WO2010112033A2

WO2010112033A2 - Method for estimating the risk of having or developing multiple sclerosis using sequence polymorphisms in a specific region of chromosome x

Info

Publication number: WO2010112033A2
Application number: PCT/DK2010/050074
Authority: WO
Inventors: Bjørn ANDERSEN NEXØ; Finn Skou Pedersen; Tove Christensen; Anné MØLLER LARSEN; Palle Villesen Fredsted; Magdalena Janina Laska
Original assignee: Østjysk Innovation A/S
Priority date: 2009-03-31
Filing date: 2010-03-31
Publication date: 2010-10-07
Also published as: WO2010112033A3

Abstract

The present invention provides methods for identifying human subjects with an increased risk of having or developing multiple sclerosis, as well as for estimating the prognosis for multiple sclerosis of an individual and for estimating a treatment response of an individual suffering or at risk of suffering from multiple sclerosis. In particular, this invention relates to the identification and characterization of polymorphisms positioned in or near human endogenous retroviruses on the human chromosome X, 3, 6, 16 and 19. The invention also discloses use of anti-viral compounds in the combat of multiple sclerosis.

Description

Method for estimating the risk of having or developing multiple sclerosis using sequence polymorphisms in a specific region of chromosome X

Background

DNA polymorphisms provide an efficient way to study the association of genes and diseases by analysis of linkage and linkage disequilibrum. With the sequencing of the human genome a myriad of hitherto unknown genetic polymorphisms among people have been detected . Most com mon among these are the si ngle nucleotide polymorphisms, also called SNPs, of which several millions are known. Other examples are variable number of tandem repeat polymorphisms, insertions, deletions and block modifications. Tandem repeats often have multiple different alleles (variants), whereas the other groups of polymorphisms usually just have two alleles. Some of these genetic polymorphisms probably play a direct role in the biology of the individuals, including their risk of developing disease, but the virtue of the majority is that they can serve as markers for the surrounding DNA, and thus serve as leads during as search for a causative gene polymorphism, as substitutes in the evaluation of its role in health and disease, and as substitutes in the evaluation of the genetic constitution of individuals.

The association of an allele of one sequence polymorphism with particular alleles of other sequence polymorphisms in the surrounding DNA has two origins, known in the genetic field as li nkage and linkage disequilibrium, respectively. Linkage arises because large parts of chromosomes are passed unchanged from parents to offspring, so that minor regions of a chromosome tend to flow unchanged from one generation to the next and also to be similar in different branches of the same family. Linkage is gradually eroded by recombination occurring in the cells of the germline, but typically operates over multiple generations and distances of a number of million bases in the DNA.

Linkage disequilibrium deals with whole populations and has its origin in the (distant) forefather in whose DNA a new sequence polymorphism arose. The immediate surroundings in the DNA of the forefather will tend to stay with the new allele for many generations. Recombination and changes in the composition of the population will again erode the association , but the new allele and the alleles of any other polymorphism nearby will often be partly associated among unrelated humans even today. A crude estimate suggests that alleles of sequence polymorphisms with distances less than 10000 bases in the DNA will have tended to stay together since modern man arose. Linkage disequilbrium in limited populations, for instance Europeans, often extends over longer distances. This can be the result of newer mutations, but can also be a consequence of one or more "bottlenecks" with small population sizes and considerable inbreeding in the history of the current population. Two obvious possibilities for "bottlenecks" in Europeans are the exodus from Africa and the repopulation of Europe after the last ice age.

Linkage disequilibrium is the results of many stochastic events and as such subject to statistical variation occasionally resulting in discontinuities, lack of a monotonic relationship between association and distance and differences between people of different ethnicity. Therefore, it is often advantageous to study more that one sequence polymorphism in a given region. This also allows for further definition of the genetic surroundings of the biologically relevant polymorphism by combining the associated alleles of the different markers into a socalled haplotype.

Humans in general carry two copies of each human chromosome in each cell. There are exceptions to this rule, not relevant to this application. We therefore speak about genotypes i.e. the combined analysis of both chromosomes at a given sequence polymorphism. The resulting genotypes of a person, analysed for instance on DNA from peripheral blood leukocytes, are inherently very stable over time. Therefore, this type of analysis can be performed any time in the life of a person and will be applicable to this person for his or her entire life. By the same token such genetic analyses are ideally suited to predict future risks of disease. A variety of investigations suggest that many diseases in part are determined by the genetic constitution of the individual.

Multiple sclerosis (MS)

Mulitiple sclerosis is an autoimmune condition in which the immune system attacks the central nervous system, leading to demyelination. Disease onset usually occurs in young adults, and it is more common in females. It has a prevalence that ranges between 2 and 150 per 100,000.

MS affects the ability of nerve cells in the brain and spinal cord to communicate with each other. Nerve cells communicate by sending electrical signals called action potentials down long fibers called axons, which are wrapped in an insulating substance called myelin. In MS, the body's own immune system attacks and damages the myelin.

When myelin is lost, the axons can no longer effectively conduct signals. The name multiple sclerosis refers to scars (scleroses - better known as plaques or lesions) in the white matter of the brain and spinal cord, which is mainly composed of myelin. The cause of MS remains unknown, and theories include genetics or infections. Different environmental risk factors have also been found.

Almost any neurological symptom can appear with the disease, and often progresses to physical and cognitive disability. MS takes several forms, with new symptoms occurring either in discrete attacks (relapsing forms) or slowly accumulating over time (progressive forms). Between attacks, symptoms may go away completely, but permanent neurological problems often occur, especially as the disease advances.

Until now no cure for MS has been known. Treatments attempt to return function after an attack, prevent new attacks, and prevent disability. MS medications can have adverse effects or be poorly tolerated, and many patients pursue alternative treatments, despite the lack of supporting scientific study. The prognosis is difficult to predict; it depends on the subtype of the disease, the individual patient's disease characteristics, the initial symptoms and the degree of disability the person experiences as time advances.

Genetic factors MS is not considered a hereditary disease. However, a number of genetic variations have been shown to increase the risk of developing the disease. The risk of acquiring MS is higher in relatives of a person with the disease than in the general population, especially in the case of siblings, parents, and children. In the case of monozygotic twins, concordance occurs only in about 35% of cases, and half-siblings have a lower risk than full siblings, indicating a polygenic origin.

Apart from familial studies, specific genes have been linked with MS. Differences in the human leukocyte antigen (HLA) system — a group of genes in chromosome 6 that serves as the major histocompatibility complex in humans — increase the probability of suffering MS. Two other genes have been shown to be linked to MS. These are the IL2RA and the IL7RA, subunits of the receptor for interleukin 2 and interleukin 7 respectively. The HLA complex is involved in antigen presentation, which is crucial to the functioning of the immune system, while mutations in the IL2 and IL7 receptor genes were already known to be associated with diabetes and other autoimmune conditions, supporting the notion that MS is an autoimmune disease. The gene encoding kinesin KIF1B is the first neuronal expressed gene demonstrated to enhance the risk for the disease. Other studies have linked genes in chromosome 5 with the disease.

Treatment The earliest clinical presentation of relapsing-remitting MS (RRMS) is the clinically isolated syndrome (CIS). Several studies have shown that treatment with interferons during an initial attack can decrease the chance that a patient will develop clinical MS. As of 2007, six disease-modifying treatments have been approved by regulatory agencies of different countries for RRMS. Three are interferons: two formulations of interferon beta-1 a (trade names Avonex, CinnoVex, ReciGen and Rebiή and one of interferon beta-1 b (U.S. trade name Betaseron, in Europe and Japan Betaferon). A fourth medication is glatiramer acetate {Copaxone). The fifth medication, mitoxantrone, is an immunosuppressant also used in cancer chemotherapy, approved only in the USA and largely for secondary progressive MS. The sixth is natalizumab (marketed as Tysabri). All six medications are modestly effective at decreasing the number of attacks and slowing progression to disability, although their efficacy rates differ, and studies of their long-term effects are still lacking. Comparisons between immunomodulators (all but mitoxantrone) show that the most effective is natalizumab, both in terms of relapse rate reduction and halting disability progression; it has also been shown to reduce the severity of MS. Mitoxantrone may be the most effective of them all; however, it is generally not considered as a long-term therapy, as its use is limited by severe cardiotoxicity.

The interferons and glatiramer acetate are delivered by frequent injections, varying from once-per-day for glatiramer acetate to once-per-week (but intra-muscular) for Avonex. Natalizumab and mitoxantrone are given by IV infusion at monthly intervals.

Treatment of progressive MS is more difficult than relapsing-remitting MS. Mitoxantrone has shown positive effects in patients with secondary progressive and progressive relapsing courses. It is moderately effective in reducing the progression of the disease and the frequency of relapses in patients in short-term follow-up. No treatment has been proven to modify the course of primary progressive MS.

The present invention provides novel methods for treatment, relapse, progression and/or prophylaxis of multiple sclerosis.

Summary of the invention

The present invention discloses regions of the human genome comprising human endogenous retroviruses (HERVs) as involved in the development of multiple sclerosis (MS). The present invention thus opens up for methods of estimating the disease risk of an individual of having or developing MS, methods for estimating the prognosis for multiple sclerosis in an individual as well as the use of antiviral compounds in order to treat, ameliorate and for prophylaxis of MS.

HERVs are retroviruses derived from ancient viral infections of germ cells in humans, as such their proviruses are passed on to the next generation thus remaining in the human genome. Retroviruses are viruses that reverse-transcribe their RNA into DNA for integration into the host's genome. A majority of retroviruses such as HIV infect somatic cells. However, retroviruses can also infect germ line cells, whereby the retroviral sequences have been transmitted to the next generation, consequently thus termed endogenous. Endogenous retroviruses may persist in the genome of their host for long periods. Generally, the HERVs are infectious only for a short time after integration due to the introduction of mutations during replication of the host cell DNA, or the the HERVS are partially excised from the genome due to recombinational deletion. HERVs are receiving increasing attention due to their alleged role of evolution but also because some HERVs have been suggested to play a role in some autoimmune diseases and also cancers.

The human genome comprises several thousands of HERVs, since the HERVs constitute nearly 1 % of the human genome.

The genomic organisation of HERVs is similar to present day exogenous retroviruses such as human immunodeficiency virus (HIV) and human T cell leukaemia virus (HTLV), and are composed of gag, pol, and env regions sandwiched between two long terminal repeats (LTRs). The LTRs harbours nucleotide sequence motifs that are fundamental to the regulation of retroviral gene expression. The gag and env genes encode retroviral capsid and envelope proteins, respectively, whereas the pol gene encodes enzymes for viral replication, integration, and protein cleavage. The flow of genetic information is reversed in retroviruses compared with the normal flow of genetic information from DNA → RNA → protein. Thus, all retroviruses have RNA genomes that are reversely transcribed into DNA catalysed by the enzyme reverse transcriptase.

The human genome sequencing project has revealed a number of HERVs and the skilled person has no difficulties in recognising sequences that derive from retrovirus integration into the human genome due to the above mentioned organisation of the genomic structure.

Thus, in a first aspect the invention relates to a method for estimating the disease risk of an individual of having or developing multiple sclerosis comprising

in a sample comprising genetic material from said individual assessing one or more sequence polymorphisms in genetic regions selected from the group of genetic regions consisting of region r on human chromosome X comprising HERV-F(c)1 corresponding to SEQ ID NO: 1 , or a part thereof, and/or in a region complementary to SEQ ID NO: 1 , or a part thereof, and/or in a transcription product from a sequence in a region corresponding to SEQ ID NO: 1 , or a part thereof, and/or translation product from a sequence in a region corresponding to SEQ ID

NO: 1 , or a part thereof; region t on human chromosome 6 comprising HERV-H corresponding to SEQ ID NO: 5, or a part thereof, and/or in a region complementary to SEQ ID NO: 5, or a part thereof, or in a transcription product from a sequence in a region corresponding to

SEQ ID NO: 5, or a part thereof, and/or translation product from a sequence in a region corresponding to SEQ ID NO: 5, or a part thereof; region u on human chromosome 16 comprising HERV-K13 corresponding to SEQ ID NO: 3, or a part thereof, and/or in a region complementary to SEQ ID NO: 3, or a part thereof, and/or in a transcription product from a sequence in a region corresponding to

SEQ ID NO: 3, or a part thereof, and/or translation product from a sequence in a region corresponding to SEQ ID

NO: 3, or a part thereof; and region v on human chromosome 19, comprising HERV-K [int2] corresponding to SEQ ID NO: 7, or a part thereof, and/or in a region complementary to SEQ ID NO: 7, or a part thereof, and/or in a transcription product from a sequence in a region corresponding to SEQ ID NO:7, or a part thereof, and/or translation product from a sequence in a region corresponding to SEQ ID

NO: 7, or a part thereof; obtaining a sequence polymorphism response, estimating the risk of said individual based on the sequence polymorphism response.

The estimation of the disease risk of an individual can involve the comparison of the number and/or kind of polymorphic sequences identified with a predetermined disease risk profile. Such a profile can be based on statistical data obtained for a relevant reference group of individuals. In particular the disease is multiple sclerosis. The presence of an allele is determined by determining the nucleic acid sequence of all or part of the region according to standard molecular biology protocols well known in the art as described for example in Sambrook et al. (1989) and as set forth in the Examples provided herein or products of the nucleic acid sequences.

In particular, the nucleic acid molecules of the present invention are nucleic acid sequences forming part of the region r corresponding to position SEQ ID NO: 1 , and preferably certain nucleic acid sequences within the gene referred to herein as HERV- F(c)1 found on chromosome X. In another embodiment the nucleic acid molecules of the present invention are nucleic acid sequences forming part of the region t corresponding to position SEQ ID NO: 5, and preferably nucleic acid sequences within the gene referred to herein as HERV-H on chromosome 6. . In yet another embodiment the nucleic acid molecules of the present invention are nucleic acid sequences forming part of the region u corresponding to position SEQ ID NO: 3, and preferably nucleic acid sequences within the gene referred to herein as HERV-K13 on chromosome 16. In further embodiment the nucleic acid molecules of the present invention are nucleic acid sequences forming part of the region v corresponding to position SEQ ID NO: 7, and preferably nucleic acid sequences within the gene referred to herein as HERV-K [INT2] on chromosome 19. As demonstrated in the examples presented below, the here mentioned human endogenous retroviruses associated with human multiple sclerosis. Furthermore, the invention relates to a method for estimating the prognosis for multiple sclerosis of an individual comprising

- in a sample comprising genetic material from said individual assessing one or more sequence polymorphisms in genetic regions selected from the group of genetic regions consisting of region r on human chromosome X comprising HERV-F(c)1 corresponding to SEQ ID NO: 1 , or a part thereof, and/or in a region complementary to SEQ ID NO: 1 , or a part thereof, and/or in a transcription product from a sequence in a region corresponding to SEQ ID NO: 1 , or a part thereof, and/or translation product from a sequence in a region corresponding to SEQ ID NO: 1 , or a part thereof; region t on human chromosome 6 comprising HERV-H corresponding to SEQ ID NO: 5, or a part thereof, and/or in a region complementary to SEQ ID NO: 5, or a part thereof, or in a transcription product from a sequence in a region corresponding to

SEQ ID NO: 5, or a part thereof, and/or translation product from a sequence in a region corresponding to SEQ ID NO: 5, or a part thereof; region u on human chromosome 16 comprising HERV-K13 corresponding to SEQ ID NO: 3, or a part thereof, and/or in a region complementary to SEQ ID NO: 3, or a part thereof, and/or in a transcription product from a sequence in a region corresponding to SEQ ID NO: 3, or a part thereof, and/or translation product from a sequence in a region corresponding to SEQ ID

NO: 3, or a part thereof; and region v on human chromosome 19, comprising HERV-K int2]corresponding to SEQ ID NO: 7, or a part thereof, and/or in a region complementary to SEQ ID NO: 7, or a part thereof, and/or in a transcription product from a sequence in a region corresponding to SEQ ID NO:7, or a part thereof, and/or translation product from a sequence in a region corresponding to SEQ ID NO: 7, or a part thereof; obtaining a sequence polymorphism response,

- estimating the disease prognosis of said individual based on the sequence polymorphism response.

The estimation of the disease prognosis of an individual can involve the comparison of the number and/or kind of polymorphic sequences identified with a predetermined disease prognosis profile. Such a profile can be based on statistical data obtained for a relevant reference group of individuals. Additionally provided is a method of identifying a human subject as having an increased likelihood of responding to a treatment, comprising a) correlating the presence of an r region allele genotype with an increased likelihood of responding to treatment; and b) determining the r region allele genotype of the subject, whereby a subject having an r region allele genotype correlated with an increased likelihood of responding to treatment is identified as having an increased likelihood of responding to treatment.

Thus, the present invention also relates to a method for estimating a treatment response of an individual suffering or at risk of suffering from multiple sclerosis to a disease treatment, comprising in a sample comprising genetic material from said individual assessing one or more sequence polymorphisms in genetic regions selected from the group of genetic regions consisting of region r on human chromosome X comprising HERV-F(c)1 corresponding to SEQ ID NO: 1 , or a part thereof, and/or in a region complementary to SEQ ID NO: 1 , or a part thereof, and/or in a transcription product from a sequence in a region corresponding to SEQ ID NO: 1 , or a part thereof, and/or translation product from a sequence in a region corresponding to SEQ ID NO: 1 , or a part thereof; region t on human chromosome 6 comprising HERV-H corresponding to SEQ ID NO: 5, or a part thereof, and/or in a region complementary to SEQ ID NO: 5, or a part thereof, or in a transcription product from a sequence in a region corresponding to SEQ ID NO: 5, or a part thereof, and/or translation product from a sequence in a region corresponding to SEQ ID NO: 5, or a part thereof; region u on human chromosome 16 comprising HERV-K13 corresponding to SEQ ID NO: 3, or a part thereof, and/or in a region complementary to SEQ ID NO: 3, or a part thereof, and/or in a transcription product from a sequence in a region corresponding to SEQ ID NO: 3, or a part thereof, and/or translation product from a sequence in a region corresponding to SEQ ID NO: 3, or a part thereof; and region v on human chromosome 19, comprising HERV-K int2] corresponding to SEQ ID NO: 7, or a part thereof, and/or in a region complementary to SEQ ID NO: 7, or a part thereof, and/or in a transcription product from a sequence in a region corresponding to

SEQ ID NO:7, or a part thereof, and/or translation product from a sequence in a region corresponding to SEQ ID NO: 7, or a part thereof;

- obtaining a sequence polymorphism response, - estimating the individual's response to the disease treatment based on the sequence polymorphism response.

The estimation of the individual's response to disease treatment can involve the comparison of the number and/or kind of polymorphic sequences identified with a predetermined multiple sclerosis treatment response profile. Such a profile can be based on statistical data obtained for a relevant reference group of individuals. In particular the disease is multiple sclerosis.

The invention also comprises primers or probes for use in the invention, as well as kits including these. The primers and/or probes are preferably capable of hybridising to SEQ ID NO:1 to 10, or a part thereof, in particularly the regions relevant to this invention, or a part thereof, under stringent conditions, as well as to a sequence complementary thereto. Thus, in one aspect the present invention relates to use of a primer or probe in the methods as defined in any of the preceding claims, said primer or probe being selected from primers or probes that amplifies and/or hybridises to rs391745, rs400586, rs7650656, rs318138, rs1929772, rs9394742, rs12196881 , rs12934809or rs2396212. The invention also relates to use of a kit for any of the methods as defined in the present invention, wherein said kit comprises at least one diagnostic primer and or at least one allele-specific oligonucleotide primer as defined herein.

Aspects also pertain to a method of treatment, amelioration, and/or prophylaxis of multiple sclerosis comprising administration in a therapeutically effective amount of at least one anti-retroviral compound to an individual in need thereof; Anti-retroviral compound for treatment of multiple sclerosis; Use of anti-retroviral compounds for the manufacture of a medicament for multiple sclerosis; a pharmaceutical composition for treating multiple sclerosis comprising anti- retroviral compounds.

One aspect relates to an antibody directed to an epitope of a chromosome X HERV- F(c)1 gene product, a chromosome 3 HERV-K [INT2] gene product, a chromosome 6, HERV-H gene product, a chromosome 1 6 H E RV-K13 gene product and/or a chromosome 19 HERV-K [[int2] gene product, or part thereof, as well as use of these antibodies in any of the methods of the present invention. Furthermore, the invention also relates to cloning vectors and expression vectors containing the nucleic acid molecules of the invention, as well as hosts which have been transformed with such nucleic acid molecules, including cells genetically engineered to contain the nucleic acid molecules of the invention, and/or cells genetically engineered to express the nucleic acid molecules of the invention. The nucleic acids are preferably isolated from the region r, s, t, u or v and preferably contain one or more sequence polymorphisms as described herein below in more detail. In addition to host cells and cell lines, hosts also include transgenic non-human animals (or progeny thereof).

In particular, the present invention is based on the discovery of the correlation with single nucleotide polymorphisms (SNPs), deletion polymorphisms, insertion polymorphisms, dinucleotide polymorphisms and/or tandem repeats in the regions and disease. Thus, polymorphisms have been found in the r region. However, the present invention is not limited to the polymorphisms particularly rs391745, rs400586, rs7650656, rs318138, rs1929772, rs9394742, rs12196881 , rs12934809 and/or rs2396212 but also include any polymorphism in the region. Another aspect pertains to use of a primer or probe in the methods, wherein the primer or probe are selected from primers or probes that amplifies and/or hybridises to rs391745, rs400586, rs7650656, rs318138, rs1929772, rs9394742, rs12196881 , rs12934809 or rs2396212.

Yet another aspect relates to use of a kit for any of the methods of the invention, wherein the kit comprises at least one diagnostic primer and or at least one allele- specific oligonucleotide primer as of the invention.

The term human includes both a human having or suspected of having a disease and an a-symptomatic human who may be tested for predisposition or susceptibility to disease. At each position the human may be homozygous for an allele or the human may be a heterozygote.

Drawings

Fig. 1 A cartoon of the human genome. Each horizontal bar denotes 2 or more SNPs near a virus tested for association with MS. The few bars that are half denotes the testing of a single SNP. Each X denotes a virus which fulfil the basic criteria, but which could not be tested at the present time. The signs to the left of the bars designate a statistical association with MS, see the insert in figure.

Fig. 2 Synergism between the SNP rs7650656 on chromosome 3 and rs391745 on chromosome X. It is obvious that persons with the genotype rs7650656^GG rs391745^cc have more than 10 fold higher frequency of MS compared to people with the genotype rs7650656^cc rs391745^GG. Persons with rs7650656^cc rs391745^cc or rs7650656^GG rs391745^GG have only approximately 2-fold increased risk of MS.

Fig. 3 Scan of the chromosome X region surrounding HERV-F(c)1 for polymorphisms associated with multiple sclerosis. The provirus stretches from the coordinates 97096500 to 97104400 as indicated by the line above the curve.

Fig. 4 Quantification of expression of HERV-F/H gag protein The Fluorescence Index for each cell subgroup in the three person categories is shown. Clearly HERV-F/H gag was over-expressed in acute patient CD4 and CD8a cells, relative to the same cells in controls and non-acute patients. A total of 30 controls, 30 MS patients and 12 acute attack MS patients were analyzed. The P values for MS patients versus acute attack patients for CD4 and CD8a were less that 0.0001.

Detailed description of the invention

Definitions

The term 'polymophisnϊ refers to a variable nucleotide sequence of the DNA on a chromosome. The variable nucleotide sequence can be identified by methods known to a person skilled in the art, for example by using specific oligonucleotides in for example amplification methods and/or hybridization techniques and/or observation of a size difference. However, the variable nucleotide sequence may also be detected by sequencing or for example restriction fragment length polymorphism analysis. The variable nucleotide sequence may be represented by a deletion, an insertion, an inversion, repeats, and/or a point mutation. Specifically, a genetic marker may comprise a variable number of polymorphic alleles.

One type of genetic marker is a single nucleotide polymorphism (SNP) marker that is linked to a quantitative trait locus. An SNP is a DNA sequence variation, wherein a single nucleotide - A, T, C, or G - differs between members of a species, or between paired chromosomes in an individual organism. For example, two DNA fragments, AAGCCTA to AAGCTTA, contain a difference in a single nucleotide. In this case, the SNP comprise two alleles: C and T. Single nucleotide polymorphisms may fall within coding sequences of genes, non-coding regions of genes, or in the intergenic regions between genes. SNPs within a coding sequence will not necessarily change the amino acid sequence of the protein that is produced, due to degeneracy of the genetic code. SNPs located in non-coding regions may influence transcription factor binding, splicing or alter the sequence of non-coding RNA.

SEQ ID NO: 1 shows a sequence of part of the human chromosome X comprising HERV-F(c)1 , >ref|NT_011651.16|HsX_11808:20385151-20405320 Homo sapiens chromosome X genomic contig, reference assembly coodinates chrX: 96975499- 96995668 or POL_9843 minus 9902bp to ENV_8944 plus 5000bp. .

SEQ ID NO: 2 shows a nucleotide sequence of part of the human chromosome 3 comprising HERV-K, >ref|NT_005612.15|Hs3_5769:19233270-19252428 Homo sapiens chromosome 3 genomic contig, reference assembly Coordinates: chr 3: 1 14225814-1 14234972

SEQ ID NO: 3 shows nucleotide sequences of part of the human chromosome 16 comprising HERV-K13, 2705000 - 2725000 , >ref|NT_010393.16|:c2665000-2645000 Homo sapiens chromosome 16 genomic contig, GRCh37 reference primary assembly.

SEQ ID NO: 4 shows a subset of SEQ ID NO: 3 comprising HERV-K13 ; 2710000 - 27210000, >ref|NT_010393.16|:2650000-2661000 Homo sapiens chromosome 16 genomic contig, GRCh37 reference primary assembly

SEQ ID NO: 5 shows nucleotide sequences of part of the human chromosome 6 comprising HERV-H; position 40825000 - 40840000; >ref|NT_007592.15|:40765000- 40780000 Homo sapiens chromosome 6 genomic contig, GRCh37 reference primary assembly.

SEQ ID NO:6 shows a subset of SEQ ID NO.: 5 comprising HERV-H; 40829000 - 40836500>ref|NT_007592.15|:40769000-40776500 Homo sapiens chromosome 6 genomic contig, GRCh37 reference primary assembly.

SEQ ID NO: 7 shows nucleotide sequences of part of the human chromosome 19 comprising HERV-K [INT2][int2]; 28125000 - 28142000, >ref|NT_01 1109.16|:393218- 410218 Homo sapiens chromosome 19 genomic contig, GRCh37 reference primary assembly.

SEQ ID NO: 8 shows a subset of SEQ ID NO.:7 comprising HERV-K [INT2][int2]; 28128000 - 28138000, >ref|NT_01 1109.16|:396218-406218 Homo sapiens chromosome 19 genomic contig, GRCh37 reference primary assembly.

SEQ ID NO: 9 shows the nucleotide sequence of the POL gene of HERV-F(c)1 ; POL_8943:), ref|NT_01 1651.16|HsX_11808:20395053-20397499 Homo sapiens chromosome X genomic contig, reference assembly. Coordinates chrX:96985401- 96987847.

SEQ ID NO: 10 shows the nucleotide sequence of the ENV gene of HERV-F(c)1 ; ENV_8944; >ref|NT_011651.16|HsX_11808:20398505-20400320 Homo sapiens chromosome X genomic contig, reference assembly. Coordinates: chrX:96988853- 96990668.

HERV-F(c)1 also herein referred to as simply HERV-F is a human endogenous retrovirus with a primer binding site homologous to tRNA-phe. HERV-K, HERV-H are human endogenous retroviruses.

Amplification: amplification according to the present invention is the process wherein a plurality of exact copies of a starting molecule is synthesised, without employing knowledge of the exact composition of the starting molecule. Hence a template may be amplified even though the exact composition of said template is unknown. In one preferred embodiment of the present invention amplification of a template comprises the process wherein a template is copied by a nucleic acid polymerase or polymerase homologue, for example a DNA polymerase or an RNA polymerase. For example, templates may be amplified using reverse transcription, the polymerase chain reaction (PCR), ligase chain reaction (LCR), in vivo amplification of cloned DNA, and similar procedures capable of complementing a nucleic acid sequence.

Antibody: The term "antibody" as used herein includes both polyclonal and monoclonal antibodies, as well as fragments thereof, such as, Fv, Fab and F(ab)2 fragments that are capable of binding antigen or hapten. It includes conventional murine monoclonal antibodies as well as human antibodies, and humanized forms of non-human antibodies, and it also includes 'antibodies' isolated from phage antibody libraries.

Complementary or substantially complementary: Refers to the hybridization or base pairing between nucleotides or nucleic acids, such as, for instance, between the two strands of a double stranded DNA molecule or between an oligonucleotide primer and a primer binding site on a single stranded nucleic acid to be sequenced or amplified. Complementary nucleotides are, generally, A and T (or A and U), or C and G. Two single stranded RNA or DNA molecules are said to be substantially complementary when the nucleotides of one strand, optimally aligned and with appropriate nucleotide insertions or deletions, pair with at least about 80% of the nucleotides of the other strand, usually at least about 90% to 95%, and more preferably from about 98 to 100%. Alternatively, substantial complementarity exists when an RNA or DNA strand will hybridize under selective hybridization conditions to its complement. Selective hybridization conditions include, but are not limited to, stringent hybridization conditions. Selective hybridization occurs in one embodiment when there is at least about 65% complementarity over a stretch of at least 14 to 25 nucleotides, preferably at least about 75%, more preferably at least about 90% complementarity. See, M. Kanehisa (Nucleic Acids Res. 12, 203, 1984), incorporated herein by reference. For shorter nucleotide sequences selective hybridization occurs when there is at least about 65% complementarity over a stretch of at least 8 to 12 nucleotides, preferably at least about 75%, more preferably at least about 90% complementarity. Stringent hybridization conditions will typically include salt concentrations of less than about 1 M, more usually less than about 500 mM and preferably less than about 200 mM. Hybridization temperatures can be as low as 5⁰C and are preferably lower than about 3O⁰C. However, longer fragments may require higher hybridization temperatures for specific hybridization. Hybridization temperatures are generally about 2⁰C to 6⁰C lower than melting temperatures (T_m), which for polynucleotides comprising less than about 20 nucleotides can be calculated as T_m = 4 x (G+C content) + 2 x (A+T content). As other factors may affect the stringency of hybridization, including base composition and length of the complementary strands, presence of organic solvents and extent of base mismatching, the combination of parameters is more important than the absolute measure of any one alone.

Vaccine: Immunogenic composition capable of raising a protective immune response in a subject.

The present invention relates to a characterization of a person's present and/or future risk of developing multiple sclerosis. The characterization is based on the analysis of sequence polymorphisms in a region of chromosome X in the person. Furthermore, the analysis of polymophisms in a region of chromosome 3 in the person can be used to further characterise a person's present and/or future risk of getting multiple sclerosis.

A number of polymorphisms in the human chromosome have been analysed and characterised with respect to their association with associated to MS. Surprisingly, the sequence polymorphisms with strongest association to multiple sclerosis appeared to be located on chromosome X. More specifically, the sequences were located in the region r comprising the HERV-F(c)1 gene.

An even stronger association to multiple sclerosis was observed by combining information of polymorphisms located on the human chromosome X in the region r and polymorphisms located on the human chromosome 3 in the region s, region s comprising the HERV-K [INT2]gene.

Sequence polymorphisms with association to multiple sclerosis were also found , that are located on chromosome 6. More specifically, the sequences were located in the region t comprising the HERV-H gene. In addition, sequence polymorphisms with association to multiple sclerosis were also found that are located on chromosome 16. More specifically, the sequences were located in the region u comprising the HERV- K13 gene. Furthermore, sequence polymorphisms with association to multiple sclerosis were also found that are located on chromosome 19. More specifically, the sequences were located in the region v comprising the HERV-K [int2] gene.

As evident form the above associations, it was, surprisingly, found that all polymorphisms associated with MS are found in or near HERVs. The nature of the association between haplotype and disease was examined together with the p-values associated with the individual haplotypes. The odds ratios for each haplotype of each set of three neighboring SNPs were also determined. The odds ratio for test of homozygotes of individual markers against multiple sclerosis status was likewise detemined. P-value is the probability that an observed difference between groups occurred by chance alone. A result is conventionally regarded as 'statistically significant' if the likelihood that it is due to chance alone is less than five times out of 100 (P < 0.05).

The invention discloses methods for estimating the disease risk of an individual of having or developing multiple sclerosis, for estimating the prognosis for multiple sclerosis of an individual and for estimating a treatment response of an individual suffering or at risk of suffering from multiple sclerosis to a disease treatment, comprising in a sample comprising genetic material from said individual assessing one or more sequence polymorphisms in genetic regions. The methods employ genetic regions comprising HERVs on the human chromosome X, human chromosome X in combination with chromosome 3, chromosome 6, chromosome 16 and chromosome 19. The methods employ sequence polymorphisms present in the nucleotide sequence of the HERVs, or part thereof, as well as complementary sequences. Within the scope of the invention are also sequence polymorphisms in transcriptional and/or translational products of the HERVs, or part thereof.

Thus in one aspect the invention relates to a method for estimating the disease risk of an individual of having or developing multiple sclerosis comprising in a sample comprising genetic material from said individual assessing one or more sequence polymorphisms in genetic regions selected from the group of genetic regions consisting of region r on human chromosome X comprising HERV-F(c)1 corresponding to SEQ ID NO: 1 , or a part thereof, and/or in a region complementary to SEQ ID NO: 1 , or a part thereof, and/or in a transcription product from a sequence in a region corresponding to SEQ ID NO: 1 , or a part thereof, and/or translation product from a sequence in a region corresponding to SEQ ID NO: 1 , or a part thereof; region t on human chromosome 6 comprising HERV-H corresponding to SEQ ID NO: 5, or a part thereof, and/or in a region complementary to SEQ ID NO: 5, or a part thereof, or in a transcription product from a sequence in a region corresponding to SEQ ID NO: 5, or a part thereof, and/or translation product from a sequence in a region corresponding to SEQ ID NO: 5, or a part thereof; region u on human chromosome 16 comprising HERV-K13 corresponding to SEQ ID NO: 3, or a part thereof, and/or in a region complementary to SEQ ID NO: 3, or a part thereof, and/or in a transcription product from a sequence in a region corresponding to SEQ ID NO: 3, or a part thereof, and/or translation product from a sequence in a region corresponding to SEQ ID NO: 3, or a part thereof; and region v on human chromosome 19, comprising HERV-K [INT2][int2] corresponding to SEQ ID NO: 7, or a part thereof, and/or in a region complementary to SEQ ID NO: 7, or a part thereof, and/or in a transcription product from a sequence in a region corresponding to SEQ ID NO:7, or a part thereof, and/or translation product from a sequence in a region corresponding to SEQ ID NO: 7, or a part thereof; - obtaining a sequence polymorphism response, estimating the risk of said individual based on the sequence polymorphism response.

In another aspect the invention relates to a method for estimating the prognosis for multiple sclerosis of an individual comprising in a sample comprising genetic material from said individual assessing one or more sequence polymorphisms in genetic regions selected from the group of genetic regions consisting of region r on human chromosome X comprising HERV-F(c)1 corresponding to SEQ ID NO: 1 , or a part thereof, and/or in a region complementary to SEQ ID NO: 1 , or a part thereof, and/or in a transcription product from a sequence in a region corresponding to SEQ ID NO: 1 , or a part thereof, and/or translation product from a sequence in a region corresponding to SEQ ID

NO: 1 , or a part thereof; region t on human chromosome 6 comprising HERV-H corresponding to SEQ ID NO: 5, or a part thereof, and/or in a region complementary to SEQ ID NO: 5, or a part thereof, or in a transcription product from a sequence in a region corresponding to SEQ ID NO: 5, or a part thereof, and/or translation product from a sequence in a region corresponding to SEQ ID NO: 5, or a part thereof; region u on human chromosome 16 comprising HERV-K13 corresponding to SEQ ID NO: 3, or a part thereof, and/or in a region complementary to SEQ ID NO: 3, or a part thereof, and/or in a transcription product from a sequence in a region corresponding to SEQ ID NO: 3, or a part thereof, and/or translation product from a sequence in a region corresponding to SEQ ID NO: 3, or a part thereof; and region v on human chromosome 19, comprising HERV-K [INT2][int2] corresponding to SEQ ID NO: 7, or a part thereof, and/or in a region complementary to SEQ ID NO: 7, or a part thereof, and/or in a transcription product from a sequence in a region corresponding to SEQ ID NO:7, or a part thereof, and/or translation product from a sequence in a region corresponding to SEQ ID

NO: 7, or a part thereof; obtaining a sequence polymorphism response,

In a third aspect the invention relates to a method for estimating a treatment response of an individual suffering or at risk of suffering from multiple sclerosis to a disease treatment, comprising in a sample comprising genetic material from said individual assessing one or more sequence polymorphisms in genetic regions selected from the group of genetic regions consisting of region r on human chromosome X comprising HERV-F(c)1 corresponding to SEQ ID NO: 1 , or a part thereof, and/or in a region complementary to SEQ ID NO: 1 , or a part thereof, and/or in a transcription product from a sequence in a region corresponding to SEQ ID NO: 1 , or a part thereof, and/or translation product from a sequence in a region corresponding to SEQ ID NO: 1 , or a part thereof; region t on human chromosome 6 comprising HERV-H corresponding to SEQ ID NO: 5, or a part thereof, and/or in a region complementary to SEQ ID NO: 5, or a part thereof, or in a transcription product from a sequence in a region corresponding to SEQ ID NO: 5, or a part thereof, and/or translation product from a sequence in a region corresponding to SEQ ID NO: 5, or a part thereof; region u on human chromosome 16 comprising HERV-K13 corresponding to SEQ ID NO: 3, or a part thereof, and/or in a region complementary to SEQ ID NO: 3, or a part thereof, and/or in a transcription product from a sequence in a region corresponding to SEQ ID NO: 3, or a part thereof, and/or translation product from a sequence in a region corresponding to SEQ ID NO: 3, or a part thereof; and region v on human chromosome 19, comprising HERV-K [INT2][int2] corresponding to SEQ ID NO: 7, or a part thereof, and/or in a region complementary to SEQ ID NO: 7, or a part thereof, and/or in a transcription product from a sequence in a region corresponding to SEQ ID NO:7, or a part thereof, and/or translation product from a sequence in a region corresponding to SEQ ID NO: 7, or a part thereof; - obtaining a sequence polymorphism response,

- estimating the individual's response to the disease treatment based on the sequence polymorphism response.

It is appreciated that any of the methods may employ any of the HERVs individually. Thus, one embodiment of the invention uses one or more polymorphisms in region r on human chromosome X comprising HERV-F(c)1 corresponding to SEQ ID NO: 1 , or a part thereof, and/or in a region complementary to SEQ ID NO: 1 , or a part thereof, and/or in a transcription product from a sequence in a region corresponding to SEQ ID NO: 1 , or a part thereof, and/or translation product from a sequence in a region corresponding to SEQ ID NO: 1 , or a part thereof. However, one or more sequence polymorphisms in region r on human chromosome

X comprising HERV-F(c)1 corresponding to SEQ ID NO: 9, or a part thereof, and/or in a region complementary to SEQ ID NO: 9, or a part thereof, and/or in a transcription product from a sequence in a region corresponding to SEQ ID NO: 9, or a part thereof, and/ortranslation product from a sequence in a region corresponding to SEQ ID NO: 9, or a part thereof may also be used.

Similarly, one or more sequence polymorphisms in region r on human chromosome X comprising HERV-F(c)1 corresponding to SEQ I D NO: 10, or a part thereof, and/or in a region complementary to SEQ ID NO: 10, or a part thereof, and/or in a transcription product from a sequence in a region corresponding to

SEQ ID NO: 10, or a part thereof, and/or translation product from a sequence in a region corresponding to SEQ ID NO: 10, or a part thereof may also be used.

The methods may also employ combined use of the sequence polymorphisms of HERVs on chromosome x and chromosome 3. Therefore, the invention also relates to one or more sequence polymorphisms in region r and a further sequence polymorphism on human chromosome 3

- -in a region comprising HERV-K [INT2]corresponding to SEQ ID NO:2, or a part thereof, or - in a region complementary to SEQ ID NO: 2, or a part thereof, or in a transcription product from a sequence in a region corresponding to SEQ ID NO: 2, or a part thereof, or or translation product from a sequence in a region corresponding to SEQ ID NO: 2, or a part thereof.

In one embodiment the methods employ one or more sequence polymorphisms in region t on human chromosome 6 comprising HERV-H corresponding to SEQ ID NO: 5, or a part thereof, and/or in a region complementary to SEQ ID NO: 5, or a part thereof, or in a transcription product from a sequence in a region corresponding to

SEQ ID NO: 5, or a part thereof, and/or translation product from a sequence in a region corresponding to SEQ ID

NO: 5, or a part thereof. As well as one or more sequence polymorphisms are in region t on human chromosome 6 comprising HERV-H corresponding to SEQ ID NO: 6, or a part thereof, and/or in a region complementary to SEQ ID NO: 6, or a part thereof, or in a transcription product from a sequence in a region corresponding to SEQ ID NO: 6, or a part thereof, and/or translation product from a sequence in a region corresponding to SEQ ID

NO: 6, or a part thereof.

The methods may also employ sequence polymorphisms present in the HERV on the human chromosome 16. Thus, one or more sequence polymorphisms are in region u on human chromosome 16 comprising HERV-K13 corresponding to SEQ ID NO: 3, or a part thereof, and/or in a region complementary to SEQ ID NO: 3, or a part thereof, and/or in a transcription product from a sequence in a region corresponding to

SEQ ID NO: 3, or a part thereof, and/or translation product from a sequence in a region corresponding to SEQ ID NO: 3, or a part thereof.

Alternatively, the one or more sequence polymorphisms are in region u on human chromosome 16 comprising HERV-K13 corresponding to SEQ ID NO: 4, or a part thereof, and/or in a region complementary to SEQ ID NO: 4, or a part thereof, and/or in a transcription product from a sequence in a region corresponding to SEQ ID NO: 4, or a part thereof, and/or translation product from a sequence in a region corresponding to SEQ ID

NO: 4, or a part thereof.

In yet another embodiment of the invention, one or more sequence polymorphisms are in region v on human chromosome 19, comprising HERV-K [INT2][int2] corresponding to SEQ ID NO: 7, or a part thereof, and/or in a region complementary to SEQ ID NO: 7, or a part thereof, and/or in a transcription product from a sequence in a region corresponding to

In a further embodiment of the invention, one or more sequence polymorphisms are in region v on human chromosome 19, comprising HERV-K [INT2][int2] corresponding to SEQ ID NO: 8, or a part thereof, and/or in a region complementary to SEQ ID NO: 8, or a part thereof, and/or in a transcription product from a sequence in a region corresponding to

SEQ ID NO:8, or a part thereof, and/or translation product from a sequence in a region corresponding to SEQ ID

NO: 8, or a part thereof;

Fragments or parts of the region r, s, t, u or v as used herein relates to any fragment of at least 5 nucleic acid residues in length, or multiples of 5 nucleic acid residues in length starting from SEQ ID NO: 1 , SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7 or SEQ ID NO:8 , SEQ ID NO.: 9, SEQ ID NO.: 10 position 1 , 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100. For example at least 21 , such as at least 22, for example at least 23, such as at least 24, for example at least 26, such as at least 27, for example at least 28, such as at least 29, for example at least 31 , such as at least 32, for example at least 33, such as at least 34, for example at least 36, such as at least 37, for example at least 38, such as at least 39, for example at least 41 , such as at least 42, for example at least 43, such as at least 44, for example at least 46, such as at least 47, for example at least 48, or at least 100 nucleic acid residues in length, or multiples of 100 nucleic acid residues in length, starting from SEQ ID NO: 1 , SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7 or SEQ ID NO:8 , SEQ ID NO.: 9, SEQ ID NO.: 10 position 1 , 100, 200, 300, 400, 500, 600, 700, 800, 900, 1000, 1 100, 1200, 1300, 1400, 1500, 1600, 1700, 1800, 1900, 2000, 2100, 2200, 2300, 2400, 2500,

2600, 2600, 2700, 2800, 2900, 3000, and so forth, each fragment starting position having an increment of 100 nucleic acid residues. Multiples are preferably multiples of e.g. 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 1 1 , 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 , 22, 23, 24, 25, 26, 27, 28, 29, 30, 31 , 32, 33, 34, 35, 36, 37, 38, 39, 40, 41 , 42, 43, 44, 45, 46, 47, 48, 49 and 50. For fragments starting at position 1 , the length of said fragments will thus be e.g. 100, 200, 300, 400, 500, 600, 700, 800, 900, 1000, 1 100, 1200, 1300, 1400, 1500, 1600, 1700, 1800, 1900, 2000, 2100, 2200, 2300, 2400, 2500, 2600, 2600, 2700, 2800, 2900, 3000, and so forth, using suitable multiplicators as listed herein above.

For fragments starting at position 100, the length of said fragments will thus be e.g. 100, 200, 300, 400, 500, 600, 700, 800, 900, 1000, 1 100, 1200, 1300, 1400, 1500, 1600, 1700, 1800, 1900, 2000, 2100, 2200, 2300, 2400, 2500, 2600, 2600, 2700, 2800, 2900, 3000, and so forth, using suitable multiplicators as listed herein above.

The nucleic acid sequences according to the present invention make it possible to estimate multiple sclerosis risk in an individual by using sequence polymorphisms originating from a specific region of chromosome X , 6, 16 and/or 19. One embodiment combines the use of polymorphisms on chromosome x and further sequence polymorphisms originating from a specific region of chromosome 3.

By sequence polymorphism is understood any single nucleotide, tandem repeat, insertion, deletion or block polymorphism, which varies among humans, whether it is of known biological importance or not. Thus, the sequence polymorphism comprises at least one mutation base change, or at least two base changes, or at least one single nucleotide polymorph ism , or at least two si n gle n u cleotid e polym orphisms. Alternatively, the sequence polymorphism comprises at least one tandem repeat polymorph ism , or at least two tandem repeat polymorphisms. The sequence polymorphism may also be characterised by at least one deletion polymorphism, or at least one insertion polymorphism, or at least one dinucleotide polymorphism.

Position of sequence polymorphism in the region r, s, t, u or v

Chromosome X

In one embodiment of the methods of the invention, preferably the method for diagnosis as described herein, one or more single nucleotide polymorphism(s) at a predetermined position in the region r (SEQ ID NO:1 , 9 or 10) are identified and used for e.g. multiple sclerosis risk profiling and/or multiple sclerosis treatment response profiling. Presently preferred polymorphism(s) of region r are rs391745: 5'- TGCCCACCCTCACACTCAACAGTATC [ C/G ] CTGAAGAGATGGTCCATGCTGAGAA (SEQ ID NO.:1 1 ) rs400586: 5'-gggttttaagccagacagaaatggta[C/T]tgaaccaaagctctaccatttacta (SEQ ID NO.:12) rs 318138: 5'- cctgccggggaggtgggatcaaggcg [A/G] gtatactggatgagggcctcagtaa (SEQ ID NO.:13)

In one embodiment of the methods of the invention, preferably the method for diagnosis as described herein, one or more single nucleotide polymorphism(s) at a predetermined position in the region (SEQ ID NO:1 ) are identified and used for e.g. multiple sclerosis risk profiling and/or multiple sclerosis treatment response profiling. Presently, the preferred polymorphism on human chromosome X of region r is rs391745, positioned in or near the POL gene of HERV-F(c)1 , wherein near means within 10 kb, preferably, within 5 kb, more preferably, within 2 kb of the POL gene of HERV-F(c)1.

Chromosome 6 In one embodiment of the methods of the invention, preferably the method for diagnosis as described herein, one or more single nucleotide polymorphism(s) at a predetermined position in the region t SEQ ID NO:5 and/or 6) are identified and used for e.g. multiple sclerosis risk profiling and/or multiple sclerosis treatment response profiling.

Presently preferred polymorphism(s) at a predetermined position in the region t (SEQ ID NO:5 and/or 6) are identified and used for e.g. multiple sclerosis risk profiling and/or multiple sclerosis treatment response profiling.

Rs 9394742: 5'- aaccgtgttgttggggactggttcaa[A/C]taaaccacaacagaacttcatacat(SEQ ID

NO.:15). rs12196881 : 5'CCAGCTGGAGCCCATACTGTACCACT[AZGJ-

TATCAGTGCGTGGTAAGCAGGGAAT (SEQ ID NO.: 16), or rs1929772 : 5'-GTGAATAGGTGGCTGGAGTCAACAAA[CZT]GCCTAATT- AATCAATTGGTGTCATC (SEQ ID NO.:17). Presently, the preferred polymorphism on human chromosome 6 of region t is rs1929772, positioned in or near the env gene of HERV-H , wherein near means within

10 kb, preferably, within 5 kb, more preferably, within 2 kb of the env gene of HERV-H

Chromosome 16

In one embodiment of the methods of the invention, preferably the method for diagnosis as described herein, one or more single nucleotide polymorphism(s) at a predetermined position in the region u SEQ ID NO:3 and/or 4) are identified and used for e.g. multiple sclerosis risk profiling and/or multiple sclerosis treatment response profiling.

Presently preferred polymorphism at a predetermined position in the region u are identified and used for e.g. multiple sclerosis risk profiling and/or multiple sclerosis treatment response profiling:

Rs12934809: 5' -ggagagttggtgccatattgtttca [A /C j tgattctttaaaatctttgaggaat (SEQIDNO.:18).

Chromosome 19 In another embodiment of the methods of the invention, preferably the method for diagnosis as described herein, one or more single nucleotide polymorphism(s) at a predetermined position in the region v SEQ ID NO:7 and/or 8) are identified and used for e.g. multiple sclerosis risk profiling and/or multiple sclerosis treatment response profiling.

Presently preferred polymorphism at a predetermined position in the region v are identified and used for e.g. multiple sclerosis risk profiling and/or multiple sclerosis treatment response profiling:

Rs2396212: 5'-gaaTTAAGctatctgtgaaactgctc[C/T]gtaatgtgtggattcatctcacaga positioned near (<10 kb) the ENV gene of HERV-K[int2] (SEQ ID NO.:19)

Rs 1 1882251 :5'-agccaagtgtttTCATTCTtagactg[C/ϊjctggtgtt-ggctaaaaggctatccc (SEQ ID NO.:20) Presently, the preferred polymorphism on human chromosome 19 of region v are Rs2396212 or Rs 1 1882251 , positioned in or near the ENV gene of HERV-K[int2] wherein near means within 10 kb, preferably, within 5 kb, more preferably, within 2 kb near the ENV gene of HERV-K[int2].

Chromosome X and chromosome 3 In one embodiment of the methods of the invention, preferably the method for diagnosis as described herein, one or more single nucleotide polymorphism(s) at a predetermined position in the region s (SEQ ID NO:2) are identified and used for e.g. multiple sclerosis risk profiling and/or multiple sclerosis treatment response profiling.

Presently preferred polymorphism of region s is

Rs7650656: 5'- CTACCctcagaggtactagcagcacc [C/G] ggatggtgttctgtcctcagaggtc (SEQ ID NO.:14)

In a further embodiment of the methods of the invention, preferably the method for diagnosis as described herein, one or more single nucleotide polymorphism(s) at a predetermined position in the region r (SEQ ID NO:1 ) and in the region s (SEQ ID NO:2) are identified and used for e.g. multiple sclerosis risk profiling and/or multiple sclerosis treatment response profiling. Presently, the preferred polymorphism on human chromosome X of region r is rs391745, in combination with the polymorphism rs7650656 on the human chromosome 3 of region s.

The sequence polymorphism of the invention comprises at least one base difference, such as at least two base differences, such as at least three base differences, such as at least four base differences, such as eighty one base pair differences. As described above the sequence polymorphism(s) comprises at least one polymorphism, such as at least two polymorphisms, such as at least three polymorphisms, such as at least four polymorphisms. Also, the sequence polymorphism comprises at least one polymorphism, such as at least two tandem repeat polymorphisms.

Also, the sequence polymorphism may be a combination of single nucleotide polymorphism and dinucleotide polymorphism, such as one single nucleotide polymorphism and one dinucleotide polymorphism.

The status of the individual may be determined by reference to allelic variation at one, two, three, four or more of the above loci. Sample

The sample comprising genetic material of an individual used in the present invention may be any suitable cell sample capable of providing the genetic material for use in the method. In a preferred embodiment, the cell sample is a blood sample, a tissue sample, a sample of secretion, semen, ovum, a washing of a body surface (e.g. a buccal swap), a clipping of a body surface (hairs, or nails), such as wherein the cell is selected from white blood cells and tumour tissue.

It will be appreciated that the test sample may equally be a nucleic acid sequence corresponding to the sequence in the test sample, that is to say that all or a part of the region in the sample nucleic acid may firstly be amplified using any convenient technique e.g. PCR, before use in the analysis of variation in the region.

Detection methods

Detection may be conducted on the sequence of SEQ ID NO: 1 or a complementary seq u en ce as we l l as o n tra n scriptional (mRNA) and translational products (polypeptides, proteins), or parts thereof. In another embodiment detection may be conducted on the sequence of SEQ ID NO: 2 or a complementary sequence as well as on translational (mRNA) and transcriptional products (polypeptides, proteins) there from. It is appreciated that the detection in one embodiment is conducted on both the sequence of SEQ ID NO:1 and SEQ ID NO:2.

In addition, detection may be conducted on the sequence of SEQ ID NO:3 and/or SEQ ID NO:4 and/or SEQ ID NO:5 and/or SEQ ID NO:6 and/or SEQ ID NO:7 and/or SEQ ID NO:8 and/or SEQ ID NO.: 9 and/or SEQ ID NO.: 10, or a complementary sequence as well as on transcriptional (mRNA) and translational products (polypeptides, proteins), or parts thereof

It will be apparent to the person skilled in the art that there are a large number of analytical procedures which may be used to detect the presence or absence of variant nucleotides at one or more of positions mentioned herein in the r region. Mutations or polymorphisms within or flanking the r region and the s region can be detected by utilizing a number of techniques. Nucleic acid from any nucleated cell can be used as the starting point for such assay techniques, and may be isolated according to standard nucleic acid preparation procedures that are well known to those of skill in the art. In general, the detection of allelic variation requires a mutation discrimination technique, optionally an amplification reaction and a signal generation system. Table 1 lists a number of mutation detection techniques, some based on the PCR. These may be used in combination with a number of signal generation systems, a selection of which is listed in Table 2. Further amplification techniques are listed in Table 3. Many current methods for the detection of allelic variation are reviewed by Nollau et al., Clin. Chem. 43, 1 114-1 120, 1997; and in standard textbooks, for example "Laboratory Protocols for Mutation Detection", Ed. by U. Landegren, Oxford University Press, 1996 and "PCR", 2nd Edition by Newton & Graham, BIOS Scientific Publishers Limited, 1997.

Table 1

Abbreviations:

ALEX Amplification refractory mutation system linear extension

APEX Arrayed primer extension

ARMS Amplification refractory mutation system b-DNA Branched DNA

CMC Chemical mismatch cleavage bp base pair

COPS Competitive oligonucleotide priming system

DGGE Denaturing gradient gel electrophoresis

FRET Fluorescence resonance energy transfer

LCR Ligase chain reaction

MASDA Multiple allele specific diagnostic assay

NASBA Nucleic acid sequence based amplification

OLA Oligonucleotide ligation assay

PCR Polymerase chain reaction

PTT Protein truncation test

RFLP Restriction fragment length polymorphism

SDA Strand displacement amplification

SNP Single nucleotide polymorphism

SSCP Single-strand conformation polymorphism analysis

SSR Self sustained replication

TGGE Temperature gradient gel electrophoresis Table 2 illustrates various mutation detection techniques capable of being used for

SNP detection.

Table 2

General techniques: DNA sequencing, Sequencing by hybridisation, SNAPshot. Scanning techniques: PJT^*, SSCP, DOGE, TGGE, Cleavase, Heteroduplex analysis,

CMC, Enzymatic mismatch cleavage

Hybridisation Based techniques

Solid phase bybridisation: Dot blots, MASDA, Reverse dot blots, Oligonucleotide arrays

(DNA Chips) Solution phase hybridisation: Taqman -U.S. Pat. No. 5,210,015 & 5,487,972

(Hoffmann-La Roche), Molecular Beacons — Tyagi et al (1996), Nature Biotechnology,

14, 303; WO 95/13399 (Public Health Inst., New York), Lightcycler, optionally in combination with FRET.

Extension Based: ARMS, ALEX - European Patent No. EP 332435 B1 (Zeneca Limited), COPS - Gibbs et al (1989), Nucleic Acids Research, 17, 2347.

Primer extension techniques

Incorporation Based: Mini-sequencing, APEX

Restriction Enzyme Based: RFLP, Restriction site generating PCR

Ligation Based: OLA Other: Invader assay

Various Signal Generation or Detection Systems is listed below: Fluorescence: FRET, Fluorescence quenching, Fluorescence polarisation-United Kingdom Patent No. 2228998 (Zeneca Limited) Other: Chemiluminescence, Electrochemiluminescence, Raman, Radioactivity, Colorimetric, Hybridisation protection assay, Mass spectrometry

Table 3 illustrates examples of further amplification techniques. Table 3 SSR, NASBA, LCR, SDA, b-DNA

Preferred mutation detection techniques include ARMS, ALEX, COPS, Taqman, Molecular Beacons, RFLP, and restriction site based PCR, Sequenom (R) and FRET techniques. Particularly preferred methods include FRET; taqman, ARMS, Sequenom (R) and RFLP based methods.

In a preferred embodiment, mutations or polymorphisms can be detected by using a microassay of nucleic acid sequences immobilized to a substrate or "gene chip" (see, e.g. Cronin, et al., 1996, Human Mutation 7:244-255).

Further, improved methods for analyzing DNA polymorphisms, which can be utilized for the identification of region r and region s specific mutations, have been described that capitalize on the presence of variable numbers of short, tandemly repeated DNA sequences between the restriction enzyme sites. For example, Weber (U.S. Pat. No. 5,075,217) describes a DNA marker based on length polymorphisms in blocks of (dC- dA)n-(dG-dT)n short tandem repeats. The average separation of (dC-dA)n-(dG-dT)n blocks is estimated to be 30,000-60,000 bp. Markers that are so closely spaced exhibit a high frequency co-inheritance, and are extremely useful in the identification of genetic mutations, such as, for example, mutations within the HERV-F(c)1 gene and the HERV-K [INT2]gene, and the diagnosis of diseases and disorders related to HERV- F(c)1 and HERV-K [INT2]mutations.

Also, Caskey et al.(U.S. Pat. No. 5,364,759) describe a DNA profiling assay for detecting short tri and tetra nucleotide repeat sequences. The process includes extracting the DNA of interest, such as the HERV-F gene, amplifying the extracted DNA, and labelling the repeat sequences to form a genotypic map of the individual's DNA.

The level of HERVs as disclosed in the present invention expression can also be assayed. For example, RNA from a cell type or tissue known, or suspected, to express one or more HERV genes may be isolated and tested utilizing hybridization or PCR techniques such as are described, above. The isolated cells can be derived from cell culture or from a patient. The analysis of cells taken from culture may be a necessary step in the assessment of cells to be used as part of a cell-based gene therapy technique or, alternatively, to test the effect of compounds on the expression of the HERV genes. Such analyses may reveal both quantitative and qualitative aspects of the expression pattern of the HERV genes, including activation or inactivation of HERV gene expression. In one embodiment of such a detection scheme, a cDNA molecule is synthesized from an RNA molecule of interest (e.g., by reverse transcription of the RNA molecule into cDNA). A sequence within the cDNA is then used as the template for a nucleic acid amplification reaction, such as a PCR amplification reaction, or the like. The nucleic acid reagents used as synthesis initiation reagents (e.g., primers) in the reverse transcription and nucleic acid amplification steps of this method are chosen from among the HERV gene nucleic acid reagents described above. The preferred lengths of such nucleic acid reagents are at least 9-30 nucleotides. For detection of the amplified product, the nucleic acid amplification may be performed using radioactively or non-radioactively labeled nucleotides. Alternatively, enough amplified product may be made such that the product may be visualized by standard ethidium bromide staining or by utilizing any other suitable nucleic acid staining method.

Additionally, it is possible to perform such HERV gene expression assays "in situ", i.e., directly upon tissue sections (fixed and/or frozen) of patient tissue obtained from biopsies or resections, such that no nucleic acid purification is necessary. Nucleic acid reagents such as those described above may be used as probes and/or primers for such in situ procedures (see, for example, Nuovo, G. J., 1992, "PCR In Situ Hybridization: Protocols And Applications", Raven Press, NY).

Alternatively, if a sufficient quantity of the appropriate cells can be obtained, standard Northern analysis can be performed to determine the level of mRNA expression of the HERV-F(c)1 and HERV-K [INT2]gene.

Activity of the HERV genes

Another method for detecting sequence polymorphism is by analysing the activity of gene products resulting from the HERV sequences of the invention. Accordingly, in one embodiment the detection uses the activity of the HERV gene product(s) as compared to a reference in the method. In particular if the activity of the genes are decreased or increased by at least or about 50 %, such as at least or about 40%, for example at least or about 30%, such as at least or about 20%, for example at least or about 10%, such as at least or about 10%, for example at least or about 5%, such as at least or about 2%, it indicates a sequence polymorphism in the gene. Mutations outside the region

The present invention may combine the result of sequence polymorphism within the region r, t, u, v or within the region r and region s, with sequence polymorphism outside the region in order to increase the probability of the correlation to MS.

Primers

The primer nucleotide sequences of the invention further include: (a) any nucleotide seq uence that hybrid izes to a n ucleic acid molecule of the region r or its complementary seq uence or RNA prod ucts under stringent conditions, e.g . , hybridization to filter-bound DNA in 6x sodium chloride/sodium citrate (SSC) at about 45°C followed by one or more washes in 0.2x SSC/0.1 % SDS at about 50-65⁰C, or (b) under highly stringent conditions, e.g., hybridization to filter-bound nucleic acid in 6x SSC at about 45°C followed by one or more washes in 0.1 x SSC/0.2% SDS at about 68°C, or under other hybridization conditions which are apparent to those of skill in the art (see, for example, Ausubel F. M. et al., eds., 1989, Current Protocols in Molecular Biology, Vol. I, Green Publishing Associates, Inc., and John Wiley & sons, Inc., New York, at pp. 6.3.1-6.3.6 and 2.10.3). Preferably the nucleic acid molecule that hybridizes to the nucleotide sequence of (a) and (b), above, is one that comprises the complement of a nucleic acid molecule of the region s or r or a complementary sequence or RNA product thereof. In a preferred embodiment, nucleic acid molecules comprising the nucleotide sequences of (a) and (b), comprises nucleic acid molecule of HERV-F(c)1 and HERV-K [I NT2]or a complementary sequence or RNA product thereof.

Among the nucleic acid molecules of the invention are deoxyoligonucleotides ("oligos") which hybridize under highly stringent or stringent conditions to the nucleic acid molecules described above. In general, for probes between 14 and 70 nucleotides in length the melting temperature (TM) is calculated using the formula:

Tm(°C)=81.5+16.6(log [monovalent cations (molar)])+0.41 (% G+C)-(500/N)

where N is the length of the probe. If the hybridization is carried out in a solution containing formamide, the melting temperature is calculated using the equation Tm(°C)=81.5+16.6(log[monovalent cations (molar)])+0.41 (% G+C)-(0.61% formamide)- (500/N) where N is the length of the probe. In general, hybridization is carried out at about 20-25 degrees below Tm (for DNA-DNA hybrids) or 10-15 degrees below Tm (for RNA-DNA hybrids).

Exemplary highly stringent conditions may refer, e.g., to washing in 6x SSC/0.05% sodium pyrophosphate at 37°C (for about 14-base oligos), 48°C (for about 17-base oligos), 55°C (for about 20-base oligos), and 60⁰C (for about 23-base oligos).

Accordingly, the invention further provides nucleotide primers or probes which detect the r region polymorphisms of the invention. The assessment may be conducted by means of at least one nucleic acid primer or probe, such as a primer or probe of DNA, RNA or a nucleic acid analogue such as peptide nucleic acid (PNA) or locked nucleic acid (LNA). The nucleotide primer or probe is preferably capable of hybridising to a subsequence of the region corresponding to SEQ ID NO: 1-10, or a part thereof, or a region complementary to SEQ ID NO: 1-10. In another embodiment the nucleotide primer or probe is preferably capable of hybridising to a subsequence of the region corresponding to SEQ ID NO: 2, or a part thereof, or a region complementary to SEQ ID NO: 2.

According to one aspect of the present invention there is provided an allele-specific oligonucleotide probe capable of detecting a r region polymorphism at one or more of positions in the r region as defined by the positions in SEQ ID NO: 1-10. Furthermore, is provided an allele-specific oligonucleotide probe capable of detecting a s region polymorphism at one or more of positions in the s region as defined by the positions in SEQ ID NO: 2. The allele-specific oligonucleotide probe is preferably 5-50 nucleotides, more preferably about 5-35 nucleotides, more preferably about 5-30 nucleotides, more preferably at least 9 nucleotides.

The design of such probes will be apparent to the molecular biologist of ordinary skill. Such probes are of any convenient length such as up to 50 bases, up to 40 bases, more conveniently up to 30 bases in length, such as for example 8-25 or 8-15 bases in length. In general such probes will comprise base sequences entirely complementary to the corresponding wild type or variant locus in the region. However, if required one or more mismatches may be introduced, provided that the discriminatory power of the oligonucleotide probe is not unduly affected. The probes of the invention may carry one or more labels to facilitate detection. In one embodiment, the primers and/or probes are capable of hybridizing to and/or amplifying a subsequence hybridizing to a single nucleotide polymorphism containing the sequence shown herein selected from the group of subsequences below or a sequence complementary thereto, wherein the polymorphism is denoted as for example T/C: According to another aspect of the present invention there is provided a diagnostic nucleic acid primer capable of detecting a r region polymorphism at one or more of positions in the r, s, t, u and/or v region as defined by the in SEQ ID NO: 1-10..

The primer or probe may be a diagnostic nucleic acid primer defined as an allele specific primer, used, generally together with a constant primer, in an amplification reaction such as a PCR reaction, which provides the discrimination between alleles through selective amplification of one allele at a particular sequence position. The diagnostic primer is preferably 5-50 nucleotides, more preferably about 5-35 nucleotides, more preferably about 5-30 nucleotides, more preferably at least 9 nucleotides.

In accordance with the present invention diagnostic primers are provided, comprising the sequences set out below as well as derivatives thereof wherein about 6-8 of the nucleotides at the 3' terminus are identical to the sequences given below and wherein up to 10, such as up to 8, 6, 4, 2, or 1 of the remaining nucleotides may be varied without significantly affecting the properties of the diagnostic primer. Conveniently, the sequence of the diagnostic primer is as written below.

Furthermore, as described above at least two sets of primer(s) and/or probe(s), such as at least three sets of primer(s) and/or probe(s) may be combined in the method thereby increasing the correlation probability. This second or other set of primer(s) and/or probe(s) may be a nucleotide or nucleotide analogues hybridising to a region within the region r or to a sequence different from the region r. Said sequence different from the region r is preferably a region in chromosome X, In particular such second or other primer or probe may be selected from one or more of the sequences below, or the complementary strands: rs391745:

MS7_rs391745_l : ACGTTGGATGGATTCTCAGCATGGACCATC (SEQ ID NO. : 21) MS7_rs391745_2 : ACGTTGGATGTAAAATATGTGCCCACCCTC (SEQ ID NO. : 22) MS7_rs391745_ext: gaCCTCACACTCAACAGTATC (SEQ ID NO. : 23)

rs400586:

MS7_rs400586_l : ACGTTGGATGGATATGTTTCCCATGGACCG (SEQ ID NO. : 24) MS7_rs400586_2 : ACGTTGGATGGGGTTTTAAGCCAGACAGAA (SEQ ID NO. : 25) MS7_rs400586_ext: gggtgTAAGCCAGACAGAAATGGTA (SEQ ID NO. : 26)

rs318138: MS7_rs318138_l : ACGTTGGATGCCTTACTGAGGCCCTCATC (SEQ ID NO. : 27)

MS7_rs318138_2 : ACGTTGGATGGACATGAGTAGCCAAGACAG (SEQ ID NO. : 28)

MS7_rs318138_ext: attAGGTGGGATCAAGGCG (SEQ ID NO. : 29)

Furthermore, as described above at least two sets of primer(s) and/or probe(s), such as at least three sets of primer(s) and/or probe(s) may be combined in the method thereby increasing the correlation probability. This second or other set of primer(s) and/or probe(s) may be a nucleotide or nucleotide analogues hybridising to a region within the region s or to a sequence different from the region s. Said sequence different from the region s is preferably a region in chromosome 3, In particular such second or other primer or probe may be selected from one or more of the sequences below, or the complementary strands:

rs7650656:

MS4_rs7650656_1 : ACGTTGGATGTTGACACACGCCCAGACCTA (SEQ ID NO. :30) MS4_rs7650656_2: ACGTTGGATGATTGGGACCCAGACCTCTGA (SEQ ID NO. :31) MS4_rs7650656_ext: CCCCCGAGGACAGAACACCATCC(SEQ ID NO. :32)

As described above at least two sets of primer(s) and/or probe(s), such as at least three sets of primer(s) and/or probe(s) may be combined in the method thereby increasing the correlation probability. This second or other set of primer(s) and/or probe(s) may be a nucleotide or nucleotide analogues hybridising to a region within the region t or to a sequence different from the region t. Said sequence different from the region t is preferably a region in chromosome 6, In particular such second or other primer or probe may be selected from one or more of the sequences below, or the complementary strands: rs1929772 MS7_rs1929772_1 : ACG TTG GAT GTG GAG GGA TGG GTG TAT AAG (SEQ ID

NO. :33)

MS7_rs1929772_2: ACG TTG GAT GAT GTG TGA ATA GGT GGC TGG (SEQ ID

NO. :34) MS7_rs1929772_ext: GTG GCT GGA GTC AAC AAA (SEQ ID NO. :35)

rs9394742

MS8_rs9394742_1 : ACG TTG GAT GTT AAC CGT GTT GTT GGG GAC (SEQ ID

NO. :36) MS8_rs9394742_2: ACG TTG GAT GAC AGT CCT TGC TCT TCC CAG (SEQ ID

NO. :37)

MS8_rs9394742_ext: TGA AGT TCT GTT GTG GTT TA (SEQ ID NO. : 38)

Rs12196881 MS5_rs12196881_1 ACG TTG GAT GAG TCT CCA AAC ATT CCC TGC(SEQ ID NO. : 39)

MS5_rs12196881_2 ACG TTG GAT GTT TCC ATG AGG AGA AGC CAG (SEQ ID Nθ. :40) MS5_rs12196881_ext CGC CCA TAC TGT ACC ACT (SEQ ID NO. :41)

As described above at least two sets of primer(s) and/or probe(s), such as at least three sets of primer(s) and/or probe(s) may be combined in the method thereby increasing the correlation probability. This second or other set of primer(s) and/or probe(s) may be a nucleotide or nucleotide analogues hybridising to a region within the region u or to a sequence different from the region u. Said sequence different from the region u is preferably a region in chromosome 16, In particular such second or other primer or probe may be selected from one or more of the sequences below, or the complementary strands: rs12934809:

MS5_rs12934809_1 : ACGTTGGATGCTGCTACATGGGAAAGTTTTT (SEQ ID NO. :42)

MS5_rs12934809_2: ACGTTGGATGAGGAGAGTTGGTGCCATATT (SEQ ID NO. :43)

MS5_rs12934809_ext: ggTGGTGCCATATTGTTTCA (SEQ ID NO. :44)

Similarly, at least two sets of primer(s) and/or probe(s), such as at least three sets of primer(s) and/or probe(s) may be combined in the method thereby increasing the correlation probability. This second or other set of primer(s) and/or probe(s) may be a nucleotide or nucleotide analogues hybridising to a region within the region v or to a sequence different from the region v. Said sequence different from the region v is preferably a region in chromosome 19, In particular such second or other primer or probe may be selected from one or more of the sequences below, or the complementary strands: rs2396212: MS7_rs2396212_1 : ACG TTG GAT GGA AAG GTT TAA TTC TGT GAG (SEQ ID

NO. :45)

MS7_rs2396212_2: ACG TTG GAT GCT AGA ATT AAG CTA TCT GTG (SEQ ID NO. :46) MS7_rs2396212_ext: GTA AGC TAT CTG TGA AAC TGC TC (SEQ ID NO. :47) Thus, one or more primers of the invention may be used in the methods of the invention. The primers may be selected from primers or probes that amplifies and/or hybridises to rs391745, rs400586, rs7650656, rs318138, rs1929772, rs9394742, rs12196881 , rs12934809 or rs2396212. Accordingly, the one or more primers are selected from MS7_rs391745_1 , MS7_rs391745_2, MS7_rs391745_ext, MS7_rs400586_1 , MS7_rs400586_2, MS7_rs400586_ext,MS7_rs318138_1 , MS7_rs318138_2, MS7_rs318138_ext, MS4_rs7650656_1 , MS4_rs7650656_2,

MS4_rs7650656_ext, MS7_rs1929772_1 , MS7_rs1929772_2, MS7_rs1929772_ext, MS8_rs9394742_1 , MS8_rs9394742_2, MS8_rs9394742_ext, MS5_rs12196881_1 , MS5_rs12196881 _2, MS5_rs12196881 _ext MS7_rs2396212_1 , MS7_rs2396212_2, MS7_rs2396212_ext, MS5_rs12934809_1 , MS5_rs12934809_2 and/or MS5_rs12934809_ext, or used in any combination for assaying several HERVs simultaneously.

The primers and probes may be manufactured using any convenient method of synthesis. Examples of such methods may be found in standard textbooks, for example "Protocols for Oligonucleotides and Analogues; Synthesis and Properties," Methods in Molecular Biology Series; Volume 20; Ed. Sudhir Agrawal, Humana ISBN: 0-89603- 247-7; 1993; Lsup.st Edition. If required the primer(s) and probe(s) may be labelled to facilitate detection. The primers or probes of the invention may be operably linked to at least one label, such as operably linked to two different labels, wherein the labels are selected from for example TEX, TET, TAM, ROX, R6G, ORG, HEX, FLU, FAM, DABSYL, Cy7, Cy5, Cy3, BOFL, BOF, BO-X, BO-TRX, BO-TMR, JOE, 6JOE, VIC, 6FAM, LCRed640, LCRed705, TAMRA, Biotin, Digoxigenin, DuO-family, Daq-family, or other suitable labels. Likewise the one or more primers or probes may be operably linked to a surface, for example where the surface is the surface of microbeads or a DNA chip. Kit

According to another aspect of the present invention, there is provided a diagnostic kit comprising at least one diagnostic primer of the invention and/or at least one allele- specific oligonucleotide primer of the invention.

The diagnostic kits may comprise appropriate packaging and instructions for use in the methods of the invention. Such kits may further comprise appropriate buffer(s) and polymerase(s) such as thermostable polymerases, for example taq polymerase.

Preferred kits can comprise means for amplifying the relevant sequence such as primers, polymerase, deoxynucleotides, buffer, metal ions; and/or means for discriminating the polymorphism, such as one or a set of probes hybridising to the polymorphic site, a sequence reaction covering the polymorphic site, an enzyme or an antibody; and/or a secondary amplification system, such as enzyme-conjugated antibodies, or fluorescent antibodies. The kit-of-parts preferably also comprises a detection system, such as a fluorometer, a film, an enzyme reagent or another highly sensitive detection device.

The methods described herein may be performed, for example, by utilizing prepackaged diagnostic kits. The invention therefore also encompasses kits for detecting the presence of a polypeptide or nucleic acid of the invention in a biological sample (i.e., a test sample). Such kits can be used, e.g., to determine if a subject is suffering from or is at increased risk of developing a disorder associated with a disorder-causing allele, or aberrant expression or activity of a polypeptide of the invention. For example, the kit can comprise a labeled compound or agent capable of detecting the polypeptide or mRNA or DNA the HERV gene sequences of the invention, e.g., encoding the polypeptide in a biological sample. The kit can further comprise a means for determining the amount of the polypeptide or mRNA in the sample (e.g., an antibody which binds the polypeptide or an oligonucleotide probe which binds to DNA or mRNA encoding the polypeptide). Kits can also include instructions for observing that the tested subject is suffering from or is at risk of developing a disorder associated with aberrant expression of the polypeptide if the amount of the polypeptide or mRNA encoding the polypeptide is above or below a normal level, or if the DNA correlates with presence of an HERV allele that causes MS, in particular RRMS. For antibody-based kits, the kit can comprise, for example: (1 ) a first antibody (e.g., attached to a solid support) which binds to a polypeptide of the invention; and, optionally, (2) a second, different antibody which binds to either the polypeptide or to the first antibody and is conjugated to a detectable agent.

Identification of an allele as having implication for risk of multiple sclerosis

An allele in the r, t, u, v region or s region can be identified as correlated with an increased risk of developing multiple sclerosis on the basis of statistical analyses of the incidence of a particular allele in two groups of individuals with and without multiple sclerosis, respectively, according to the χ²test, which is well known in the art.

Furthermore, an allele in the region can be identified as an allele correlated with prognosis of multiple sclerosis on the basis of statistical analyses of the incidence of a particular allele in individuals demonstrating different prognostic characteristics.

Identification of humans having increased likelihood of responding to treatment

It is further contemplated that the present invention provides a method for identifying a human subject as having an increased likelihood of responding positively to a multiple sclerosis treatment, comprising determining the presence in the subject of a r, t, u, v region or s region allele genotype correlated with an increased likelihood of positive response to treatment, whereby the presence of the genotype identifies the subject as having an increased likelihood of responding to multiple sclerosis treatment.

The present invention relates to method of treatment, but also relapse, progression and/or prophyylaxis of multiple sclerosis comprising administration in a therapeutically effective amount of at least one anti-retroviral compound to an individual in need thereof.

Treatment

Several subtypes of MS are found. In an attempt to predict the future course of disease subtypes are used, wherein the subtypes have been defined based on the past course of disease. Classification into subtypes of MS are important also for deciding on treatment.

One subtype is relapsing remitting MS, characterized by unpredictable relapses followed by periods of months to years of relative quiet (remission) with no new signs of disease activity. Deficits suffered during attacks may either resolve or leave sequelae. Sequelae become more pronounced as a function of time. The relapsing-remitting subtype usually begins with a clinically isolated syndrome (CIS). In CIS, a patient has an attack suggestive of demyelination, but does not fulfill the criteria for multiple sclerosis.

Another subtype is secondary progressive MS and accounts for around 65 % of those with an initial relapsing-remitting MS, who then begin to have progressive neurologic decline between acute attacks without any definite periods of remission. On average the time between disease onset and conversion from relapsing-remitting to secondary progressive MS is around 20 year.

A third subtype, primary progressive, accounting for 10% to 15% of individuals who never has remission after their initial MS symptoms, is characterized by progression of disability from onset, with no, or only occasional and minor, remissions and improvements. The age of onset for the primary progressive subtype is later than for the relapsing-remitting - around 40 years of age

A fourth subtype is progressive relapsing MS characterised by a steady neurologic decline and superimposed attacks right from the outset of the disease.

It is appreciated that the methods and compounds of the present invention relate to all subtypes, in a preferred embodiment the invention relates to relapsing remitting MS and secondary progressive MS. In a further preferred embodiment the methods and compounds of the present invention pertains to relapsing remitting MS.

One aspect of the invention relates to the use of antiviral compounds, pharmaceutical composition, or kits of the invention for the manufacture of a medicament for the treatment of multiple sclerosis, preferably relapsing-remitting multiple sclerosis.

The term "treatment", as used anywhere herein comprises any type of therapy, which aims at terminating, preventing, ameliorating and/or reducing the susceptibility to a clinical condition as described herein. In a preferred embodiment, the term treatment relates to prophylactic treatment, i.e. a therapy to reduce the susceptibility of a clinical condition, a disorder or condition as defined herein.

Thus, "treatment," "treating," and the like, as used herein, refer to obtaining a desired pharmacologic and/or physiologic effect, covering any treatment of a pathological condition or disorder in a mammal, including a human. The effect may be prophylactic in terms of completely or partially preventing a disorder or symptom thereof and/or may be therapeutic in terms of a partial or complete cure for a disorder and/or adverse affect attributable to the disorder. That is, "treatment" includes (1 ) preventing the disorder from occurring or recurring in a subject who may be predisposed to the disorder but has not yet been diagnosed as having it, (2) inhibiting the disorder, such as arresting its development, (3) stopping or terminating the disorder or at least symptoms associated therewith, so that the host no longer suffers from the disorder or its symptoms, such as causing regression of the disorder or its symptoms, for example, by restoring or repairing a lost, missing or defective function, or stimulating an inefficient process, or (4) relieving, alleviating, or ameliorating the disorder, or symptoms associated therewith, where ameliorating is used in a broad sense to refer to at least a reduction in the magnitude of a parameter, such as MS, in particular relapse remitting MS.

The terms "prevent," "preventing," and "prevention", as used herein, refer to a decrease in the occurrence of pathological cells in an animal. The prevention may be complete, e.g., the total absence of pathological cells in a subject. The prevention may also be partial, such that for example the occurrence of pathological cells in a subject is less than that which would have occurred without the present invention. Prevention also refers to reduced susceptibility to a clinical condition.

The terms "inhibiting," "reducing," or "prevention," or any variation of these terms, when used in the claims and/or the specification includes any measurable decrease or complete inhibition to achieve a desired result.

According to the methods and compositions of the present invention the activity of multiple sclerosis disease is decreased by at least 10%, such as at least 15%, such as at least 25%, such as at least 30%, such as at least 35%, such as at least 40%, such as at least 45%, such as at least 50%, such as at least 55%, such as at least 60%, such as at least 70%, such as at least 75%, such as at least 80%, such as at least 85%, such as at least 90%, such as at least 95%, such as at least 96%, such as at least 97%, such as at least 98%, such as at least 99%. Thus, in analogy, the present invention relates in one aspect to a pharmaceutical composition for treating, ameliorating and/or preventing MS comprising a) antiviral drugs; and in another aspect to a method for treating, ameliorating and/or preventing MS comprising administration of a) antiviral drugs b) the pharmaceutical composition of the invention or c) the kit of parts of the invention or d) the kit of the invention, in a therapeutically effective amount to an individual in need thereof.

Pharmaceutical composition

Pharmaceutical compositions of the present invention that aid in the combat, prevention or amelioration of MS comprises antiviral drugs as described elsewhere herein and a pharmaceutical acceptable carrier and/or diluent. It is appreciated that the pharmaceutical composition comprises at least one antiviral drug, two antiviral drugs, three antiviral drugs, 4 antiviral drugs may be used in combination

Pharmaceutical formulation

Pharmaceutical compositions, kit, or kit of parts of the present invention may be prepared by conventional techniques, e.g. as described in Remington: The Science and Practice of Pharmacy 1995, edited by E. W. Martin, Mack Publishing Company, 19th edition, Easton, Pa. The compositions may appear in conventional forms, for example capsules, tablets, aerosols, solutions, suspensions or topical applications.

The terms "medicament" and "pharmaceutical compositions" are used interchangeably herein.

The present invention provides pharmaceutical compositions for treating, ameliorating and/or preventing MS comprising a) antiviral drugs, b) the kit of the invention or c) the kit of parts of the invention.

In one aspect the present invention relates to a pharmaceutical composition. The pharmaceutical composition may be formulated in a number of different manners, depending on the purpose for the particular pharmaceutical composition.

For example the pharmaceutical composition may be formulated in a manner so it is useful for a particular administration form. Preferred administration forms are described herein below. In one embodiment the pharmaceutical composition is formulated so it is a liquid. For example the composition may be a protein solution or the composition may be a protein suspension. Said liquid may be suitable for parenteral administration, for example for injection or infusion.

The liquid may be any useful liquid, however it is frequently preferred that the liquid is an aqueous liquid. For many purposes, in particular when the liquid should be used for parenteral administration, it is furthermore preferred that the liquid is sterile. Sterility may be conferred by any conventional method, for example filtration, irradiation or heating. Furthermore, it is preferred that the liquid has been subjected to a virus reduction step, in particular if the liquid is formulated for parenteral administration.

Virus reduction may for example be performed by nanofiltration or virus filtering over a suitable filter, such as a Planova filter consisting of several layers. The Planova filter may be any suitable size for example 75N, 35N, 2ON or 15N or filters of different size may be used, for example Planova 20N.Virus reduction may also comprise a step of prefiltering with another filter, for example using a filter with a pore size of the the range of 0.01 to 1 μm, such as in the range of 0.05 to 0.5 μm, for example around 0.1 μm. Virus reductions may also include an acidic treatment step.

The pharmaceutical composition may be packaged in single dosage units, which may be more convenient for the user. Hence, pharmaceutical compositions for bolus injections may be packages in dosage units of for example at the most 10 ml, pre- ferably at the most 8 ml, more preferably at the most 6 ml, such as at the most 5 ml, for example at the most 4 ml, such as at the most 3 ml, for example around 2 ml.

The pharmaceutical composition may be packaged in any suitable container. In one example a single dosage of the pharmaceutical composition may be packaged in injection syringes or in a container useful for infusion.

In another embodiment of the present invention the pharmaceutical composition is a dry composition. The dry composition may be used as such, but for most purposes the composition is a dry composition for storage only. Prior to use the dry composition may be dissolved or suspended in a suitable liquid composition, for example sterile water. It is also comprised within the invention that the pharmaceutical composition may be applied topically to the site of the site, for example in the form of a lotion, a creme, an ointment, a spray, such as an aerosol spray or a nasal spray, rectal or vaginal suppositories, drops, such as eye drops or nasal drops, a patch, an occlusive dressing or the like.

Pharmaceutically acceptable additives

The pharmaceutical compositions may be prepared by any conventional technique, e.g. as described in Remington: The Science and Practice of Pharmacy 1995, edited by E. W. Martin, Mack Publishing Company, 19th edition, Easton, Pa.

The pharmaceutically acceptable additives may be any conventionally used pharmaceutically acceptable additive, which should be selected according to the specific formulation, intended administration route etc. For example the pharmaceutically acceptable additives may be any of the additives mentioned in Nema et al, 1997. Furthermore, the pharmaceutically acceptable additive may be any accepted additive from FDA^'s "inactive ingredients list", which for example is available on the internet address http://www.fda.gov/cder/drug/iig/default.htm.

In some embodiments of the present invention it is desirable that the pharmaceutical composition comprises an isotonic agent. In particular when the pharmaceutical composition is prepared for administration by injection or infusion it is often desirable that an isotonic agent is added.

Accordingly, the composition may comprise at least one pharmaceutically acceptable additive which is an isotonic agent.

The pharmaceutical composition may be isotonic, hypotonic or hypertonic. However it is often preferred that a pharmaceutical composition for infusion or injection is essentially isotonic, when it is administrated. Hence, for storage the pharmaceutical composition may preferably be isotonic or hypertonic. If the pharmaceutical composition is hypertonic for storage, it may be diluted to become an isotonic solution prior to administration. The isotonic agent may be an ionic isotonic agent such as a salt or a non-ionic isotonic agent such as a carbohydrate.

Examples of ionic isotonic agents include but are not limited to NaCI, CaCI₂, KCI and MgCI₂ Examples of non-ionic isotonic agents include but are not limited to mannitol and glycerol.

However, in other embodiments of the invention the pharmaceutical composition may comprise no buffer at all or only micromolar amounts of buffer.

In a preferred embodiment the buffer is TRIS. TRIS buffer is known under various other names for example tromethamine including tromethamine USP, THAM, Trizma, Trisamine, Tris amino and trometamol. The designation TRIS covers all the aforementioned designations.

The buffer may furthermore for example be selected from USP compatible buffers for parenteral use, in particular, when the pharmaceutical formulation is for parenteral use. For example the buffer may be selected from the group consisting of monobasic acids such as acetic, benzoic, gluconic, glyceric and lactic, dibasic acids such as aconitic, adipic, ascorbic, carbonic, glutamic, malic, succinic and tartaric, polybasic acids such as citric and phosphoric and bases such as ammonia, diethanolamine, glycine, triethanolamine, and TRIS.

The pharmaceutical compositions may comprise at least one pharmaceutically acceptable additive which is a stabiliser.

For example the stabiliser may be selected from the group consisting of poloxamers, Tween-20, Tween-40, Tween-60, Tween-80, Brij, metal ions, amino acids, polyethylene glycol, Triton, EDTA, ascorbic acid, Triton X-100, NP40 or CHAPS.

The pharmaceutical composition according to the invention may also comprise one or more cryoprotectant agents. In particular, when the composition comprises freeze-dried protein or the composition should be stored frozen, it may be desirable to add a cryoprotecting agent to the pharmaceutical composition. The cryoprotectant agent may be any useful cryoprotectant agent, for example the cryoprotectant agent may be selected from the group consisting of dextran, glycerin, polyethylenglycol, sucrose, trehalose and mannitol.

Accordingly, the pharmaceutically acceptable additives may comprise one or more selected from the group consisting of isotonic salt, hypertonic salt, buffer and stabilisers. Furthermore, the pharmaceutically acceptable additives may comprise one or more selected from the group consisting of isotonic agents, buffer, stabilisers and cryoprotectant agents. For example, the pharmaceutically acceptable additives comprise glucosemonohydrate, glycine, NaCI and polyethyleneglycol 3350.

Formulations

Whilst it is possible for the antiviral drugs of the present invention to be administered as the raw composition, it is preferred to present it in the form of a pharmaceutical formulation. Accordingly, the present invention further provides a pharmaceutical formulation, for medicinal application, which comprises a composition of the present invention or a pharmaceutically acceptable salt thereof, as herein defined, and a pharmaceutically acceptable carrier therefore.

Oral administration

The compositions of the present invention may be formulated in a wide variety of oral administration dosage forms. The pharmaceutical compositions and dosage forms may comprise the compositions of the invention or its pharmaceutically acceptable salt or a crystal form thereof as the active component. The pharmaceutically acceptable carriers can be either solid or liquid. Solid form preparations include powders, tablets, pills, capsules, cachets, suppositories, and dispersible granules. A solid carrier can be one or more substances which may also act as diluents, flavoring agents, solubilizers, lubricants, suspending agents, binders, preservatives, wetting agents, tablet disintegrating agents, or an encapsulating material.

Preferably, the composition will be about 0.5% to 75% by weight of a composition or compositions of the invention, with the remainder consisting of suitable pharmaceutical excipients. For oral administration, such excipients include pharmaceutical grades of mannitol, lactose, starch, magnesium stearate, sodium saccharine, talcum, cellulose, glucose, gelatin, sucrose, magnesium carbonate, and the like. In powders, the carrier is a finely divided solid which is a mixture with the finely divided active component. In tablets, the active component is mixed with the carrier having the necessary binding capacity in suitable proportions and compacted in the shape and size desired. The powders and tablets preferably contain from 1 to about 70 %t of the active composition. Suitable carriers are magnesium carbonate, magnesium stearate, talc, sugar, lactose, pectin, dextrin, starch, gelatin, tragacanth, methylcellulose, sodium carboxymethylcellulose, a low melting wax, cocoa butter, and the like. The term "preparation" is intended to include the formulation of the active composition with encapsulating material as carrier providing a capsule in which the active component, with or without carriers, is surrounded by a carrier, which is in association with it. Similarly, cachets and lozenges are included. Tablets, powders, capsules, pills, cachets, and lozenges can be as solid forms suitable for oral administration. . Multiple- unit-dosage granules can be prepared as well. Tablets and granules of the above cores can be coated with concentrated solutions of sugar, etc. The cores can also be coated with polymers which change the dissolution rate in the gastrointestinal tract, such as anionic polymers having a pka of above 5.5. Such polymers are hydroxypropylmethyl cellulose phthalate, cellulose acetate phthalate, and polymers sold under the trade mark Eudragit S100 andL.100. In preparation of gelatine capsules these can be soft or hard. In the former case the active compound is mixed with oil, and in the latter case the multiple-unit-dosage granules are filled therein.

Drops according to the present invention may comprise sterile or non-sterile aqueous or oil solutions or suspensions, and may be prepared by dissolving the active ingredient in a suitable aqueous solution, optionally including a bactericidal and/or fungicidal agent and/or any other suitable preservative, and optionally including a surface active agent. The resulting solution may then be clarified by filtration, transferred to a suitable container which is then sealed and sterilized by autoclaving or maintaining at 98-100 degree C for half an hour. Alternatively, the solution may be sterilized by filtration and transferred to the container aseptically. Examples of bactericidal and fungicidal agents suitable for inclusion in the drops are phenylmercuric nitrate or acetate (0.002%), benzalkonium chloride (0.01 %) and chlorhexidine acetate (0.01 %). Suitable solvents for the preparation of an oily solution include glycerol, diluted alcohol and propylene glycol. Also included are solid form preparations which are intended to be converted, shortly before use, to liquid form preparations for oral administration. Such liquid forms include solutions, suspensions, and emulsions. These preparations may contain, in addition to the active component, colorants, flavours, stabilizers, buffers, artificial and natural sweeteners, dispersants, thickeners, solubilising agents, and the like.

Other forms suitable for oral administration include liquid form preparations including emulsions, syrups, elixirs, aqueous solutions, aqueous suspensions, toothpaste, gel dentrifrice, chewing gum, or solid form preparations which are intended to be converted shortly before use to liquid form preparations. Emulsions may be prepared in solutions in aqueous propylene glycol solutions or may contain emulsifying agents such as lecithin, sorbitan monooleate, or acacia. Aqueous solutions can be prepared by dissolving the active component in water and adding suitable colorants, flavours, stabilizing and thickening agents. Aqueous suspensions can be prepared by dispersing the finely divided active component in water with viscous material, such as natural or synthetic gums, resins, methylcellulose, sodium carboxymethylcellulose, and other well known suspending agents. Solid form preparations include solutions, suspensions, and emulsions, and may contain, in addition to the active component, colorants, flavours, stabilizers, buffers, artificial and natural sweeteners, dispersants, thickeners, solubilising agents, and the like.

Parenteral administration

The compositions of the present invention may be formulated for parenteral administration (e.g., by injection, for example bolus injection or continuous infusion) and may be presented in unit dose form in ampoules, pre-filled syringes, small volume infusion or in multi-dose containers with an added preservative. The compositions may take such forms as suspensions, solutions, or emulsions in oily or aqueous vehicles, for example solutions in aqueous polyethylene glycol. Examples of oily or nonaqueous carriers, diluents, solvents or vehicles include propylene glycol, polyethylene glycol, vegetable oils (e.g., olive oil), and injectable organic esters (e.g., ethyl oleate), and may contain formulatory agents such as preserving, wetting, emulsifying or suspending, stabilizing and/or dispersing agents. Alternatively, the active ingredient may be in powder form, obtained by aseptic isolation of sterile solid or by lyophilisation from solution for constitution before use with a suitable vehicle, e.g., sterile, pyrogen-free water. Oils useful in parenteral formulations include petroleum, animal, vegetable, or synthetic oils. Specific examples of oils useful in such formulations include peanut, soybean, sesame, cottonseed, corn, olive, petrolatum, and mineral. Suitable fatty acids for use in parenteral formulations include oleic acid, stearic acid, and isostearic acid. Ethyl oleate and isopropyl myristate are examples of suitable fatty acid esters.

Suitable soaps for use in parenteral formulations include fatty alkali metal, ammonium, and triethanolamine salts, and suitable detergents include (a) cationic detergents such as, for example, dimethyl dialkyl ammonium halides, and alkyl pyridinium halides; (b) anionic detergents such as, for example, alkyl, aryl, and olefin sulfonates, alkyl, olefin, ether, and monoglyceride sulfates, and sulfosuccinates, (c) nonionic detergents such as, for example, fatty amine oxides, fatty acid alkanolamides, and polyoxyethylenepolypropylene copolymers, (d) amphoteric detergents such as, for example, alkyl-. beta. -aminopropionates, and 2-alkyl-imidazoline quaternary ammonium salts, and (e) mixtures thereof.

The parenteral formulations typically will contain from about 0.5 to about 25% by weight of the active ingredient in solution. Preservatives and buffers may be used. In order to minimize or eliminate irritation at the site of injection, such compositions may contain one or more nonionic surfactants having a hydrophile-lipophile balance (HLB) of from about 12 to about 17. The quantity of surfactant in such formulations will typically range from about 5to about 15% by weight. Suitable surfactants include polyethylene sorbitan fatty acid esters, such as sorbitan monooleate and the high molecular weight adducts of ethylene oxide with a hydrophobic base, formed by the condensation of propylene oxide with propylene glycol. The parenteral formulations can be presented in unit-dose or multi-dose sealed containers, such as ampules and vials, and can be stored in a freeze-dried (lyophilized) condition requiring only the addition of the sterile liquid excipient, for example, water, for injections, immediately prior to use. Extemporaneous injection solutions and suspensions can be prepared from sterile powders, granules, and tablets of the kind previously described.

Transdermal Delivery

The pharmaceutical agent-chemical modifier complexes described herein can be administered transdermally. Transdermal administration typically involves the delivery of a pharmaceutical agent for percutaneous passage of the drug into the systemic circulation of the patient. The skin sites include anatomic regions for transdermal^ administering the drug and include the forearm, abdomen, chest, back, buttock, mastoidal area, and the like.

Transdermal delivery is accomplished by exposing a source of the complex to a patient's skin for an extended period of time. Transdermal patches have the added advantage of providing controlled delivery of a pharmaceutical agent-chemical modifier complex to the body. See Transdermal Drug Delivery: Developmental Issues and Research Initiatives, Hadgraft and Guy (eds.), Marcel Dekker, Inc., (1989); Controlled Drug Delivery: Fundamentals and Applications, Robinson and Lee (eds.), Marcel Dekker Inc., (1987); and Transdermal Delivery of Drugs, VoIs. 1-3, Kydonieus and Berner (eds.), CRC Press, (1987). Such dosage forms can be made by dissolving, dispersing, or otherwise incorporating the pharmaceutical agent-chemical modifier complex in a proper medium, such as an elastomeric matrix material. Absorption enhancers can also be used to increase the flux of the compound across the skin. The rate of such flux can be controlled by either providing a rate-controlling membrane or dispersing the compound in a polymer matrix or gel.

Administration as suppositories

The compositions of the present invention may be formulated for administration as suppositories. A low melting wax, such as a mixture of fatty acid glycerides or cocoa butter is first melted and the active component is dispersed homogeneously, for example, by stirring. The molten homogeneous mixture is then poured into convenient sized molds, allowed to cool, and to solidify.

The active composition may be formulated into a suppository comprising, for example, about 0.5% to about 50% of a composition of the invention, disposed in a polyethylene glycol (PEG) carrier (e.g., PEG 1000 [96%] and PEG 4000 [4%].

The compositions of the present invention may be formulated for vaginal administration. Pessaries, tampons, creams, gels, pastes, foams or sprays containing in addition to the active ingredient such carriers as are known in the art to be appropriate. Respiratory tract administration

The compositions of the present invention may be formulated for nasal administration. The solutions or suspensions are applied directly to the nasal cavity by conventional means, for example with a dropper, pipette or spray. The formulations may be provided in a single or multidose form. In the latter case of a dropper or pipette this may be achieved by the patient administering an appropriate, predetermined volume of the solution or suspension. In the case of a spray this may be achieved for example by means of a metering atomizing spray pump.

The compositions of the present invention may be formulated for aerosol administration, particularly to the respiratory tract and including intranasal administration. The composition will generally have a small particle size for example of the order of 5 microns or less. Such a particle size may be obtained by means known in the art, for example by micronization. The active ingredient is provided in a pressurized pack with a suitable propellant such as a chlorofluorocarbon (CFC) for example dichlorodifluoromethane, trichlorofluoromethane, or dichlorotetrafluoroethane, carbon dioxide or other suitable gas. The aerosol may conveniently also contain a surfactant such as lecithin. The dose of drug may be controlled by a metered valve. Alternatively the active ingredients may be provided in a form of a dry powder, for example a powder mix of the composition in a suitable powder base such as lactose, starch, starch derivatives such as hydroxypropylmethyl cellulose and polyvinylpyrrolidine (PVP). The powder carrier will form a gel in the nasal cavity. The powder composition may be presented in unit dose form for example in capsules or cartridges of e.g., gelatin or blister packs from which the powder may be administered by means of an inhaler.

When desired, formulations can be prepared with enteric coatings adapted for sustained or controlled release administration of the active ingredient.

The pharmaceutical preparations are preferably in unit dosage forms. In such form, the preparation is subdivided into unit doses containing appropriate quantities of the active component. The unit dosage form can be a packaged preparation, the package containing discrete quantities of preparation, such as packeted tablets, capsules, and powders in vials or ampoules. Also, the unit dosage form can be a capsule, tablet, cachet, or lozenge itself, or it can be the appropriate number of any of these in packaged form.

Pharmaceutically acceptable salts Pharmaceutically acceptable salts of the instant compounds, where they can be prepared, are also intended to be covered by this invention. These salts will be ones which are acceptable in their application to a pharmaceutical use. By that it is meant that the salt will retain the biological activity of the parent compound and the salt will not have untoward or deleterious effects in its application and use in treating diseases.

Pharmaceutically acceptable salts are prepared in a standard manner. If the parent compound is a base it is treated with an excess of an organic or inorganic acid in a suitable solvent. If the parent compound is an acid, it is treated with an inorganic or organic base in a suitable solvent.

The compounds of the invention may be administered in the form of an alkali metal or earth alkali metal salt thereof, concurrently, simultaneously, or together with a pharmaceutically acceptable carrier or diluent, especially and preferably in the form of a pharmaceutical composition thereof, whether by oral, rectal, or parenteral (including subcutaneous) route, in an effective amount.

Examples of pharmaceutically acceptable acid addition salts for use in the present inventive pharmaceutical composition include those derived from mineral acids, such as hydrochloric, hydrobromic, phosphoric, metaphosphoric, nitric and sulfuric acids, and organic acids, such as tartaric, acetic, citric, malic, lactic, fumaric, benzoic, glycolic, gluconic, succinic, p-toluenesulphonic acids, and arylsulphonic, for example.

Administration forms

The pharmaceutical composition may be prepared so it is suitable for one or more particular administration methods. Furthermore, the method of treatment described herein may involve different administration methods.

In general any administration method, wherein at least one antiviral drug may be administered to an individual in a manner, wherein the antiviral drug may reach the site of disease may be employed with the present invention. The main routes of drug delivery, in the treatment method are intravenous, oral, and topical, as will be described below. Other drug-administration methods, such as subcutaneous injection or via inhalation, which are effective to deliver the drug to a target site or to introduce the drug into the bloodstream, are also contemplated.

The mucosal membrane to which the pharmaceutical preparation of the invention is administered may be any mucosal membrane of the mammal to which the biologically active substance is to be given, e.g. in the nose, vagina, eye, mouth, genital tract, lungs, gastrointestinal tract, or rectum, preferably the mucosa of the nose, mouth or vagina.

Compositions of the invention may be administered parenterally, that is by intravenous, intramuscular, subcutaneous intranasal, intrarectal, intravaginal or intraperitoneal administration. The subcutaneous and intramuscular forms of parenteral administration are generally preferred. Appropriate dosage forms for such administration may be prepared by conventional techniques. The compositions may also be administered by inhalation, that is by intranasal and oral inhalation administration. Appropriate dosage forms for such administration, such as an aerosol formulation or a metered dose inhaler, may be prepared by conventional techniques.

The compositions according to the invention may be administered with at least one other compound. The compounds may be administered simultaneously, either as separate formulations or combined in a unit dosage form, or administered sequentially.

Combination treatment

It may be advantageously to add additional therapeutics to the pharmaceutical composition or to administer one or more therapeutics. Thus, in one embodiment the invention relates to a pharmaceutical composition according to the invention, further comprising at least one additional therapeutic agent. In analogy, at least one additional therapeutic agent may be used in the methods for treatment, amelioration and/or prophylaxis of MS, in particular RRMS.

Antiviral drugs may be used in a pharmaceutical composition or in a method comprising administering an effective amount to a cell, tissue, organ, animal or patient in need. Such a pharmaceutical composition or method can optionally further comprise co-administration or combination therapy for treating MS, wherein the administering of said composition further comprises administering, before concurrently, and/or after, at least one selected from at least one, an antirheumatic (e.g., methotrexate, auranofin, aurothioglucose, azathioprine, etanercept, gold sodium thiomalate, hydroxychloroquine sulfate, leflunomide, sulfasalzine), a muscle relaxant, a narcotic, a non-steroid antiinflammatory drug (NSAID), an analgesic, an anesthetic, a sedative, a local anethetic, a neuromuscular blocker, an antimicrobial (e.g., aminoglycoside, an antifungal, an antiparasitic, an antiviral, a carbapenem, cephalosporin, a flurorquinolone, a macrolide, a penicillin, a sulfonamide, a tetracycline, another antimicrobial), , an anabolic steroid, a diabetes related agent, a mineral, a nutritional, a thyroid agent, a vitamin, a calcium related hormone, an antidiarrheal, an antitussive, an antiemetic, an antiulcer, a laxative, an anticoagulant, an erythropieitin (e.g. epoetin alpha), a filgrastim (e.g. G- CSF, Neupogen), a sargramostim (GM-CSF, Leukine), an immunization, an immunoglobulin, an immunosuppressive (e.g., basiliximab, cyclosporine, daclizumab), a growth hormone, a hormone replacement drug, an estrogen receptor modulator, a mydriatic, a cycloplegic, an alkylating agent, an antimetabolite, a mitoticinhibitor, a radiopharmaceutical, an antidepressant, antimanic agent, an antipsychotic, an anxiolytic, a hypnotic, a sympathomimetic, a stimulant, donepezil, tacrine, an asthma medication, a beta agonist, an inhaled steroid, a leukotriene inhibitor, a methylxanthine, a cromolyn, an epinephrine or analog, dornase alpha (Pulmozyme), a cytokine or a cytokine antagonist. Suitable dosages are well known in the art. See, e.g., Wells et al., eds., Pharmacotherapy Handbook, 2nd Edition, Appleton and Lange, Stamford, CT (2000); PDR Pharmacopoeia, Tarascon Pocket Pharmacopoeia 2000, Deluxe Edition, Tarascon Publishing, Loma Linda, CA (2000).

Thus, one aspect of the invention relates to a kit of parts comprising at least one therapeutic agent as described above and at least one antiviral drug of the invention as a combination for the simultaneous, separate or successive administration in MS therapy.

Dosing regimes

The dosage requirements of antiviral drugs to be administered will vary with the particular drug composition employed, the route of administration and the particular subject being treated. Ideally, a patient to be treated by the present method will receive a pharmaceutically effective amount of the compound in the maximum tolerated dose, generally no higher than that required before drug resistance develops.

The treatment mentioned herein may be any multiple sclerosis treatment, such as for example treatment with antiretroviral drugs.

The present invention relates to the treatment, amelioration and/or prophylaxis of multiple sclerosis comprising administrating anti-retroviral compounds selected from for example protease inhibitors, inhibitors against RT (reverse transcriptase enzyme) in the form of nucleoside or non-nucleosides, inhibitors of IT (integrase enzyme), inhibition of fusion for example by use of peptides derived from heptad repeats of transmembrane (TM) region of the envelope.

Non-limiting examples of drugs employed for the treatment of MS of the present invention are those drugs developed against HIV/AIDS as HIV and HERV-F(c)1 and HERV-K [INT2]are related. Drugs with which one could fight the activity of the viruses and/or the relapse or progression of MS include antiretroviral agents such as inhibitors that bind to gag protein and prevent its processing; entry/fusion inhibitors; nucleoside analog reverse transcriptase inhibitors, such as Zidovudine (1-[(2/?,4S,5S)-4-azido-5- (hydroxymethyl)oxolan-2-yl]-5-methyl-1 ,2,3,4-tetrahydropyrimidine-2,4-dione),

Didanosine (9-[(2/?,5S)-5-(hydroxymethyl)oxolan-2-yl]-6,9-dihydro-3/-/-purin-6-one), Zalcitabine (4-amino-1 -[(2/?,5S)-5-(hydroxymethyl)oxolan-2-yl]-1 ,2-dihydropyrimidin-2- one), Stavudine (1 -[(2R,5S)-5-(hydroxymethyl)-2,5-dihydrofuran-2-yl]-5-methyl-1 ,2,3,4- tetrahydropyrimidine-2,4-dione), Lamivudine (4-amino-1 -[(2/?,5S)-2-(hydroxymethyl)- 1 ,3-oxathiolan-5-yl]-1 ,2-dihydropyrimidin-2-one), Abacavir ({(1 S,4/?)-4-[2-amino-6- (cyclopropylamino)-9/-/-purin-9-yl]cyclopent-2-en-1 -yl}methanol), Emtricitabine (4- amino-5-fluoro-1 -[(2/?,5S)-2-(hydroxymethyl)-1 ,3-oxathiolan-5-yl]-1 ,2-dihydropyrimidin- 2-one) , Atricitabine; nucleotide analog reverse transcriptase inhibitors such as Tenofovir ({[(2/?)-1 -(6-amino-9H-purin-9-yl)propan-2-yl]oxy}methyl)phosphonic acid), Adefovir ({[2-(6-amino-9H-purin-9-yl)ethoxy]methyl}phosphonic acid); non-nucleoside reverse transcriptase inhibitors such as Efavirenz ( (4S)-6-chloro-4-(2- cyclopropylethynyl)-4-(trifluoromethyl)-2,4-dihydro-1 /-/-3,1-benzoxazin-2-one) , Nevirapine (11-cyclopropyl-4-methyl-5,1 1-dihydro-6/-/- dipyrido[3,2-b:2',3'- e][1 ,4]diazepin-6-one), Delavirdine (Λ/-[2-({4-[3-(propan-2-ylamino)pyridin-2- yl]piperazin-1-yl}carbonyl)-1 /-/-indol-5-yl]methanesulfonamide), Etravirine (4-[6-Amino- 5-bromo-2- [(4-cyanophenyl)amino] pyrimidin-4-yl]oxy- 3,5-dimethylbenzonitrile) portmanteau inhibitors that inhibit both reverse transcriptase and integrase; integrase inhibitors such as Bevirimat (3β- (3-carboxy-3-methyl -butanoyloxy) lup-20(29)- en-28- oic acid) and Vivecon; and protease inhibitors such as Atazanavir (methyl Λ/-[(1 S)-1- {[(2S,3S)-3-hydroxy-4-[(2S)-2-[(methoxycarbonyl)amino]-3,3-dimethyl-Λ/'-{[4-(pyridin-2- yl)phenyl]methyl}butanehydrazido]-1-phenylbutan-2-yl]carbamoyl}-2,2- dimethylpropyl]carbamate); Fosamprenavir ({[(2/?,3S)-1 -[Λ/-(2-methylpropyl)(4- aminobenzene)sulfonamido]-3-({[(3S)-oxolan-3-yloxy]carbonyl}amino)-4-phenylbutan- 2-yl]oxy}phosphonic acid), Lopinavir ((2S)-Λ/-[(2S,4S,5S)-5-[2-(2,6- dimethylphenoxy)acetamido]-4-hydroxy-1 ,6-diphenylhexan-2-yl]-3-methyl-2-(2-oxo-1 ,3- diazinan-1-yl)butanamide), Darunavir ([(1 R,5S,6R)-2,8-dioxabicyclo[3.3.0]oct-6-yl] N- [(2S,3R)-4- [(4-aminophenyl)sulfonyl- (2-methylpropyl)amino]-3-hydroxy-1 -phenyl- butan-2-yl] carbamate), Nelfinavir ((3S,4aS,8aS)-Λ/-te/f-butyl-2-[(2R,3R)-2-hydroxy-3- [(3-hydroxy-2-methylphenyl)formamido]-4-(phenylsulfanyl)butyl]- decahydroisoquinoline-3-carboxamide), Ritonavir (1 ,3-thiazol-5-ylmethyl /V-

[(2S,3S_!5S)-3-hydroxy-5-[(2S)-3-methyl-2-{[methyl({[2-(propan-2-yl)-1 ,3-thiazol-4- yl]methyl})carbamoyl]amino}butanamido]-1 ,6-diphenylhexan-2-yl]carbamate), Saquinavir ((2S)-Λ/-[(2S,3R)-4-[(3S)-3-(te/f-butylcarbamoyl)-decahydroisoquinolin-2-yl]- 3-hydroxy-1-phenylbutan-2-yl]-2-(quinolin-2-ylformamido)butanediamide), Tipranavir (Λ/-{3-[(1 R)- 1 -[(2R)-6-hydroxy-4-oxo-2-(2-phenylethyl)-2-propyl-3,4-dihydro-2H-pyran-5- yl]propyl]phenyl}-5-(trifluoromethyl)pyridine-2-sulfonamide), Amprenavir ((3S)-oxolan-3- yl Λ/-[(2S,3R)-3-hydroxy-4-[Λ/-(2-methylpropyl)(4-aminobenzene)sulfonamido]-1- phenylbutan-2-yl]carbamate), Indinavir ((2S)-1 -[(2S,4/?)-4-benzyl-2-hydroxy-4- {[(1 S,2R)-2-hydroxy-2,3-dihydro-1 H-inden-1 -yl]carbamoyl}butyl]-Λ/-te/f-butyl-4-(pyridin- 3-ylmethyl)piperazine-2-carboxamide). One could in particular use these or similar compounds specifically selected for efficient inhibition of functions of HERV-F(c)1 and/or HERV-K. One could also use combinations of the aforementioned drugs. The known combination treatments comprising for example three antiviral drugs, triple combinations) as used in treatment of HIV and AIDS is also within the scope of this invention for treatment of MS, and in particular RRMS). A preferred combination comprises two nucleoside-analogue RTIs and one non-nucleoside-analogue RTI or protease inhibitor. In another aspect one could use antibodies, such as monoclonal antibodies, against the gag and env proteins of HERV-F(c)1 , HERV-H (chromosome 6), HERV-K13 on chromosome 16, HERV-K [INT2]on chromosome 19 and/or HERV-K [INT2]on chromosome 3, in particular such antibodies that have been humanized to minimize adverse reactions in the human body and/or maximize the effectiveness in the human body. Again one could use a combination of several antibodies or a combination of drugs and antibodies.

For all methods of use disclosed herein for the antiviral compounds, the daily oral dosage regimen will preferably be from about 0.01 to about 80 mg/kg of total body weight. The daily parenteral dosage regimen may be about 0.001 to about 80 mg/kg of total body weight. The daily topical dosage regimen will preferably be from 0.1 mg to 150 mg, administered one to four, preferably two or three times daily. The daily inhalation dosage regimen will preferably be from about 0.01 mg/kg to about 1 mg/kg per day. It will also be recognized by one of skill in the art that the optimal quantity and spacing of individual dosages of a compound or a pharmaceutically acceptable salt thereof will be determined by the nature and extent of the condition being treated, the form, route and site of administration, and the particular patient being treated, and that such optimums can be determined by conventional techniques. It will also be appreciated by one of skill in the art that the optimal course of treatment, i.e., the number of doses of a compound or a pharmaceutically acceptable salt thereof given per day for a defined number of days, can be ascertained by those skilled in the art using conventional course of treatment determination tests.

The daily dose of the active antiviral compound varies and is dependant on the type of administrative route, but as a general rule it is 1 to 100 mg/dose of active compound at peroral administration, and 2 to 200 mg/dose in topical administration. The number of applications per 24 hours depend of the administration route, but may vary, e. g. in the case of a topical application in the no. se from 3 to 8 times per 24 hours, i. e. , depending on the flow of phlegm produced by the body treated in therapeutic use.

The compound according to the present invention is given in an effective amount to an individual in need there of. The amount of compound according to the present invention in one preferred embodiment is in the range of from about 0.01 milligram per kg body weight per dose to about 20 milligram per kg body weight per dose, such as from about 0.02 milligram per kg body weight per dose to about 18 milligram per kg body weight per dose, for example from about 0.04 milligram per kg body weight per dose to about 16 milligram per kg body weight per dose, such as from about 0.06 milligram per kg body weight per dose to about 14 milligram per kg body weight per dose, for example from about 0.08 milligram per kg body weight per dose to about 12 milligram per kg body weight per dose, such as from about 0.1 milligram per kg body weight per dose to about 10 milligram per kg body weight per dose, such as from about 0.2 milligram per kg body weight per dose to about 10 milligram per kg body weight per dose, for example from about 0.3 milligram per kg body weight per dose to about 10 milligram per kg body weight per dose, such as from about 0.4 milligram per kg body weight per dose to about 10 milligram per kg body weight per dose, for example from about 0.5 milligram per kg body weight per dose to about 10 milligram per kg body weight per dose, such as from about 0.6 milligram per kg body weight per dose to about 10 milligram per kg body weight per dose, for example from about 0.7 milligram per kg body weight per dose to about 10 milligram per kg body weight per dose, such as from about 0.8 milligram per kg body weight per dose to about 10 milligram per kg body weight per dose, for example from about 0.9 milligram per kg body weight per dose to about 10 milligram per kg body weight per dose, such as from about 1.0 milligram per kg body weight per dose to about 10 milligram per kg body weight per dose, for example from about 1.2 milligram per kg body weight per dose to about 10 milligram per kg body weight per dose, such as from about 1.4 milligram per kg body weight per dose to about 10 milligram per kg body weight per dose, for example from about 1.6 milligram per kg body weight per dose to about 10 milligram per kg body weight per dose, such as from about 1.8 milligram per kg body weight per dose to about 10 milligram per kg body weight per dose, for example from about 2.0 milligram per kg body weight per dose to about 10 milligram per kg body weight per dose, such as from about 2.2 milligram per kg body weight per dose to about 10 milligram per kg body weight per dose, for example from about 2.4 milligram per kg body weight per dose to about 10 milligram per kg body weight per dose, such as from about 2.6 milligram per kg body weight per dose to about 10 milligram per kg body weight per dose, for example from about 2.8 milligram per kg body weight per dose to about 10 milligram per kg body weight per dose, such as from about 3.0 milligram per kg body weight per dose to about 10 milligram per kg body weight per dose, for example from about 3.2 milligram per kg body weight per dose to about 10 milligram per kg body weight per dose, such as from about 3.4 milligram per kg body weight per dose to about 10 milligram per kg body weight per dose, for example from about 3.6 milligram per kg body weight per dose to about 10 milligram per kg body weight per dose, such as from about 3.8 milligram per kg body weight per dose to about 10 milligram per kg body weight per dose, for example from about 4.0 milligram per kg body weight per dose to about 10 milligram per kg body weight per dose, such as from about 4.2 milligram per kg body weight per dose to about 10 milligram per kg body weight per dose, for example from about 4.4 milligram per kg body weight per dose to about 10 milligram per kg body weight per dose, such as from about 4.6 milligram per kg body weight per dose to about 10 milligram per kg body weight per dose, for example from about 4.8 milligram per kg body weight per dose to about 10 milligram per kg body weight per dose, such as from about 5.0 milligram per kg body weight per dose to about 10 milligram per kg body weight per dose, for example from about 5.2 milligram per kg body weight per dose to about 10 milligram per kg body weight per dose, such as from about 5.4 milligram per kg body weight per dose to about 10 milligram per kg body weight per dose, for example from about 5.6 milligram per kg body weight per dose to about 10 milligram per kg body weight per dose, such as from about 5.8 milligram per kg body weight per dose to about 10 milligram per kg body weight per dose, for example from about 6.0 milligram per kg body weight per dose to about 10 milligram per kg body weight per dose, such as from about 6.2 milligram per kg body weight per dose to about 10 milligram per kg body weight per dose, for example from about 6.4 milligram per kg body weight per dose to about 10 milligram per kg body weight per dose, such as from about 6.6 milligram per kg body weight per dose to about 10 milligram per kg body weight per dose, for example from about 6.8 milligram per kg body weight per dose to about 10 milligram per kg body weight per dose, such as from about 7.0 milligram per kg body weight per dose to about 10 milligram per kg body weight per dose, for example from about 7.2 milligram per kg body weight per dose to about 10 milligram per kg body weight per dose, such as from about 7.4 milligram per kg body weight per dose to about 10 milligram per kg body weight per dose, for example from about 7.6 milligram per kg body weight per dose to about 10 milligram per kg body weight per dose, such as from about 7.8 milligram per kg body weight per dose to about 10 milligram per kg body weight per dose, for example from about 8.0 milligram per kg body weight per dose to about 10 milligram per kg body weight per dose, such as from about 0.2 milligram per kg body weight per dose to about 8 milligram per kg body weight per dose, for example from about 0.3 milligram per kg body weight per dose to about 8 milligram per kg body weight per dose, such as from about 0.4 milligram per kg body weight per dose to about 8 milligram per kg body weight per dose, for example from about 0.5 milligram per kg body weight per dose to about 8 milligram per kg body weight per dose, such as from about 0.6 milligram per kg body weight per dose to about 8 milligram per kg body weight per dose, for example from about 0.7 milligram per kg body weight per dose to about 8 milligram per kg body weight per dose, such as from about 0.8 milligram per kg body weight per dose to about 8 milligram per kg body weight per dose, for example from about 0.9 milligram per kg body weight per dose to about 8 milligram per kg body weight per dose, such as from about 1.0 milligram per kg body weight per dose to about 8 milligram per kg body weight per dose, for example from about 1.2 milligram per kg body weight per dose to about 8 milligram per kg body weight per dose, such as from about 1.4 milligram per kg body weight per dose to about 8 milligram per kg body weight per dose, for example from about 1.6 milligram per kg body weight per dose to about 8 milligram per kg body weight per dose, such as from about 1.8 milligram per kg body weight per dose to about 8 milligram per kg body weight per dose, for example from about 2.0 milligram per kg body weight per dose to about 8 milligram per kg body weight per dose, such as from about 2.2 milligram per kg body weight per dose to about 8 milligram per kg body weight per dose, for example from about 2.4 milligram per kg body weight per dose to about 8 milligram per kg body weight per dose, such as from about 2.6 milligram per kg body weight per dose to about 8 milligram per kg body weight per dose, for example from about 2.8 milligram per kg body weight per dose to about 8 milligram per kg body weight per dose, such as from about 3.0 milligram per kg body weight per dose to about 8 milligram per kg body weight per dose, for example from about 3.2 milligram per kg body weight per dose to about 8 milligram per kg body weight per dose, such as from about 3.4 milligram per kg body weight per dose to about 8 milligram per kg body weight per dose, for example from about 3.6 milligram per kg body weight per dose to about 8 milligram per kg body weight per dose, such as from about 3.8 milligram per kg body weight per dose to about 8 milligram per kg body weight per dose, for example from about 4.0 milligram per kg body weight per dose to about 8 milligram per kg body weight per dose, such as from about 4.2 milligram per kg body weight per dose to about 8 milligram per kg body weight per dose, for example from about 4.4 milligram per kg body weight per dose to about 8 milligram per kg body weight per dose, such as from about 4.6 milligram per kg body weight per dose to about 8 milligram per kg body weight per dose, for example from about 4.8 milligram per kg body weight per dose to about 8 milligram per kg body weight per dose, such as from about 5.0 milligram per kg body weight per dose to about 8 milligram per kg body weight per dose, for example from about 5.2 milligram per kg body weight per dose to about 8 milligram per kg body weight per dose, such as from about 5.4 milligram per kg body weight per dose to about 8 milligram per kg body weight per dose, for example from about 5.6 milligram per kg body weight per dose to about 8 milligram per kg body weight per dose, such as from about 5.8 milligram per kg body weight per dose to about 8 milligram per kg body weight per dose, for example from about 6.0 milligram per kg body weight per dose to about 8 milligram per kg body weight per dose, such as from about 0.2 milligram per kg body weight per dose to about 6 milligram per kg body weight per dose, for example from about 0.3 milligram per kg body weight per dose to about 6 milligram per kg body weight per dose, such as from about 0.4 milligram per kg body weight per dose to about 6 milligram per kg body weight per dose, for example from about 0.5 milligram per kg body weight per dose to about 6 milligram per kg body weight per dose, such as from about 0.6 milligram per kg body weight per dose to about 6 milligram per kg body weight per dose, for example from about 0.7 milligram per kg body weight per dose to about 6 milligram per kg body weight per dose, such as from about 0.8 milligram per kg body weight per dose to about 6 milligram per kg body weight per dose, for example from about 0.9 milligram per kg body weight per dose to about 6 milligram per kg body weight per dose, such as from about 1.0 milligram per kg body weight per dose to about 6 milligram per kg body weight per dose, for example from about 1.2 milligram per kg body weight per dose to about 6 milligram per kg body weight per dose, such as from about 1.4 milligram per kg body weight per dose to about 6 milligram per kg body weight per dose, for example from about 1.6 milligram per kg body weight per dose to about 6 milligram per kg body weight per dose, such as from about 1.8 milligram per kg body weight per dose to about 6 milligram per kg body weight per dose, for example from about 2.0 milligram per kg body weight per dose to about 6 milligram per kg body weight per dose, such as from about 2.2 milligram per kg body weight per dose to about 6 milligram per kg body weight per dose, for example from about 2.4 milligram per kg body weight per dose to about 6 milligram per kg body weight per dose, such as from about 2.6 milligram per kg body weight per dose to about 6 milligram per kg body weight per dose, for example from about 2.8 milligram per kg body weight per dose to about 6 milligram per kg body weight per dose, such as from about 3.0 milligram per kg body weight per dose to about 6 milligram per kg body weight per dose, for example from about 3.2 milligram per kg body weight per dose to about 6 milligram per kg body weight per dose, such as from about 3.4 milligram per kg body weight per dose to about 6 milligram per kg body weight per dose, for example from about 3.6 milligram per kg body weight per dose to about 6 milligram per kg body weight per dose, such as from about 3.8 milligram per kg body weight per dose to about 6 milligram per kg body weight per dose, for example from about 4.0 milligram per kg body weight per dose to about 6 milligram per kg body weight per dose, such as from about 4.2 milligram per kg body weight per dose to about 6 milligram per kg body weight per dose, for example from about 4.4 milligram per kg body weight per dose to about 6 milligram per kg body weight per dose, such as from about 4.6 milligram per kg body weight per dose to about 6 milligram per kg body weight per dose, for example from about 4.8 milligram per kg body weight per dose to about 6 milligram per kg body weight per dose, such as from about 5.0 milligram per kg body weight per dose to about 6 milligram per kg body weight per dose. The daily dose of the active antiviral compound varies and is dependant on the type of administrative route, but may be 100 to 1500 mg/dose of active compound at peroral administration, and 200 to 3000 mg/dose in topical administration. The number of applications per 24 hours depend of the administration route, but may vary, e. g. in the case of a topical application in the no. se from 3 to 8 times per 24 hours, i. e. , depending on the flow of phlegm produced by the body treated in therapeutic use.

ANETTE skriver doser ind I henhold til Bjørns oplysninger om doser, foretrukne doser er indskrevet nedenfor.

As indicated above the daily dose at peroral administration may in one embodiment vary from 100 to 1500 mg/dose, such as 100-1400 mg/dose, for example 100-1300 mg/dose, such as 100-1200 mg/dose, for example 100-1100 mg/dose, such as 100- 1000 mg/dose, for example 100-900 mg/dose, for example 100-800 mg/dose, such as 100-700 mg/dose, for example 100-600 mg/dose, such as 100-500 mg/dose, for example 100-400 mg/dose, such as 100-300 mg/dose, for example 100-200 mg/dose.

In another embodiment of the present invention the daily dosis at peroral administration may vary from 200 to 1500 mg/dose, such as 200-1400 mg/dose, for example 200- 1300 mg/dose, such as 200-1200 mg/dose, for example 200-1 100 mg/dose, such as 200-1000 mg/dose, for example 200-900 mg/dose, for example 200-800 mg/dose, such as 200-700 mg/dose, for example 200-600 mg/dose, such as 200-500 mg/dose, for example 200-400 mg/dose, such as 200-300 mg/dose.

In a further embodiment of the present invention the daily dosis at peroral administration may vary from 300 to 1500 mg/dose, such as 300-1400 mg/dose, for example 300-1300 mg/dose, such as 300-1200 mg/dose, for example 300-1 100 mg/dose, such as 300-1000 mg/dose, for example 300-900 mg/dose, for example 300- 800 mg/dose, such as 300-700 mg/dose, for example 300-600 mg/dose, such as 300- 500 mg/dose, for example 300-400 mg/dose.

The daily dosis at peroral administration may in another embodiment vary from 400 to 1500 mg/dose, such as 400-1400 mg/dose, for example 400-1300 mg/dose, such as 400-1200 mg/dose, for example 500-1100 mg/dose, such as 600-1000 mg/dose, for example 400-900 mg/dose, for example 400-800 mg/dose, such as 400-700 mg/dose, for example 400-600 mg/dose, such as 400-500 mg/dose,

In another embodiment of the present invention the daily dosis at peroral administration may vary from 500 to 1500 mg/dose, such as 500-1400 mg/dose, for example 500- 1300 mg/dose, such as 500-1200 mg/dose, for example 500-1 100 mg/dose, such as 500-1000 mg/dose, for example 500-900 mg/dose, for example 500-800 mg/dose, such as 500-700 mg/dose, for example 500-600 mg/dose.

In a further embodiment of the present invention the daily dosis at peroral administration may vary from 600 to 1500 mg/dose, such as 600-1400 mg/dose, for example 600-1300 mg/dose, such as 600-1200 mg/dose, for example 600-1 100 mg/dose, such as 600-1000 mg/dose, for example 600-900 mg/dose, for example 600- 800 mg/dose, such as 600-700 mg/dose.

The daily dosis at peroral administration may in another embodiment vary from 700 to 1500 mg/dose, such as 700-1400 mg/dose, for example 700-1300 mg/dose, such as 700-1200 mg/dose, for example 700-1100 mg/dose, such as 700-1000 mg/dose, for example 700-900 mg/dose, for example 700-800 mg/dose.

In yet another embodiment of the present invention the daily dosis at peroral administration may vary from 800 to 1500 mg/dose, such as 800-1400 mg/dose, for example 800-1300 mg/dose, such as 800-1200 mg/dose, for example 800-1 100 mg/dose, such as 800-1000 mg/dose, for example 800-900 mg/dose.

In a further embodiment of the present invention the daily dosis at peroral administration may vary from 900 to 1500 mg/dose, such as 900-1400 mg/dose, for example 900-1300 mg/dose, such as 900-1200 mg/dose, for example 900-1 100 mg/dose, such as 900-1000 mg/dose.

The daily dosis at peroral administration may in another embodiment vary from 1000 to 1500 mg/dose, such as 1000-1400 mg/dose, for example 1000-1300 mg/dose, such as

1000-1200 mg/dose, for example 1000-1 100 mg/dose. In a further embodiment the daily dosis may vary from 1 100-1500 mg/dose, such as 1100-1400 mg/dose, for example 1 100-1300 mg/dose, such as 1100-1200 mg/dose. In another embodiment the daily dosis may vary from 1200-1500 mg/dose, such as 1200-1400 mg/dose, for example 1200-1300 mg/dose. In yet another embodiment the daily dose may vary from 1300-1500 mg/dose, such as 1300-1400 mg/dose or even 1400-1500 mg/dose.

It is also within the scope of the present invention that the daily dosis at peroral administration may vary 100 to 500 mg/dose, such as 125 to 475 mg/dose, such as 150-450 mg/dose, for example 175-425 mg/dose, such as 200-400 mg/dose, for example 225-375 mg/dose, such as 250-350 mg/dose, for example 275-325 mg/dose. Thus, the daily dosis may vary from 100-250 mg/dose, such as 125-250 mg/dose, for example 150-250 mg/dose, such as 175-250 mg/dose, for example 200-250 mg/dose, such as 225-250 mg/dose. The daily dose may thus also vary from 250-500 mg/dose, uch as 275-500 mg/dose, for example 300-500 mg/dose, such as 325-500 mg/dose, for example 350-500 mg/dose, such as 375-500 mg/dose, for example 400-500 mg/dose, such as 425-500 mg/dose, for example 450-500 mg/dose, such as 475-500 mg/dose.

However, it is also within the scope of the present invention that the daily dosis at peroral administration may vary 500 to 1000 mg/dose, such as 525 to 975 mg/dose, such as 550-950 mg/dose, for example 575-925 mg/dose, such as 600-900 mg/dose, for example 625-875 mg/dose, such as 650-850 mg/dose, for example 675-825 mg/dose, such as 700-800 mg/dose, for example 725-875 mg/dose. Thus, the daily dosis may vary from 500-750 mg/dose, such as 525-750 mg/dose, for example 550- 750 mg/dose, such as 575-750 mg/dose, for example 600-750 mg/dose, such as 625- 750 mg/dose, for example 650-750 mg/dose, such as 675-750 mg/dose, for example 700-750 mg/dose, such as 725-750 mg/dose. The daily dose may thus also vary from 750-1000 mg/dose, such as 775-1000 mg/dose, for example 800-1000 mg/dose, such as 825-1000 mg/dose, for example 850-1000 mg/dose, 875-1000 mg/dose, for example 900-1000 mg/dose, such as 925-1000 mg/dose, for example 950-1000 mg/dose, such as 975-1000 mg/dose.

Further, it is within the scope of the present invention that the daily dosis at peroral administration may vary 1000 to 1500 mg/dose, such as 1025 to 1475 mg/dose, such as 1050-1450 mg/dose, for example 1075-1425 mg/dose, such as 1100-1400 mg/dose, for example 1 125-1375 mg/dose, such as 1 150-1350 mg/dose, for example 1 175-1325 mg/dose, such as 1200-1300 mg/dose, for example 1225-1275 mg/dose. Thus, the daily dosis may vary from 1000-1250 mg/dose, such as 1025-1225 mg/dose, for example 1050-1200 mg/dose, such as 1075-1 175 mg/dose, for example 1 100-1150 mg/dose, such as 625-650 mg/dose. The daily dose may thus also vary from 750-1000 mg/dose, such as 775-1000 mg/dose, for example 800-1000 mg/dose, such as 825- 1000 mg/dose, for example 850-1000 mg/dose, such as 875-1000 mg/dose, for example 900-1000 mg/dose, such as 925-1000 mg/dose, for example 950-1000 mg/dose, such as 975-1000 mg/dose. The daily dose may thus also vary from 1250- 1500 mg/dose, such as 1275-1500 mg/dose, for example 1300-1500 mg/dose, such as 1325-1500 mg/dose, for example 1375-1500 mg/dose, 1400-1500 mg/dose, for example 1425-1500 mg/dose, such as 1450-1500 mg/dose, for example 1475-1500 mg/dose,

The compound according to the present invention is given in an effective amount to an individual in need there of. The amount of compound according to the present invention In preferred embodiments the protease inhibitors such as Atazanavir; Fosamprenavir, Lopinavir, Darunavir, Nelfinavir, Ritonavir, Saquinavir, Tipranavir, Amprenavir, Indinavir are provided in doses ranging between 50 mg and 1000 mg per kg body weight per dose. In particular, Atazanavir may be given in a dose ranging from 50 to 300 mg per kg body weight per dose, more preferably in a dose of 300 mg per kg body weight, in combination with Ritonavir in a dose in the range of 10 mg to 500 mg per kg body weight, perferably 100 mg per kg body weight per dose. In another embodiment of the invention Darunavir may be given in a dose ranging from 100 to 800 mg per kg body weight per dose, more preferably in a dose of 600 mg per kg body weight, in combination with Ritonavir in a dose in the range of 10 mg to 500 mg per kg body weight , perferably 100 mg per kg body weight per dose. Similarly, Fosamprenavir may be given in a dose ranging from 100 to 1000 mg per kg body weight per dose, more preferably in a dose of 700 mg per kg body weight, in combination with Ritonavir in a dose in the range of 10 mg to 500 mg per kg body weight, perferably 100 mg per kg body weight per dose. Indinavir may be given in a dose ranging from 100 to 1000 mg per kg body weight per dose, more preferably in a dose of 800 mg per kg body weight per dose. Ritonavir may be given in a dose ranging from 100 to 1000 mg per kg body weight per dose, more preferably in a dose of 800 mg per kg body weight per dose. Saquinavir may be given in a dose ranging from 100 to 1000 mg per kg body weight per dose, more preferably in a dose of 1000 mg per kg body weight, in combination with Ritonavir in a dose in the range of 10 mg to 500 mg per kg body weight, perferably 100 mg per kg body weight per dose. Tipranavir may be given in a dose ranging from 100 to 1000 mg per kg body weight per dose, more preferably in a dose of 500 mg per kg body weight, in combination with Ritonavir in a dose in the range of 10 mg to 500 mg per kg body weight, perferably 200 mg per kg body weight per dose

In preferred embodiments the nucleoside analog reverse transcriptase inhibitors, such as Zidovudine, Didanosine, Zalcitabine, Stavudine, Lamivudine, Abacavir, Emtritabine, Atricitabine are given in doses ranging between 50 mg and 1000 mg per kg body weight per dose. In particular, Abacavir may be given in a dose ranging from 50 to 500 mg per kg body weight per dose, more preferably in a dose of 300 mg per kg body weight. Didanosine may be given in a dose ranging from 50 to 500 mg per kg body weight per dose, more preferably in a dose of 400 mg per kg body weight, when the total body weight is above 60 kg, and preferably in a dose of 250 mg per kg body weight, when the total body weight is below 60 kg. Emtricitabin may be given in a dose ranging from 50 to 500 mg per kg body weight per dose, more preferably in a dose of 200 mg per kg body weight. Lamivudin may be given in a dose ranging from 25 to 500 mg per kg body weight per dose, more preferably in a dose of 150 mg per kg body weight. Stavudin may be given in a dose ranging from 5 to 200 mg per kg body weight per dose, more preferably in a dose of 40 mg per kg body weight. Tenofovirdisoproxil may be given in a dose ranging from 50 to 500 mg per kg body weight per dose, more preferably in a dose of 245 mg per kg body weight. Nevirapin may be given in a dose ranging from 50 to 1000 mg per kg body weight per dose, more preferably in a dose ranging from 200 to 400 mg per kg body weight. Zidovudin may be given in a dose ranging from 50 to 800 mg per kg body weight per dose, more preferably in a dose of 300 mg per kg body weight.

In preferred embodiments the nucleotide analog reverse transcriptase inhibitors such as Tenofovir and Adefovir are given in doses ranging between 50 mg and 1000 mg per kg body weight per dose. In particular, Efavirenz may be given in a dose ranging from 50 to 800 mg per kg body weight per dose, more preferably in a dose of 600 mg per kg body weight. Nevirapin may be given in a dose ranging from 50 to 800 mg per kg body weight per dose, more preferably in a dose in the range of 200 to 400 mg per kg body weight.

In preferred embodiments the non-nucleoside reverse transcriptase inhibitors such as Efavirenz, Nevirapine, Delavirdine, Etravirine are given in doses ranging between 50 mg and 1000 mg per kg body weight per dose.

In preferred embodiment the inhibitor of fusion Enfurvirtid may be given in doses ranging between 10 mg to 800 mg per kg body weight per dose, preferably as 90 mg per kg body weight per dose.

In a preferred embodiment Maraviroc (4,4-difluoro-Λ/-{(1 S)-3-[3-(3-isopropyl- 5-methyl- 4H- 1 ,2,4-triazol-4-yl)- 8-azabicyclo[3.2.1]oct-8-yl]-1- phenylpropyl}cyclohexanecarboxamide) may be given in doses ranging between 10 mg to 800 mg per kg body weight per dose, preferably in the range of 150 mg to 600 mg per kg body weight per dose.

The term "unit dosage form" as used herein refers to physically discrete units suitable as unitary dosages for human and animal subjects, each unit containing a predetermined quantity of a compound, alone or in combination with other agents, calculated in an amount sufficient to produce the desired effect in association with a pharmaceutically acceptable diluent, carrier, or vehicle. The specifications for the unit dosage forms of the present invention depend on the particular compound or compounds employed and the effect to be achieved, as well as the pharmacodynamics associated with each compound in the host. The dose administered should be an "effective amount" or an amount necessary to achieve an "effective level" in the individual patient.

Since the "effective level" is used as the preferred endpoint for dosing, the actual dose and schedule can vary, depending on individual differences in pharmacokinetics, drug distribution, and metabolism. The "effective level" can be defined, for example, as the blood or tissue level desired in the patient that corresponds to a concentration of one or more compounds according to the invention.

Protein Products of the Gene(s)

Gene products of the region r, s, t, u and/or v, or peptide fragments thereof, can be prepared for a variety of uses. For example, such gene products, or peptide fragments thereof, can be used for the generation of antibodies, in diagnostic assays.

The gene products of the invention include, but are not limited to, human chromosome X HERV-F(c)1 gene product, human chromosome 3 HERV-K [INT2] gene product, human chromosome 6 HERV-H gene product, human chromosome 16 HERV-K13 gene product and/or human chromosome 19 HERV-K [INT2]gene product

Gene product, sometimes referred to herein as an "protein" or "polypeptide", includes those gene products encoded by any of X HERV-F(c)1 gene product, human chromosome 3 HERV-K [INT2] gene product, human chromosome 6 HERV-H gene product, human chromosome 16 HERV-K13 gene product and/or human chromosome 19 HERV-K [INT2]gene product of the gene sequences, or part thereof . Among gene product variants are gene products comprising amino acid residues encoded by the polymorphisms. Such gene product variants also include a variant of the X HERV-F(c)1 gene product, human chromosome 3 HERV-K [INT2] gene product, human chromosome 6 HERV-H gene product, human chromosome 16 HERV-K13 gene product and/or human chromosome 19 HERV-K [INT2] gene product.

In addition, X HERV-F(c)1 gene product, human chromosome 3 HERV-K [INT2] gene product, human chromosome 6 HERV-H gene product, human chromosome 16 HERV-K13 gene product and/or human chromosome 19 HERV-K [INT2]gene product may include proteins that represent functionally equivalent gene products. In preferred embodiments, such functionally equivalent X HERV-F(c)1 gene product, human chromosome 3 HERV-K [INT2] gene product, human chromosome 6 HERV-H gene product, human chromosome 16 HERV-K13 gene product and/or human chromosome 19 HERV-K [INT2]gene product are naturally occurring gene products. Functionally equivalent X HERV-F(c)1 gene product, human chromosome 3 HERV-K [INT2] gene product, human chromosome 6 HERV-H gene product, human chromosome 16 HERV-K13 gene product and/or human chromosome 19 HERV-K [INT2]gene product also include gene products that retain at least one of the biological activities of the X HERV-F(c)1 gene product, human chromosome 3 HERV-K [INT2] gene product, human chromosome 6 HERV-H gene product, human chromosome 16 HERV-K13 gene product and/or human chromosome 19 HERV-K [INT2]gene productdescribed above, and/or which are recognized by and bind to antibodies (polyclonal or monoclonal) directed against X HERV-F(c)1 gene product, human chromosome 3

HERV-K [INT2] gene product, human chromosome 6 HERV-H gene product, human chromosome 16 HERV-K13 gene product and/or human chromosome 19 HERV-K [INT2]gene product.

Antibodies to Gene Products

Described herein are methods for the production of antibodies capable of specifically recognizing one or more gene product epitopes or epitopes of conserved variants or peptide fragments of the gene products. Furthermore, antibodies that specifically recognize mutant forms are encompassed by the invention. The terms "specifically bind" and "specifically recognize" refer to antibodies that bind to HERV-F(c)1 , HERV-K [INT2]on chromome 3, HERV-H (chromosome 6), HERV-K13 on chromosome 16 and/or HERV-K [INT2] on chromosome 19 gene product epitopes at a higher affinity than they bind to non-HERV-F(c)1 , non-on chromosome 3, non-HERV-H (chromosome 6), non-HERV-K13 on chromosome 1 and/or non- HERV-K [INT2]on chromosome 19 (e.g., random) epitopes.

Such antibodies may include, but are not limited to, polyclonal antibodies, monoclonal antibodies (mAbs), humanized or chimeric antibodies, single chain antibodies, Fab fragments, F(ab')₂ fragments, fragments produced by a Fab expression library, anti- idiotypic (anti-Id) antibodies, and epitope-binding fragments of any of the above, including the polyclonal and monoclonal antibodies described below. Such antibodies may be used, for example, in the detection of a gene product in a biological sample and may, therefore, be utilized as part of a diagnostic or prognostic technique whereby patients may be tested for abnormal levels of gene products, and/or for the presence of abnormal forms of such gene products. Such antibodies may also be utilized in conjunction with, for example, compound screening schemes, as described, below, for the evaluation of the effect of test compounds on gene product levels and/or activity.

For the production of antibodies against a gene product, various host animals may be immunized by injection with a HERV-F(c)1 , HERV-K [INT2]on chromome 3, HERV-H (chromosome 6), HERV-K1 3 on chromosome 16 and/or HERV-K [INT2][INT2]on chromosome 19 gene product, or a portion thereof. Such host animals may include, but are not limited to rabbits, mice, and rats, to name but a few. Various adjuvants may be used to increase the immunological response, depending on the host species, including but not limited to Freund's (complete and incomplete), mineral gels such as aluminum hydroxide, surface active substances such as lysolecithin, pluronic polyols, polyanions, peptides, oil emulsions, keyhole limpet hemocyanin, dinitrophenol, and potentially useful human adjuvants such as BCG (bacille Calmette-Guerin) and Corynebacterium parvum.

Polyclonal antibodies are heterogeneous populations of antibody molecules derived from the sera of animals immunized with an antigen, such as a gene product, or an antigenic functional derivative thereof. For the production of polyclonal antibodies, host animals such as those described above, may be immunized by injection with gene product supplemented with adjuvants as also described above.

Monoclonal antibodies, which are homogeneous populations of antibodies to a particular antigen, may be obtained by any technique that provides for the production of antibody molecules by continuous cell lines in culture. These include, but are not limited to, the hybridoma technique of Kohler and Milstein (1975, Nature 256:495-497; and U.S. Pat. No. 4,376,1 10), the human B-cell hybridoma technique (Kosbor et al., 1983, Immunology Today 4:72; Cole et al., 1983, Proc. Natl. Acad. Sci. U.S.A. 80:2026-2030), and the EBV-hybridoma technique (Cole et al., 1985, Monoclonal Antibodies And Cancer Therapy, Alan R. Liss, Inc., pp. 77-96). Such antibodies may be of any immunoglobulin class including IgG, IgM, IgE, IgA, IgD and any subclass thereof. The hybridoma producing the mAb of this invention may be cultivated in vitro or in vivo. Production of high titers of mAbs in vivo makes this the presently preferred method of production.

In addition, techniques developed for the production of "chimeric antibodies" (Morrison, et al., 1984, Proc. Natl. Acad. Sci., 81 :6851-6855; Neuberger, et al., 1984, Nature 312:604-608; Takeda, et al., 1985, Nature, 314:452-454) by splicing the genes from a mouse antibody molecule of appropriate antigen specificity together with genes from a human antibody molecule of appropriate biological activity can be used. A chimeric antibody is a molecule in which different portions are derived from different animal species, such as those having a variable region derived from a murine mAb and a human immunoglobulin constant region. (See, e.g., Cabilly et al., U .S. Pat. No. 4,816,567; and Boss et al., U.S. Pat. No. 4,816397, which are incorporated herein by reference in their entirety.)

I n addition, techniques have been developed for the production of humanized antibodies. (See, e.g., Queen, U.S. Pat. No. 5,585,089, which is incorporated herein by reference in its entirety.) An immunoglobulin light or heavy chain variable region consists of a "framework" region interrupted by three hypervariable regions, referred to as complementarily determining regions (CDRs). The extent of the framework region and CDRs have been precisely defined (see, "Sequences of Proteins of Immunological Interest", Kabat, E. et al., U.S. Department of Health and Human Services (1983) ). Briefly, humanized antibodies are antibody molecules from non-human species having one or more CDRs from the non-human species and a framework region from a human immunoglobulin molecule.

Alternatively, techniques described for the production of single chain antibodies (U.S. Pat. No. 4,946,778; Bird, 1988, Science 242:423-426; Huston, et al., 1988, Proc. Natl. Acad. Sci. U.S.A. 85:5879-5883; and Ward, et al., 1989, Nature 334:544-546) can be adapted to produce single chain antibodies against gene products. Single chain antibodies are formed by linking the heavy and light chain fragments of the Fv region via an amino acid bridge, resulting in a single chain polypeptide.

Antibody fragments that recognize specific epitopes may be generated by known techniques. For example, such fragments include but are not limited to: the F(ab')₂ fragments, which can be produced by pepsin digestion of the antibody molecule and the Fab fragments, which can be generated by reducing the disulfide bridges of the F(ab')₂ fragments. Alternatively, Fab expression libraries may be constructed (Huse, et al., 1989, Science 246:1275-1281 ) to allow rapid and easy identification of monoclonal Fab fragments with the desired specificity.

Immunoassays for gene products, conserved variants, or peptide fragments thereof will typically comprise incubating a sample, such as a biological fluid, a tissue extract, freshly harvested cells, or lysates of cells in the presence of a detectably labeled antibody capable of identifying gene product, conserved variants or peptide fragments thereof, and detecting the bound antibody by any of a number of techniques well- known in the art.

The biological sample may be brought in contact with and immobilized onto a solid phase support or carrier, such as nitrocellulose, that is capable of immobilizing cells, cell particles or soluble proteins. The support may then be washed with suitable buffers followed by treatment with the detectably labeled gene product specific antibody. The solid phase support may then be washed with the buffer a second time to remove unbound antibody. The amount of bound label on the solid support may then be detected by conventional means.

By "solid phase support or carrier" is intended any support capable of binding an antigen or an antibody. Well-known supports or carriers include glass, polystyrene, polypropylene, polyethylene, dextran, nylon, amylases, natural and modified celluloses, polyacrylamides, gabbros, and magnetite. The nature of the carrier can be either soluble to some extent or insoluble for the purposes of the present invention. The support material may have virtually any possible structural configuration so long as the coupled molecule is capable of binding to an antigen or antibody. Thus, the support configuration may be spherical, as in a bead, or cylindrical, as in the inside surface of a test tube, or the external surface of a rod. Alternatively, the surface may be flat such as a sheet, test strip, etc. Preferred supports include polystyrene beads. Those skilled in the art will know many other suitable carriers for binding antibody or antigen, or will be able to ascertain the same by use of routine experimentation. One of the ways in which the HERV-F(c)1 , HERV-K [INT2]on chromome 3, HERV-H (chromosome 6), HERV-K13 on chromosome 16 and/or HERV-K [INT2]on chromosome 19 gene product-specific antibody can be detectably labeled is by linking the same to an enzyme, malate dehydrogenase, staphylococcal nuclease, delta-5- steroid isomerase, yeast alcohol dehydrogenase, α-glycerophosphate, dehydrogenase, triose phosphate isomerase, horseradish peroxidase, alkaline phosphatase, asparaginase, glucose oxidase, β-galactosidase, ribonuclease, urease, catalase, glucose-6-phosphate dehydrogenase, glucoamylase and acetylcholinesterase. The detection can be accomplished by colorimetric methods that employ a chromogenic substrate for the enzyme. Detection may also be accomplished by visual comparison of the extent of enzymatic reaction of a substrate in comparison with similarly prepared standards.

Detection may also be accomplished using any of a variety of other immunoassays. For example, by radioactively labeling the antibodies or antibody fragments, by labeling the antibody with a fluorescent compound. Among the most commonly used fluorescent labeling compounds are fluorescein isothiocyanate, rhodamine, phycoerythrin, phycocyanin, allophycocyanin, o-phthaldehyde and fluorescamine.

The antibody can also be detectably labeled using fluorescence emitting metals such aass ¹¹⁵⁵²²EEuu,, oorr others of the lanthanide series or by coupling it to a chemiluminescent compound.

Diseases Described herein are various applications of gene sequences, gene products, including peptide fragments and fusion proteins thereof, and of antibodies directed against gene products and peptide fragments thereof. Such applications include, for example, prognostic and diagnostic evaluation of a disease, such as multiple sclerosis, and the identification of subjects with a predisposition to such disorders, as described above.

Gene nucleic acid sequences, described above, can be utilized for transferring recombinant nucleic acid sequences to cells and expressing said sequences in recipient cells. Such techniques can be used, for example, in marking cells or for the treatment of multiple sclerosis. Such treatment can be in the form of gene replacement therapy. Specifically, one or more copies of a normal HERV-F(c)1 , HERV-K [INT2]on chromome 3, HERV-H (chromosome 6), HERV-K13 on chromosome 16 and/or HERV- K [INT2][INT2]on chromosome 19 gene or a portion of the HERV-F(c)1 , HERV-K [INT2]on chromome 3, HERV-H (chromosome 6), HERV-K13 on chromosome 16 and/or HERV-K [INT2] on chromosome 19 gene that directs the production of an HERV-F(c)1 , HERV-K [INT2] on chromome 3, HERV-H (chromosome 6), HERV-K13 on chromosome 16 and/or HERV-K [INT2] on chromosome 19 gene product exhibiting normal HERV-F(c)1 , HERV-K [INT2]on chromome 3, HERV-H (chromosome 6), HERV-K13 on chromosome 16 and/or HERV-K [INT2][INT2]on chromosome 19 gene function, may be inserted into the appropriate cells within a patient, using vectors that include, but are not limited to, adenovirus, adeno-associated virus, and retrovirus vectors, in addition to other particles that introduce DNA into cells, such as liposomes.

Examples

Statistics and haplotype assignment Data recording and calculations and tests of allele frequencies were performed in

SPSS and Excel. Calculation of the relative risk and confidence intervals for the single polymorphisms was performed in SAS (SAS Institute, Cary, NC, USA).

Simultaneous analysis of multiple SNPs employing haplotype trend regression (17) was performed with HelixTree (GoldenTree, Bozeman, MT, USA). Haplotype trend regression is basically a two-stage procedure. First, genotype results in combination with population assumptions such as Hardy-Weinberg equilibrium are used to construct all haplotype probabilities corresponding to a given set of markers for each individual. Secondly, the disease state (1 for cases, 0 for controls) is regressed on the haplotype probabilities of all individuals, resulting in a p-value for the overall association of the set of markers with disease, and parameters for association for each specific haplotype with disease. The HelixTree program will use sets of markers of defined size, typically 2 to 4 neighboring markers at a time, to scan the entire region. It can then be used to derive frequencies of the individual haplotypes, to calculate an overall p-value for the distribution of haplotypes covering a given set of markers among cases and controls, and to calculate p-values for the distribution of each haplotype derived from a given set of markers.

The program RASCAL for performing gene localization according to Lazzeroni (16) was implemented in Delphi (B.A. Nexø, unpublished). We used a bootstrap set of 10000 sets of haplotypes selected from the original set with replacement, and to avoid a Q-form with negative values we used a relaxation value of 0.25. A 95% confidence interval for the location of the causative gene variant was derived from the Q-form. Places, where it took on a value less that 3.85 above the minimum, were considered inside the confidence interval.

Three programs were used for assigning haplotypes to individuals on the bases of genotype data: HelixTree, Arlequin (18) and Phase (19). Arlequin (18) like HelixTree is a maximum likelihood algorithm, while Phase in addition includes a penalty for each new haplotype that is brought into play. Furthermore, the program Arlequin includes missing values in its table of frequencies. To compensate for the latter, we normalised the values corresponding to fully defined haplotypes before including them in the analysis. All three were run under Windows 2000.

Experimental setup

Two major views have dominated the discussions of the etiology of multiple sclerosis in recent decades: It could be a genetic disease, or it could be a disease caused by an infectious agent.

The genetic view is most clearly expounded by studies of twins. If one identical twin gets multiple sclerosis the other twin (which has the same genetic make-up has 25% risk of getting it also. This is in contrast of a general disease frequency in Danes of

0.1 %. The alternative view, that multiple sclerosis is caused by an infectious agent, is most clearly backed by animal studies. A number of neurodegenerative diseases exists in animal models and are known to be caused by retroviruses. However no horizontally transmitted virus has been unequivocally linked to multiple sclerosis in man. The obvious intersections of a genetic and a viral etiology are the endogenous retroviruses of man. These are viruses that are inherited. The sequencing and assembly of the human genome have shown that literally thousands of retroviral sequences exist in man. The sequences range from short fragments, such as single LTRs, to apparently intact viruses. Moreover, analyses show that these sequences vary between persons, which would go along with the genetic findings.

We have chosen an approach based on genetic epidemiology to study the involvement of endogenous viruses in multiple sclerosis. Thus, we have treated each endogenous virus as a Mendelian locus rather than an infectious agent, and have tested, if the disease was associated with any of these loci, rather than investigating the disease process as such. In this way we have brought the formidable knowledge of human genetics to bear on the problem, and we have avoided the difficulties of establishing the causality of an ubiquitous infectious agent.

It is a well-known fact that the different alleles of two markers close together on the chromosomal maps normally are non-randomly distributed in a population. The phenomenon is known as linkage disequilibrium. Therefore, we suspected that if a virus was involved in the causation of sclerosis then nearby markers in the surrounding DNA would also be associated with disease. Moreover, while many endogenous retroviruses are rather similar, their sites of integration are generally unique, so by testing neighboring markers we should be able to test the viral loci individually. We also speculated that in order to contribute to disease a retroviral sequence should contain at least one functional or near-functional major gene. We therefore prepared a list of endogenous retroviruses in the human genome, which fulfilled this criterion, and selected at least 2 nearby markers for each.

Initially, we investigated 350 DNAs from patients with multiple sclerosis living in Western Denmark as well as 500 control DNAs from medical students in the same part of the country. Markers with a p-value for association to MS less than 0.05 were mapped onto the chromosomes. In several places, there were clear-cut clusters of significant markers. These were substantiated by analyzing additional nearby markers.

The SNPs tested and the p-value for the association is shown in the table 4 below: Table 4

p-value rs# (Pearsons Chi-square) rsl0266695 0,393 rsl0985376 0,519 rsl0985387 0,505 rsll52326 0,952 rsll523890 0,898 rsll754914 0,562 rsl249808 0,893 rsl2611178 0,116 rsl2823738 0,497 rsl70320 0,897 rsl822077 0,529 rsl985254 0,771 rs219073 0,525 rs2303473 0,327 rs2435029 0,005 rs281040 0,406 rs2984350 0,717 rs4618579 0,523 rs4971095 0,552 rs5920968 0,103 rs5962376 0,773 rs5993571 0,381 rs603486 0,775 rs6460216 0,9 rs6619307 0,736 rs6620400 0,613 rs6712285 0,974 rs7933855 0,767 rs8110756 0,126 rs9604952 0,84 rs9823336 0,574 rs9840472 0,347 rsl0416706 0,298 rslO426414 0,452 rslO818593 0,969 rslll72544 0,532 rsll74600 0,432 rsll824690 0,635 rsl2107596 0,939 rsl2117797 0,908 rsl2199776 0,531 rsl2261856 0,356 rsl6926345 0,35 rsl939392 0,654 rs2091224 0,931 rs2136918 nonvariant only AA rs2182597 0,92 rs2984351 0,775 rs352697 0,298 rs3856908 0,827 rs4827909 0,002 rs5992338 0,164 rs6518591 0,322 rs6689503 0,896 rs6787835 0,975 almost all CC, only one cntl rs7524742 1 CT rs9468414 0,273 rslO214511 0,43 rsl0877101 0,215 rsll224962 0,111 rsll224968 0,126 rsll48533 0,585 rsl2263936 0,868 rsl3073918 0,91 rsl384625 0,402 rsl650930 0,645 rsl67609 0,754 rs2435031 0,186 rs281053 0,454 rs3740073 0,587 rs4148397 0,792 rs4805369 0,137 rs4809040 0,948 rs530133 0,851 rs5748485 0,565 rs5940190 0,874 rs598645 0,918 rs6620397 0,001 rs6791696 0,345 rs7253937 0,257 rs7254577 0,007 rs7650483 0,695 rs8182505 0,448 rs9604911 0,861 rslO232215 0,335 rsl0792346 0,042 rsllO92162 0,03 rsl2925045 0,019 rsl564653 0,234 rsl651576 NA All GG rs210559 NA All GG rs2140336 0,197 rs2504278 0,009 rs2652427 0,209 rs2688228 0,447 rs2902299 0,727 rs322119 0,164 rs3872610 0,998 rs4132355 0,938 rs4517316 0,937 rs4679676 0,861 rs4679677 0,202 rs5983521 0,791 rs6451123 0,59 rs6460219 0,544 rs7650656 0,584 rs819079 0,077 rsl0403221 0,517 rsll264397 0,493 rsll760888 0,243 rsl2185748 0,797 rsl2196881 0,03 rsl2934809 0,015 rsl387153 0,557 rsl651559 0,534 rs219200 0,931 rs2631731 0,469 rs2688242 0,554 rs3088174 0,871 rs4576878 0,15 rs4686378 0,86 rs4717229 0,534 rs4718180 0,837 rs4727276 0,408 rs4764383 0,271 rs5983522 0,877 rs6501089 0,006 rs6620396 0,022 rs7586085 0,779 rs9819214 0,681 rsll797742 0,004 rsll882251 0,003 rsl2192983 0,58 rsl249822 0,341 rsl6889290 0,319 rsl929761 0,235 rs2096537 0,859 rs219077 0,064 rs219078 0,686 rs2347214 0,105 rs2652425 0,445 rs4238842 0,016 rs545075 0,179 rs5748489 0,99 rs5993426 0,937 rs7288876 0,156 rs9393931 0,531 rsl0126790 NA all AA rsl0426848 0,059 rsll52324 0,746 rsl929772 0,003 rs2189362 0,007 rs2379168 0,643 rs2396212 0,003 rs318129 <0,001 rs318131 <0,001 rs318132 0,869 rs318136 0,47 rs318138 <0,001 rs318156 0,543 rs318157 0,957 rs391745 <0,001 rs400586 <0,001 rs445913 0,908 rs5964961 0,332 rs6615516 0,788 rs6619304 0,837 rs7116792 NA Almos rs7935912 0,284 rsllO85338 0,358 rsl2013135 0,337 rs318155 NA all AA rs5962377 0,849 rs6619299 0,837 rs7109277 0,656 rs7886111 0,342 rs9394742 0,014 env_Fcll22 <0,001 rsllO92163 0,004 rsll646366 0,702 rsll672223 0,662 rsl2845339 0,578 rsl6894097 0,011 rsl6982583 NA All CC rsl6982595 0.093 rsl7003794 NA AII AA rsl7333695 0,002 rs318130 NA AII GG rs318133 0,698 rs421531 0,533 rs4786303 0,072 rs4786305 0,055 rs4786309 0,174 Almost all CC, 2 cntl CG rs5920696 0,142 rs628526 0,15 env_fcl401 NA AII CC rsll646705 0,036 rsl229931 0,028 rsl628324 0,65 rs28546315 NA AII TT rs318137 0,429

The results are depicted in Figure 1 (see symbols to the left of the individual chromosome).

Table 5 shows the polymorphisms investigated in this study, their primers used for PCR and extension primers for Sequenom analysis. The list is organized in plexes MS1 - MS13 as analyzed on the Sequenom. The concentrations of the extension primers have been color coded.

A particularly striking cluster occurred on chromosome X at approximate chromosome position 96980000 around a HERV-F proviral locus. Here 3 close-lying markers gave p- values less than 0.001. The marker rs391745 was lowest with a p-value of 0.000028 for association with disease. This value was significant after Bonferroni correction considering that about 200 tests were made.

Table 6 elaborates on the association of rs391745 with disease. It shows the distribution of genotypes among cases and controls.

Table 6 The best association of a marker with MS: Rs391745 on chromosome X near HERV-F(c)1. Association of a SNP near HERV-F(c)l with Multiple Scleroses in Danes

Cases 24 60 273

Cntls 12 56 473

P (chisq) = 0.000028

OR (homozygotes ) = 3.47

OR((CC+CG)/GG) = 2 .14

P(C;cases) = 0.151

P(C;cntls) = 0.085

The SNP assumes the values C and G. and the persons therefore have 3 genotypes CC, CG and GG.The P-value for the association is 0.00003. The OddsRatio for the association among the homozygotes (CC or GG) is = 24/12^*473/273 = 3.47. Sex-stratified analyses confirm the above conclusions.

The association of rs391745 with multiple sclerosis was further tested by investigating DNA from 542 patients with multiple sclerosis and DNA from 1 160 controls located in Eastern Denmark. Women constituted 66 percent of the patients and 65 percent of the controls. In accordance with the results obtained by investigating DNA from people originating from western Denmark, rs391745 was found to be associated with multiple sclerosis (Table 1 , cohort 2). Finally, we tested a third cohort of patients with primary progressive sclerosis, in which we could not find any association of rs391745 with MS (Table 1 , cohort 3). This may indicate a different etiology of primary progressive sclerosis and is in accordance with the observation that the prevalence of primary progressive sclerosis amongst males and females is equal.

The p-value (2-sided) for all 3 cohorts combined was 0.00001 and thus significant after Bonferroni correction (p = 0.003).

To substantiate the association of HERV-F(c)1 with multiple sclerosis a scan of the chromosome X region surrounding the provirus was performed. Figure 3 shows the association of a number of polymorphisms in and around HERV-F(c)1 in relation to their position on chromosome X. Table 5 lists the additional polymorphisms tested. It is clear that the polymorphisms are located in a very narrow region surrounding the provirus of chromosome X. In contrast, the nearest known genes are located 141 kb upstream and 57 kb downstream, respectively.

Moreover, we found that a HERV-K [INT2] virus on chromosome 3 acted synergistically with the HERV-F locus on chromosome X (Figure 2). This suggests that the two viruses form pseudotypes or recombine and thus complement each other.

The present finding that endogenous retroviruses cause MS open for several new avenues for the treatment of disease: One could apply anti-retroviral drugs. Many such drugs have already been developed in the attempts to curb AIDS. Similarly, vaccines or monoclonal antibodies raised against disease causing viral variants could be employed. The application of drugs and vaccines to these persons should make it possible to reduce the incidence of MS while still only interfering with a small minority of the population.

All data for the figures come from a cohort of 350 MS patients and 500 controls sampled in Eastern Jutland.

Quantification of expression of HERV-F/H gag protein

Quantification of expression of HERV-F/H gag protein on human PBMCs from healthy controls, MS patients and MS patients in acute attacks. Blood samples from 30 controls, 30 MS patients, and 12 MS patients with an acute attack, were collected in CPT™ tubes (BD Vacutainers ®), and processed according to the manufacturer's protocol. The PBMCs were stored at - 135 C, until analysis. 3 million of PBMCs were stained for flow cytometry with immunostaining for virus as follows:

The cells were resuspended in growth media (RPMI 1640 and 10% FBS with penicillin, streptomycin and glutamine), and washed twice with PBS (pH 7.4). The cells in 100 μl aliquots were moved to V-bottom 96 well plate, and stained for 30 min with either fluorescent anti CD4 (PE-Cy5), anti CD8a (PE-Cy7) or anti CD19 (PE) (eBioscience, San Diego, CA, USA) at dilution 1 :20 at 4 C. The cells were spun down 1500 rpm for 5 min and washed once with PBS. The cells fixed with PBS + 0.1 percent formaldehyde, 10 min room temperature while rocking. The cells were spun down 1000 rpm, 5 min, and resuspended in 0.2 percent Tween 20 in PBS (pH 7.4). The cells were incubated for 15 min, room temperature on a rocking platform. The were pelleted at 1000 rpm, 5 min and washed twice in PBS. The cells were incubated with 500 μg/ml of human IgG (Beriglobin, Statens Serum Institute, Copenhagen), for 60 min at 4 C. The cells were incubated for 30 min on ice with rabbit anti H ERV-F/H gag antibody #2319 or preimmune serum from the same rabbit at final concentration 1 :1000. [The antibody was raised under contract with Thermo Fisher Scientific (Waltham, MA 02454, USA) against the peptide DIRKKLKKVEEGPQT].

The cells were spun down at 1 000 rpm, 5 min and washed once with PBS. The cells were incubated with secondary FITC conjugated goat anti rabbit IgG antibody (1 :200) for 30 min on ice. The cells were spun down at l OOOrpm, 5 min and washed three times with PBS. The cells were resuspended in 400 μl PBS and 0.1 percent formaldehyde and moved to a Falcon (BD) flow cytrometry tubes. The samples were placed in 4 C until analysis. In all experiments the following samples were analyzed: Unstained PBMCs, PBMCs stained only with second antibody, PBMCs stained with Mouse IgGI , K isotype controls (PE, PE-Cy5 and PE-cy-7), PBMCs stained with anti CD4, CD8a, CD19 and preimmune rabbit anti HERV-F/H gag antibody, PBMCs stained with anti CD4, CD8a, CD19 and rabbit anti HERV-F/H gag antibody,.

The samples were analyzed on a Cytomics™ FC500 (Beckman Coulter, Brea, CA, USA). Monocytes were identified by gating on side/forward scatter. The data were analyzed using the FIoJo software (TreeStar Inc, Ashland, OR, USA). The Fluorescence Index was calculated for CD4, CD8a, CD19 and monocyte cells as the mean fluorescence with the HERV-F/H antibody divided by the mean fluorescence with the HERV-F/H preimmune serum. Figure 4 shows the Fluorescence Index for each cell subgroup in the three person categories. Clearly HERV-F/H gag was over-expressed in acute patient CD4 and CD8a cells, relative to the same cells in controls and non-acute patients. A total of 30 controls, 30 MS patients and 12 acute attack MS patients were analyzed. The P values for MS patients versus acute attack patients for CD4 and CD8a were less that 0.0001

Sequences Chromosome X:

Whole sequence here: >ref|NT_011651.16|HsX_11808:20385151-20405320 Homo sapiens chromosome X genomic contig, reference assembly coodinates chrX: 96975499- 96995668 or POL_9843 minus 9902bp to ENV_8944 plus 5000bp

POL_8943: (shown in bold) >ref|NT_011651.16|HsX_11808:20395053-20397499 Homo sapiens chromosome X genomic contig, reference assembly Coordinates chrX: 96985401-96987847

ENV_8944 (shown in small letters) >ref|NT_011651.16|HsX_11808:20398505-20400320 Homo sapiens chromosome X genomic contig, reference assembly Coordinates: chrX:96988853-96990668

A: RS400586 coordinates chrX: 96980522

C: RS391745 coordinates chrX:96981136

C: RS318138 coordinates chrX:96984891 SEQ ID NO: 1

TAGTCCCTCTCTCCCTCATTACCTTTAGGGCCTGAACACATGGTCATGTTCTAATCTGCTTATTACAGA GAGCGTAGGCAGCCCTGCGGCTTTCCATCTTAGCCTCACTTAGGGCTAATGTTTTCAGTACAGATGTA CACAAGCCGGCAAAGACTGGTTTGAGGCAGAAATTGGCCAAATTACAAGAGCTAAGCAGAATAAAAAA TAAAAATCCAACTTTAACTTCATTCATAAAGAAAGAGATAAAATGATAAAAGGCAAATAAAATAAATCAT AAGAAATGAAACTACTTTAGACATACGTCAATTCTCTTGTATTGAAATAAATCATTTATTTTAGCAGTGG

AGGCACTTATTTCAATATTAGAAAAATAATGCTATTGTTTTCAGCGTAAAATAACCCTCAGGTGGAATA GATGCATTGATTTTTTTAAAATGGATTTAAAATAAATCCAATGTCTTCATAATGAAAACTTACAACATTCA CTAGAATATAGTAGTTACATAAGCCAGTGGCTTTCCAAGAAAAAGGAAAATTGCATTCCCTTGCTTTCA TTGGTTTTTGTTAAATACAATTTGTCCATTCCGTTTGACTGGCCAATTTGATTGCAGTGTACTAAAACTC AGCTAGGTACAATATAGATCCACAGGCTTGACTTAGGAAAACCAAGCCCATATAGCACAATAATTGGA

TCCACACATTAATTAGATCCAGAGATACATCTTGGCTTATTGTCACTGGGCTTCCAGGCTGAAGGAAT CTAGAAATAGGGTGCTTTGAGGCTCTGATTGATTGTCTATGGTATTTTGTACCAGACAGCAAGTATGA GAAAGAAGAACAGCTGTGCAATGACTATAATCAAATGCAAATACCTAGGAGTCTCCACAACAAAATAA CAAAGACAGCAGAATGATGCTCATTTTGATCAATAATAACAGTCTCCCGCCCCTGAAAATTTTCACACA CAATAATCACTGTTAAAGCTGTTTCCTTTTTGTCAAATTGAAACATTCAGTGTGTGGGTATGTTGCCTG

ATGGCATGCAGGCTCCTGATAAAGTATTAATCATGCAACTAAATGACCTGAGTCCCCAACCACATCAT GTAAAATAACATCATCTCTTTAAAATTAATTCATTGAAAGAAACTTTAAAAAGAAGTGTGGAGAACAAAG TAGTTTATGCTGCTGCAGTGAGACCCTATTATAACAGGTTAACACTACAGTAGTATAGAATATACACCA ATGCTGTTGGTGGTAGAAGTACTCCAGGAAGCTAACAAGTATCTGAGCATGCATCAAATTCCTTAGCT AGGAGTTGCATGGATCCTCTACTTTCTGCTTCTACTTTAATTCATTTATTCAGTAAATGTCTACTGAGCA

CCTACTATGTGACAACTGGTTGCACTACTTGTTGGACAACACCCTTTCACTAACATCTTACCTCTTCCA ATGCATTCTAGACATGGCTACTAGATCAATATTGTAAAAACACACTTTGATTGTTTCATAAACCAGGCT CAAAAACATTTGTTGACATACCACTGCCTGCCAATATAATCCCAACACTTTATATTACATTTAGATCTCT GAGTAATATGTTTCTCTCCAACATTAGCTTGCACATTTTCCTCACTAGAGTGTAAGCTCTTTGGTTGCA GTTAGTTCATTTCAATGAAAATTTTTTTGAATATTTATCATGACCAGTGACTGTGCTAAGCATGGGGATA ACATGGTGAATAAGACAGGAAGAATTCTTGTTATAGTGGAAGAGCCTGACATGAGAAACAAATACTCT CAATATAATGCGGTTAAGGGCAATAACAAAACCGAGCACAGGATACTCAGGAAGTACAGAGGAAGTG CTCATAATTCAGACCAGTTGTTGAAGGAAGTCTTCTTAAAGGGGTGCAGGCCCCACACCTTATTCAAC TTGATGTTCCCAGTGTCTAGCACAATTCTTGGCACATAGTAACTTGAATAAATACGTAATCCTTACAAT ATAGTCAATTTGGAAGACTCATCTTCCCCAGTCTGCTGTTTTTCTATCCCTCTCCTCTTTGCCTAGAAT ACCCTATTTTTTTTTTTCACGACTATTTTTGCCTTTCAGAAGTTCAGTTCAAATGCCACCTGCTCCATGA TGGCTTTCCTGATTACTGAAACCAGTAAATAAGCATGAAATCAGATTATCCTCTATGAGAGAAAATAAC TGTAATTAGTTGGAAATGGTTACTGGCCATCCCCAGAAGTAGCTGAAAAGACCATCTTTAGTGTGCCC CTGACTTTCAAATAGAGTTCTCTAGCCTAGACCTCCACCCTGAGCCCTACATCTGCATATTCAACTGTT AACTTGGCATTTCCATTTGAATGTCACACAAGCAATTGAAACACAACAGGTCCCAAACAGAACTCATTA TCTTTTTCATTCTATTTGTCTGTTTCTGTTCCAATGTTTTCTCTACCATTGCAATCCATCCAGTTGCTCAA GCTAGATCTGTGGGTGTCATCTTTGAATCACTCCACACTTGGTATTCGATCAGTCGCCAAGTTTTATTG ATTCTACCCCCTAAATATTTCTCTCCATGTTCACTGTTACTGCCCACTATCACTTCTTGCCTGGAATACT GCAAGAGCTTTCTGTCTGGTCTCCCTGCCTCCAATCTTGTTTACTTCCAAATGCCACTCCAATCTGCA GCCAGAGTGATCAAAAAATGAAAAATTGAACAAGTCAGGCCCATCTTCAAAACACTTCAGCAAATTGTA ATAGCCTTTAGGGAGAAGTGCAAAATCAGACAATGGCTTACAAGGCTTCTCATATTTAGACTCATCTCT CCCCCTTCTCTCTACCACTCTCCTCATTACTCATGTATTAGACTTCTTTCAGTTCACACTGAACAATTTC TCACATCATAGCCTTCAACCATGCTGTTTCCTCTGCCTGGGACACTCTTTTCTTGAATTTTTATGCGGC TGATTCTTATTTCTCCTCTAGATCTCACTGCTTCAGGGAGGCTTTCCTAATAAATTAAAGATAGCCATG GTCTTAATCTGTTGGGGCTTATAACAAAGTACCACAGACTAGGCAGCTTATAAAGAACAGAAATGTATT TCTAACAGTTCTGGAAGCTGGGAAGTCCAAGATCAAGGTGCTGGTAGATTTGGTGTCTAGTGAAGGTT CATTCCTCATAGACAGCACATTCTTGCTGTGTCATGATGGAACAGGACATGATGGAAGGGGCAAGGC AGCTCTTTGGGATCTCCTTTAAAAGGACACTAATCCCATCAATGAGGGCTCCACATCCCTGGAAGACC CCCCAGTCCTAACCGTATCACCTGTGGTTAGGATTTCAATAAATGAATTTTGGGGCTTGGGGACACAA ACATTCGGACCATAGCAGTAGTTAATAAGATAATCCATCTCATTCTCCTGATTCTGGCTCCAAACTTAC CTAGGAACCTCTTTGTAACAATAACAGGCTTGCCTGATTATATTTTTCTTTATCAGAGAGACTATGACAT TATTTACATCTTATAACAAAAAAGAAAATTTTAAACCCCGATATTCTGATTTATGCATCATTCTGGGTAA GCTGATTTAGAAAAAACACCTTCACCTTGTCTCTCCCTAACTGTATAAATCACAACTGGAAATGATGTT CCCTCCCTCACCACTTTTATGTCATTTAGCTCATACTATGCCTGCCCTTCTTCCATACCTCAAAACATT GCATACATCTCATCTCCTCTATTAACAAGCAGATACATGAGCCTTCTACATTTCTGTGTAAATAGAATG TGTAGGTGCTCGATGAGTATTTGTTAACTGTAGTAAAACACATGAAATAATGAAATGACAGATCTAACC ATGTTGATTCTATTTCCTACCTCTCTATCGCATGTGTTCTTCCTTTTCTAACACTATTGCCACTGCTGCC AGACTTTGATGATTCTCTCTGGATTACTGCAACAGCATCTTACTGGTACACAGTCCCTCTAATGCTACA TTTTCCTCCTCAAGGTCAGTGTCCTTAAAACACTTCAACAAGTTTCTATTTACCTCAGCATAACAAACAC ATTCATTAAAATGCTTCCAAGGACCTTGATGATCTGGCCCCTGCTGACCTCTCAAGTCCTTGTCTCTCT CCCCTGCCCCTGTTCCTATCCTTCAGTCACACTGGGTCTACTTGCTGTCTCTTCTGTGCTCTGGTCTTT AATAACCCACATTATTGCACATTCCACTGGATCCACCTGGAACAACCCTGCACCCCCCCGCCCCTACA TAATTTCCAAACATACTTTAAGACACAGTTCTAGAGACAATTCTGGAAAGCCTTCCTTGACCCTGCCTC ACGTCACCCAGGCTGCCTTCTCGTCTCACTTTCTTAGCATCTGCTGCTAACTTCTATCACAGAACTTAC CATATTCGTCCATCTTTCTGTTCACGTCCTCACTCCTTCTAACAGACAAAACTAAACCATGAACTCTTAA ATGGTAGGGACCACATCTGTCCTGCTTACAATTGCGTCTCCAGGACATAGTATAATGCCCAGTATATA CCAGGTGCTCAAGACACATTTGATGAATGAATGCTTTAGGGTGCTAGTGCTCTAGGCAAGGGATGGG CAGTTCCCAGAATATTGGAATAGAACATATCCAAATGTGAGGTCCTTGGACAATAAATAAGCAACCAAA CTAGGCACCATCTAATAAGTCAAAAACTTTTATTACTTGCCCTCCCAACACAGTGGAGTCAGGAGACA GGAAAAAGACCACACATTTTATGTTCCTAGTGGTAAAAAATAAAAATAAAAATAGCCACAGCAGCAATA ACAATCATTTATTAACTGCTTACTTTGGGCTCAGGCACTATAGTACATACCCTATGTAGATTATCTCATT TAAAATTCACAGTGATTCTATGAGGTAGGTACTATTAATTTTTTGCAGATGAGAACTTTAATGCTCAGG GTGGTTCGATATGTTTCCCATGGACCGCACAACTAGTAAATGGTAGAGCTTTGGTTCAATACCATTTC TGTCTGGCTTAAAACCCCAGGCACTTAACTGCTGCCCTGTATTGTCCAGAAAAGAGTTAAACTTTAAAA CACAAAAACAGAAAGACGGTCATGCACAAACACAACACTGCTGAGGATGCCTGTAAGGAAAATCCAG AGCATAAGTTCCTCAACTTGTCTCCTTCCTGCCACTTCCTTTAAATCTGAATGAAAGAAGCCTCTAAGG AGATAAACTGGAGAGGTCAATGTACCATTGCTTTTCTAACATTTGAGACTCTGAAAATTTACTGGACAG TTTCCATTTAGGTTGTTTTTTCTATTTTTTGCTAACATCAGCTGCAGGCTTTTGTAGCAATATGGAGGG GGAACACTGGCCACAGGGATGGAGGAACTTGCCTGAGTCCTCCTGGGGACTGAGCCCCAGATGTGG ATGAGAGGAGCAGGGGTAGCAAGAGAAACTTAGAGTATTAAGCTGTTCTTTCAAAGTGAGTGCTCTCC TACCTGCACCTTAAATAAGCCTTGGCCTGGCAGGGACACTGCAGTCAAATCTCAATCTCTCTCTCTCT

TTCAATCCCCCCTCCCCGAATTTTCTTAAGAAGATTCTCAGCATGGACCATCTCTTCAGCGATACTGT TGAGTGTGAGGGTGGGCACATATTTTAATTCTTCTTACCCATGCCTCGTCCTTCATATTCAACTCCTAT CTTCCTTGACTGTTTTAATTTTCCACTTTCCTTTATAATTTCTCACTTTCACATGCCAGTAATATACCAGA GATTAGGTATTTATGCTGTCACTTGGGCTACAGGATTTATTGTAGTAGAATGCATTTGGATGTAGGGG AGAATGTGAAACAATTGTAGTCACCCAGGAGAAAGGTGACCAGAATTCTAAACAAAGATTTGATTCTG AAAAAGGAGACTGAGAAAGTGCAGCAAAGGCCTTTTTTGGAAATCTTGTTTCCATATTCTATGTTGCTT ATGTTTCATATGCTATCACAATCACAATTTAAAAACATGCAAAAAAAAATTAAGATGCTCTTAATTGAGA ATAGTTGCTATTCAGACTATTGACAGAGAAATATAGATGCATGTGAAATCCTGCTGCAACAGATGATAT TAACCATCTTATGTTAGATACTGGCAGAAGTGAGTCTAGTTTGATAGGGGCCCTCAGCTGTGGATTAG

CCATCTTTGTGTTTGTCTCTCTAAAGAGATGGTATTTTAATAGTATTTGTTATAATAAGAATTGTCCTGA AGCAATCAAAATGTATCTAGTGTTCCTGGGATTGTGCTTTATGGTCTATGCCTTCATTATGATCATTCAT TTATTAATGTGCTAAAAGGGGAATACTTTGCCATTAACAGAAGAAAATGGCAAAAAAGGGTTGTGACAT TGGGCAAGCAGGCCTTTAATGGAGATGGGAAAGCATCAAATATCCTCCTTTCATTTGTCAGAGATAAA TTCATTTTCAAATATATACCACTTCACTCTATTCAAAGGTACTGAAATAGGGCATTTCTTACAGGCCATT

TTGAACACTAATTGCATTTAAATATTGGGGACGAAATCATTTAACCTGAACTGTATTTGTAGACAATTTT AAAACACATTTCCTCTCAAGAAAAAATGTAAAAAGAAAAATATGTCTAACGAATTTTTAAATGTATTAGG GATGAATACTGAAAGCAGGAATCATAACCAGAAAGAGAAATCTAAAAAGATGGAAAGAAGATAGAATT AAATCTCAAATAGCTGAATTATTGGGCTTAGAAGTTGCTATTTCAGAAAGATCCATTCAGCACAAAATG CTAATAATTACAGTATATGTCTGCCTGCTCATGGTTCTGTGGCTACCTGTGACCAGTCATCATTCATAT

ACAGACAGAAGTCAGATTCTACTTTGCTCTCTTGGCTGTCTTAAGCAAATTACTGGCAAAGTATGAATG CAGAGACTACAAATGACTGGAAGAAGAGGTGAGTGGGGAATGATAACAAGTCAGATGAGGATAAGAT AATCATAAGAAAAGAGAAGAGAAAACATGGCAACATTTTCCACTCTTAAAAATGTCTCCACCAACCTGG ACTTTATTCCTAGGTTTAAATTAATAGATACAATGAATATATATCAAAAAGGCTTTAAAATGTACATGAC CTTTGATCCAGAAATTCTACTTTAGGAATACCTCAGGTAAATTAATAAAGATGTGGTCCAAAACAGAGT

TGTAATGAAGTTCGTTGCAGCATGATTTGTTATAGCAAAACATTGGAAACAACTTAAAAGTATATACAA AAGGATTTATTAAATTATGGCATGTCTATAAGATGGAATATTTTGCTGCCACTAAAATTATGATTTCTAT TTTTATTGGCATAGAATATGATCATTATTGTTGAGAAAAAGGATTATAAAACGACCCACAGTATGATCC CTTAAAAGTATACATAGAAAGATGCCTGAAGAACATACAGCATTACCAGTAATTGCCTCTAAATGGTTT TTATTATGGGTGCTTTTTATCTTTTTTTTTTCTCCTTTTCCTTTTTCTTGTTTTCATTCTTTTTTCTTGTTTC

TATGCTAAGATATTTCTGCCATGAATATACATTGGTTTTATTAACATAAAATTGTTAGGCAGGTCACCCA AGATGGCCGTTCCTCCAGGACCCAAGATGGCAGCACCAACCCCTTCTCCCCCCACCCCCGCCCCCC GCCCGCTTGGAATCTCCCACCAGATTTTCCTGCTGGACGGGCACTTTCAGATGACTGCAGCCCCGAG AAGTCGAAACCTATCCCAGAAAACCGAAACTTACTAAGCCCCTCCCCGCGTGCTCTATAAAAACCCTC TACTGCCCCAGTCGGGCGCGACTTCCCTGGCCCTCCTTGTTAGGACCAGTGAACCTCGCCCGAGAG

CTCCATTAATAAAGCAGGTCGCCTCTGACCATTAGTCACCTAAATTCTGTGCGGTAGTTCTCATTGGAT ACCTGTCTTCCCAAGCCGGACATTGGTGCCAAAACCCGGGAGGAGACCCCTCTCTGACCCAGGGTC GGGGAGCATCTCCTCTCCCTACCTGCCAGGAACCAGACTCGGGCCAGCGCATTCGGCCTTTGCTATT GGGTAAGTCTCCCCTCCGTCCTGTAGGCCCCGGGAACCTCTGTCTGTAATCGCGGCCACTCAGAGTC TTCCCCCCATCAGTTTCCGACTACGGGACCGAGGACGCGGAGACGTCCGTCCTCCTCGGCCTCCGC

CATCCGCGCTTCAAGGAAGGTTGGGGGATGCCCCTCCCTGACCTTGAATCGCCCGCCTCAGGACAAT GGGAGGTGCCCAATCCAAAATTGATCCTAAGACACCCCTGGGGTGTCTCCTAGCCAACTTTGAAGCT CTAGGCCTCAGTATGGACCTTAAGCGGAAGCGACTCATTTTCTTTTGCTTGGTCGCTTGGCCGCAATA CAAATTGGACAACCAATCTCGGTGGCCGCCGGAAGGAACTTTCGATTTCCAAATTTTACAGGACCTAG ACAACCTTTGCAGAAGACAAGGCAAATGGTCAGAGGTCCCTTATGTACAAGCCTTTTGGGACCTACGC

TCTCGTCCTGACCTATGTGCCAAGTGTTCCCTTGGACAGGTGTTACTGGCTAAGGCATCCCCCTCTAA CAAAGAACCTGATTCCTCCCCTCTCTCCGAGCCTCCTGAAGCCCTCGCTTTACCACCATTGCCAGCG GCGCTCCCTCCTCCCTATCCAGGATCCTCTGGCCCCACCCCAACGGCTCCTCCGCTACCTCCTACAC CACCTTCCTCTCCCGCTAACCCTCCCGCTTCTGCTCTGCCACCGCCTTCCCCTGTATCTGCGCACACT CGGTCGAAGACGGACCTCTTGTGTCTGCTCCGTGAAGTTGCCGGTGCGGAAGGCGTGGTCAGGGTC

CATGTTCCCTTTTCTCTTACTGACTTATCTAAAATAGAGAAGCGGCCTGGGTCCTTCTCTGCCAACCCA ACCCTGTATATCAAACAATTTAGGTACCTATGCCAGGCTTATGACCTCACCTGGCGTGACCTACATATT ATCCTAACATCCACTCTGTCCCCAGAGGAGAGGGAGCGAGTCCAGGCGGTGGCTAGGCAACATGCC GACCAAATTCATTTAACTGACCCCGCCATGCCTGTCGGAACCCTAGCAGTACCGGCAGCCGAGCCGG ACTGGGATTACCAAGCTGGTCAGACTGGCCGTCGACGCCGTGACCAAATGGTTCAGTGCCTTCTGGC

AAGCATGCAGGCGGCTTCCAATAAGACGGTCAACTTTGACAAATTACGGGAGATTATTCAAGGGTCTG

ACGAGAACCCAGCAGTTTTCCTTAACTGCCTTACTGAGGCCCTCATCCAGTATACC'CGCCTTGATCC CACCTCCCCGGCAGGGGCCACTGTCTTGGCTACTCATGTCATTTCCCAATCAGCGGGAGATATTCGG AAAAAACTAAAAAAGGTGGAGGAAGGCCCTCAAACCCCAATACAGGACCTAGTTAAAATGGCCTTCAG GGTCTATAATTCCAGGGAGGAGACGGCTGAGGCCCAAAGACAGGCAAGGCTAAAGCAGAAGGTACA

GTTCCAGACCCAGGCCTTGGTAGCTGCCCCGCGGCTGGCCGGCTCCGGGAGCCAACCGAAAGGGG GTTCCGGCCACCGAGCGCCACCTGGTGCCTGCTTCAAGTGTGGGAACGAAGGCCACTGGGCCTGAC AATGCCCGTACCCTAAGGAACCGACCCGACCATGCCCTAACTGCCACCAGATGGGACATTGGAAGTC TGAGTGCCCCAGCGTCGGAGCGTCCACAGTGCCTCTACGCTGTGAAAACTCCGAGACGACCGGTGG CGCCTTCCAATTACTCAGCATGGACGACGACTGAAGAGGCCCAGACTCGGGAACCCCCCTCACTCT

TGCCGAGCCCAGGGTAACGCTCCAGGTAGCAGGTAAGTCCATATCTTTTCTCGTGCATATGGGGGC TACCTATTCTGTTTTGCCTTCCTTCGGCGTGTCCAGTTTCCCGTCCCCGGTCACGGTAGTGGGGATT GACGGTACCCCTTCCACCCATCGTCAGACCCCCCCCCCATTGTCTTGCCGGCTGGACGACACTCTC ATCTCCCATTCCTTCCTCATTATCCCTTCCTGTCCCGTCCTGCTCTTCGGAAGGGACTTGCTGTCTAA GTTAGGGGCCTCCATTCGGTTGCACCCCAGCCTCCCCTCCAGTGCAATCTCTTTGCTTCCTCTGCTG GCACTTAGCGATGACACTCCTTCGCCGATCCCATTGCTCCCTGTGCCCGTTGATCCAATAGTATGGG ACATCTCAACCCCCTCCATCGCCCGACACCATGCCCCAATAATGATCAAACTCAAGGACCCTACCA AATTTCCCTCGCGGCCACAATTCCCCATCTCAGTTGAACACCGCCAAGGGTTAAAACCTATCATCAC

CAGGCTCTTGCAACAACACATCCTTATCCCGGTAAACTCCCGTTGCAACACGCCCATTCTGCCCATC CGTAAGGCCTCTGGTGCGTACCGTTTAGTGCAAGATCTTCGCATCATCAACGAGGCTGTCGTCCCC ATTTTTCCTGTAGTGCCTAACCCATACACTCTCCTATCCCGCATTCCTCCGACCACCACCCATTTCAC GGTCCTTGACCTCAAAGATGATTTCTTCACTATCCCCCTCCACCCTGACTGTTACTTCCTGTTCGCTT TCACCTGGGAAGACCCTGACACCCATGTCTCCTCGCAATTTGCCTGGACCGTTCTCCCGCAAGGCT

TCCGAGACAGCCCTCACCTCTTTGGACAGGCTCTAGCTAAAGACCTCAGTACATGCACTTTGGCCG ACAGCACCCTTCTCCTGTATGTTGATGACCTTCTCCTTTGCAGTCCTTCCCTGTCTGTCTCGCAGCAA GATACAGCCACAATCCTTAATTTCTTAGGAAAACAAGGGTATCGAGTTACCCCTCACAAAGTTCAGC TCTGCACCCCGACAGTCACATACCTAGGCATTTCTCTCACCGCCACCACCAAAAGCCTCACCACAG ACCGAGTTAGCCTCATTAAAGACCTCCAACTTCCCCAGGACGCAGATAAGATCCTCTCCTTCGTAG

GGCTAGTAGGGTTCTTCCGGCACTGGATCCCAAACTTCGGGGTCTTAGCTAAGCCCCTGTACCAGG CGGCGAAAGAAACACCCACCAGCCCTCTGTCTGATCCCGCCCTAGTGGCCCGCCATTTCCACCGG CTGCAGCAGTGCTTACTCACAGCTCCAGTTGTATCCCTGCCGAACCCCCTGCGGCCTTTTCATCTCT ACACAGATGAACTGCAGGGAGTTGCTACTGGCCTACTAGGGCAACCGGTAGGACCCACCTATCAG GTGGTGGCTTACCTTTCCAGGCAGCTTGATCCCAGCACTCGGGGCTGGCAGCCCTGCCTGCGGGC

CTTAGCAGCGGCGGCAGAGCTTACCAAAGAGGCCCTCAAACTTACTCTCAGTCACCCACTCACAGT ATACTCCCCGCACCGCTTGACAGATGTACTCTCTCACAAATGTCTGGCCCATCTGGCGCCCTCCAG AATACAGCTGTTTCATGTGCTCTTTGTCGAAAACCCAGATATCACCCTGACCGCCTCACCACCTCTT AACCCTGCTACACTTCTTCCCATAGAAGCCTCTGAGCCCCCTCCTGTCCTGTCGCATTCTTGTCCCG AACTCCTTACCTCTAACCCCAACTCCCGACTTGGCCTCTTCGATCGACCGCTTTCTAATCCTGACAG

CACTCTGTTTGTCGATGGCAGCTCAGTCCTCACCCCTTGCGGTAGGCGACAGGCAGCTTACGCCGT AGTCACCCACGACAAAACAGTGGAGGCGGCAGCCCTACCCCTTGGGACCACTTCGCAGAAGGCTG AACTCCTTGCTCTTACCAGGGCTCTACTCCTCTCTCAGGGACAGCGGGTCAACATTTACACTGACTC CAAGTATGCGTATTCTCATTGCACACACGCATTCTGTTCTCTGGCAGGAGCGAGGTTTCCTTACTAT GAAAGGGACTTCAATCGTCAACGGGCCTCTTATCCATAAACCCTTAAATGCCTTACAGGCGCCCCG

AGAGGTGGCGATCATACACTGCAAAAGTCACCAGCACTCAAAAGACCCTGTTGCTCAAGGAAATAA TCTAGCCGACTCTACTGCTAAGTCTCTTGCTCTTACTTCTGCCCCTGCCCCAGCTCCCGCAATGTTC CTGTCCGGTTCACGCACCCCTGCCTATTCTCCACAGGAGACCTTCCACCTCATTTCCAACTTAAAAG GAATGACCGACCAAGACGGTTGAATCTGGGTCGATAACCGGATTGCCCTCCCCGAATCCCAGGCTC AGGCTATTATTACCGATGTGCACAAGACCCTACTCATAGGCCCAAAACTCTTACATCAGTTCTTAGAAC

CAATTTTTCTATGCCCCGGCCTACAGTCCCTCATTCACCAGGTACACCAAACCTGTGCTGTCTGTTCA ACAGTCAACACACAAGGAGGACTTAGGCGCCCAGGGCCCCATCACCAGCTCCGCGGGCATCAGCCA GGAGAGGACTGGCAGCTAGATTTCACCCACATGCCGCGGCACAAGCATTACCGCTACCTTCTTACTC TTGTAGATACCTTCACAGGCTGGATTGAGGCCTTTCCCACTGCACGTGAGACAGGAGAAGTCGCAGT CTCTGTCCTGCTAGAACATATCATCCCTCGCTTTGGACTTCCCCGATCCCTGCAATCAGACAACGGCC

CCGCGTTCGTCTCAAAAATCACTCAGCAAGTATCCGAGTCGCTCCGCGTCACATGGAAGCTCCATATC CCTTACCGCCCTCAATCCTCTGGTAAAGTAGAAAGGGCTAACAGCCTCCTCAAAGAACACCTTACAAA ACTTACTCTTGAAACAAAGCTGTCGTGGGTCACCCTCCTACCATTGGCCCTGACCCGCCTCCGGGCA GCTCCCAGGGGCCCCACAGGGCTCAGCCCCTTCGAACTTCTCTACGGACGCCCCTTCCTACTTCCTG GTCTTCCCCCCACTGTTTCGCCCCCTCCCCTCGCGTCCTATCTTCCTTATCTGACCCTCCTTCGCGAC

CTTCTCCGCAAGCACGCGGACGCCTGCCTCCCCGAACCTACCCCCTCCTCCCCGGACGCCCCTGTT GTGCTCTCTCCAGGTGATAGTGTCCTCCTTAAGGAACTACAGTCCAAGACCTTGACCCCGCGGTGGT CAGGCCCTTACACCGTGATCCTCACCACTCCGAGGGCCACTAAGTTACTAGGTCTACCATCCTGGTAT CATTTGTCACAGTTGaagaaagcaccgactcagcacgactggtcctcaaaactcaccccaacccggcttcgtatcacccatggccagac cttccccactatgcctcctactcctcctgaccctcctaacccccatagtgcccagtaactccctcctaactgaacccccgttccgatggaggttctacctgc atgagacttggacccaaggcaaccggctctccactgtcacactggcaacggtggactgccaacctcacggttgtcaggcccaagtaacttttaacttc acttcctttaaaagtgttctgcggggctggtccaatcccaccatctgctttgtctatgatcaaacacacagcaactgccgcgactattgggtggacacaa acggaggatgcccctatgcctattgtcgtatgcatgtgacccagctccataccgccaagaaactccaacacacctatcgcctgacatctgatggaagg acaacttacttcctgaccatcccagacccatgggattctcggtgggtcagtggagtcactggtcgactgtaccggtggcccaccgactcctacccagtt ggcaaactccggatattcctgacttatatacgagttatcccccaggttttgtctaatttaaaggaccaagcagacaacattaagcatcaggaagaggtc atcaatactttggtgcagtcccatccgaaggctgacatggtcacctatgatgacaaggctgaggcaggaccgttttcatggataaccctagtccgccac ggggctcgccttgttaatatggcaggcctagttaatctctcccactgtttcctttgcaccgccctcagccaaccaccactagtagctgtacccctacccca ggcttttaacacctctggtaaccacactgcccacccttccggcgtcttctctgagcaggtccctcttttccgagaccccctccagccccagttccccttctgc tacaccactcctaactcatcctggtgcaaccagacctattctggctccctatctaacctctctgcaccggcaggtggctacttctggtgtaacttcaccctta caaaacatcttaatatttcctctaacaataccctttctagaaacttatgcctccccatctctctggtgcctcgactcactctgtacagcgaggctgaactctct tcccttgtcaacccgcctatgcgtcagaagcgggccgttttcccaccgctggtaataggtgtctccttgacctcctcacttgttgcctccgggctgggcaca ggtgctattgtacatttcataagctcttcccaagatctctctattaagctccagatggccatcgaagcctcagccgaatccttag cctctctacagagacagattacgtctgtggccaaggtggccatgcagaaccggagagccctagatctcctcacagccgacaaaggcggaacctgc atgtttctcggggaagagtgctgttattacatcaatgaatcaggcttagtagaaaccagcctcctcacccttgataaaatccgggacggtctccatcgac cctcctcaactcccaactatggaggagggtggtggcaatcccctttaaccacttggattatccctttcataagccccatcctaatcatttgccttttacttctc atagccccctgtgtcctcaagttcatcaaaaaccgcatcagcgaagtctcccgggtgacggtcaaccaaatgttactacacccttactcccgtcttccg aCCTCCGAAGACCACTATGACGACGCCCTCACTCAGCAGGAAGCAGCCAGATGATTACGTCGCCCCT

TTTTCTTACAGTATGAGGTCGGAATGTTAGGCAGGTCACCCAAGATGGCTGTTCCCCCAGGACCCAA GATGGCGGCACGAACCCCTTCTTCCCCGCCCCCCCCACCGCTTGGAGTCTCCCACCAGATTTTCCCG CCCGACGGGCACTTTCCGATGACAGCAGCCCCGAGAAGTCGAAACCTATCCCAGAAAACCGAAACTT ACTAAGCCCCTCCCCACACGCTCTATAAAAACCCTCTACTGCCCCAGTCGGGTGCGACTTCCCTGGC CCTCCTTGTTAGGACCAGTGAACCTCGCCCGAGAGCTCCATTAATAAAGCAGGTCGCCTCTGACCATT

AGTTACCTAAATTCTGTGCGGCACTTCTCATTGGATACCTGTCTTCCCAAGCCGGACAAAAATGAATAA AACAAAATTTGTTTTCGAATGGTTTAGTTGCCAAGGCAACACTAGTTCCAGAAACTCAGAATGCCCCTT TGTATGATTATGTGCAAGTACATACCTCCGTTGAGCCTCAGTTTACTCATTTGTGATATGGAATAAAAG CACCTATTTTACAAGGTTGCTGAGAGGATTCGATAAGACCAAGTGCGTCAAAGTGGCTGGCACAATGC TCAGCATATTGATGAGTTCAGTAAACACCGAGTCTACAACTGAATAATAGGTCAATAATCTGTATTTCA

CATGAGCATCAATAAACTAGAAGATTTGTATATTCTATTATTTAGATAGTGAGGGAAATCTGTTCTTCAA ACATAAACAAGGTAGGTTCCAACATGGGGTATAGCGAGGCTACTCTTACTCTGTGTCTTGAGACTTTG TGGAATGTGAAGATTTGGAAGGGCGTGGCCAGACAAGCTAAGATTAATCCAAGCACCTACTTCACCA GCAGACACCAGAGCCCACGACCTCCCTCATATGAGTGCAAAGACAGAGTAGTACAACAACACATGGT TTGCTCATTCCTTGTTAAAATGGAAAATGTCAACTAAAAATAATTTTCTTTAAATACTACCATTAACAAAA

CCCAAGAGTTTTGAGCAAACAGATGTTTAAAAAGAAACTTATTTTCTAAAGTGTAACTGGGACAATGTA ACCAGCCAAATTGCTATATATTCAGTTGCCAAGACACTGATATTGGCAAGTTCTATATTGCTCTCTATT GGTAGATGGAAGAAACTCCAGATAATGAATGAAGAGCAAATGGCACTTCTGAACTAGAGCAGAGTGG TTTCCTTAGTCATTTAACAAATATTTATAGAGCATGTAAATATTTGGAATGCTCTGGTAGGCACTAATGG CAATGGGATTAGGACCCCTGCCCTCAAGGAATTTCACATGAGAAAGGTGAATTAAAGTAGATTAGCTA

TCAAGAAACCTCAGTTCCATTTAATGTTCTGTTTAAGAGTGACTTGCATATGTCACACAACAACGCAGT GCCTTGGTTTCTCAATTTTTAAAATATGGAAAACTATATTGCTTTTCTTGAGGACTAAATATATGAAGAA TTTGAAATTGTTTCAAGCTTTTGCTGGAAAAAGCTTTTTTTGGAAAATACTGAGATTTTTTTTCCAGGCA ATATTATAAGAAAATGCAGTATTTTCCTTTATCCTTGTTTCTTCCTTGAGAAGTCTTAGAAATTACCAAC AACAGCAACAACAACAACAACAACAACAACAACAACAACAAATGCTCCAATTTTTAAATCGGTTAATCT

TCATTTGAAGGGTTTTTTCTTCTCTTTATTTTTTCATTTTACAGTCTGTTCATCTTTAGCCCTCATGTGTA TATTTAAATACATCATTGTGGAATTGCAAATGTGTAGTTTGTTTATTTCTCTTTGCTCCCAAATTGCTCC CCAATCCAGTTTATTTTTCAAAAGCAATTTAAAGGTGCATCTTTCAGTGGGTTAATCTAGGCAATCTGTT TGTTGGTTCTGTTCTCTCAACTGTTGAGTAATAGTTATTGGATTATTCAAAAGGGAGAGAGTTGGCTTA TTTCAAATAACATGGGCAAGATTCTCGTTTCACATGGTTGTGCCAGTGCACCTGACAACCCACCAGCA

ACACATTCCTTTCTCCATACTCTGGCATCTCTTGGCTACCCTCCACTGAGCCAGGTCCAACAGACTTC ATTGATGACTCAGTGAAGAACATAAACATATATTTGGCTAAAAACAGGGGTGAAATTCATCTTTTAAAA TTTTAAGTAAGGTCCAAATTGTAGTTTACAAAAATAAAAGTCTAATATTTTAGTTCATGTATTCATAATTC CATATGGTGGCCAACAGGTCCAACATACTGTGACTTCCACCTCCCTGACTGTCCTTAACTTGGATTAC TCTCTCGCTTGCCCATTACGCTTAAGTCACACTGTCTTTCTGTTTCTGGAACACACCAAGCTCATTTCC

TCTCCAGGGCCTTTGCTCATTACACTTGTTCCCTTTTCCTGGAATGGTCTCCTCTTCTTCCTCAAATTA CCCCCTATGCCCCATTATC

AATTTAACACCTACTTATCCTACAGCTCTTAGCCCAAACGTCATTTTCTCTGGAAGGACTTTCCTGACT TTCCAGATCAAGTTCTCCTCTTACATTTTTATGAACTGGAAGAAAGCCAGTGTAGCTTCAGCATATGAT ACAAGAGTGGCAGTGGTGCAAATACCTGACACTGGGTGATTTATAAAGAAAAGAGGCTTAACTGACTC

ACAGTTCAGCATGGCTGGGGAGGCATCAGGAAGCTTACAATCATGGTGGAAGGCACCTCTTCACGGG GTGGCAGGAGAGAGAATGAGAATTGAGTGAAGGGGGAAACCTTTTATAAAACCATCAGATCTCATGA CAACTCACTCACTATCATGAGAACTCACTCAGTATCATGAGAACAGTTTGGGGGAAACTGCCTCCTTG ATTCAATTATCTCCACCTGGTCCTGCACTTGACACGTGGGGATTATTACAGTTAAAGGTGAAAATGGG TGGGGACACAGAGACAAACCATATCAGAGAGATAGGCAGGAGACAGACCAAGCAGGGCCTTGTAGA

ACTAGGTGACACTTTAGTTAGTAATAGTGTAGGAACAGTGGAAAGCCATTCAAGAGAGTGATCATATTT GTGTTTTGAAAAGGTCACTGTGTCTACTCTATGGAGAATCTGCTTAAATATGGGAAATGGGGGGTACA AAAGGAAACCAGTTAGGAGGCCATTTGCGGTAGTCTAGGGAGGAGAAAATGGAGACTTGGACCAGG GTGGTGACCATGGAGGTAGGGTGAAGTTAGTAAATGCCAGACATATTCACAAAGTAAATTAATAAATC TTAATGGATTAGATTTGGAGAGTGAAGGAGAAGGTGGTGTCCAAGATGATACCCTGTCCTGGGTTGG

GCAGTTAGATGGATGGTAGAAGAGTAGCTCTTAAAGGTATGTGACCGTGTGTGGTGGGGGTAGGGTG GGAAGTTGGAGAGGACAGTGGTAATGCTGTGGGCTGGCTCTAGATTTTAGTTTTAAACTAAAGTTTGT AAAGTGCTTAGTAGAATGCTTTATTATACTATTACAGCGTCATAATAATTATAGCTTATACTTACTGAAC ATGTACTTGTGCCAGGCACTGTTTTACATGCTGCACATATATTAAGTCACTTAGACATCAATAAATGAT AATGTTTATGATTCCATAATTATCATTATCATTATTGCAATATATAGTGCCTGTCTTTCTGGACAGAGTT

AGATAACACAAGCAATTTCTTTCTAGCCAATTCTCCTTTTTATAGACTTCATGCAGGCAACTACCACAG AGTATAGGCACATTCTTCAGATAAGTTAACAATGCAATTGATGAGATTATACCTTTATTTAGATCTTTTC TAACCCTGAGGGACCGGGCATTTCCCAGGTGTGTAACTCATCTAAAAGTCTGTACTCAGAGTGGGCT ATTTTAGTCTGACTGTTGGTTTCTATTATCTTCATTCTTATAAAGTGATTATATCTGACATTACCCTGAAA TAATTTTTTGTGGCTATTTACTAAAGCCACATATGTACTGACTAGAGTATTCTTGCCCAATCTAGGACAA AGAGCTTGATGGGGTTAAAAATTAAATCTCAACTTTTTGGAAAATCCACTCAACTGAGACCAAACTGGC AGTATTTTTATTTTATTTTATTTTTTTAAATTCAGTTTTATAAACTGAAGGCAGAAAGCCTCTTAGAGCTG TCCTCTGACCTACATGCTGAGAAGTCAGGGGCATCAAAATGCTTATGTATAGCTCATTTGGGGGGAAC

TTGCAAACTAGCTGGACTAGTTTATTCTGATGAAATTATCAAGGTCTGAGAAGTTTACACAGGTATTCT GGAAATTGATTCAAATTGGCAGGTTACATGTTGATATCGCTTTAAATCATTAGCACTGCCTTTGCCTTA TTTGGGAATAGATCTGTATTTGTCTGTTAAGAAAGGAATTAAAAAAGAGACAATGTTGTTTTTATTGTGC AAGATAACATCGTCATCAGCTATTCATTGCACTGAACAAGCAACAGTGTGTCTTCCTCTTTCACCTCGA TTTTAGGTGGAAACACTTAGGCAAACAAACAAACAAACAAAAAGTGGCATTAGAGATGGTCTTCCAATT

TTCTTGGAGACATTAAACATGGAAGCATAAATTACCGTAAAGGCTTGTGACCACTTCATTTGGTTTCAA AATCTATTGATGTGATCCCAGAACTTTAAATGTTGTCAAGGGTAAGGAAACAGAAAAGTAGGCATGAC TAAAATAACTAACACACTGAAGTGATAAGTGAGATTTGAGATGCAGTACAGTCCATGGAGTTCAGCTC AGGCTCACTAGGCACATTCACCCCCCGTTTATAAAACAATCAGGAAAAACCTCCTGTAAATGAGGGAC TGCCAAAGAAGACACTTGTTGGGATTTCTATGCAAGGAAAGCTCCTCGATTCACAGAGGAGAAGATGA

TACAGGAGGCTGAGTAACTATAG

Sequences Chromosome 3:

Whole virus incl LTR + 5 kb start and end: Whole sequence here:

>ref|NT_005612.15|Hs3_5769:19233270-19252428 Homo sapiens chromosome 3 genomic contig, reference assembly Coordinates: chr 3: 1 14225814-1 14234972 Whole virus sequence inc. LTR:

Start: TGTAGGGGTGGGTTGCCCCTACACACCT end: CACAGTAACAATCTGATCTCTCTTGCTTTTCCCCA (shown as underlined) >ref|NT_005612.15|Hs3_5769:19238270-19247428 Homo sapiens chromosome 3 genomic contig, reference assembly Coordinates: chr3: 114225814-1 14234972

GAG_103883 (shown in bold letters)

>ref|NT_005612.15|Hs3_5769:19244243-19246595 Homo sapiens chromosome 3 genomic contig, reference assembly Coordinates: chr3:114231787-114234139

ENV_103887_103885 (shown in small letters)

>ref|NT_005612.15|Hs3_5769:19239186-19243732 Homo sapiens chromosome 3 genomic contig, reference assembly Coordinates: chr3:114226730-114231276

G: rs7650656 coordinate: chr3: 114237277

SEQ ID NO.2:

CAGCGCACGGCTGAGCCTTGGTCTTTCATCTCTCCAGCCAAGCCCTGGGTTAGCACAGCTGGTTCAA TGAAGGAATGCGAAGCCAGAGGCCCTACAAGCTACACCAGCAAAGTGCTGGGACCGCTCGACCCCT ACGTGCCCCGCGCCCCTTCCCAGCGTCCCCCGGGCCGGGAAGTCCCGGTACCACCCCCGCCCACA TGCGCCGGCTGGGCCTGGCGGCCTCCCCCGGAAACGTTCCCCCATCCTCGCCCGGCGCCTCACTCA CCAAGGGCCGCGCCGGGGTTCTGCACTGTCACTGCGCTGCGGTTCCCCGCCTTAGGGATTCTCACA

CGGTTCCACGGCTCCAGGCCCGGCGGCACCGCAGCCATCATGCGAGGCGGGGGGACTTACGAAAG GCGGAGCTACGCGAGAGCACGTCCAGCGACCGGAGGTGGGGCGATGGGACCCAGTCCGGGCCGG AAGGGAGCAGGGGGTGGGGCTCGGGCGGGGCCAGGAGCCCGGCGGGAGGCTGCCTTCATCGAGT AAACGCGTGGGACTGGGAAGGACCCAGTCATCTGTATATTGGTTACCAACACGTGGCCGCGTAGAAT CATGGGGGAAAAAAGGCCCCATCCCAATACTAACCAACAGAATCTCTGAGAATGCGATGAGGAATCT GCGTTTTGTTTAAACTTAGCGCAGGGGATTCGGAAGCACAACCAAGTTTGGAACTGTTAAATACTTCT AGGCATTTTACAAATATGGAAAATGAGGCCCAGAATTGAGTTGGTGCTTTTACCCCCAACTCTGCCTC AGACATTAGGGGAAAAAGGAAGAAATGAAATGAAGAGGTTTGTGCAAGGTGTGGAATTTGTAGCGAA GAAGCAGTGATTTGCTTTGAGTGGTAAAGGAAGGCTCCTTTATGTCTTGAACCACAGCAAAACCGAGA

TCACATCAAAGAAACTTGGAAGACACCTGTCAGTCATTCCCACTTTTGTCAGTCTCCAAGACAAGATCA TATTCCAAGCTCTAGTGATCCTTACCTCATTAATATCTTTCTAATAATTCATTTATCCTCAGCCATGCTA ATGCCCCCTTAAGTTCTTAACACTCCCACAGTAACGTATTAGAAAAACAGTGAGTTTTGGAAACAGACT GCCAAGGTTCTAGTTCTAGCTTTGCTGTTTACTAGCTCGGTGATCTCAGGAAATTTACTTACCTCCTCC TCCAGACCTTAGTATCCCTGTGGGTAAAATGAAGATGATAATAATAGTATCAATCTCACAGACTTGTAA

AATGCCAAGGCACTCCTGGCATACAAACAATGAACATTTACCATAGTTAATATTGTTGATGTTATTACT ACTATTTCATGCAAGCAGTCTTACTTTATTGAAACACTTTCCATGCTCTTTCTGTGCGCCTTTACACATC TACCTACTCTACCTGGGTCATCCTCGGAAACACAATCTCCTTTCCTCAGCTCTGGGGTCGTCACTTGG GGTAATTCTTCCTAAACACCCCGTCCTCACTCCATAACTTGATACAGAGGCCCCTTTAATGTGTTACCA CAGTGCCCTATGTTGGCCTATGTATTAGTTTTCTATTGCTGCTGTAACCAATTACGACAAACCTAATGG

CTTGAAATAAGTAGAAGTTATTTTACATTTCTGGAGGTCAGAAGTCCAAAATTAATTTCAATGGACTGA AGTTGGCAGGGCTGGTTCCTTCCGGAATCTCTAGGGAAGAATTCATTTCCTTTCCTTTTCCAGCTTCTA GAGGCTGCCTTCATTCCTTGGCTCATTTCACTATCCTCCACCTTCATTGTCAGCATGACATTTTTCAGT CTCCTCCTCTTCCTCTGTCTCTCTCACCCTCCTGCCTGCCTCCCTCTTAAAAACACCCTTGTGATTACA TTGAGCCCATCAAGATAATCAGGATAGTCACTCCATCTCAGAATCTTTAACTTAATCACATCTGTTTTA

GAACTCCAAATTCAGGCTCATGTACCCGATGGGCAGCTGATGCCAAATATTGAGATACTGGTGCTTGG AGACAGAGAAATATTTATTCGATTTGACCAAAGTTAGAGGGCAAGAGAGCAAGATCTCTCAGATCCAC AGTAACAAAAAAGAAGCAGGGAGTTTTTATGGAGCTAGAGAGTAATGGAGAGGGAGTTTCAAGGAAT CCAAGGGAAAAGTCTGTGTTTCTTCCATTTCAGGTAACACCTTGTGCAGCCGTATGTACATGGCAGCT GGTTGCAATGTCCTTCCAGGAATTCATTCCTTCTGCAAACTATTCTTATGACCCTGAAGTTATCTCCTT

CTGCTTGACAAAGAAACAGTACATCAGCAGTTTATAATTACATTGTGGGAACAAGGAATACTGGGCAA AAAGCGAGTGGTTAACATGTACAAGCAAGCAAGGGCCTGTTCAAAATTTTCATTATTTCATGCACACAC ACACACACACACACACACAAAAATGCTGGGGTGCTGAAATCTCAAGCAGCTGAAATCTCAAGGTTATA TAGCTACAAAATCCCTTCTCAGTGCAAGGTAACATATTTACAGATTATGGAAATTAGCATGTGAACATC TTTGGGTGGGAGGTGGAGGGATCTTTATTCAGCCTACCACAGCCTCTCTCACAGAATTTACCTCGCTT

TATTGTATTTCTTTGTTTACTTTCATGTCTATTTCTCCAATGGCATATGAACCTACTGAAAGCGAGAACT ACCATTGACATAGCTAACTGGTCTTTCTATCTCAATGCTTAGTTCAGAGCCTGGCATATAGTAGGGCCT CAGTAGATATTTACTGGCTGTATATGAGGTTGGATGATGCTTGAATAGAGTCTTTTGAAGGATGAATAG GAACTCCCCAGGCAGTTAAAGGAAAAAGGATATTCCTACAGAGAGGTTTTAAGCAGCATGGGTTTGAA GAATCACTAGTCCTGAGTTGGTACTGCTGGGACGTGATTTGTGCTGAGGGGTGGAGCTGGGAATAGT

GGTGTCAGTCAGATCATGGGAAGAATTTGGCTTTTTACCTGAAGACCAGTAGTTCAGAAACCTGGCTG ATTATCAAAATTGCCTGGATAACTTAAAAATAGAGATTTTCAGGTCCCACTTGAAAATTCTTACTCATTA GTTCTGAGTAGGTCTGTTTTGAAAAGGTCTTTGTGATGGTACTCTAGGTTGACGTGTCCTTGCTATAG GTGATAAAGGAGTCACTCACTGAGTCTTAGGCAGAGCAATTTTTGTCAGCTTGCCTCAGAAGAAGAGC ACCCTGGAGAACAGATTTGGGAGAGAAGAGGTTGGAAGTAAGGAGACCAGGCCCATCTGTTCTATTA

CAAAAGCTAAGGCCAGAAATGATGCAGACCCAAACCTTCAAGCATTTCTACTGGATATAGACAGTATG ACTTATTTAGATGTCTAGCATGGGTGGAGAGTGTCCCTTATCTGAAATGCTTGGGACCAAAATTGTTTC AGATTTCCGGTTTTTTTTAGATTTTGGAATACTTGCAAATATACATGAGATAT CTTGGGTATGGGACCCAAGTATAAACATGAAATGTATGTATGTTTCATATCTACCTTAAACACATGGCC TGAAGAAACTTTTATGTAATATTTTTAATAATTTTGTGCATGAAACAAAGTTTGTGTACATCTCAATCAC

CCATGTGGACAGTCTGTGGTTGTTTGGTGTCAACATCATTCCTGACTCTGAATTTATATGCTACTGTTT TTTTGTTTGTTTGTTTGTTTGTTTGTTTGTTTTTTGAGATAGAGTCTCACTCTGTTGCCCAGGCTGGAGT GCAGTGGCACGATCCCGGCTCACTGCAAGCTCCACCTCACAAGATCACACTATTCTCCTGTCTCAGC CTCCCGAGTAGCTGGGACTACAGGTGCCCACCACCATGTCTGGCTAATGTTTTTTTGTATTTTTAGTA GAGACGGGGTTTCACTGTGTTAGCCAGGATAGTCTCGATCTGCTGACCTTGTGATCTGCCCGCCTTG

GCCTCCCAAAGTGCTGGGATTACAGGTGTGAGCCACCGCACCCAGCCTATATGCTGCTGTTAAGCAA CCATTTTTTTCTCTTATTCACACATATGTGCTTAATAGTAAAAAAAATGATATACCATTAATACAGTGAAA ATTAATGTGTTCAGGGTAACTTGTATCATCATGTCAGTACTCAAAAAGTTTGGCATTTTGGAGCACTTC AGATTTTGGATTTTCAGTTTAAAGATGCTCAACCTATTTACATATTTACATGTCTAGAATGATGATATGG TTTGGGTCTGTGTCCCTACCCAAATCTCATGTTGAATTATAACCCCCAATGTTGGAGGAGGGGCCTTG

TGGGATGCAATTGGATAGTAGGGGCAGAAATCTCCCTTGCTGTTCTCATGATAGTGAGTTCTCAGGAC ATCTGGTTGTTTAAAAGTGTGTAGCACCTCCCTCTTTGCTCGCTTGCTCTCCTTCTCTGGCCATGTAAG ATGTGCCTGCTTCCCCTTCACCTTCCTCCATGATTGTAAGTTTCCTGAGGCTTCCCCAGTTGTGCTTC CTGTACAGCCTGCAGAATTGTGAGTCAATTAAACTTCTTTTATTTATAAATTACCCAATCTCAGGTAGTT CTTTATAATAATGTGAGAATGGACTAATACAAATGACTTCCAGATTTTCACCTTAAGTTCGAAATATGAC

ATTCAGAAGAAAAATAGATTTAGGGAGGTGGCAAGGGTGATAAGATAACTTTCGATATACTGAGTTTG AGATTGTCCATGGCTATCCACGAGAAAATGTGCAGTTCACCAGTTGAATAAATGGGACTATAGCTCAA AAGTGATTGCAAAGGGTTGAAGTAGAGACAATGAATATAAAACAATATTTTTAGTAGCTTAGATAGGAG GGAAAATGGAGTTTATTGGTGACAGAGAGATGCAGGATCAAGAAGAGTATTGTTTTGTTTTGTTCTGAT TTTAAGGATAGTTTACTAGTCAGGATTCCACCAGCCTGTAGGGGTGGGTTGCCCCTACACACCTGTG GGTGTTTCTCGTAAGGTGGGACGAGAGATTTGGAAAAGAAAAAGACACAGAGACAAAGTATAGAGAA AGAAATAAGGGGACCCGGGGAACCAGCGTTCAGCATATGGAGGATCCCGCCAGCCTCTGAGTTCCC TTAGTATTTATTGATCATCTGTGGGTGTTTCTCGAAGAGGGGGATGTGTCAGGGTCACAAGACAATTG

TGGGGAGAGGGTCAGCAGACAAACACGTGAACAAAGGTCTTTGCATCATAGACAATGTAAAGGATTA AGTGCTGTGCTTTTAGATATGCATACACATAAACATCTCAATGCTTTACAAAGCAGTATTGCTGCCCGC AGGTCCCACCTCCAGCCGTAAGGCGGTTTTTCCCTATCTCAGTAGATGGAGCATACAATCGGGTTTTA TACCGAGACATTCCATTGCCCAGGGACAGGCAGGAGACAGATGCCTTCCTCTTGTCTCAACTGCAAG AGGCATTCCTTCCTCTTTTACTAATCCTCCTCAGCACAGACCCTTTACGGGTGTCGGGCTGGGGGAC

GGTCAGGTCTTTCCCTTCCCACGAGGCCATATTTCAGACTATCACATGGGGAGAAACCTTGGACAATA CCTGGCTTTCCTAGGCAGAGGTCCCTGCGGCCTTCCGCAGTTTTTGTGTCCCTGGGTACTTGAGATT AGGGAGTGGTGATGACTCTTAAGGAGCATGCTGCCTTCAAGCATCTGTTTAACAAAGCACATCTTGCA CCGCCCTTAATCCATTTAACTCTGAGTTGACACAGCACATGTTTCAGAGAGCACGGGGTTGGGGGTA AGGTCACAGAATCTCAAGGCAGAAGAATTTTTCTTAGTACATAACAAAATGGAGTCTCCTATGTCTACT

TCTTTCTacacagacacagtaacaatctgatctctcttgcttttccccacatttcccccttttcttttcgacaaaaccaccgtcgtcatcatggcccgttct cgatggtcgctgcctcttcggagctgttgggtacacctgcagactaacaactgacaaaacaggcacacaaggattaatatgaaatttataatcgtagta cttccaatggtcttaacccaagtgacagggttaagatttgcgaggccaacagcaactcctgcaattgcctcagttcctggcaccaaatttaaatgggcttt agatgcttcgaaaatttgttcttttaatttggaaatgtctaaagtgagattatcttctcttccctgtagatggcgtctaaccatgtcccagtgatgctcagactca ttataaatttggggtgtaatacaaaaatctgacgtattccagtcacactgtaactggaaaagatgttctaagctcatgagtctgtctcccatccaaatgac agtttgtctaagatcaattaatttgatttgccaatttttgatcaatactagattgtgaattc cacaatcttgtagaattcttttgccaatcattaacaaagtttactgactgaacagaagagtgcaatgcaactcctgctacagcagccgtagctgtgactg caattaatcccataatcactgcaattaaagtaaaaatgaatcttttggatctatttaaaacaccttttaatacttcagttaaaatatggacggatagtgaggc ctcccacggtcggtccatggacacagggatccacacgccctctcttgctctcaccagcagaatacggtgttgccaattaaaagttgaatcaatgcaag taagcaatctccaattttcacaggttatagtctgggagtctggtttaataactatatttcctacaactagcatataagggggctttacgcaactttgtaaagg aactgttagactggaatttaggtcaacagtataaaatggcttacgatctcttgtttctaaagtttgatttccagaccaaattctaatgtggtgtgaggccaca gtaagcctccataattctggatgttcaggaccagaaacaggacttattatttttggtcttggggtagagattcctttttctccccattcccaagggtagaaag actgcaattttttatgcttatgtttgtctaaactttctgttaagtcgctatcaacagctggactcacttgtgcacttggacacgactgagtttgtcctgagcaattg tggtagaattgacctcgaggtgcccaatctataatagttccgaattcattgttttgtaatatcaccgcactattggccacacattcttcccaaactaaaacttc tgtattttttgattctttgggaatttccttggggcaaggtttccctttaggtctaaattttaatgatctttgataagaaaagtcttgtaaataatttacccgtggccta agtgacatcccgcttaccatgtgataagtgaatctactgatgggactgacagtaggtacttctaccaaccaattttggactgcaggcattaaacatcctg gtgctctccctaggcaaataggaggataacgatacccaatggaaatatttatcatcatcccttcttcctcaggtttggcagggcagcgatcatctgtggg gccaggtacccattcgctatcattaacatatacttctataggattatccatccatgtgactggtgttaccatctccgtggaggcccttttctttgcatctccgat gggttcattgtagaacttcaaatgtctagtgggtatccaaacaggaagctgattttctcctggtgaaacacaagcaaaacctctcccccacgttatcacct tccctatttcccatgtcttatttttattatctttccaccaaattagttttccttcatgtgggctgttctttttaccagtaagatgttgttctgcagaagtagtagtctgattt ctataaatgtttaaaaaatttaaagtatagagtgctagattaagttgcatctgaggagtggtacactccttactgtctcccccttctttttgtttaactaattgagt tttgagtgttctattagttctttcaactatggcctgtccttgggaattataaggaattcctgttgtatgtgaaattttccactgacttaagaatttttggaaagcttta ctacaatatcctggtccattgccagttttgattttttctggaactcccattatagcaaaacaataaatgttttttaacatgggaagtactttctcctgtttggcaag ttgcccatatgaaatgtgaataagtatcaactgttacatgaacatatgataatcttccaaatgaaggtacatgcgtgacatgcatttgccataatgcattag gacacagacctctgggattaactcctgcctcttgagtgggcaggtgtaagacttgacactgggtgcaatgttgtacaatatcttttgcctgtttccatgtgac atcaaatttgttttttaatcctgctgcatttacatgagtcaaagcatgaagttcttgtgcttttatgagtgcagatgataccagtaagtcagcttcttcatttgcttt agtcaaaggccctggtaaattagtgtgtgctcgaatatgagtaatataaaatgggaaatttctttttcttacagtttgttgtaataaattgaatagctggtttaa ctgatcatccatgctatatttaattagagctgtctcaacatcccttgtagcctgtactacatatgcagaatctgatataatattgataggttggtcaaaatcttg taacactgtaatgactgcaaccaactctgctctttgagctgattgatatggagttttgattactcgttctttcggccctgtgtaagctgcttttccattgctggaa ccatcagtaaatactgttagagcattttctaaaggttcacgtctggtaattttaggtagaatccaagtagtcagttttaagaactggaagatctttgtttttggg taatgattatcaataattcccacaaaattagcaagaccaatctgccatgcaccagaattgataaaggcttgtctaacttgttccttggttaaagggacaac tattttgtctgggtcatttccacataattttattattcgtaatcttgtctgaccgattaatgtagctatttgatccaagtacaatgtaaaagtcttaactgtactgtga ggaaggaatgaccactccacaagatcagtattttgaataatgatgcctgttggagaatgtgcagtggcaaaaatcaaaagttggagtggggctaagg gatctattctatttatttgcgctgactgaattttttcttccactaatttaatttcttttgttgcctctggggttaacattcttttactatttaagtctgagtctcctcttaagat agagaacaaatttgacatggcataagtaggaatgcctagagttggccaaatccaattaatatctcctagtaatttttgaaaatcatttagtgtttttaatgtgt cttttcttatttctattttttgtggcttaatttttctattttctatctgcatccctaaataatgaaaaggagtagaggtttggatcttatcagatgctattgccagtccag cattggcaacctctgcttgcagaaatgtataacagtcaattaatttatctttcgtttctgcagcacataaaatatcatcaatataatgaataatataacagtct gaaaacttttctctaactggttgaagagctcgacctacaaaagtctgacaaatagttggactattaagcattccctgaggtaacactttccactgaaacct ggtggctggttctttattatttatggctggtatagtaaaggcaaatttttcacaatcctgctctgccagagggatggtaaaaaagcaatcctttagatcaatta taattaaaggccaatcttttgggatcatggccggagagggcaacccgggttggagaggccccatgggttgaattacggcgtttacggcccttaagtta gttaacatacgccatttgcctgatttcttctgaattacaaacacaggagaattccaaggcgaggatgaaggctcaatatgacccttttctaactgttcatttg ctaataaatgtaaagcctccagtttttgttttggtagcggacactgatttacccacaccggtttttctgttttccaagttaatggtatgggtttaggaggctctac agtggccgcccctaaaaaggataccctattccttctcttttttgatttattttagcctcaactggaactttaatgccatcttcatttttccctagtccctttcctggta tatatcccatcttggtcatgattttttgactcgtggggctatataatggagcgggcatggtgatttccgcacccccttgttgtaataaatctcgaccccacag attaagaggaatTTAAGTAATCATTGGCTGAACAGTACTTTCTTGATTATCTGGCCCTAAGCAATGTAAAATC

TCCATACTTTGATACACTTCTGAGGCTGTGCCTATGCCGACAAGTCCTGTAACAGCCTTTTGTTTAGG CCAATTTTTTGGCCACTGATTTAAAGCAATGATAGAGACATCTGCTCCAGTGTCTACCAACCCTTCAAA CTGTTTTCCTTGAATAATGGCCTTACACACAGGTCTGTTCTCTGAGACCTGACTTGCCCAATATGCAG CCTTTCCTGTTGGATCAGTGCTTCCAAGCCCTCCTATTCTTTTTATTTCACTATTTCCACCCTTAATATA TGGCAGGAGTAATAATTGAGCAATCCTGTCTCCTGGACTGGCACTCCAAGGAACTGAAGAGCTAATAA CCAATTGAATTTCGCCTTTATAGTCTGAATCAACCACACTAGTATGAATTTGAACTCCTTTTAGATTTAG ACTTGATCTTCCCAAGATTAGTCCTACAGTCCCCTCAGGCAGGGGGCCATATACCCCTGTGGGGATT TTTTGTGGGGGCTCCCCTGGAAGCAGAGAGACTGCTTGTATAGTACATAAATCTACTGCTGCACTG

CCGCTTGTGGGGGGGACAATTGTTGTATTGTGGTAACTGGCTTATTCCCTGAAACACTTGGGACAGT GGGGGTTGTTGTCCCTGAAAACCCTGAGGAACAAATGGCTGAATTGGGAATGCCCCAGTTTGTTGT GGGGCCTGAGGCTGGCCCCTTTGCTCGTTTCCCGACAATGGTTGCCCATTTTTATCAAATTTAGAAC GACATTGACTAGCCCAATGTTTTCCTTTTTTACATCTTGGACATAAGTCAGGTGGCTCTCTACCTGTT GTAGTTGCTTGAATAGTTATATTCTGTTTATTTAAGACTGGGCAATTCTTTTTTAAGTGACCAATTTGA

CCACAATTATAACATTTTCCTCCAAATGTTCTAACTTGTCCTCCTAAAACAACTCCTGTTATTGCTTG AGCCATAAGCATAGCTTTATGCATAGCTCCTCCGATTCCATCACA

GGCTTTTACATATTCTGAGATTACATCTGATCCTGCAGGAACCTTTCCTTTTAATGGCTTAATGGCTG ATTGACACTCAGGATTGGCGTTTTCATATGCCATTAACTCCACTATGACCTTACGGGCTTTTTCATCG GCAATTGACTTTTGAGCAACATCTTGGAGCCTTGCCACAAAATCAGGATAGGGCTCTTTTGAACCTT

GTCTTACTGTATTAAATGAGGGGCAGGTACTTCCTGGGTCTTGGATTTTTTCCCAGGCTCTAAGGCA GATAGCTCTAACTTGCTCAATGGCCTCATTTTGCATTAATGCTTGTTGACTAATAGTACTCCAATTTT GACCTATTCCTAATAGTTGATCTGCATCTATGTTAACTGGAGGATTGGCAGCCCTATTTCTTCGGAC CTGTTCTTGTACCCCATCAATCCACCAAGTCTTAAATTGTAAAAATTGAGAGGGTGAGAGAGACGAT TTTGCCAGAATCTCCCAATCATAAGGAATGAGTTTATGTCCATGAGCAATGGAATCTAATAATGTCC

TCATATAAGGGGAGTTGGGTCCATACTGTTTTACTCCCTCTTTCATATCTTTTAGCATTTTTATCGAAA AAGACTTGTATCTGGCCTCAACTGTGGGAGGCTCTCCCTCTTGGGCTCCTTCTCCAGGTGGCATCG GTTCTAACGTTACTGGGAATTGCCATGCCTCAGTATCTCCTTCCTTTCTTGATTTATCAATAATTTCAT GTAATTCACTACCCCGTCTACTAGGTGGTGCCGTAGGATTAAGTCTCCTAGTGGGTGGCTGAGGGT ATGGCGCCCTGCCCTGTGGTGCTGGGGGCATTCCTGGATATCCATACTGACTTTCTGGGGGTGGCC

GATACTGAAGTTCAGCCGGCGGCCAGTATTGATAGGCTACTGGCGGTTGGGTCTTATTTTCTTTAAC CTGCTTTTGAGGTTGTAATGTTACGGGCACCTGACCTGCTGGAAGATGACTTGTGCCTCGTGGTTTA GACTCTGATGGCCCCACTAATTCTGGACCTTTTCCTTCCAATTTTAACGTTTCAGGATATATCACCTC CTGTAATTGATTATAGTCAACATTTTGCGTTGACTGAGCCATTACCGGCTCTGCTACATATTCGCAAT GTAAACCTTCCGTTTCTTTCTGGGATTTTTTCCTTGTGTTTTCATTACAATCTATTATACAGCTTCCAA

GGGCATCAGAAACTGAAACACTATCTTCTTCTGTTTGAAATGGTTCTAAAGCTGCTTTAATAATGGC CCAATCATTCCATACTGTAAGTGGAATGACATTACCCTTCCTACCTGCTTGTTTTAGTTCCTTACCAA TTCTTTTCCAATCTTTTAGATCTAAAGTTCCTTGTTCTGGAAACCATGGGCAAAATTGTTCTATTATTT GAAATAGCTTGATTAGATTTTTTGTAGATACTTTAACTCCCCCTCTTTTTAAAAGAATTTTAATAAAGC TGAGATAAGAGGCATATTTACTTTTAATTTTACTTTTAGTTTGCCCCATTATCACCCTAGCTTCTTCCG

AGCGCACAAGCTTACCGTAAGGCTGACTGTAGACGTACTCGGGATCTCTCGTCGACTTGTCCTCAA TGACCACGCTCGAGCGTACCTTCACCCTAGAGAAAAGCCTCCACGTTGGGCACCAGATGTAGGGG TGGGTTGCCCCTACACACCTGTGGGTGTTTCTCGTAAGGTGGGACGAGAGATTTGGAAAAGAAAAA GACACAGAGACAAAGTATAGAGAAAGAAATAAGGGGACCCGGGGAACCAGCGTTCAGCATATGGA GGATCCCGCCAGCCTCTGAGTTCCCTTAGTATTTATTGATCATCTGTGGGTGTTTCTCGAAGAGGGGG

ATGTGTCAGGGTCACAAGACAATTGTGGGGAGAGGGTCAGCAGACAAACACGTGAACAAAGGTCTTT GCATCATAGACAATGTAAAGGATTAAGTGCTGTGCTTTTAGATATGCATACACATAAACATCTCAATGC TTTACAAAGCAGTATTGCTGCCCGCAGGTCCCACCTCCAGCCGTAAGGCGGTTTTTCCCTATCTCAGT AGATGGAGCATACAATCGGGTTTTATACCGAGACATTCCATTGCCCAGGGACAGGCAGGAGACAGAT GCCTTCCTCTTGTCTCAACTGCAAGAGGCATTCCTTCCTCTTTTACTAATCCTCCTCAGCACAGACCCT

TTACGGGTGTCGGGCTGGGGGACGGTCAGGTCTTTCCCTTCCCACGAGGCCATATTTCAGACTATCA CATGGGGAGAAACCTTGGACAATACCTGGCTTTCCTAGGCAGAGGTCCCTGCGGCCTTCCGCAGTTT TTGTGTCCCTGGGTACTTGAGATTAGGGAGTGGTGATGACTCTTAAGGAGCATGCTGCCTTCAAGCAT CTGTTTAACAAAGCACATCTTGCACCGCCCTTAATCCATTTAACTCTGAGTTGACACAGCACATGTTTC AGAGAGCACGGGGTTGGGGGTAAGGTCACAGAATCTCAAGGCAGAAGAATTTTTCTTAGTACATAAC

AAAATGGAGTCTCCTATGTCTACTTCTTTCTACACAGACACAGTAACAATCTGATCTCTCTTGCTTTTCC CCACACCAGCCAAAGAGAAACAGTAGAATATGTAAAGGGATTTACAGAAAGAAATTGACTTATACCATT GTAGAGGTCAGATAGGAAAGTCTGAAATTCATAAGGCTGGAAACTCTCAGGCAGGAGCTGAAGAGGA AGTCCGCAGGTGGAATTTCTTCTTTCTTCACATCTTCAGGAAAACCTAAGTTCTATTCTTTAGGCCTTT CAACTGATTGGATCAGGCTCACCCACATTACCCAGAATAAT

CCCCTTTACATAAAATCAACTGGCTGTAGACATTAATCACTTCTACAGAATACCTTCACAGCAACACCT AAGCTAATATTTGATTGAATAACTGGGTGCTACAGCCTAGCCAAGTTGACACATAAAGCTGACCATCA CAGATGGAAAATGACTTGATCAAACATATATATAGGCTAAAGGGAAGAATTCAAAGTGTGAAAGAAGC TGGATATAAAAAAATAGGAGAGAATTGATGGAGAAAGACCCATTACTCATTCAACAAAGTTTCTGAGC GTCAGTTTTTTGCCAGACACCATCCTAGGAACCAGAAGAGACAAGCAGGGATGGAATCAAGTGCTGA

AGTAAAGCAGTTGACTTAAATATCAAAACCTTTTATTATCTGAGCCAGGAAGAAAAATAAAGATAGTAT AGATATAGATCTATTTCGGAAGGAGTGATGGACAGCTTCTGTGTTCTCAATGGAGGAGGATTTGAGAT CATTACCAAGAGTGGAGGAGGGCAGGGAGATGGTGTTCTGGATGAGCAATGGATGTTGAAATCCGAG CTTCCTTGAATCAGGGCACATGGGAAAAGCACAGGCTATGTACATTAGAAGTAAGGTTTTAGGGCCCT ACTGTAAACAAATCTCTAGACTGCAAAAAAAAAAAAAAAAAAAGGCTGTCACAGACAAAAATGACCATT AAATGTAAAACCTTGGCCATCTCATTAGTAATTCATGAAATACAAATTAAAATAATTTTTAGCTTCTATCA AATAGACAAAGAGTAAAAAGCATGGTGTCTGGTGTCACTAGGGCTTTGCACGAAAAATCTAGGTGCAA AGTTATCCTTTGTTGTAATCATAAAAAAGGAAAGTGACATTGTATCCTCACAATAATTCGATTACTTTCT AATATTTTGGCAGTGGAATTTTTTATTCCCCACAAAATCTTATATAGAAACCTACTATGTAAAACAAATA TATAAAAGCAAGATTGCAGTGGTTAAGTATGTATGGGGGAATGCAAGGCCCTCCCATTAAGGCAATTT TGAGGGGCCATTTCCTGAGGTACTTGCCCAAGACATTTCCTAGAACAGTTTGAAACTTGCTGCTGTAA ATAAATATGTATTAATGTGAGCAATTATTAATGATACATTAAGATTTTTTTAAGCAGTTCAGAAAACTGTA TGTCATTCCTTGAAAAAAATACATAGCCACACATTGAGGAAGAGGTCTAGAAGGATCTAAATGAAGGT TATAACAATGGTCATTTTTCTGGCAGTAGGATAGATTTTTTTTTCTTCTATGAGCTTATTTTTTTATATTT TAAAAAAAGAAGTATTGCTGTTGTAATGAGAAAAAATTATGTATTATTTTTATTTATTTATTTAATTATTTT ATTTATTTTACTTTTTTTGAGGTGGAGTCTCACTCTGTCGCCCAGGCTGGAGTGCAGTGACACTGTCT CGGCTCACTGCAACCTCCACTGGGAACAAGTGATTATCCTGCCTCCGCCTTCCAAGTAGTTGGGATTA TAGGCACCCACCGTGGCCAGCTAATTTTTGTGTTTTTAGCAGAGACAGGGTTTCTCGATGTTGGCCAG TCTGGTCGCGAACTCCTGACCTCAGGTGATCCCCCAACCTCAGCCTCCCAAAGTGCTGGGATTACAG GCGTGAGCCACCTCGCCCGGCGAAAAAAATTATTTTTAATGCTAGAATGCTGTGTACCAAGATGTTTG TGTGTGTGCATGCACATGATATGATATGTGTATGCACAATATATTCAGAGATATATCTTTTGGCTTATTC ACCTATGGCCTTTCAGCTCTAATCCCATGCTTCTATATTTGCTCTGTGATGCTGGAACTGGGACTCTG CAAACTACTTGGCTAGCTGGTAGATATACCAATATGGGCCACTAGAGGGAGGTTGAAGGCAAGAGCA GGAGAGAAGATTCTTCTCTGCTCCATTGTCCCTGGCAGTGTTGCCCAACACTGTCTTCACTCCAGGTA ATGGCAGTTGGTTCCAGTCCCTGAATCTTTTTGACACACGCCCAGACCTACCCTCAGAGGTACTAGCA

GCACCGGGATGGTGTTCTGTCCTCAGAGGTCTGGGTCCCAATTCCGTAAGTCCCTTCCTCTAAAAAT CTAAATTCTGATAACCCCAAATTTCTTTGCCTGGTTTCTCCAGTTCCAGGGATTGTAACTGCTTTCAGC AGTTACCTCTGTGTTACTTCAGTGTTGTATCATCTTTTCATCTTAGTTCTTAAACATTCATTTAACTAATT CCTTATATTTACCTTAAATTCTTTCTGGTGGCCGGGCGCGGTGGCTCATACCTGTAATCCCAGCACTT TGGGAGGCTGAAGTGGGTGGATCACTTGAGGCCAGGAGTTCGAGACCAGCCTGACCCACATGGTGA AACCCCCTCTCTACTAAAAATGCAAAAAAATTAGCCAGGCGTGTTGGCGCATGCTTGTAATCCCAGCT ACTTGGGAGGCTGAGGCAGGAGAATCCTTGAACCTGGGAGGCAGAGGTTGCAGTGAGCCGAGATTG CACCCTTGCACTCCAGCCTGGGCAACAAGAGTGAAACTCCATCTCGAAAAAGAAAATTCTTTCTGGTA AAATATATAACATGGTATTATTTTGTTTTACTAATGGACTTTGACTGATATGATATTTGGAACCAGAAGT GGTCCCAGGAAACGGCCCCTCTAAATGAAATTCTGTGGTTGGTTTGGCCATGTCCTTAGCTTTAAACA CAGTAGTGATGGGGAAATTGGGTATTAGAAATCCTTGGTGTGCTGCAGCATCATACTTAGTCACCTGA AGCTGACTGTGAGGAAGTGCCCTCTGAAGCCCACTGACTCCACGACTGTTACAGTAGCAGTGATGCT TCTGAGTGCACTGGAAAGCCTACAGAAAGTGACACACTTAGGTATTTAACACAGCTCAAGTCACAGAG AATCAGGGAGCGTCTATGCTGGCCCTAAAATAATCAGTTATTTCTTATAGTTTCATAGCTGACCTTGAC CCAAAATTCAGTTCTGTGGGTTGCAGAATTACAACCTAAACTGAATTCATAGACTCACAAATCTCATCT GTGAAAGTTAGAGCATTGATTGGCAGCAAGAAGGACTCTGAGCCTCGGAATTAGTTGAACTCAGGAA AAGCTGAGAATCTTGGAGCAGTCTGCCTTCCTGTGTCTGAGGAGACTTGTATGAAGACCCTATGATAA CCTCAAGACCCACCAAACCACTTCTCATCACTTCTAGAGCTATAACTAAAATCAGATCTCAGTTA

GCTCCAGGGGGACAAGTACAAAGTCTAATATGGAAAGAAATAGTTTAGATTTCAAAATAGTTGCAAAAT GTTGCTAATTTTTAGTGACAGAAACTGAAGTAGTGTTGGATTTTAACGTTATTAGACCATAGAGGATGG AATATCAAGCACTGGACTAAACCAAATGTATCAATATGAGTCATCATATCAGTTTCTAGAGAGTCTTGC AGCGAGAAGTGTATCTAACAGTTTTCTTTGATGATTGAAAATTGAATCCAGCTATAACCTACATTCAAC GAGGTTAAGATGCCAGAATTTCCCTGGATTAATGTAAAAGGAGGGATCCAAAGACTTAGGAAAATTGG AATGTTGGAATGGATATATAATCTGTGGTCTGCACATCCACCCCACCCCGACTGTGTCTTCTGAGAGA GCTCAGAGGTCACACCCTCCACTAAGGCCTTGAGAAATACATTAATGAGGTGCTATCAGTTTCTTTAC AAAGTTCTGCAATGGCTGTCTTCTGTAGGTCAGAGTGATGATAGAAGATACCATCATTGAAATTGGCC CCTTGATTTCAATGGGATCCCAGAATGGTAAAGACCAATGAGCAATGATTAATTACAAGAGACAGTTG ATGCATTTACTATAATGGACAATAGGAACAAAATGGTAACCAGATTGTTTTGACTAGCAAGGAACTTTA GTGGAGGCTAATTGATCACAGTGTCTGTAGGAATTAAATATATCGCAGCCTATGAAAATATTACTTCAT CGATACAAAAGGAACCAGGAACTTGATTTGAGCACCAAACTGGAGAGACATGGCTTCTTACTTAGTTT CCAGATTTAGACAAGTTCAACAATATAGAGTCTCTTGATGGACAGGAAATTCAGGACAAGGATGTTCA TCACTGTCATTTACAGTAACAAAAATGTGAACACATATAAATACTGTTGGGCTTCAAAGTGTGGGACCC TAGAAATTGAGAAAACCACAGAAGCAAGGTCATTCTCTCATATTCTCCCACCGTTCTGCAAGACAGCC AGCCATAAAAGAATTATCTGACCTACCTCCCCTGAAAGTAGGCCATAAGACATCACAACACAGGTGTC CTGCTCTGTATCTAGAGGAAATAAAGGAAGACATAAAGAAGAATCTGAACAAACAGGCCTTGCTAAGT TCTCCCCCACAATCCCTGTTTATTATCATTAGGTCATACTCTCCTTTGTCTAGTCATGTTTCTCCACAAC TATCCACTTCTTTTATCGGACTTACCATAAAAATACAGTTTTCCCTCGGTTTTTGGGTCATCATTTTTGA AGGGTTCCATGTCATGTAAAATTTTGGTTAAATCTAAATTTTATATGTTTCCTTTGTTAATCCATCTTTTG TTCCGGGGTGTCAGTCATGAACCTTGCAATGGGTGAGGAAAAGATATTGCCTTTTCTCTCCTACAATA TCCATGTTTCAGTTATCTGTTGCTGGCTAAAAATCAA

Claims

1. A method for estimating the disease risk of an individual of having or developing multiple sclerosis comprising

NO: 1 , or a part thereof; region t on human chromosome 6 comprising HERV-H corresponding to SEQ ID NO: 5, or a part thereof, and/or in a region complementary to SEQ ID NO: 5, or a part thereof, or in a transcription product from a sequence in a region corresponding to SEQ ID NO: 5, or a part thereof, and/or translation product from a sequence in a region corresponding to SEQ ID NO: 5, or a part thereof; region u on human chromosome 16 comprising HERV-K13 corresponding to SEQ ID NO: 3, or a part thereof, and/or in a region complementary to SEQ ID NO: 3, or a part thereof, and/or in a transcription product from a sequence in a region corresponding to SEQ ID NO: 3, or a part thereof, and/or translation product from a sequence in a region corresponding to SEQ ID NO: 3, or a part thereof; and region v on human chromosome 19, comprising HERV-K [int2] corresponding to SEQ ID NO: 7, or a part thereof, and/or in a region complementary to SEQ ID NO: 7, or a part thereof, and/or in a transcription product from a sequence in a region corresponding to SEQ ID NO:7, or a part thereof, and/or translation product from a sequence in a region corresponding to SEQ ID

2. The method according to claim 1 , wherein said one or more sequence polymorphisms are in region r on human chromosome X comprising HERV-F(c)1 corresponding to SEQ ID NO: 1 , or a part thereof, and/or in a region complementary to SEQ ID NO: 1 , or a part thereof, and/or in a transcription product from a sequence in a region corresponding to

SEQ ID NO: 1 , or a part thereof, and/or translation product from a sequence in a region corresponding to SEQ ID NO: 1 , or a part thereof.

3. The method according to claim 1 , wherein said one or more sequence polymorphisms are in region r on human chromosome X comprising HERV-F(c)1 corresponding to SEQ ID NO: 9, or a part thereof, and/or in a region complementary to SEQ ID NO: 9, or a part thereof, and/or in a transcription product from a sequence in a region corresponding to

SEQ ID NO: 9, or a part thereof, and/or translation product from a sequence in a region corresponding to SEQ ID NO: 9, or a part thereof.

4. The method according to any of the preceding claims, wherein the method comprises assessing region r and a further sequence polymorphism on human chromosome 3 -in a region comprising HERV-K corresponding to SEQ ID NO:2, or a part thereof, or in a region complementary to SEQ ID NO: 2, or a part thereof, or in a transcription product from a sequence in a region corresponding to SEQ ID NO: 2, or a part thereof, or or translation product from a sequence in a region corresponding to SEQ ID NO: 2, or a part thereof.

5. The method according to any of the preceding claims, wherein said one or more sequence polymorphisms in region r on human chromosome X is rs400586, rs391745, and/or rs318138, or any combination thereof.

6. The method according to any of the preceding claims, wherein said one or more sequence polymorphisms in region r on human chromosome X on chromosome 3 is rs391745.

7. The method according to any of the preceding claims, wherein said one or more sequence polymorphisms in region s on human chromosome 3 on is rs7650656.

8. The method according to any of the preceding claims, wherein said one or more sequence polymorphisms in region r on chromosome X is rs391745 and sequence polymorphism in region s on chromosome 3 is rs7650656.

9. The method according to claim 1 , wherein said one or more sequence polymorphisms are in region t on human chromosome 6 comprising HERV-H corresponding to SEQ ID NO: 5, or a part thereof, and/or in a region complementary to SEQ ID NO: 5, or a part thereof, or in a transcription product from a sequence in a region corresponding to

NO: 5, or a part thereof.

10. The method according to claim 1 , wherein said one or more sequence polymorphisms are in region t on human chromosome 6 comprising HERV-H corresponding to SEQ ID NO: 6, or a part thereof, and/or in a region complementary to SEQ ID NO: 6, or a part thereof, or in a transcription product from a sequence in a region corresponding to SEQ ID NO: 6, or a part thereof, and/or translation product from a sequence in a region corresponding to SEQ ID NO: 6, or a part thereof.

1 1. The method according to claims 1 , 9 and 10, wherein said one or more sequence polymorphisms in region t on human chromosome 6 is rs1929772, rs9394742, and/or rs12196881 , or any combination thereof.

12. The method according to claims 1 , 9 and 10 wherein said one or more sequence polymorphisms in region t on human chromosome 6 is rs1929772.

13. The method according to claim 1 , wherein said one or more sequence polymorphisms are in region u on human chromosome 16 comprising HERV-K13 corresponding to SEQ ID NO: 3, or a part thereof, and/or in a region complementary to SEQ ID NO: 3, or a part thereof, and/or in a transcription product from a sequence in a region corresponding to

NO: 3, or a part thereof.

14. The method according to claim 1 , wherein said one or more sequence polymorphisms are in region u on human chromosome 16 comprising HERV-K13 corresponding to SEQ ID NO: 4, or a part thereof, and/or in a region complementary to SEQ ID NO: 4, or a part thereof, and/or in a transcription product from a sequence in a region corresponding to SEQ ID NO: 4, or a part thereof, and/or translation product from a sequence in a region corresponding to SEQ ID NO: 4, or a part thereof.

15. The method according to claims 1 , 13 and 14 wherein said one or more sequence polymorphisms in region u on human chromosome 16 is rs12934809.

16. The method according to claim 1 , wherein said one or more sequence polymorphisms are in region v on human chromosome 19, comprising HERV-K [int2] corresponding to SEQ ID NO: 7, or a part thereof, and/or in a region complementary to SEQ ID NO: 7, or a part thereof, and/or in a transcription product from a sequence in a region corresponding to

SEQ ID NO:7, or a part thereof, and/or translation product from a sequence in a region corresponding to SEQ ID

NO: 7, or a part thereof;

17. The method according to claim 1 , wherein said one or more sequence polymorphisms are in region v on human chromosome 19, comprising HERV-K [int2] corresponding to SEQ ID NO: 8, or a part thereof, and/or in a region complementary to SEQ ID NO: 8, or a part thereof, and/or in a transcription product from a sequence in a region corresponding to

NO: 8, or a part thereof;

18. The method according to claims 1 , 16 and 17, wherein said one or more sequence polymorphisms in region v on human chromosome 19 is rs2396212 or rs1 1882251 , or both.

19. The method according to claims 1 , 16 and 17, wherein said one or more sequence polymorphisms in region v on human chromosome 19 is rs2396212.

20. The method according to claim 1 , wherein said sample comprising genetic material is a blood sample, a tissue sample, a sample of secretion, semen, ovum, a washing of a body surface, such as a buccal swap, a clipping of a body surface, including hairs and nails.

21. The method according to any of the preceding claims, wherein the sequence polymorphism comprises at least one mutation base change.

22. The method according to any of the preceding claims, wherein the sequence polymorphism comprises at least two base changes.

23. The method according to any of the preceding claims, wherein the sequence polymorphism comprises at least one single nucleotide polymorphism.

24. The method according to any of the preceding claims, wherein the sequence polymorphism comprises at least two single nucleotide polymorphisms.

25. The method according to any of the preceding claims, wherein the sequence polymorphism comprises at least one tandem repeat polymorphism.

26. The method according to any of the preceding claims, wherein the sequence polymorphism comprises at least two tandem repeat polymorphisms.

27. The method according to any of the preceding claims, wherein the sequence polymorphism comprises at least one deletion polymorphism.

28. The method according to any of the preceding claims, wherein the sequence polymorphism comprises at least one insertion polymorphism.

29. The method according to any of the preceding claims, wherein the sequence polymorphism comprises at least one dinucleotide polymorphism.

30. The method according to any of the preceding claims, wherein the assessment is conducted by means of at least one nucleic acid primer or probe, such as a primer or probe of DNA, RNA or a nucleic acid analogue such as peptide nucleic acid (PNA) or locked nucleic acid (LNA).

31. A method for estimating the prognosis for multiple sclerosis of an individual comprising

in a sample comprising genetic material from said individual assessing one or more sequence polymorphisms in genetic regions selected from the group of genetic regions consisting of region r on human chromosome X comprising HERV-F(c)1 corresponding to SEQ ID NO: 1 , or a part thereof, and/or in a region complementary to SEQ ID NO: 1 , or a part thereof, and/or in a transcription product from a sequence in a region corresponding to SEQ ID NO: 1 , or a part thereof, and/or translation product from a sequence in a region corresponding to SEQ ID NO: 1 , or a part thereof; region t on human chromosome 6 comprising HERV-H corresponding to SEQ ID NO: 5, or a part thereof, and/or in a region complementary to SEQ ID NO: 5, or a part thereof, or in a transcription product from a sequence in a region corresponding to SEQ ID NO: 5, or a part thereof, and/or translation product from a sequence in a region corresponding to SEQ ID NO: 5, or a part thereof; region u on human chromosome 16 comprising HERV-K13 corresponding to SEQ ID NO: 3, or a part thereof, and/or in a region complementary to SEQ ID NO: 3, or a part thereof, and/or in a transcription product from a sequence in a region corresponding to

SEQ ID NO: 3, or a part thereof, and/or translation product from a sequence in a region corresponding to SEQ ID NO: 3, or a part thereof; and region v on human chromosome 19, comprising HERV-K [int2] corresponding to SEQ ID NO: 7, or a part thereof, and/or in a region complementary to SEQ ID NO: 7, or a part thereof, and/or in a transcription product from a sequence in a region corresponding to SEQ ID NO:7, or a part thereof, and/or translation product from a sequence in a region corresponding to SEQ ID NO: 7, or a part thereof; obtaining a sequence polymorphism response,

32. The method according to claim 31 , wherein said one or more sequence polymorphisms are as defined in any of claims 2-30.

33. A method for estimating a treatment response of an individual suffering or at risk of suffering from multiple sclerosis to a disease treatment, comprising in a sample comprising genetic material from said individual assessing one or more sequence polymorphisms in genetic regions selected from the group of genetic regions consisting of region r on human chromosome X comprising HERV-F(c)1 corresponding to SEQ ID NO: 1 , or a part thereof, and/or in a region complementary to SEQ ID NO: 1 , or a part thereof, and/or in a transcription product from a sequence in a region corresponding to SEQ ID NO: 1 , or a part thereof, and/or translation product from a sequence in a region corresponding to SEQ ID NO: 1 , or a part thereof; region t on human chromosome 6 comprising HERV-H corresponding to SEQ ID NO: 5, or a part thereof, and/or in a region complementary to SEQ ID NO: 5, or a part thereof, or in a transcription product from a sequence in a region corresponding to SEQ ID NO: 5, or a part thereof, and/or translation product from a sequence in a region corresponding to SEQ ID NO: 5, or a part thereof; region u on human chromosome 16 comprising HERV-K13 corresponding to SEQ ID NO: 3, or a part thereof, and/or in a region complementary to SEQ ID NO: 3, or a part thereof, and/or in a transcription product from a sequence in a region corresponding to

NO: 7, or a part thereof;

- obtaining a sequence polymorphism response,

The method according to claim 33, wherein said one or more sequence polymorphisms are as defined in any of claims 2-30

34. Use of a primer or probe in the methods as defined in any of the preceding claims, said primer or probe being selected from primers or probes that amplifies and/or hybridises to rs391745, rs400586, rs7650656, rs318138, rs1929772, rs9394742, rs12196881 , rs12934809 or rs2396212.

35. The use according to claim 34, wherein said primer or probe is selected from

MS7_rs391745_1 , MS7_rs391745_2, MS7_rs391745_ext, MS7_rs400586_1 , MS7_rs400586_2, MS7_rs400586_ext,MS7_rs318138_1 , MS7_rs318138_2, MS7_rs318138_ext, MS4_rs7650656_1 , MS4_rs7650656_2, MS4_rs7650656_ext, MS7_rs1929772_1 , MS7_rs1929772_2, MS7_rs1929772_ext, MS8_rs9394742_1 , MS8_rs9394742_2, MS8_rs9394742_ext, MS5_rs12196881 _1 , MS5_rs12196881_2, MS5_rs12196881_ext MS7_rs2396212_1 , MS7_rs2396212_2, MS7_rs2396212_ext, MS5_rs12934809_1 , MS5_rs12934809_2 and/or MS5_rs12934809_ext.

36. The use according to claims 34 and 35, wherein the probe is operably linked to at least one label, such as operably linked to two different labels.

37. The use according to claim 36, wherein said label is selected from TEX, TET, TAM, ROX, R6G, ORG, HEX, FLU, FAM, DABSYL, Cy7, Cy5, Cy3, BOFL,

BOF, BO-X, BO-TRX, BO-TMR, JOE, 6JOE, VIC, 6FAM, LCRed640, LCRed705, TAMRA, Biotin, Digoxigenin, DuO-family, Daq-family.

38. The use according to 37, wherein the primer or probe is operably linked to a surface.

39. The use according to claim 38, wherein the surface is the surface of microbeads or a DNA chip.

40. An antibody directed to an epitope of a chromosome X HERV-F(c)1 gene product, a chromosome 3 HERV-K gene product, a chromosome 6, HERV-H gene product, a chromosome 16 HERV-K13 gene product and/or a chromosome 19 HERV-K [int2] gene product, or part thereof.

41. Use of one or more antibodies as defined in claim 40 in any of the methods as defined in any of claims 1-33.

42. Use of a kit for any of the methods as defined in the preceding claims, wherein said kit comprises at least one diagnostic primer and or at least one allele- specific oligonucleotide primer as defined in any of claims 34-39.

43. A method of treatment, amelioration and/or prophylaxis of multiple sclerosis comprising administration in a therapeutically effective amount of at least one anti-retroviral compound to an individual in need thereof.

44. The method of claim 43, wherein said antiretroviral compound is selected from protease inhibitors, inhibitors against RT, inhibitors of IT (integrase enzyme), and or inhibitors of fusion.

45. Anti-retroviral compound for treatment of multiple sclerosis.

46. Use of anti-retroviral compounds for the manufacture of a medicament for multiple sclerosis.

47. A pharmaceutical composition for treating multiple sclerosis comprising anti- retroviral compounds.