC tumor), ovarian tumor, gastric tumor, esophageal tumor, or head and neck tumor.

The sample is examined by microscopy (such as brightfield microscopy if the sample has been stained using CISH or SISH, or fluorescence microscopy if the sample has been stained using FISH). The cells in the sample that have the highest number of signals (such as the highest number of spots per cell or the brightest intensity of staining) for the gene of interest are identified. The number of signals is counted in each identified cell until a pre-determined number of cells have been counted (such as about 20, 25, 30, 40, 50, 100, 200, 500, 1000 cells or more). The number of signals is divided by the number of cells counted, determining an average number of signals per cell, which is the average gene copy number. The resulting gene copy number can then be outputted or provided to a user.

In some examples, the sample has also been stained by in situ hybridization for a reference, such as a chromosomal locus which is known not to be abnormal, for example centromeric DNA. The number of signals for the reference is counted in the same cells as were identified and counted for the gene of interest. The number of signals of the gene of interest is divided by the number of signals of the reference, determining an average ratio of gene: reference per cell. The resulting ratio of gene copy number to reference gene copy number can then be outputted or provided to a user.

In view of the many possible embodiments to which the principles of the disclosure may be applied, it should be recognized that the illustrated embodiments are only examples and should not be taken as limiting the scope of the invention. Rather, the scope of the invention is defined by the following claims. We therefore claim as our invention all that comes within the scope and spirit of these claims.

Claims

We claim:

1. A method for predicting prognosis of a neoplastic disease, comprising: determining insulin-like growth factor 1 receptor (IGFlR) gene copy number in a biological sample from a patient having a neoplastic disease, wherein an increase in the IGFlR gene copy number predicts a good prognosis of the neoplastic disease in the patient.

2. The method of claim 1, wherein the neoplastic disease is lung cancer.

3. The method of claim 2, wherein the lung cancer is a non-small cell lung cancer.

4. The method of claim 3, wherein the non-small cell lung cancer is a squamous cell carcinoma.

5. The method of any one of claims 1 to 4, wherein the good prognosis is greater than 2-year survival of the patient after initial diagnosis of the neoplastic disease.

6. The method of claim 5, wherein the good prognosis is greater than 5- year survival of the patient after initial diagnosis of the neoplastic disease.

7. The method of claim 5 or 6, wherein survival of the patient comprises overall survival or progression- free survival after initial diagnosis of the neoplastic disease.

8. The method of any one of claims 1 to 7, wherein the biological sample is a tumor sample.

9. The method of any one of claims 1 to 8, wherein the IGFlR gene copy number is determined by in situ hybridization.

10. The method of claim 9, wherein the in situ hybridization is silver in situ hybridization, fluorescent in situ hybridization, chromogenic in situ hybridization, or a combination of two or more thereof.

11. The method of any one of claims 1 to 10, wherein the increase in the IGFlR gene copy number is IGFlR gene copy number greater to or equal than about two

IGFlR gene copies per nucleus.

12. The method of claim 11, wherein the increase in the IGFlR gene copy number is IGFlR gene copy number greater to or equal than about four IGFlR gene copies per nucleus.

13. The method of any one of claims 1 to 12, wherein the increase in the IGFlR gene copy number is relative to a non-neoplastic control.

14. The method of any one of claims 1 to 13, wherein the increase in the

IGFlR gene copy number is an increase in the IGF IR: Chromosome 15 ratio.

15. The method of claim 14, wherein the IGF IR: Chromosome 15 ratio is greater than one.