WO2010114821A1

WO2010114821A1 - Genomic dna methylation analysis

Info

Publication number: WO2010114821A1
Application number: PCT/US2010/029159
Authority: WO
Inventors: Xiyu Jia
Original assignee: Zymo Research Corporation
Priority date: 2009-03-30
Filing date: 2010-03-30
Publication date: 2010-10-07

Abstract

A method is provided for determining the methyation status at a plurality of potential sites of DNA methyaltion. Methods to determine a genome-wide methylation profile and to assess changes in a methylation profile are also provided. The invention also provides reagents and kits to assess DNA methylation status.

Description

TITLE OF INVENTION

GENOMIC DNA METHYLATION ANALYSIS

Reference to Related Applications

This application claims priority to U.S. Provisional Application No. 61/164,834, filed on March 30, 2009 which is incorporated herein by reference in its entirety.

Incorporation of Sequence Listing

The Sequence Listing, which is a part of the present disclosure, includes a computer readable 2 KB file created on March 26, 2010 entitled "ZYMO004WO_ST25.txt" comprising nucleotide and/or amino acid sequences of the present invention submitted via EFS-Web. The subject matter of the Sequence Listing is incorporated herein by reference in its entirety.

Field of the Invention

The present invention generally relates to genetics and molecular biology. More specifically, the invention relates to methods and compositions for genomic DNA methylation analysis. Description of the Related Art

DNA methylation plays an important role in epigenetic control for all high organisms. In mammals DNA methylation almost exclusively occurs at the cytosine proceeding a guanidine base, or a CpG dinucleotide. Cytosine is methylated at the 5-carbon position producing a moiety called 5-methylcytosine. DNA methylation signatures play an essential role in gene regulation, developmental biology, aging, and diseases, such as cancer, diabetes, rheumatoid arthritis.

The effort to study DNA methylation is limited by technical inability to obtain whole genome methylation profile. Many investigative techniques have been developed to study DNA methylation, and each has advantages and disadvantages. For example, bisulfite sequencing takes advantage of the chemical properties of 5-methylcytosine to distinguish cytosine from 5-methylcytosine, but genome-wide experiments are costly, unwieldy, and indiscriminate. On the other hand, methods that rely on immunoprecipitation of 5- methylcytosine are selective of modified bases, but provide low resolution methylation mapping. Summary

In a first aspect a method is provided for determining genomic DNA methylation status comprising: (a) cleaving genomic DNA with at least one methylation-sensitive DNA endonuclease under conditions wherein DNA cleavage occurs to generate a cleaved DNA; (b) ligating the cleaved DNA from step (a) to a DNA oligonucleotide tag having a known sequence to generated tagged DNA; (c) cleaving the tagged DNA from (b) with a second endonuclease under conditions wherein DNA cleavage occurs, wherein the second endonuclease does not cleave the oligonucleotide tag; (d) ligating the tagged DNA to generate a chimeric DNA molecule having two DNA oligonucleotide tag sequences flanking the genomic DNA; and (e) determining the nucleotide sequence of the chimeric DNA molecule of step (d) thereby determining the genomic DNA methylation status. In certain embodiments, methods disclosed herein can be used to determine the methylation status over an entire genome (e.g., to generate a whole-genome methylation map). For example, methylation status may be determined at 1%, 2%, 3%, 4%, 5%, 10%, 15%, 20%, 25%, 30% or more of the potential CpG methylation sites in genomic DNA. In further embodiments, methods according to the invention may be used to determine DNA methylation at a plurality of DNA sites of interest, such as in the coding region or expression control region (e.g., the promoter) of one or more genes. Such methods may be used, for instance, to determine the methylation status at about 5, 10, 15, 20, 50, 100, 500, 1,000 or more sites of potential DNA methylation in a genome.

In certain aspects, a methylation sensitive enzyme for use in disclosed methods may be selected from Acil, Hpall, HinPlI, HpyCH4IV, Aatll, AcII, Afel, Agel, Ascl, AsiSI, Aval, BmgBI, BsaAI, BsaHI, BsiEI, BsiWI, BsmBI, BspDI, BstBI, CIaI, Eagl, Faul, Fsel, Fspl, Haell, Hgal, Hhal, Hpy99I, Kasl, MM, Nael, Narl, NgoMIV, Notl, NmI, PaeR7I, PmII, Pvul, RsrII, SacII, Sail, Sfol, SgrAI, Smal, SnaBI and Zral. In certain cases, the methylation sensitive enzyme is an endonuclease that recognizes a 4-base-pair sequence (e.g., a 4-based pair sequence comprising a CpG dinucleotide sequence). For example, in certain aspects, the Hpall enzyme can be used. Moreover, in some cases, disclosed methods involve cleaving the genomic with at least 2, at least 3, at least 4 or more methylation-sensitive DNA endonucleases. The skilled artisan will recognize that, in cases wherein a methylation sensitive enzyme cleaves only unmethylated recognition sequences, sites that are methylated can be determined by the absence of tagged DNA sequences corresponding to the methylation site (e.g., by examining known genomic sequence from a database).

In certain aspects, methods according to the invention concern cleaving a tagged genomic DNA with at least a second endonuclease. Any DNA endonuclease can be employed and may be selected, for example, based on the lack of a cleavage site with-in the DNA oligonucleotide tag and on cleavage frequency with-in genomic DNA (e.g., such that, when cleaved, a proportion of the tagged DNA fragments have a sequence length that permissible for sequence analysis such as hybridization, PCR or sequencing). In certain embodiments, the second DNA endonuclease is a type II, type Hs or type IV endonuclease, wherein the cleavage site for the second endonuclease is not comprised in the DNA oligonucleotide tag. For example, the second endonuclease can be Mmel, Acul, Bpml, BsmFI or EcoP15I. Thus, in certain embodiments, a plurality of tagged genomic DNAs is cleaved to generate a plurality of cleaved tagged genomic DNA comprising substantially identical sequence length. In further aspects, methods for determining a methylation status involve ligating cleaved and tagged genomic DNA to generate a chimeric DNA(s). For example, in one embodiment, the cleaved and tagged DNA is ligated in the presence of a second DNA oligonucleotide tag to generate a chimeric DNA comprising two DNA oligonucleotide tag sequences such that the oligonucleotide tag sequences are flanking a genomic DNA which represents one site of a methylation sensitive DNA cleavage. In an alternative embodiment, the cleaved and tagged DNA can be ligated to a second cleaved, tagged DNA to generate a chimeric DNA comprising two DNA oligonucleotide tag sequences that flank genomic DNA from the two tagged DNAs (i.e., such that oligonucleotide tag sequences flank genomic DNA which represents two sites of a methylation sensitive cleavage). In certain cases, chimeric DNA sequences comprise two identical oligonucleotide tag sequences; however, it is contemplated that chimeric DNA sequences can comprise two different oligonucleotide tag sequences.

In various aspects, methods according to the invention concern oligonucleotide tag sequences comprising double stranded DNA having a known sequence. In some embodiments, oligonucleotide tag sequences comprise a label, such as a fluorescent label, a radioactive label, a sequence label, an enzymatic label or an affinity label (e.g., biotin). Thus, in certain embodiments, methods concern (in step (b)) isolating the tagged DNA using the affinity label, such as by using an avidin-biotin affinity column or affinity beads.

In certain aspects, methods according to the invention involve ligation of an oligonucleotide tag to a genomic DNA. A variety of commercially available ligase enzymes may be employed in such methods, including but not limited to, a bacterial DNA ligase or a phage DNA ligase (e.g., T4 DNA ligase). In certain embodiments, methods according to the invention further comprise treating the ligated (tagged) DNA with an enzyme that polymerizes additional 3' sequence, thereby repairing the 3' end of the tagged DNA. For example, a DNA polymerase such as Taq polymerase can be employed. In further aspects, methods may be used for determining methylation status concern determining the sequence of a chimeric DNA (or the genomic DNA portion of a chimeric DNA). For example, the chimeric DNA maybe sequenced {e.g., by single molecule direct sequencing) or hybridized to an array of known polynucleotide sequences to determine the chimeric DNA sequence. In some embodiments, determining a sequence can involve PCR amplification of the chimeric DNA and/or cloning of the chimeric DNA into a plasmid.

In certain aspects, one or more steps of the methods according to the invention may be automated. For example, the methods may be performed by a robot using a programmed thermocycler apparatus.

In some further aspects, methods according to the invention may be used to determine methylation status in mammalian genomic DNA, such as in human genomic DNA. Genomic

DNA may be from a variety of sources such as from a human subject or from a cell line or tissue bank. Genomic DNA from a patient or subject may be isolated from, for example, a blood sample, a tissue biopsy sample, a urine sample or a saliva sample. In certain embodiments, methods according to the invention may involve comparing methylation status in two or more genomic DNA samples. For example, a sample from a tumor may be compared to a sample from surrounding tissue or samples collected over a period of time may be compared to determine changes in methylation status over time.

In still a further aspect, a method for diagnosing a disease or a risk for a disease in a subject is provided comprising (i) determining the genomic DNA methylation status at potential DNA methylation sites in the DNA of the subject using a method according to the invention (ii) comparing the DNA methylation status at potential DNA methylation sites to a reference that is representative of the DNA methylation status of corresponding DNA methylation sites in a subject having said disease.

In yet still a further aspect, a kit for determining DNA methylation status in genomic DNA is provided comprising a type Hs or type IV endonuclease, a methylation sensitive DNA endonuclease and a double stranded DNA oligonucleotide comprising a label. In still further aspects, a kit may also comprise one or more of the following an affinity purification column; a DNA ligase; a DNA polymerase; DNA sequencing reagents; instructions for using kit components; and/or DNA primers.

Embodiments discussed in the context of a methods and/or composition of the invention may be employed with respect to any other method or composition described herein. Thus, an embodiment pertaining to one method or composition may be applied to other methods and compositions of the invention as well.

As used herein the specification, "a" or "an" may mean one or more. As used herein in the claim(s), when used in conjunction with the word "comprising", the words "a" or "an" may mean one or more than one.

The use of the term "or" in the claims is used to mean "and/or" unless explicitly indicated to refer to alternatives only or the alternatives are mutually exclusive, although the disclosure supports a definition that refers to only alternatives and "and/or." As used herein "another" may mean at least a second or more. Throughout this application, the term "about" is used to indicate that a value includes the inherent variation of error for the device, the method being employed to determine the value, or the variation that exists among the study subjects

Other objects, features and advantages of the present invention will become apparent from the following detailed description. It should be understood, however, that the detailed description and the specific examples, while indicating preferred embodiments of the invention, are given by way of illustration only, since various changes and modifications within the spirit and scope of the invention will become apparent to those skilled in the art from this detailed description.

Brief Description of the Drawings The following drawings form part of the present specification and are included to further demonstrate certain aspects of the invention. The invention may be better understood by reference to one or more of these drawings in combination with the detailed description of specific embodiments presented herein:

FIG. 1: Diagram of an exemplary tagged CpG DNA methylation analysis. FIG. 2: Observed Lambda CpG sequence frequency. Detailed Description

The instant invention provides a simplified and uniform method for DNA methylation detection. The method involves use of restriction enzymes sensitive to DNA methylation. In the method disclosed here methylation sensitive restriction endonucleases (MSREs) are used to cleave genomic DNA at non-methylated CpG sites, and the cleaved sites are then tagged with a linker DNA fragment. Recovered tagged DNAs are then further cleaved and ligated to each other or to a second linker DNA fragment, to generate a chimeric DNA. Resultant chimeric DNAs can then be directly analyzed (e.g., by single molecule sequencing) or may be amplified by PCR prior to further analysis. Amplified PCR products can then be used for microarray and/or sequence analysis. Microarray hybridization signal or sequence data can pinpoint the non-methylated CpG sites from the original DNA source. Therefore, a whole genomic profile of DNA methylation can be determined by mapping the non-methylated sites.

High resolution whole-genome methylation profiles that can be obtained by methods according to the invention have a broad range of applications, from basic scientific research to individualized medicine. For example, genomic methylation maps can used to diagnose and the chart the progression diseases such as cancer and autoimmune disease by comparison of a methylation profile from the subject to a methylation profile established for a given disease. Similarly, genomic methylation profiles may be used to characterize the developmental or differentiation status of tissue cell cultures, such as stem cell cultures. As used herein the term "linker" or "linker DNA fragment" refers to a double- stranded DNA of known sequence that may be ligated to cleaved DNAs. Thus, linker sequences are designed to comprise ends that are compatible for ligation to a DNA cleaved with a particular endonuclease. A linker may be composed to two annealed synthetic oligonucleitdes and such oligonucleotides may additionally comprise affinity tags and/or detectible labels. Genomic DNA that is ligated to linker sequences is referred to herein as a "tagged" sequence. As used herein the term "chimeric DNA" refers to a genomic DNA fragment that is flanked on each end by a linker DNA sequence. In certain embodiments, the genomic DNA portion of a chimeric DNA corresponds to a single stretch of contiguous genomic DNA sequence (i.e., the genomic DNA sequence is representative of a single site of potential DNA methylation). In an alternative embodiment, the genomic DNA portion of chimeric DNA comprises sequence that corresponds to two stretches of contiguous genomic DNA (i.e., the genomic DNA sequence is representative of two distinct site of potential DNA methylation).

In this case the chimeric DNA can be generated by ligating a tagged DNA to a second tagged

DNA to generate a ligated DNA having the arrangement of: (oligo tag) - (genome seq I) - (genome seq T) - (oligo tag).

I. General Protocol

One example of a method for DNA methylation analysis is illustrated in FIG. 1 and detailed below:

A. Methylation-sensitive cleavage of genomic DNA using a MSRE. At least a first MSRE is used to cleave genomic DNA. All type II methylation sensitive restriction enzymes can be used to cut the DNA. Such enzymes include Acil, Hpall, HinPlI, HpyCH4IV, Aatll, AcII, Afel, Agel, Ascl, AsiSI, Aval, BmgBI, BsaAI, BsaHI, BsiEI, BsiWI, BsmBI, BspDI, BstBI, CIaI, Eagl, Faul, Fsel, Fspl, Haell, Hgal, Hhal, Hpy99I, Kasl, MM, Nael, Narl, NgoMIV, Notl, NmI, PaeR7I, PmII, Pvul, RsrII, SacII, Sail, Sfol, SgrAI, Smal, SnaBI and Zral. The precise buffer condition for the enzymatic cleavage will depend on the enzyme or combination of enzymes used but can be readily determined by a skilled artisan. The cleavage ability of these restriction enzymes is blocked by cytosine methylation. Thus, only non-methylated sites will be cleaved.

For example, the enzyme Hpall can cut DNA at a CCGG sequence. However, if the C preceding the G is methylated, Hpall will not be able to cut the DNA. This is in contrast to the isoschizomer restriction enzyme Mspl, which can cut the CCGG sequence regardless of its methylation status. Accordingly, in certain embodiments, a method according to the invention is performed on two identical samples using two different isoschizomer restriction enzymes one of which is sensitive to methylation and one of which is not. Comparison of the sequences of the chimeric DNAs obtained by the two methods is indicative of the methylation status of potential DNA methylation sites. Furthermore, such a method can provide a quantitative estimate of the probability of DNA methylation at potential sites of DNA methylation.

Following cleavage of the genomic DNA with one or more MSRE' s the enzymes may be inactivated, for example by heating. DNA fragments may also be isolated from the reaction mixture (e.g., by DNA precipitation, use of a DNA affinity column and/or use of size-exclusion chromatography). However, in certain aspects the entire reaction mixture may be used in the ligation step (B).

B. Ligation of DNA linker(s) to cleaved genomic DNA

Following MSRE cleavage, the cleaved genomic DNA has defined end sequences (e.g., overhang sequence), and can be ligated to known linker sequences. Double-stranded oligonucleotide linkers can be selected, for example, based on their sequence, such that, when annealed, the oligonucleotides have an overhanging end complimentary that of the cleaved genomic DNA. Furthermore, in cases wherein the cleavage and ligation steps are performed simultaneously or in cases where the MSRE(s) is not inactivated, the annealed oligonucleotides should lack a cleavage site for the MSRE(s).

The defined sequence in the linker is useful for several purposes:

- It can be used to amplify the tagged sites at a later step;

- It can comprise a type Hs restriction enzyme recognition site to recover a short fragment of the annealed genomic DNA (in step "C"); - It can comprise an affinity moiety, such as biotin, to purify the tagged sequence from rest of genomic DNA;

- It can comprise a "DNA bar code" sequence for sample identification; and

- It can comprise a label, such as a fluorescent label, for detection of tagged DNAs. Example oligonucleotides for tagging cleaved DNA are provided below: a. Linker A, 5^{^}-Biotin-TEG -ACC ATG CGG TTC GA GGATCCGACT -3^V

(CTMm-Al; SEQ ID NO: 1) with reverse complement 5'- CG AGT CGG ATC CTC GAA- 3^v(CTMm-A2; SEQ ID NO: 2) annealed together to form double stranded linker. This linker can be ligated to any restriction enzyme cleavages site with a 5^V end CG overhang. b. Linker B, 5^{^}-Biotin-TEG ctt cac tga gcg tt GGATCCGACT -3^V (CTMm-Bl;

SEQ ID NO: 3) and 5'- CG AGT CGG ATC CAA CGC -3^V (CTMm-B2; SEQ ID NO: 4) annealed together to form double stranded linker.

TCCGAC = Mmel site is underlined. Mmel is a type Hs restriction enzyme, which has recognition sequence TCCGAC and cleaves the DNA 20/18 bases away from the recognition site. Biotin-TEG= biotin linked to TEG (tetra-ethyleneglycol).

A wide a array of DNA ligase enzymes are available and may be used to ligate the cleaved genomic DNA to oligonucleotide linkers. Examples of ligases include without limitation, T4 DNA ligase, E. coli DNA ligase and Thermococcus sp. DNA ligase {e.g., 9°N™ available from New England BioLabs^®). DNA ligation can be carried out in a variety of buffers in appropriate salt conditions. Buffer conditions may be adjusted depending on the ligase that is used and the requirements of other enzymes that may be present in the reaction. For example, T4 DNA ligase requires the presence of ATP whereas E. coli DNA ligase requires NAD. In practice, step A, "methylation-sensitive DNA cleavage," and step B, "Ligation of the cleaved DNA to linker sequences," can be conducted in one reaction with restriction enzyme cutting and adaptors ligation occurring essentially simultaneously.

In certain aspects, a method according to the invention further comprises a step for ligated end repair and/or removal of free non-ligated oligonucleotide linkers. Oligonucleotide linkers are designed such that only one strand of the linker DNA is ligated to the cleaved end of genomic DNA by methylation sensitive restriction enzyme {e.g., in the example above the CTMm-Al and CTMm-Bl oligosnucleotides). The other strand denatures upon heating, and a DNA polymerase, such as Taq polymerase, may be used to repair the single stranded end into double strand DNA. The free oligonucleotides may be selectively removed {e.g., by using a DNA affinity column), such that only the tagged DNA is recovered. However, a linker can also be designed to have both strands ligated to the cleaved ends of methylation sensitive restriction enzyme.

C. Cleavage of the tagged genomic DNA with a restriction enzyme.

Virtually any restriction enzyme {e.g., AIuI, EcoRI, BamHI, DpnII, Sad) may be used to cleave a tagged genomic DNA, so long as the enzyme does not cleave the DNA tag sequence. This cleavage will generate a DNA fragment that is tagged at one end with a known sequence. The length to the tagged DNAs, will vary depending on the frequency that the restriction enzymes cleaves genomic sequence.

In one embodiment, a type Hs or type IV restriction enzyme digestion is used to cleave the tagged genomic DNA. Type Hs and type IV restriction enzymes cleave DNA outside their recognition sequences. Examples of such enzymes include Mmel, Acul, Bpml, BsmFI, and EcoP15I. For example, Mmel can be used to cleave the tagged genomic DNA to generate short tagged genomic DNA fragment sequences. In the case of Mmel, once cleaved, the tagged genomic DNA contains the linker sequence plus 18-20 nucleotides of DNA (of genomic origin) outside the Mmel recognition sequences with a two bases 3" end overhang. Following cleavage of the tagged genomic DNAs, the tagged DNAs may be purified.

For example, in cases wherein the tag DNA comprises an affinity label such biotin the tagged DNA may be purified by affinity chromatography. In this case, avidin coated beads, plates, or any avidin coated surface can be used to purify the biotin labeled short linker-genomic DNA sequence. The cleaved DNA is simply mixed with avidin coated beads, incubated to allow the biotin labeled DNA to bind to the avidin beads and the beads washed to remove components other than tagged, cleaved genomic DNA. The biotin labeled DNA can be eluted into water for use in further steps.

D. Ligation of cleaved, tagged genomic DNA sequence.

In one embodiment, the tagged genomic DNA sequences are cleaved with an enzyme that generates and overhang sequence. Thus, the tagged DNAs can be subjected to ligation and form head-to-head dimers with genomic sequence flanked by DNA linker sequence. In this case, the genomic DNA of each head-to-head dimer represents two sites of MSRE cleavage.

In certain other embodiments, a second DNA linker can be ligated to the exposed (cleaved) end of tagged genomic DNA. As described above the DNA linker can be designed to comprise a compatible overhang for ligation to genomic DNA cleaved with and particular restriction endonuclease. In the case where a second tag DNA is ligated to the genomic DNA the resting DNA will comprise a monomer genomic DNA corresponding to a single MSRE cleavage event, flanked by the tag DNA sequences. E. Determining the nucleotide sequence of a chimeric DNA The resultant genomic DNA sequences flanked by DNA linker sequences can be used with many different methods to evaluate genomic methylation status. Some methods that are available in the art and may be used for analysis of the chimeric DNA sequence include:

- PCR amplification of the chimeric DNAs; - direct single molecule sequencing;

- large scale sequence analysis; and

- RNA transcription for use as probes in microarray analysis.

For example, chimeric DNAs may be amplified by PCR and the PCR products analyzed by conventional sequencing or by hybridization to an array of the known sequences. In certain aspects, the chimeric DNA sequences are subjected to direct for single molecule sequencing. Because each chimeric DNA molecule provides information regarding methylation status at one site in the genome (or in certain aspects two sites in the genome), use of high throughput sequencing technologies enable a profile of a whole genome to be rapidly constructed. II. Genomic DNA and Samples

Exemplary eukaryotic genomic DNA that can be used in a method of the invention includes, without limitation, mammal DNA such as a rodent, mouse, rat, rabbit, guinea pig, ungulate, horse, sheep, pig, goat, cow, cat, dog, primate, human or non-human primate. Plant DNA may also be analyzed according to the invention. For example, DNA from Arabidopsis thaliana, maize, sorghum, oat, wheat, rice, canola, or soybean may be analyzed. It is further contemplated that genomic DNA from other organisms such as algae, a nematodes, insects (e.g., Drosophila melanogaster, mosquito, fruit fly, honey bee or spider), fish, reptiles, amphibians and yeast may be analyzed.

As indicated above, genomic DNA can be isolated from one or more cells, bodily fluids or tissues. An array of methods can be used to isolate genomic DNA from samples such as blood, sweat, tears, lymph, urine, saliva, semen, cerebrospinal fluid, feces or amniotic fluid. Genomic DNA can also be obtained from one or more cell or tissue in primary culture, in a propagated cell line, a fixed archival sample, forensic sample or archeological sample.

Methods for isolating genomic DNA from a cell, fluid or tissue are well known in the art (see, e.g., Sambrook et al, 2001). Exemplary cell types from which genomic DNA can be obtained in a method of the invention include, a blood cell such as a B lymphocyte, T lymphocyte, leukocyte, erythrocyte, macrophage, or neutrophil; a muscle cell such as a skeletal cell, smooth muscle cell or cardiac muscle cell; germ cell such as a sperm or egg; epithelial cell; connective tissue cell such as an adipocyte, fibroblast or osteoblast; neuron; astrocyte; stromal cell; kidney cell; pancreatic cell; liver cell; or keratinocyte. A cell from which genomic DNA is obtained can be at a particular developmental level including, for example, a hematopoietic stem cell or a cell that arises from a hematopoietic stem cell such as a red blood cell, B lymphocyte, T lymphocyte, natural killer cell, neutrophil, basophil, eosinophil, monocyte, macrophage, or platelet. Other cells include a bone marrow stromal cell (mesenchymal stem cell) or a cell that develops therefrom such as a bone cell (osteocyte), cartilage cells (chondrocyte), fat cell (adipocyte), or other kinds of connective tissue cells such as one found in tendons; neural stem cell or a cell it gives rise to including, for example, a nerve cells (neuron), astrocyte or oligodendrocyte; epithelial stem cell or a cell that arises from an epithelial stem cell such as an absorptive cell, goblet cell, Paneth cell, or enteroendocrine cell; skin stem cell; epidermal stem cell; or follicular stem cell. Generally any type of stem cell can be used including, without limitation, an embryonic stem cell, adult stem cell, totipotent stem cell or pluripotent stem cell.

A cell from which a genomic DNA sample is obtained for use in the invention can be a normal cell or a cell displaying one or more symptom of a particular disease or condition.

Thus, a genomic DNA used in a method of the invention can be obtained from a cancer cell, neoplastic cell, apoptotic cell, senescent cell, necrotic cell, an autoimmune cell, a call comprising a heritable genetic disease or the like.

III. Kits

The kits may comprise suitably aliquoted reagents of the present invention, such as a type Hs or type IV endonuclease; a methylation sensitive DNA endonuclease; a DNA ligase; a DNA polymerase and/or DNA oligonucleotides (e.g., oligonucleotides that can be annealed to form a linker). The components of the kits may be packaged either in aqueous media or in lyophilized form. The container means of the kits will generally include at least one vial, test tube, flask, bottle, syringe or other container means, into which a component may be placed, and preferably, suitably aliquoted. Where there is more than one component in the kit, the kit also will generally contain a second, third or other additional container into which the additional components may be separately placed. However, various combinations of components may be comprised in a vial. The kits of the present invention also will typically include a means for containing reagent containers in close confinement for commercial sale. Such containers may include cardboard containers or injection or blow-molded plastic containers into which the desired vials are retained.

When the components of the kit are provided in one or more liquid solutions, the liquid solution is an aqueous solution, with a sterile aqueous solution being preferred.

However, the components of the kit may be provided as dried powder(s). When reagents and/or components are provided as a dry powder, the powder can be reconstituted by the addition of a suitable solvent. It is envisioned that the solvent may also be provided in another container means.

Such kits may also include components that facilitate isolation of nucleic acids (e.g., genomic DNA), such as reagents, columns or filters. Such kits generally will comprise, in suitable means, distinct containers for each individual reagent or solution as well as for the targeting agent.

A kit may also include instructions for employing the kit components as well the use of any other reagent not included in the kit. Instructions may include variations that can be implemented.

IV. Examples

The following examples are included to demonstrate preferred embodiments of the invention. It should be appreciated by those of skill in the art that the techniques disclosed in the examples which follow represent techniques discovered by the inventor to function well in the practice of the invention, and thus can be considered to constitute preferred modes for its practice. However, those of skill in the art should, in light of the present disclosure, appreciate that many changes can be made in the specific embodiments which are disclosed and still obtain a like or similar result without departing from the spirit and scope of the invention. Example 1: 5-methylcytosine DNA Methylation Analysis of Lambda Phage DNA

1. Methylation sensitive restriction enzyme digestion. Lambda DNA was cut with methylation-sensitive restriction enzymes and ligated to DNA linkers to tag the cleavage positions. DNA source: Lambda DNA (N301 Is, New England Biolabs, Inc). This DNA can also be methylated by HpaII DNA methyltransferase (New England Biolabs, Inc) at CCmGG recognition sites. The methylation reaction was conducted as instructed by the manufacturer. The second C base in front of the G is methylated and such methylated Lambda DNA is resistant to digestion by HpaII. Other enzymes and reagents: restriction enzymes and ligase were purchased from

New England Biolabs, Inc. Oligo DNAs are from IDT DNA Corp. ATP is from USB Corp.

Reaction conditions: For 25 μl reaction, 500ng HpaII methylated or non-methylated DNA was incubated with 4 units of either HpaII or HpyCH4IV restriction enzyme, 500 units T4 DNA ligase, ImM ATP, 200 nM each of linker A and B in NEB Reaction Buffer 1. The reaction was carried out at 21⁰C for 6 hours, then 12 hours at 8°C.

2. End Repair. The product of the previous step was incubated at 74°C for 30 minutes in the presence of 2 μl 2.5mM dNTP nucleotide mixture and 1 unit of Taq polymerase (Promega) to repair the linker-ligated ends. Following end repair, the product was purified by DNA Clean & Concentrator-5 (Zymo Reseach Corp.) according to manufacturer's instructions.

3. Mmel restriction enzyme digestion. The above purified DNA was cleaved by 20 units of Mmel restriction enzyme in a 50 μl reaction at 37°C for 1 hour according to the manufacturer's instructions.

4. Magnetic Avidin recovery of linker tagged DNA. The Mmel-digested DNA was added to 500 μl of TENS (10 mM Tris-HCl, pH8.0, ImM EDTA, IM NaCl) and 20μl of

Dynal Beads and shaken at room temperature for 30 minutes. The magnetic beads were washed with 500 μl of TE (10 mM Tris-HCl, pH8.0, ImM EDTA). The beads were resuspended in 50 μl TE and phenol-chloroform extraction was used to recover the DNA in 10 μL TE. 5. Ligation of the recovered linker tagged DNA. Ligation was conducted in 12 μl ligation reaction containing 2000 units of ligase at 10⁰C for 15 hours according to the manufacturer's instructions.

PCR amplification. The following two primers were used for PCR amplification using ZymoTaq DNA polymerase (Zymo Research Corp) according to the manufacturer instruction. CTM-A-amp: 5^{^}-ATGCGGTTCGAGGATCCGACT CG -3^V (SEQ ID NO: 5); CTM-B-amp: 5^V- CACTGAGCGTTGGATCCGACT CG-3^{^} (SEQ ID NO: 6)

6. Purification of amplified products. PCR amplified products were subjected to agarose gel electrophoresis and excised from the gel using the Zymoclean Gel DNA Recovery Kit and ligated to pGEM-Easy T vector (Promega). The recovered plasmids were sequenced by standard commercial sequencing company.

Results: Fifty-nine (59) tagged lambda DNA sequences were analyzed from HpaII methylated DNA. All 59 sequences were tagged at HpyCH4IV sites. None was tagged at the methylated HpaII sites. However, when non-methylated DNA was used as input, 54 tagged lambda DNA were analyzed. Of the 54 sequences, 35 sequences were tagged to the HpaII sites (65%) and 19 (35%) sequences were tagged at HpyCH4IV sites. The distribution is in consistent with theoretic prediction ratio. There are 143 HpyCH 4IV and 328 Hpa II cleavage sites on lambda DNA with theoretic 70% versus 30% distribution of HpaII and HpyCH4IV sites, respectively, according to the cutting frequencies on lambda DNA. See results shown in FIG. 2.

REFERENCES

Each of the foregoing documents is hereby incorporated by reference in its entirety: U.S. Patent No. 5,695,937

Sambrook et ah, Molecular Cloning: A Laboratory Manual, 3rd edition, Cold Spring Harbor Laboratory, New York (2001).

Claims

What is claimed is:

Claim 1. A method for determining genomic DNA methylation status at potential DNA methylation sites comprising: a) cleaving genomic DNA with at least one methylation-sensitive DNA endonuclease to generate cleaved genomic DNA; b) ligating the cleaved genomic DNA to a DNA oligonucleotide tag having a known sequence to generated tagged DNA; c) cleaving the tagged DNA with a second endonuclease under conditions wherein DNA cleavage occurs, wherein the second endonuclease does not cleave the oligonucleotide tag; d) ligating the tagged DNA to generate a chimeric DNA molecule having two DNA oligonucleotide tag sequences flanking the genomic DNA; and e) determining the nucleotide sequence of the chimeric DNA molecule of step (d), thereby determining the genomic DNA methylation status at a potential methylation site.

Claim 2. The method of claim 1, comprising determining the genomic DNA methylation status at a plurality of potential methylation sites.

Claim 3. The method of claim 2, comprising determining the genomic DNA methylation status at 5, 10, 15, 20, 50, 100, 500 or 1,000 potential methylation sites.

Claim 4. The method of claim 1, wherein determining the genomic DNA methylation status at a potential methylation site comprises identifying a sequence corresponding to chimeric DNA molecule sequence on a genomic map.

Claim 5. The method of claim 1, wherein the methylation-sensitive DNA endonuclease is Acil, Hpall, HinPlI, HpyCH4IV, Aatll, AcII, Afel, Agel, Ascl, AsiSI, Aval, BmgBI, BsaAI, BsaHI, BsiEI, BsiWI, BsmBI, BspDI, BstBI, CIaI, Eagl, Faul, Fsel, Fspl, Haell, Hgal, Hhal, Hpy99I, Kasl, MM, Nael, Narl, NgoMIV, Notl, NmI, PaeR7I, PmII, Pvul, RsrII, SacII, Sail, Sfol, SgrAI, Smal, SnaBI or Zral.

Claim 6. The method of claim 2, wherein the methylation-sensitive DNA endonuclease recognizes a 4-base-pair sequence.

Claim 7. The method of claim 3, wherein the methylation-sensitive DNA endonuclease is Hpall.

Claim 8. The method of claim 1, wherein (a) cleaving the genomic DNA with at least one methylation-sensitive DNA endonuclease comprises cleaving the DNA with at least 2, at least 3 or at least 4 methylation-sensitive DNA endonucleases.

Claim 9. The method of claim 1, wherein steps (a) and (b) are performed in a single reaction.

Claim 10. The method of claim 1, wherein steps (c) and (d) are performed in a single reaction.

Claim 11. The method of claim 1, wherein the genomic DNA is mammalian genomic DNA.

Claim 12. The method of claim 11, wherein the mammalian genomic DNA is human genomic DNA.

Claim 13. The method of claim 12, wherein the human genomic DNA is from a human subject.

Claim 14. The method of claim 11, wherein the human genomic DNA is from a cell line or tissue bank.

Claim 15. The method of claim 1, wherein the genomic DNA is from a blood sample, a tissue biopsy sample, a urine sample or a saliva sample.

Claim 16. The method of claim 1, wherein step (d) comprises ligating the tagged DNA in the presence of a second DNA oligonucleotide tag to generate a chimeric DNA having two DNA oligonucleotide tag sequences that flank genomic DNA corresponding to one site of methylation-sensitive DNA cleavage.

Claim 17. The method of claim 1, wherein step (d) comprises ligating the tagged DNA to a second tagged DNA to generate a chimeric DNA having two DNA oligonucleotide tag sequences that flank genomic DNA corresponding to two sites of methylation-sensitive DNA cleavage.

Claim 18. The method of claim 1, wherein the DNA oligonucleotide tag comprises a label.

Claim 19. The method of claim 18, wherein the label is a fluorescent label, a radioactive label, a sequence label, an enzymatic label or an affinity label.

Claim 20. The method of claim 19, wherein the affinity label is biotin.

Claim 21. The method of claim 1, wherein step (e) determining the sequence of the chimeric DNA comprises sequencing the chimeric DNA or hybridization of the chimeric DNA to an array of known nucleotide sequences.

Claim 22. The method of claim 1, wherein step e) determining the sequence of the chimeric DNA comprises PCR amplification of the chimeric DNA or cloning of the chimeric DNA into a plasmid.

Claim 23. The method of claim 1, wherein step e) determining the sequence of the chimeric DNA is by single molecule direct sequencing.

Claim 24. The method of claim 1, wherein step b) further comprises treating the tagged DNA with an enzyme that polymerizes additional 3' DNA sequence.

Claim 25. The method of claim 19, wherein the enzyme that polymerizes additional 3 ' sequence is Taq polymerase.

Claim 26. The method of claim 1, wherein the DNA oligonucleotide tag comprises an affinity label and wherein step (b) further comprises isolating the tagged DNA using the affinity label.

Claim 27. The method of claim 1, wherein the second endonuc lease of step (c) is a type Hs or type IV endonuclease and wherein the recognition sequence for the second endonuclease is not comprised in the DNA oligonucleotide tag.

Claim 28. The method of claim 1, wherein the second endonuclease of step (c) is Mmel, Acul, Bpml, BsmFI or EcoP15I.

Claim 29. The method of claim 1, wherein the second endonuc lease of step (c) is one or more type II restriction endonuc lease.

Claim 30. The method of claim 1, wherein the method is performed by a robot.

Claim 31. A method for calculating a risk of a disease in a subject comprising: (i) determining the genomic DNA methylation status at potential DNA methylation sites in the DNA of the subject according to the method of claim 1; and (ii) comparing the DNA methylation status at potential DNA methylation sites to a reference that is representative of the DNA methylation status of corresponding DNA methylation sites in a subject having said disease.

Claim 32. The method of claim 31, further comprising obtaining a sample comprising genomic DNA from the subject.

Claim 33. A kit for determining DNA methylation status in genomic DNA comprising: a type Hs or type IV endonuclease; a methylation sensitive DNA endonuclease; and a double stranded DNA oligonucleotide comprising a label.

Claim 34. The kit of claim 27, further comprising one or more of the following an affinity purification column; a DNA ligase; a DNA polymerase; DNA sequencing reagents; instructions; and/or DNA primers.