WO2010106366A1

WO2010106366A1 - Fk506 and fk520 analogues and their pharmaceutical uses

Info

Publication number: WO2010106366A1
Application number: PCT/GB2010/050458
Authority: WO
Inventors: Steven James Moss; Barrie Wilkinson; Christine Janet Martin; Ursula Elisabeth Schell
Original assignee: Biotica Technology Limited
Priority date: 2009-03-17
Filing date: 2010-03-17
Publication date: 2010-09-23
Also published as: GB0904540D0

Abstract

The present invention relates to novel FK506 and FK520 analogues and strains generated by replacing the natural loading module of the FK506 or FK520 polyketide synthase (PKS) with the avermectin or an avermectin-like PKS loading module and optionally feeding non-natural starter units to these strains and to use of such compounds in therapy.

Description

FK506 AND FK520 ANALOGUES AND THEIR PHARMACEUTICAL USES

Field of the Invention

Background of the invention FK506 (tacrolimus/fujimycin/Prograf) (Schreiber and Crabtree, 1992) and FK520

(ascomycin or immunomycin) (Wu et al., 2000) (Figure 1 ) are lipophilic macrolides produced by a variety of actinomycetes, including Streptomyces tsukubuaensis No. 9993 (Hatanaka et al., 1989), Streptomyces sp. MA8858, Streptomyces sp. MA6548, Streptomyces kanamyceticus KCC S-0433, Streptomyces clavuligerus CKD11 19 (Kim and Park, 2008) which have been shown to produce FK506 (Muramatsu et al., 2005), and Streptomyces hygroscopicus subsp. hygroscopicus (DSM 40822), which is equivalent to Streptomyces hygrosoopicus var ascomyceticus (ATCC 14891 ), producing FK520 (Garrity et a!.. 1993). Other closely related macrolides include FK525 (Hatanaka H, et al., 1989), FK523 (Hatanaka, H., et al., 1988) and antascomicins (Fehr, T., et al., 1996). A number of semisynthetic derivatives of these molecules have also been shown to be of utility, including pimecrolimus (SDZ ASM 981 , Elidel), which is a derivative of FK520 (Meingassner et al., 1997).

FK506, 1 : R₁= -CH=CH₂, R₂ = trans-OH FK520, 2 : R₁= -CH₃, R₂ = trans-OH FK523, 3 : R₁= -H, R₂ = trans-OH Pimecrolimus, 4 : R₁= -CH₃, R₂ = c/s-CI

BIOSYNTHESIS: FK506 and FK520 are synthesised by type I polyketide synthases (PKS). This biosynthesis involves a shikimate derived starter unit, followed by 10 extensions utilising malonyl, or substituted malonyl derivatives, thioesters, and addition of a lysine derived pipecolate group. The structure is then finally completed by O-methylation at C-31 and oxidation at C-9 (Motamedi et al., 1996). FK520 and FK506 differ at the C-21 position.

FK520 has a C-21 ethyl substituent, whereas FK506 has a C-21 allyl substituent.

Meanwhile, the avermectin PKS naturally incorporates branched chain keto acids

(Ikeda et al., 1999), but has been found to additionally incorporate a variety of other non- natural carboxylic acids when fed exogenously to fermentation broths (Dutton et al., 1991 ).

This capability is encoded on the PKS by the loading module, which consists of a section of the PKS including an Acyltransferase domain (AT) and an Acyl Carrier Protein domain (ACP)

(Ikeda et al., 1999).

It has been shown previously, that if the loading module, and optionally the first ketosynthase domain (KS), of the avermectin PKS replaces the natural loading module of another PKS, such as erythromycin, a broad variety of starter acids can be incorporated into the product of this hybrid PKS (Marsden et al., 1998, WO 98/01546).

Other examples of PKS with loading modules with similar specificities to the avermectin PKS include nemadectin (Carter et al., 1988) and milbemycin (Takiguchi et al., 1980; Okazaki et al., 1983). Methods for elucidating the sequence of PKS gene clusters have been published previously, examples include using homologous probes to screen cosmid libraries [e.g. Oliynyk et al., 2003, Fang et al., 2007, Choi et al., 2007 ].

MECHANISM OF ACTION: FK506, FK520 and close analogues suppress the immune system by inhibiting signal transduction pathways required for T-cell activation and growth. In particular, they have been shown to inhibit Ca²⁺-dependent T-cell proliferation, via initial formation of a complex with an FK-binding protein (FKBP), which binds to and blocks calcineurin (CaN). This FK506-FKBP-CaN complex inhibits the activation of nuclear factor of activated t-cells (NF-AT), preventing its entrance into the nucleus, and subsequent activation of the promoter of lnterleukin-2 (IL-2), which initiates IL-2 production. Additionally, FK506 can interfere with the action of calcineurin on substrates other than NFAT, including IKB, Na-K-

ATPase and nitric oxide synthase, which may lead to some of the side-effects (Kapturczak et al., 2004).

Treatment with FK506 also seems to be associated with up-regulation of transforming growth factor beta (TGF-β). This cytokine not only has immunosuppressive properties, but may be associated with the development of allograft fibrosis, which can lead to serious complications after long term treatment with these agents (Kapurtzak et al., 2004). USES: FK506, in particular, is an important immunosuppressant used to aid prevention of organ rejection after transplantation. For example, it is used intravenously and orally for the prevention of organ rejection after allogeneic liver or kidney transplantation and in bone marrow transplantation. It has been shown to have potential utility in a wide variety of autoimmune, inflammatory and respiratory disorders, including Crohn's disease, Behcet syndrome, uveitis, psoriasis, atopic dermatitis, rheumatoid arthritis, nephritic syndrome, aplastic anaemia, biliary cirrhosis, asthma, pulmonary fibrosis, chronic obstructive pulmonary disease (COPD) and celiac disease.

Treatment of many of these disorders is currently limited to patients with severe disease that are either refractory or hypersensitive to standard treatments. This limitation is due to the side effects of administration of FK506, which include renal dysfunction, gastrointestinal effects, neurological effects, hyperthrichosis and gingival hyperplasia.

Chronic treatment with FK506 requires strict therapeutic monitoring due to its narrow therapeutic index and great inter-individual variability which lead to dangers of over (or under) dosing (Roy et al., 2006).

Pimecrolimus and FK506 are both used in topical formulations, such as ointments and creams, as treatments for a variety of skin conditions, in particular atopic dermatitis (Nghiem et al., 2002).

Cytochrome P450 3A4 (Cyp3A4) and Cyp3A5 are the most important contributors to FK506 metabolism while the P-glycoprotein pump (MDR-1 ) modulates its bioavailability (Roy et al., 2006). The complexity of FK506 dosing is therefore enhanced by significant drug-drug interactions (Kapturczak et al., 2004).

The mechanism of toxicity of FK506 and FK520 has been related to the mechanism of action of immunosuppression (F. Dumont et al., 1992). This strong link between the mechanism of action and the toxicity has presented significant challenges to improving the therapeutic index through chemical modification. Segregation of efficacy and toxicity of new analogues may be possible by altering distribution or metabolism (NH Signal et al., 1991 ). By limiting the exposure of the compound to organs that are sensitive to such inhibition, such as the kidney, systemic toxicity can be avoided. Additionally, topical administration of the calcineurin inhibitor at the site of administration (such as skin, lungs, gut, eye etc.) can be maximized. One way this can be achieved is by using a 'soft drug' approach, which involves designing compounds to have limited systemic exposure such as through increased metabolism, higher blood/plasma protein binding, poor absorption or bioavailability.

It has also been suggested that the variable metabolism of FK506 leads to some of the toxicity, due to variable levels of systemic exposure, which led to the need for constant drug monitoring (Armstrong and Oellerich, 2001 ). Therefore, analogues of FK506 with reduced or less variable metabolism could be useful in reducing toxicity, and reducing the need for constant monitoring of drug levels.

FK506 is also poorly bioavailable (Tamura et al., 2003), which leads to variable systemic exposure when dosed orally, and the frequent need for intravenous dosing. Therefore, analogues with improved oral bioavailability would be very useful, to reduce systemic toxicity through incorrect dosing, and improve the ease of oral dosing.

Therefore, there remains a need to identify novel FK506 and FK520 analogues, which may have utility in the maintenance of immunosuppression, both for organ transplantation, and for the treatment of inflammatory conditions, and for the treatment of fungal infections. The present invention discloses novel FK506 and FK520 analogues which have improved pharmaceutical properties compared with the currently available FK506 and FK520 analogues; these properties may be useful for therapies requiring good systemic bioavailability, including, but not limited to oral therapies to maintain immunosuppression, which in particular are expected to show improvements in respect of one or more of the following properties: increased metabolic stability, increased bioavailability, increased oral bioavailability, reduced efflux via membrane transporters and low plasma protein binding; The novel FK506 and FK520 analogues may also be useful for therapies requiring local availability but with poor systemic availability, including, but not limited to topically administered therapies for inflammatory disorders such as atopic dermatitis, asthma and inflammatory bowel diseases, which in particular are expected to show improvements in respect of one or more of the following properties: decreased metabolic stability, decreased bioavailability, decreased oral bioavailability, increased efflux via membrane transporters and high plasma protein binding; Other properties the molecules might be expected to have that are of general use, include improved formulation ability, improved potency, increased FKBP binding, improved toxicological profile, reduced nephrotoxicity and neurotoxicity, improved crystallinity, improved water solubility or improved lipophilicity.

Summary of the Invention In the present invention, the natural loading module from the FK506 or FK520 polyketide synthase is replaced by the loading module from the avermectin or an avermectin- like polyketide synthase, and optionally non-natural starter units are fed to these strains, said strains optionally having been mutated by classical methods or targeted inactivation or deletion of one or more genes responsible for post-PKS modification, and/or mutated by classical methods or targeted inactivation or deletion of one or more precursor supply genes, including bkd genes (Ward et al., 1999) and homologues thereof.

Thus in one aspect of the invention there is provided a compound of formula (I)

wherein

X^a represents bond or CH₂; R₂ represents -CH₃, -CH₂CH₃, Or -CH₂CH=CH₂; R₃ represents H₂ or =0; Ri is selected from the group consisting of

(A) wherein R_4, R₅ and R₆ independently represent F, Cl, CrC₄ alkyl, OR₇, SR₇ or NHR₇ and R₇ represents H, CrC₄ alkyl or CrC₄ acyl, wherein two or three of R₄-Rβ are CrC₄ alkyl;

wherein R₈ and R₉ independently represent H, F, Cl, CrC₄ alkyl, ORi₀, SRi₀ or NHR₁₀ and Rio represents H, CrC₄ alkyl or CrC₄ acyl;

(C) wherein R₁₁ R₁₂ and R₁₃ independently represent H, F, Cl, C₁-C₄ alkyl, OR₁₄, SR₁₄ or NHR₁₄ and R₁₄ represents H, C₁-C₄ alkyl or C₁-C₄ acyl, save that OR₁₄ shall not represent OH;

(D) wherein R₁₅ and R₁₆ independently represent H, F, Cl, C₁-C₄ alkyl, OR₁₇, SR₁₇ or NHR₁₇ and R₁₇ represents H, C₁-C₄ alkyl or C₁-C₄ acyl, save that OR₁₇ shall not represent OH;

(E) wherein R₁₈ and R₁₉ independently represent H, F, Cl, C₁-C₄ alkyl, OR_2O, SR_2O or NHR₂₀ and R₂₀ represents H, C₁-C₄ alkyl or C₁-C₄ acyl;

wherein R₂i represents H, F, Cl, CrC₄ alkyl, OR22, SR22 or NHR22, and R22 represents H, Ci-C₄ alkyl or Ci-C₄ acyl;

wherein R₂3 and R₂₄ independently represent H, F, Cl, CrC₄ alkyl, OR₂5, SR₂5 or NHR₂₅ and R₂₅ represents H, Ci-C₄ alkyl or Ci-C₄ acyl ;

wherein R₃₀ R3₁ and R₃₂ independently represent H, F, Cl, CrC₄ alkyl, OR₃₃, SR₃₃ or

NHR₃₃ and R₃₃ represents H, CrC₄ alkyl or CrC₄ acyl;

(J) wherein R₃₈ R₃g and R₄₀ independently represent H, F, Cl, CrC₄ alkyl, OR₄i, SR₄i or NHR_4I and R₄₁ represents H, d-C₄ alkyl or d-C₄ acyl, save that OR₄₁ shall not represent OH;

wherein R₅₂ R53, R₅₄ and R₅₅ independently represent H, F, Cl, CrC₄ alkyl, OR₅₆, SR₅₆ or NHR₅₆ and R₅₆ represents H, d-C₄ alkyl or d-C₄ acyl, save that OR₅₆ shall not represent OH; and

(L) wherein R₅₇ and R₅₈ independently represent H, F, Cl, d-C₄ alkyl, OR₅₉, SR₅₉ or

NHR₅₉ and R₅₉ represents H, d-C₄ alkyl or d-C₄ acyl; and physiologically functional derivatives thereof.

The above structure shows a representative tautomer and the invention embraces all tautomers of the compounds of formula (I) for example keto compounds where enol compounds are illustrated and vice versa.

The invention embraces all stereoisomers of the compounds defined by structure (I) as shown above.

In a further aspect, the present invention provides FK506 or FK520 analogues such as compounds of formula (I) or a pharmaceutically acceptable salt thereof, for use as a pharmaceutical.

In a further aspect, the present invention provides strains containing hybrid PKS, with a loading module conferring avermectin-like chain initiation, and the rest of the PKS conferring FK506/FK520-like chain processing and termination.

In a further aspect, the present invention provides processes for production of FK506 and FK520 analogues defined by structure (I) above.

Definitions:

The articles "a" and "an" are used herein to refer to one or to more than one (i.e. at least one) of the grammatical objects of the article. By way of example "an analogue" means one analogue or more than one analogue.

As used herein the term "analogue(s)" refers to chemical compounds that are structurally similar to another but which differ slightly in composition (as in the replacement of one atom by another or in the presence or absence of a particular functional group). As used herein the terms "FK506 and FK520 analogues" / "FK506 or FK520 analogues" refer to compounds related to FK506, FK520 and similar compounds in structure.

Such compounds are 22-membered rings with one lactone and one amide bond. The N of the amide bond forms a 2-carboxyl piperidine or a 2-carboxyl pyrrolidine. This carboxyl group forms the lactone group, with an oxygen that is allylic to a double bond that is exo to the main

22-membered ring. Such compounds include, without limitation, FK520, FK506, antascomicin, FK523, FK525, pimecrolimus and tsukubamycin as well as compounds of formula (I). As used herein the term "FK506 or FK520 producing strain" refers to a strain

(natural or recombinant) which is capable of producing one or more FK506 or FK520 analogues when fed appropriately.

As used herein the term "recombinant strain of a FK506 or FK520 producing host" refers to a recombinant strain based on a natural FK506 or FK520 producing strain which is capable of producing one or more FK506 or FK520 analogues when fed appropriately. As used herein the term "FK506 or FK520 cluster" means the PKS and associated enzymes responsible for production of FK506 or FK520 analogues.

As used herein the term "modifying gene(s)" includes the genes required for post- polyketide synthase modifications of the polyketide, for example but without limitation cytochrome P-450 monooxygenases, ferredoxins and SAM-dependent O-methyltransferases.

In the FK520 system these modifying genes include fkbD and fkbM, but a person of skill in the art will appreciate that PKS systems related to FK520 (for example but without limitation:

FK506, antascomicin, FK523, FK525 and tsukubamycin) will have homologues of at least a subset of these genes, some of which are discussed further below. As used herein the term "precursor supply gene(s)" includes the genes required for the supply of the natural or non-natural precursors, the genes required for the synthesis of any naturally or non-naturally incorporated precursors and the genes required for the incorporation of any naturally or non-naturally incorporated precursors. For example but without limitation in the FK506 and FK520 system these genes include fkbL, fkbO and fkbP but a person of skill in the art will appreciate that PKS systems related to FK506 and FK520 (for example but without limitation: antascomicin, FK523, FK525 and tsukubamycin) will have homologues of these genes, some of which are discussed further below. Additionally it may be useful to inactivate homologues of the bkd genes, which are involved in the generation of branched chain keto-acids, such as might be expected to incorporate preferentially into avermectin type loading modules, such as those described in Ward et al. 1999 (e.g. Wei et a/., 2006).

As used herein, the term "auxiliary gene(s)" includes references to modifying genes, precursor supply genes or both modifying genes and precursor supply genes. One example of an auxiliary gene is an oxygenase which may hydroxylate the starter unit.

As used herein the term "basic product" refers to the initial product of the polyketide synthase enzyme before the action of any modifying genes.

As used herein, the term "precursor" includes the natural starter units (i.e. 4,5- dihydroxycyclohex-1-ene carboxylic acid), non-natural starter units (e.g non-cyclic or heterocyclic starter units), and naturally incorporated amino acids (i.e. pipecolic acid) and non-naturally incorporated amino acids As used herein the term "non-natural starter unit" refers to any compounds which can be incorporated as a starter unit in polyketide synthesis that are not the starter unit usually incorporated by that PKS.

The term "avermectin-like PKS" means the PKS of a bacterium producing a avermectin-like polyketide such as nemadectin or milbemycin which contains a loading domain consisting of AT and ACP domain and which naturally incorporates branched chain starter acids such as those of the present invention.

The term "acyl" means an alkyl group in which the first carbon atom is a carbonyl moiety.

Examples of C1-4 acyl groups include C2-4 acyl groups such as -COMe and -COEt, especially COMe. CHO (i.e. C1 acyl) is a further example which is less preferred.

Examples of C1-4 alkyl groups include Me, Et, n-Pr, i-Pr, n-Bu, especially Me.

Detailed Description of the Invention

Physiologically functional derivatives of compounds of formula (I) include physiologically acceptable salts, esters and solvates. Pharmaceutically acceptable salts include the nontoxic acid addition salt forms of the compounds of formula (I). The pharmaceutically acceptable acid addition salts can conveniently be obtained by treating the base form with such appropriate acid. Appropriate acids comprise, for example, inorganic acids such as hydrohalic acids, e.g. hydrochloric or hydrobromic acid, sulphuric, nitric, phosphoric and the like acids; or organic acids such as, for example, acetic, propanoic, hydroxyacetic, lactic, pyruvic, oxalic (i.e. ethanedioic), malonic, succinic (i.e. butanedioic acid), maleic, fumaric, malic (i.e. hydroxylbutanedioic acid), tartaric, citric, methanesulfonic, ethanesulfonic, benzenesulfonic, p-toluenesulfonic, cyclamic, salicylic, p-aminosalicylic, pamoic and the like acids. Conversely said salt forms can be converted by treatment with an appropriate base into the free base form. Example esters include labile esters which are cleaved in the body, for example carboxylic acid esters formed with hydroxyl groups. Example solvates include hydrates.

In one embodiment X^a represents a bond. In another embodiment X^a represents CH₂. Preferably X^a represents CH₂.

In one embodiment R₁ represents [A]. In another embodiment R₁ represents [B]. In another embodiment R₁ represents [C]. In another embodiment R₁ represents [D]. In another embodiment R₁ represents [E]. In another embodiment R₁ represents [F]. In another embodiment R₁ represents [G]. In another embodiment R₁ represents [H]. In another embodiment R₁ represents [J]. In another embodiment R₁ represents [K]. In another embodiment R₁ represents [L]. Preferably R₂ represents -CH₃, -CH₂CH₃, or -CH₂CH=CH₂. More preferably R₂ represents -CH₂CH₃, Or -CH₂CH=CH₂. In one embodiment, R₂ represents -CH₂CH₃. In another embodiment R₂ represents -CH₂CH=CH₂.

Preferably R₃ represents =0 (keto).

Preferably R₄ represents CH₃ or CH₂CH₃. Preferably R₅ represents CH₃ or CH₂CH₃

Preferably R₆ represents H.

Preferably R₇ represents H

Preferably R₈ represents OH, CH₃ or H. Most preferably R₈ represents CH₃

Preferably R₉ represents H. Preferably R₁₀ represents H

Preferably R₁₁ represents H.

Preferably R₁₂ represents H.

Preferably R₁₃ represents H.

Preferably R₁₄ represents H Preferably R₁₅ represents H.

Preferably R₁₆ represents H. Preferably Ri₇ represents H

Preferably Ri₈ represents H.

Preferably Ri₉ represents H.

Preferably R₂o represents H Preferably R₂₁ represents H.

Preferably R₂₂ represents H

Preferably R₂3 represents H.

Preferably R₂₄ represents H.

Preferably R₂5 represents H Preferably R₃₀ represents H

Preferably R3₁ represents H.

Preferably R3₂ represents H.

Preferably R₃₃ represents H.

Preferably R₃₈ represents H. Preferably R₃₉ represents H.

Preferably R₄o represents H.

Preferably R₄₁ represents H.

Preferably R5₂ represents H.

Preferably R₅₃ represents H. Preferably R₅₄ represents H.

Preferably R₅₅ represents H.

Preferably R₅₆ represents H.

Preferably R₅₇ represents H.

Preferably R₅₈ represents H. Preferably R₅₉ represents H.

In one embodiment, Ri represents [A], R₄ represents CH₂CH₃, R₅ represents CH₃, R₆ represents H, R₂ represents -CH₂CH=CH₂, R₃ represents =0, X^a represents CH₂, as shown by the following structure:

In another embodiment, R₁ represents [A], R₄ represents CH₃, R₅ represents CH₃, R₆ represents H, X_b represents CH₂, R₂ represents -CH₂CH=CH₂, R₃ represents =0, X^a represents CH₂, as shown by the following structure:

In another embodiment, R₁ represents [C], R₁₁, R₁₂ and R₁₃ represent H, R₂ represents - CH₂CH=CH₂, R₃ represents =0, X^a represents CH₂, as shown by the following structure:

In another embodiment, R₁ represents [B], R₈ represents CH₃, R₉ represents H, R₂ represents -CH₂CH=CH₂, R3 represents =0, X^a represents CH₂, as shown by the following structure:

In another embodiment, R₁ represents [A], R₄ represents CH₂CH₃, R₅ represents CH₂CH₃, R₆ represents H, R₂ represents -CH₂CH=CH₂, R₃ represents =0, X^a represents CH₂, as shown by the following structure:

In another embodiment, R₁ represents [K], R5₂, R53, R5₄ and R55 represent H, R₂ represents -CH₂CH=CH₂, R3 represents =0, X^a represents CH₂, as shown by the following structure:

In another embodiment, R₁ represents [H], R₃₀, Rs₁ and R₃₂ represent H, R₂ represents -CH₂CH=CH₂, R₃ represents =0, X^a represents CH₂, as shown by the following structure:

In another embodiment, Ri represents [L], R₅₇, and R₅₈ represent H, R₂ represents CH₂CH=CH₂, R₃ represents =0, X^a represents CH₂, as shown by the following structure:

In one embodiment, R₁ represents [A], R₄ represents CH₂CH₃, R₅ represents CH₃, R₆ represents H, R₂ represents -CH₂CH₃, R₃ represents =0, X^a represents CH₂, as shown by the following structure:

In another embodiment, R₁ represents [A], R₄ represents CH₃, R₅ represents CH₃, R₆ represents H, X_b represents CH₂, R₂ represents -CH₂CH₃, R₃ represents =0, X^a represents CH₂, as shown by the following structure:

In another embodiment, R₁ represents [C], R₁₁, R₁₂ and R₁₃ represent H, R₂ represents CH₂CH₃, R₃ represents =0, X^a represents CH₂, as shown by the following structure:

In another embodiment, R₁ represents [B], R₈ represents CH₃, R₉ represents H, R₂ represents CH₂CH₃, R₃ represents =0, X^a represents CH₂, as shown by the following structure:

In another embodiment, R₁ represents [A], R₄ represents CH₂CH₃, R₅ represents CH₂CH₃, R₆ represents H, R₂ represents -CH₂CH₃, R₃ represents =0, X^a represents CH₂, as shown by the following structure:

In another embodiment, Ri represents [K], R₅₂, R53, R5₄ and R₅₅ represent H, R₂ represents -CH₂CH₃, R₃ represents =0, X^a represents CH₂, as shown by the following structure:

In another embodiment, Ri represents [H], R₃₀, R₃i and R₃₂ represent H, R₂ represents -CH₂CH₃, R₃ represents =0, X^a represents CH₂, as shown by the following structure:

In another embodiment, R₁ represents [L], R₅₇, and R₅₈ represent H, R₂ represents CH₂CH₃, R₃ represents =0, X^a represents CH₂, as shown by the following structure:

Compounds of formula (I) may be produced by replacing the natural loading module of the FK506 or FK520 PKS with that of the avermectin or an avermectin-like PKS (such as nemadectin or milbemycin), and feeding an appropriate non-natural starter unit to the resultant strain, culturing the strain and optionally isolating the compounds thereafter. The loading modules of avermectin and avermectin-like PKSs consist of an AT and an ACP domain. In an optional embodiment the strain is mutated to inactivate or delete of one or more genes that contribute to the biosynthesis or regulation of precursor supply. For example the gene(s) that contribute to the biosynthesis or regulation of precursor supply may contribute to the biosynthesis or regulation of branched chain keto acid, such as bkd (Ward et al., 1999). By removal of the means of generation of branched chain keto acids, incorporation of other non-natural starter acids is facilitated due to lack of competition with the preferential substrate of the avermectin loading module. In an alternative embodiment the strain may be mutated to inactivate or delete of one or more genes responsible for biosynthesis of pipecolic acid, such as fkbL (Wu et al., 2000). Pipecolic acid is naturally incorporated into the chain as a final step prior to ring closure. This particular modification increases the yield of prolyl derivatives of formula (I) when proline is fed to the strain. Additionally or instead in an alternative embodiment the strain may be mutated to have targeted inactivation or deletion of one or more genes responsible for post-PKS modification, for example the gene responsible for oxidation at the C-9 position, fkbJ (Motamedi and Shafiee, 1998, Wu et al., 2000). This particular modification increases the yield of C-9 desketo derivatives of formula (I).

If appropriate or necessary compounds so produced may be subject, after their isolation, to synthetic alteration using processes known to a skilled person e.g. alkylation of hydroxyl and amino groups and the like. It should be understood by one skilled in the art that it may be possible to use alternative junctions to join the avermectin loading module to the rapamycin PKS. Examples of this include taking just the Acyltransferase (AT) and Acyl Carrier Protein (ACP) domains from the avermectin PKS and joining to the FK506/FK520 PKS before the first ketosynthase (KS) domain. Alternatively, the junction may be made between the KS from the avermectin PKS and the first extender AT from the FK506/FK520 PKS. Analogous possibilities are discussed in WO 98/01546. Hence the splice junction in the hybrid PKS between the avermectin load and the FK506/FK520 PKS may be before, within or after the KS of the first extension module. Thus part or all of the KS of the first extension domain of the recombinant strain is from the avermectin PKS. The loading module (optionally together with part or all of the KS of the first extension domain) of an avermectin-like PKS may be used in place of the avermectin loading module, such as those loading modules found in the milbemycin PKS or nemadectin PKS.

In one method of generating a suitable strain, a precursor supply gene or genes such as the bkd genes or homologues thereof may be manipulated by targeted inactivation or deletion or modified by other means such as exposing cells to UV radiation and selection of the phenotype indicating that branched chain alpha keto acid biosynthesis has been disrupted. The optional targeting of the post-PKS genes may occur via a variety of mechanisms, e.g. by integration, targeted deletion of a region of the FK506 or FK520 cluster including all or some of the post-PKS genes optionally followed by insertion of gene(s) or other methods of rendering the post-PKS genes or their encoded enzymes non-functional e.g. chemical inhibition, site-directed mutagenesis or mutagenesis of the cell for example by the use of UV radiation.

WO2004/007709 provides methods for the alteration of a gene system which comprises a core portion responsible for the production of a basic product, and a multiplicity of modifying genes responsible for effecting relatively small modifications to the basic product - e.g. effecting oxidation, reduction, alkylation, dealkylation, acylation or cyclisation of the basic product, and a multiplicity of precursor supply genes which are involved in the production of particular precursor compounds. Thus the basic product may be a modular polyketide and the modifying genes may be concerned with modifications of a polyketide chain (such as oxidation at the 9 position), and the precursor supply genes may be involved in the production and/or incorporation of natural or non-natural precursors (e.g. pipecolate and/or 4,5 dihydroxycyclohex-1-ene carboxylic acid).

The core portion may not function properly or even at all in the absence of a precursor supply gene (unless a natural or unnatural precursor compound is supplied or is otherwise available). Therefore, the deletion or inactivation of a precursor supply gene provides a system where it is possible to incorporate non-natural starter units with no competition from the natural starter unit.

Therefore, the present invention provides a method for the incorporation of non- natural starter acids into FK506 and FK520 analogues, said method comprising replacing the natural FK506/FK520 loading module with the loading module of avermectin or an avermectin-like PKS and feeding starter units to this strain which optionally contains chromosomal DNA in which the precursor supply gene has been deleted or inactivated. Suitable gene systems which express FK506/FK520 homologues include, but are not limited to, antascomicin, FK520 (Wu et al., 2000; U.S. 6,150,513; AF235504), FK506 (Motamedi et al., 1996; Motamedi et al., 1997; Motamedi and Shafiee, 1998; AF082100, Y10438), FK523, FK525 and tsukubamycin biosynthetic clusters. The precursor supply gene which is deleted or inactivated is preferably a gene whose product is involved in branched chain keto acid formation, such as a bkd gene or homologue. The gene system is preferably the FK506 or FK520 cluster. The precursor supply gene deleted or inactivated is more preferably one or more of the bkd genes. Optionally fkbM and/or fkbl are deleted or inactivated in addition to one or more of the bkd genes. Optionally fkbL, or an analogue of rapL is also deleted to allow more efficient incorporation of pipecolate analogues (Motamedi and Shafiee, 1998, Khaw et al., 1998)

Therefore in one aspect the present invention provides a method of producing compounds of formula (I) comprising: (a) generating a recombinant strain of a FK506 or FK520 producing host that contains a biosynthetic cluster that encodes polypeptides involved in FK506 and FK520 analogue synthesis in which the natural loading module has been replaced by the loading module from the avermectin or an avermectin-like PKS; and

(b) feeding a non-natural non-natural starter unit to said recombinant strain;

(c) culturing said strain; and (d) optionally isolating compounds of formula (I).

There is also provided a method of producing compounds of formula (I) comprising:

(a) feeding a non-natural starter unit to a recombinant strain of a FK506 or FK520 producing host that contains a biosynthetic cluster that encodes polypeptides involved in FK506 and FK520 analogue synthesis in which the natural loading module has been replaced by the loading module from the avermectin or an avermectin-like PKS;

(b) culturing said strain; and

(c) optionally isolating compounds of formula (I).

Optionally one or more starter genes have been deleted or inactivated which produce a starter unit (e.g. starter acid). Additionally or instead the precursor for which one or more starter genes have been deleted or inactivated may be pipecolic acid. Optionally one or more genes responsible for post-PKS modification are also deleted or inactivated.

In a preferred embodiment the recombinant strain is generated using the methods described in WO2004/007709 and in the examples below.

In one embodiment, the host strain is a selected from the group consisting of Streptomyces tsukubaensis No. 9993 (Ferm BP-927), Streptomyces hygroscopicus subsp. hygroscopicus (DSM 40822), Streptomyces sp. AA6554, Streptomyces hygroscopicus var. ascomyceticus MA 6475 ATCC 14891 , Streptomyces hygroscopicus var. ascomyceticus MA 6678 ATCC 55087, Streptomyces hygroscopicus var. ascomyceticus MA 6674, Streptomyces hygroscopicus var. ascomyceticus ATCC 55276, Streptomyces hygroscopicus subsp. ascomyceticus ATCC 14891 , Streptomyces kanamycetscus KCC S-G433, Streptomyces cJavuhgonjs CKD11 19 (Kim and Park, 200S). Streptomyces hygroscopicus subsp. yakushimaensis, Streptomyces sp. DSM 7348, Micromonospora n.sp. A92-306401 DSM 8429 Streptomyces sp. MA 6548 and Streptomyces sp. MA 6858 ATCC 55098. In a preferred embodiment the host strain is selected from the group consisting of: S. hygroscopicus var. ascomyceticus ATCC 14891 , Streptomyces hygroscopicus subsp. hygroscopicus (DSM 40822) or Streptomyces tsukubaensis No. 9993 (Ferm BP-927).

If desired or necessary one or more auxiliary genes may be deleted or inactivated in the host strain. If desired or necessary one or more of the deleted or inactivated genes of the host strain may be reintroduced by complementation (e.g. at an attachment site, on a self- replicating plasmid or by insertion into a homologous region of the chromosome). If desired or necessary, further chemical steps, known to one skilled in the art may be used to generate the final compound (for example see March, Wiley Interscience)

It is well known to those skilled in the art that polyketide gene clusters may be expressed in heterologous hosts (Pfeifer et al., 2001 ). Accordingly, the present invention includes the transfer of the FK506 or FK520 biosynthetic gene cluster with or without resistance and regulatory genes, either complete, engineered, containing mutations, or containing deletions, for complementation in heterologous hosts. Methods and vectors for the transfer as defined above of such large pieces of DNA are well known in the art (Rawlings, 2001 ; Staunton and Weissman, 2001 ) or are provided herein in the methods disclosed. Therefore in another aspect the present invention provides a method of producing compounds of formula (I) comprising:

(a) generating a recombinant strain of a non-FK506 or FK520 producing host (i.e. a heterologous host) that contains a biosynthetic cluster that encodes polypeptides involved in FK506 and FK520 analogue synthesis in which the natural loading module has been replaced by the loading module from the avermectin or an avermectin-like

PKS; and

(b) feeding a non-natural non-natural starter unit to said recombinant strain;

(c) culturing said strain; and

(d) optionally isolating compounds of formula (I). There is also provided a method of producing compounds of formula (I) comprising:

(a) feeding a non-natural non-natural starter unit to a recombinant strain of a non- FK506 or FK520 producing host (i.e. a heterologous host) that contains a biosynthetic cluster that encodes polypeptides involved in FK506 and FK520 analogue synthesis in which the natural loading module has been replaced by the loading module from the avermectin or an avermectin-like PKS;

(b) culturing said strain; and

(c) optionally isolating compounds of formula (I)

In this context a preferred heterologous host cell strain is a prokaryote, more preferably an actinomycete or Escherichia coli, still more preferably include, but are not limited to S. hygroscopicus, S. hygroscopicus sp., S. hygroscopicus var. ascomyceticus, Streptomyces tsukubaensis, Streptomyces coelicolor, Streptomyces lividans, Saccharopolyspora erythraea, Streptomyces fradiae, Streptomyces avermitilis, Streptomyces cinnamonensis, Streptomyces rimosus, Streptomyces albus, Streptomyces griseofuscus, Streptomyces longisporoflavus, Streptomyces venezuelae, Micromonospora griseorubida, Amycolatopsis mediterranei or Actinoplanes sp. N902-109. Those skilled in the art will appreciate that the methods of the present invention could be applied to recombinant host strains in which the polyketide synthase (PKS) has been altered by genetic engineering to express a modified FK506 or FK520 analogue or other polyketide analogue. For example the PKS in a homologous or heterologous could be a hybrid PKS in which one or more domains have been removed, replaced or inserted, such replacements or insertions coming from other heterologous (or homologous) PKS clusters. The prior art describes several methods for the production of novel polyketides by the deletion or inactivation of individual domains (WO93/13663, WO97/92358), construction of hybrid polyketide synthases (WO98/01546, WO00/00618, WO00/01827) or alteration of domain specificity by site-directed mutagenesis (WO02/14482).

It is well known that many actinomycetes contain multiple biosynthetic gene clusters for different secondary metabolites, including polyketides and non-ribosomally synthesised peptides. Specifically, it has been demonstrated that strains of S. hygroscopicus produce a variety of polyketides and non-ribosomally synthesised peptides in addition to FK506, FK520, FK523, meridamycin, FK525, antascomicin or tsukubamycin. These include, but are not limited to, elaiophylin, bialaphos, hygromycin, augustmycin, endomycin (A, B), glebomycin, hygroscopin, ossamycin and nigericin. These additional biosynthetic gene clusters represent a competing requirement for biosynthetic precursors and an additional metabolic demand on the host strain. In order to enhance production of the desired rapamycin, or other polyketide, analogues, it may therefore be advantageous to delete or inactivate any other biosynthetic gene clusters present in the host strain. Methods for the deletion or inactivation of biosynthetic gene clusters are well known in the art.

Suitably, the starter unit is selected from the following carboxylic acids:

or

or

or

or

or

or

or

or

or a derivative of any of the aforesaid carboxylic acids; wherein the variable definitions in the aforementioned carboxylic acids are as for compounds of formula (I).

Starter units are suitably provided as the free carboxylic acid, but derivatives that may be employed include salts and esters. The aforementioned starter unit substances are either known or may be prepared by a skilled person using conventional methods.

Standard methods known to those of skill in the art may be used to culture the host or recombinant strain in order to produce compounds of formula (I). Such methods include, without limitation, those described in the examples below; additional methods may also be found in Reynolds and Demain, 1997 and references therein.

Compounds of the invention may be isolated using standard methods known to those of skill in the art, including, without limitation, those described in the methods of the examples below. Alternatives to these methods which may also be considered by a person of skill in the art include those as described in Natural Products Isolation (Cannell et al., 1998). Compounds of formula (I) are useful as pharmaceuticals for example, but without limitation, having potential utility as immunosuppressants, antifungal agents, anticancer agents, neuroregenerative agents, or agents for the treatment of psoriasis, rheumatoid arthritis, fibrosis and other hyperproliferative diseases. In a further aspect, the invention provides for the use of a compound of formula (I) as disclosed herein, in the preparation of a medicament for the prophylaxis and/or treatment of organ rejection after transplantation, autoimmune diseases, inflammatory disorders, fungal infections, cancer, neurodegeneration, psoriasis, rheumatoid arthrisis, fibrosis and/or other hyperproliferative disorders. In a further aspect, the invention provides for a method of treatment or prophylaxis of organ rejection after transplantation, autoimmune diseases, fungal infections, cancer, neurodegeneration, psoriasis, rheumatoid arthritis, fibrosis and/or other hyperproliferative disorders comprising administering a compound of formula (I) to a subject in need thereof. Additionally, the compounds of formula (I) disclosed herein may be used in the preparation of a medicament for the prevention of organ allograft rejection. In a preferred embodiment the compounds of formula (I) are used in the preparation of a medicament for the treatment of autoimmune diseases or inflammatory disorders. One skilled in the art would be able by routine experimentation to determine the ability of these compounds to inhibit fungal growth (e.g. Baker, H., et al., 1978; NCCLS Reference method for broth dilution antifungal susceptibility testing for yeasts: Approved standard M27- A, 17(9). 1997). Additionally, one skilled in the art would be able by routine experimentation to determine the ability of these compounds to inhibit tumour cell growth, (see Dudkin, L., et al., 2001 ; Yu et al. 2001 ). In a further aspect the compounds of this invention are useful for inducing immunosuppression and therefore relate to methods of therapeutically or prophylactically inducing a suppression of a human's or an animal's immune system for the treatment or prevention of rejection of transplanted organs or tissue, the treatment of autoimmune, inflammatory, proliferative and hyperproliferative diseases (examples include but are not inclusively limited to autoimmune diseases, diabetes type I, acute or chronic rejection of an organ or tissue transplant, asthma, tumours or hyperprolific disorders, psoriasis, eczema, rheumatoid arthritis, fibrosis, allergies and food related allergies). Such assays are well known to those of skill in the art, for example but without limitation: Immunosuppressant activity - Warner, LM., et al., 1992, Kahan et al. (1991 ) & Kahan & Camardo, 2001 ); Allografts - Fishbein, T.M., et al., 2002, Kirchner et al. 2000; Autoimmune / Inflammatory / Asthma - Carlson, R.P. et al., 1993, Powell, N. et al., 2001 ; Diabetes I - Rabinovitch, A. et al., 2002; Psoriasis - Reitamo, S. et al., 2001 ; Rheumatoid arthritis - Foey, A., et al., 2002; Fibrosis - Zhu, J. et al., 1999, Jain, S., et al., 2001 , Gregory et al. 1993

The ability of the compounds of this invention to induce immunosuppression may be demonstrated in standard tests used for this purpose. In a further aspect the compounds of this invention are useful in relation to antifibrotic, neuroregenerative and anti-angiogenic mechanisms, one skilled in the art would be able by routine experimentation to determine the ability of these compounds to prevent angiogenesis (e.g. Guba, M.,et al., 2002, ). One of skill in the art would be able by routine experimentation to determine the utility of these compounds in stents (e.g. Morice, M. C, et al., 2002). Additionally, one of skill in the art would be able by routine experimentation to determine the neuroregenerative ability of these compounds (e.g. Myckatyn, T. M., et al., 2002, Steiner ef a/. 1997)

The compounds of formula (I) are also, or in particular, expected to be useful as a therapeutic or prophylactic agents for one or more of the following conditions: rejection reactions after transplantation of organs or tissues (for example heart, kidney, liver, bone marrow, skin, cornea, lung, pancreas, small intestine, limb, muscle, nerve, intervertebral disc, trachea, myoblast and cartilage); graft-versus-host reactions following bone marrow transplantation; autoimmune diseases (for example rheumatoid arthritis, systemic lupus erythematosus, Hashimoto's thyroiditis, multiple sclerosis, myasthenia gravis, type I diabetes); infections caused by pathogenic microorganisms, in particular fungal infections; inflammatory or hyperproliferative skin diseases or cutaneous manifestations of immunologically-mediated diseases (for example psoriasis, atopic dermatitis, contact dermatitis, eczematoid dermatitis, pyoderma gangrenosum, seborrhoeic dermatitis, lichen planus, pemphigus, bullous pemphigoid, epidermolysis bullosa, rosacea, urticaria, angioedema, vasculitides, erythema, dermal eosinophilia, lupus erythematosus, acne, Netherton syndrome, and alopecia areata); autoimmune or allergic diseases of the eye (for example keratoconjunctivitis, vernal conjunctivitis, allergic conjunctivitis, uveitis associated with Behcet's disease, keratitis, herpetic keratitis, conical keratitis, corneal epithelial dystrophy, keratoleukoma, ocular pemphigus, Mooren's ulcer, scleritis, Graves' ophthalmopathy, Vogt-Koyanagi-Harada syndrome, keratoconjunctivitis sicca (dry eye), phlyctenule, iridocyclitis, sarcoidosis affecting the eye, endocrine ophthalmopathy); reversible obstructive airway diseases or asthma, in particular chronic or inveterate asthma (for example late asthma, airway hyperresponsiveness, bronchial asthma, allergic asthma, intrinsic asthma, extrinsic asthma, and dust asthma), mucosal or vascular inflammations (for example gastric ulcers, ischaemic or thrombotic vascular injury, ischaemic bowel diseases, enteritis, necrotizing enterocolitis, intestinal damage associated with thermal burns, leukotriene B4- mediated diseases); intestinal inflammations or allergies (for example coeliac disease, proctitis, eosinophilic gastroenteritis, mastocytosis, Crohn's disease and ulcerative colitis); food-related allergic diseases with symptomatic manifestation remote from the gastrointestinal tract (for example migraine, rhinitis and eczema); renal diseases (for example interstitial nephritis, Goodpasture's syndrome, haemolytic uraemic syndrome, nephrotic syndrome (for example glomerulonephritis) and diabetic nephropathy); nervous system diseases (for example multiple myositis, Guillain-Barre syndrome, Meniere's disease, multiple neuritis, solitary neuritis, cerebral infarction, Alzheimer's disease, Parkinson's disease, amyotrophic lateral sclerosis and radiculopathy); ischaemic diseases (for example head injury, brain haemorrhage, cerebral thrombosis, cerebral embolism, cardiac arrest, stroke, transient ischemic attack, hypertensive encephalopathy, cerebral infarction); endocrine diseases (for example hyperthyroidism and Basedow's disease); haematic diseases (for example pure red cell aplasia, aplastic anemia, hypoplastic anemia, idiopathic thrombocytopenic purpura, autoimmune hemolytic anaemia, agranulocytosis, pernicious anaemia, megaloblastic anaemia, and anerythroplasia); bone diseases (for example osteoporosis); respiratory diseases (for example sarcoidosis affecting the respiratory tract, pulmonary fibrosis, chronic obstructive pulmonary disease (COPD), Bronchiolitis Obliterans Syndrome (BOS) and idiopathic interstitial pneumonia); skin diseases (for example dermatomyositis, leukoderma vulgaris, ichthyosis vulgaris, photosensitivity, and cutaneous T- cell lymphoma); circulatory diseases (for example arteriosclerosis, atherosclerosis, aortitis syndrome, polyarteritis nodosa, and myocardosis); collagen diseases (for example scleroderma, Wegener's granulomatosis, and Sjogren's syndrome); adiposis; eosinophilic fasciitis; periodontal diseases (for example damage to gingiva, periodontium, alveolar bone or substantia ossea dentis); male pattern alopecia, alopecia senile; muscular dystrophy; pyoderma and Sezary syndrome; chromosome abnormality-associated diseases (for example Down's syndrome); Addison's disease; Human Immunodeficiency Virus (HIV) infection or AIDS; hypertrophic cicatrix and keloid due to trauma, burn, or surgery.

The aforementioned compounds of the invention or a formulation thereof may be administered by any conventional method including topically (for example by inhalation, vaginally, intranasally, or by eye or ear drop), enterally (for example orally or rectally) or parenterally (for example by intravenous, intracavernosal, subcutaneous, intramuscular, intracardiac or intraperitoneal injection) or via a medical device (for example via a stent). The treatment may consist of a single dose or a plurality of doses over a period of time.

Whilst it is possible for a compound of the invention to be administered alone, it is preferable to present it as a pharmaceutical formulation, together with one or more physiologically acceptable diluents or carriers. The diluents or carrier(s) must be "physiologically acceptable" in the sense of being compatible with the compound of the invention and not deleterious to the recipients thereof. In some cases, the diluent or carrier will be water or saline which will be sterile and pyrogen free.

The formulations may conveniently be presented in unit dosage form and may be prepared by any of the methods well known in the art of pharmacy. Such methods include the step of bringing into association the active ingredient (compound of the invention) with the carrier which constitutes one or more accessory ingredients. In general the formulations are prepared by uniformLy and intimately bringing into association the active ingredient with liquid carriers or finely divided solid carriers or both, and then, if necessary, shaping the product.

Tablets may contain excipients such as microcrystalline cellulose, lactose, sodium citrate, calcium carbonate, dibasic calcium phosphate and glycine, disintegrants such as starch (preferably corn, potato or tapioca starch), sodium starch glycollate, croscarmellose sodium and certain complex silicates, and granulation binders such as polyvinylpyrrolidone, hydroxypropylmethylcellulose (HPMC), hydroxy-propylcellulose (HPC), sucrose, gelatin and acacia. Additionally, lubricating agents such as magnesium stearate, stearic acid, glyceryl behenate and talc may be included.

Solid compositions of a similar type may also be employed as fillers in gelatin capsules. Preferred excipients in this regard include lactose, starch, a cellulose, milk sugar or high molecular weight polyethylene glycols. For aqueous suspensions and/or elixirs, the compounds of the invention may be combined with various sweetening or flavouring agents, colouring matter or dyes, with emulsifying and/or suspending agents and with diluents such as water, ethanol, propylene glycol and glycerin, and combinations thereof.

A tablet may be made by compression or moulding, optionally with one or more accessory ingredients. Compressed tablets may be prepared by compressing in a suitable machine the active ingredient in a free-flowing form such as a powder or granules, optionally mixed with a binder (eg povidone, gelatin, hydroxy propyl methyl cellulose), lubricant, inert diluent, preservative, disintegrant (eg sodium starch glycolate, cross-linked povidone, cross-linked sodium carboxymethyl cellulose), surface-active or dispersing agent. Moulded tablets may be made by moulding in a suitable machine a mixture of the powdered compound moistened with an inert liquid diluent. The tablets may optionally be coated or scored and may be formulated so as to provide slow or controlled release of the active ingredient therein using, for example, hydroxypropylmethylcellulose in varying proportions to provide desired release profile.

Formulations in accordance with the present invention suitable for oral administration may be presented as discrete units such as capsules, cachets or tablets, each containing a predetermined amount of the active ingredient; as a powder or granules; as a solution or a suspension in an aqueous liquid or a non-aqueous liquid; or as an oil-in-water liquid emulsion or a water-in-oil liquid emulsion. The active ingredient may also be presented as a bolus, electuary or paste.

Aerosol formulations suitable for administering via inhalation can also be made using methods known in the art. Examples of this include administration of the compounds of the invention by inhalation in the form of a powder (e.g. micronized) or in the form of atomized solutions or suspensions. The aerosol formulation may be placed in a suitable pressurized propellant, and may be used with additional equipment such as nebulizer or inhaler.

For applications to external tissues, for example the mouth and skin, the compositions are preferably applied as a topical ointment or cream. When formulated in an ointment, the active agent may be employed with either a paraffinic or a water-miscible ointment base. Alternatively, the active agent may be formulated in a cream with an oil-in-water cream base or a water-in-oil base.

The compounds of the invention may also be administered using medical devices known in the art. For example, in one embodiment, a pharmaceutical composition of the invention can be administered with a needleless hypodermic injection device, such as the devices disclosed in U.S. 5,399,163; U.S. 5,383,851 ; U.S. 5,312,335; U.S. 5,064,413; U.S. 4,941 ,880; U.S. 4,790,824; or U.S. 4,596,556. Examples of well-known implants and modules useful in the present invention include : US 4,487,603, which discloses an implantable micro- infusion pump for dispensing medication at a controlled rate; US 4,486,194, which discloses a therapeutic device for administering medicaments through the skin; US 4,447,233, which discloses a medication infusion pump for delivering medication at a precise infusion rate; US 4,447,224, which discloses a variable flow implantable infusion apparatus for continuous drug delivery; US 4,439,196, which discloses an osmotic drug delivery system having multi- chamber compartments; and US 4,475,196, which discloses an osmotic drug delivery system. Many other such implants, delivery systems, and modules are known to those skilled in the art.

The compounds can be administered as the sole active agent, or in combination with other pharmaceutical agents, such as other agents that stimulate or inhibit cell proliferation of immune responses. These agents include e.g. cyclosporine, rapamycin, FK506, leflunomide, butenamides, corticosteroids, Doxorubicin, and the like. In such combinations, each active ingredient can be administered either in accordance with its usual dosage range, or at a lower dose level.

It should be understood that in addition to the ingredients particularly mentioned above the formulations of this invention may include other agents conventional in the art having regard to the type of formulation in question, for example those suitable for oral administration may include flavouring agents.

Pharmaceutical compositions of the invention may optionally contain further active ingredients.

Further aspects of the invention include: -A hybrid PKS containing extension modules for producing FK506 or FK520 and the loading module of avermectin or an avermectin-like PKS optionally in which part or all of the KS of the first extension module is from avermectin or an avermectin-like PKS;

-An engineered FK506 or FK520 producing strain containing a hybrid PKS according to the invention;

-An engineered non- FK506 or FK520 producing strain containing a hybrid PKS according to the invention, for example such a strain in which one or more starter unit genes have been deleted or inactivated and/or a strain in which one or more pipecolic acid biosynthesis genes have been deleted or inactivated and/or a strain in which one or more post PKS modification genes have been deleted or inactivated.

-A process for producing a polyketide which comprises culturing such an engineered strain in the presence of a starter acid and optionally isolating said polyketide.

Brief description of the Figures

Figure 1 Sequence of the relevant part of the S. tsukubaensis FK506 cluster (fkbP' in italics, fkbO bold, fkbB' in capitals, presumed KS1 -encoding sequence of fkbB' in bold capitals):

Materials and Methods

Materials All molecular biology enzymes and reagents were from commercial sources. Vector pUC19 was obtained from New England Biolabs. Cosmid Supercos-1 was obtained from Stratagene. Vector pKC1 139B01was obtained by inserting a linker into pKC1139 (Bierman et al., 1992). The 674bp BgIW PvuW fragment of pKC1139 was replaced by the annealing product of oligos B01 and B02 to give the plasmid pKC1139B01 (5789bp) containing the polylinker below:

Primers

5' gatccactagttcggacgcatatgctggatatccaagtatctagaac BOl (SEQ ID 21) 5' gttctagatacttggatatccagcatatgcgtccgaactagtg B02 (SEQ ID 22)

Resulting polylinker

Spel Ndel EcoRV Xbal 5' gatccactagttcggacgcatatgctggatatccaagtatctagaac 3' 3' gtgatcaagcctgcgtatacgacctataggttcatagatcttg 5' Starter materials

All of the feeds used for starting units were obtained from commercial sources with the exception of tetrahydro-2H-thiopyran-4-carboxylic acid which was synthesised by the method of Strassler ef a/.1997

Bacterial strains and growth conditions

Escherichia coli DH10B (GibcoBRL) and E. coli JM1 10 (New England Biolabs) were grown in 2xTY medium as described by Sambrook et al. (2001 ). E. coli ET12567(pUZ8002) was grown as described by Paget et al. (1999) in 2xTY medium with kanamycin (25 mg/L) and chloramphenicol (12.5 mg/L). E. coli VCS257 was used for transfection of in vitro packaged cosmids. According to the instructions of Stratagene's Gigapack® III XL Packaging Extract the strain was kept on LB medium and grown on LB plus 0.2% maltose and 1 OmM MgSO₄ for transfection. E. coli transformants were selected for with ampicillin (100 mg/L), kanamycin (50 mg/L), apramycin (50 mg/L). The avermectin producer Streptomyces avermitilis (DSM41443J was grown on TSB at 28

⁰C for genomic DNA isolation.

The FK506 producer Streptomyces tsukubaensis no. 9993 (FERM BP-927) (International Patent Organism Depositary, Tsukuba, Japan) and its derivatives were maintained on medium 1 agar plates or ISP4, ISP3, or ISP2 (see below) at 28 ⁰C. The FK520 producer, Streptomyces hygroscopicus subsp. hygroscopicus (DSM 40822, purchased from DSMZ, Braunschweig, Germany) (known to be equivalent to Streptomyces hygroscopicus subsp. ascomyceticus ATCC 14891 ) and its derivatives were maintained on medium 1 agar plates, ISP2, ISP3 or ISP4 (see below) at 28 ⁰C.

Production of FK520 was carried out by fermentation of Streptomyces hygroscopicus subsp. hygroscopicus (DSM 40822), also termed BIOT-4081. Streptomyces tsukubaensis no. 9993 (FERM BP-927), also termed BIOT-3119 was used for producing FK506. Single spore isolates of both strains, termed BIOT-4168 (containing the genes for FK520 biosynthesis) and BIOT-4206 (containing the genes for FK506 biosynthesis), were used for strain construction.

Strains were grown on MAM, ISP4, ISP3 or ISP2 agar at 28 ⁰C for 5 - 21 days and used to inoculate seed medium NGY. The inoculated seed medium was incubated with shaking between 200 and 300 rpm at 5.0 or 2.5 cm throw at 28 ⁰C for 48 h. For production of FK520 or FK506 the fermentation medium PYDG or PYDG+MES buffer (PYDM) were inoculated with 2.5%-10% of the seed culture and incubated with shaking between 200 and 300 rpm with a 5 or 2.5 cm throw at 28 ⁰C for six days. The culture was then harvested for extraction. Production of FK520, FK506 or analogues in Tubes

Spore stocks of BIOT-4081 , BIOT-4168, BIOT-3119, BIOT-4206 or strains which are described below were cultured on MAM, ISP4, ISP3 or ISP2 plates, and preserved in 20% (w/v) glycerol and stored at -80 ⁰C. Spores were recovered on plates of MAM, ISP4, ISP3 or ISP2 and incubated for 5-21 days at 28 ⁰C. Vegetative cultures (seed culture) were prepared by removing one agar plug (6 mm in diameter) from the MAM, ISP4, ISP3 or ISP2 plate and transferring into 7 ml. medium NGY in 50 ml. polypropylene centrifuge tubes (cat no. 227261 , purchased from Greiner Bio-One Ltd, Stonehouse, Gloucestershire, UK) with foam plugs, or in Erlenmeyer flasks as described below. The culture tubes were incubated at 28 ⁰C, 300 rpm, 2.5 cm throw for 48 h. From the seed culture 0.5 m l. were transferred into 7 m l. production medium PYDG or PYDG+MES in 50 ml. centrifuge tubes with foam plugs. Cultivation was carried out for 6 days at 28 ⁰C and 300 rpm (2.5 cm throw). When necessary a selected precursor was fed to the production medium 24 h post inoculation. The feed compound was dissolved in 0.05 - 0.1 ml_ methanol and added to the culture to give a final concentration of 2.12 mM of the feed compound.

Production of FK520, FK506 or analogues in Flasks

Spore stocks of BIOT-4081 , BIOT-4168, BIOT-3119, BIOT-4206 or strains which are described below were cultured on MAM, ISP4, ISP3 or ISP2 plates, and preserved in 20% (w/v) glycerol and stored at -80 ⁰C. Spores were recovered on plates of MAM, ISP4, ISP3 or ISP2 and incubated for 5 - 21 days at 28 ⁰C. Vegetative cultures (seed culture) were prepared by removing 4 - 10 agar plugs (6 mm in diameter) from the MAM, ISP4, ISP3 or ISP2 plate and inoculating into 50 - 250 ml. medium NGY in 250 ml. or 2000 ml. Erlenmeyer flasks with foam plugs. The seed flasks were incubated at 28 ⁰C, 200 - 250 rpm (5 or 2.5 cm throw) for 48 h. From the seed culture 2 - 10% (v/v) was transferred into 50 or 250 ml. production medium PYDG (or PYDG + MES) in 250 ml. or 2000 ml. Erlenmeyer flasks respectively with foam plugs. Cultivation was carried out for 6 days at 28 ⁰C and 200 - 250 rpm (5 or 2.5 cm throw). If necessary a selected precursor was fed to the production medium 24 h post inoculation. The feed compound was dissolved in 0.375 - 1 ml_ methanol and added to the culture to give final concentration of 2.12 mM of the feed compound.

Production of FK520, FK506 or analogues in stirred bioreactors

Spore stocks of BIOT-4081 , BIOT-4168, BIOT-3119, BIOT-4206 or strains which are described below were prepared after growth on MAM, ISP4, ISP3 or ISP2 agar medium, and preserved in 20% (w/v) glycerol and stored at -80 ⁰C. Spores were recovered on plates of MAM,

ISP4, ISP3 or ISP2 medium and incubated for 5-21 days at 28 ⁰C. Vegetative cultures (seed culture) were prepared by removing 5-10 agar plugs (6 mm in diameter) from the MAM, ISP4, ISP3 or ISP2 plate and inoculation of 200 - 350 ml. medium NGY in 2 L Erlenmeyer flasks with foam plug. Cultivation was carried out for 48 h at 28 ⁰C, 250 rpm (2.5 cm throw). The entire seed culture in one flask was transferred into 5 L PYDG containing 0.01- 0.05% antifoam SAG 471 , in 7 L Applikon Fermentor. The fermentation medium was pre-adjusted at pH 6.0-7.0 post-sterilization. The fermentation was carried out for 6 days at 28 ⁰C, with starting agitation set at 300-450 rpm, aeration rate at 0.5-0.8 v/v/m and dissolved oxygen (DO) level controlled with the agitation cascade at 20 - 40% air saturation. If required the pH may be maintained using acid or base addition on demand. For production of analogues of FK520 or FK506, the selected feed (providing the starter unit for biosynthesis of target compound) was fed to the production medium 12 - 24 h post inoculation. The feed compound was dissolved in 3 - 5 ml. methanol and added to the culture to give final concentration of 2 mM of the feed compound, the amount of methanol not exceeding 1 % of the total volume. Fermentation was continued for further five days post-feeding.

Media Recipes Water used for preparing media was prepared using Millipore ENx Analytical Grade Water

Purification System.

Medium 1: Modified A-medium (MAM)

Component Source per L

Wheat starch Sigma 10 g

Corn steep powder Sigma 2.5 g

Yeast extract Difco 3 g

Calcium carbonate Sigma 3 g

Iron sulphate Sigma 0.3 g

BACTO agar Difco 2O g

No pH adjustment is made. Sterilised by autocla

Medium 9: R6 (Kieseret al., 2000)

Component Source per L

Sucrose Fisher 20O g

Dextrin Avedex 10 g

Casamino acids Difco i g

MgSO₄.7H₂O Sigma 0.05 g

ISP Trace Element See below 1 ml_ Solution

K₂SO₄ Sigma 0.1 g Water to 70O mL

Add 20 g BACTO agar and a stirrer bar to each 1 L Duran and autoclave at 121 ⁰C for 15 min.

After autoclaving add:

Component Source per L

(previously sterilised individually by autoclaving 121 °ι 3, 15 min)

0.65 M L-glutamic acid, mono Sigma 100 ml_ (10.99 g) sodium salt

0.48 M CaCI₂.2H₂O Sigma 100 ml_ (7.06 g)

0.1 M MOPS pH 7.2 Fisher 100 ml_ (2.09 g)

ISP3

Component Source per L

Oatmeal Tesco 2O g

BACTO agar Difco 18 g

ISP Trace Element See 1 ml_ Solution below

Oatmeal is cooked/steamed in the water for 20 min, strained through a muslin and more water added to replace lost volume. ISP Trace Elements Solution is added and pH adjusted to 7.2 with NaOH. Agar is added before autoclaving at 121 ⁰C, 15 min.

/SP Trace Elements Solution

Component Source per L

FeSO₄JH₂O Sigma 0.1 g

MnCI₂.4H₂O Sigma 0.1 g

ZnSO₄.7H₂O Sigma 0.1 g

Distilled water 100 ml_

Stored in the dark at 4 ⁰C.

2xTY

Component Source per L

Tryptone Difco 16 g

Yeast extract Difco 10 g

NaCI Sigma 5 g

BACTO agar Difco 15 g Sterilised by autoclaving 121 ⁰C, 15 min.

LB

Component Source per L

Tryptone Difco 1 O g

Yeast extract Difco 5 g

NaCI Sigma 1 O g

BACTO agar Difco 15 g

Sterilised by autoclaving 121 ⁰C, 15 min. TSB

Component Source per L

Bacto Tryptic Soy BD 3O g Broth

Sterilised by autoclaving 121 ⁰C, 15 min.

NGY

Component Source per L

Difco Nutrient Broth Difco 8 g

Glucose Sigma 10 g

Yeast Extract Difco 5 g

The medium is adjusted to pH 7.0, with NaOH and then sterilised by autoclaving 121 ⁰C, 15 min.

PYDG

Component Source per L

Peptone from Milk Sigma 15 g Solids

Yeast Extract Difco 1.5 g

Dextrin Avedex 45 g

Glucose Sigma 5 g

The medium is adjusted to pH 7.0 with NaOH, and then sterilised by autoclaving 121 ⁰C, 15 min. When M ES is added to PYDG (PYDG + MES) it is added 21 .2 g/L prior to pH adjustment.

ISP4

Component Source per L

Soluble Starch BDH 1 O g K₂HPO₄ Sigma 1.O g

MgSO₄.7H₂O Sigma 1.O g

NaCI RDH 1.O g

(NhU)₂SO₄ RDH 2.O g

CaCO₃ Caltec 2.O g

BACTO agar Difco 2O g

ISP Trace Elements See 1 ml. Solution above

A paste is made using a little cold water and the starch. This is brought up to a volume of 500 ml_. All other ingredients are then added, and the pH of the media is adjusted to pH 7.0 - 7.4. Sterilise by autoclaving 121 ⁰C, 15 min.

ISP2

Component Source per L

Yeast extract Difco 4 g

Malt extract Difco 10 g

Glucose Sigma 4 g

Bacto agar Difco 2O g

Sterilise by autoclaving 121 ⁰C, 15 min.

DNA manipulation and sequencing

DNA manipulations and electroporation procedures were carried out as described in Sambrook et al. (2001 ). PCR was performed according to the instructions of the KOD

Polymerase kit (Novagen). DNA sequencing was performed as described previously (Gaisser et al., 2000). Genome sequencing was carried out using 454 technology (Margulies et al.,

2005) at Cogenics and the University of Cambridge.

Genomic DNA preparation

Strains were grown in shake flasks containing 25 ml. TSB or ISP2 medium at 250 - 300 rpm and 28 ⁰C and harvested after 2 to 3 days. Cell pellets were washed with 10.3% sucrose and frozen at -20 ⁰C until used. The following method was most successful for genomic DNA isolation from S. hygroscopicus, S. tsukubaensis and S. avermitilis. A pellet originating from 12.5 ml. of culture was resuspended in 1 ml. STE buffer (10O mM NaCI, 10 mM Tris HCI pH8, 1 mM EDTA). 20 ml. STE buffer supplemented with 2 mg/mL lysozyme were added and the resuspension incubated for 30 min at 37 ⁰C. 20 μl_ of RNaseA (10 mg/mL) were added and the mixture incubated for another 30 min at 37 ⁰C. 4.8 ml. EDTA (0.1 M final concentration) were added to stop the reaction. 1.4 ml. 20% SDS were added. After careful mixing the lysate was incubated on ice for 5 min, then extracted with one volume of phenol/chloroform/isoamylalcohol (25:24:1 ) and centrifuged at 2300 g and 4 ⁰C for at least 15 min up to 1 h. Extractions were repeated until no more protein was visible at the interface, followed by a final chloroform/isoamylalcohol (49: 1 ) extraction. The upper phase was precipitated with 1/10 vol. 5 M NaCI and 1 vol. cold isopropanol. After a few min, the DNA was spooled out with a glass rod and washed in ice cold 70% EtOH. After brief drying, the recovered DNA was dissolved in 0.5 - 1 ml. TE 10:1. The proteinase K method (Kieser et al., 2000) was also applied successfully to recover genomic DNA from S. tsukubaensis.

Cosmid library preparation for S. tsukubaensis

A cosmid library of genomic DNA of S. tsukubaensis, was constructed. High molecular weight DNA from several genomic DNA preps was partially digested with BfuC\, an isoschizomer of Sau3A, to a mean size of 30 - 60 kb, ligated to Supercos-1 , packaged into A phage using Gigapack® I I I XL Packaging Extract (Stratagene) and transfected into Escherichia coli VCS257. The titre was 6.7 x 10⁵ cfu / μg vector. DNA of 10 cosmids was isolated and digested with EcoRI to check the insert size which was 40 kb on average. 2000 clones were grown in 96-well microtitre plates (150 μl_ LB AmplOO Kan50 per well) at 37 ⁰C and frozen at -80 ⁰C after mixing wells with 50μL LB/glycerol 1 :1.

FkbO probe preparation

A DIG labeled fkbO probe was used to detect cosmids containing this region of the FK506 biosynthetic cluster. The probe was prepared by PCR using DIG labeled dNTP mix (Roche). It comprises 410 bp of 3'-terminal fkbO sequence. Sequence information for primer design had been obtained by 454 sequencing of BIOT-31 19 - see Figure 1 and SEQ ID 1. Primer sequences were:

UES2for (Seq ID 2) 5'-CACTCCTTCGATCTCCACGAGCAGGTCGCCACGGGC-S' and UES2rev (Seq ID 3) 5'-ACCCTGCCGTCCTCACGGCACACCACTACCCCACGG-S'. Annealing temperatures between 66 and 71 ⁰C and extension for 20 sec at 68 ⁰C proved to be successful.

Colony hybridization

Thawn microplate-cultures were stamped onto positively charged filter membranes

(Roche) which had been placed on LB AmplOO Kan50 plates. After overnight growth at 37 ⁰C membranes were taken off. Cells were lysed and cell debris removed according to the DIG

Application Manual for Filter Hybridization (Roche). DNA was crosslinked by exposing membranes to UV (302nm) for 5 min. Membranes were kept between two sheets of filter paper soaked with 2xSSC at 4 ⁰C or used immediately for hybridization. Hybridization was carried out using standard hybridization buffer and DIG labeled fkbO probe (see above) at a hybridization temperature of 68 ⁰C. Stringent washes were performed at 68 ⁰C. The nonradioactive DIG Nucleic Acid Detection kit from Roche was used to identify 5 positive clones on 4 library plates. The procedure followed the instructions of the DIG Application Manual for Filter Hybridization (Roche).

Conjugation of Streptomyces hygroscopicus subsp. hygroscopicus and Streptomyces tsukubaensis

Escherichia coli ET12567 (pUZ8002) (Macneil et al., 1992, Paget et al., 1999) was transformed with pKC1139B01 -derived plasmids by electroporation to generate the E. coli donor strains for spore conjugation (Kieser et al., 2000). Fresh spores were harvested in water from plates of Streptomyces hygroscopicus (BIOT-4168) or Streptomyces tsukubaensis (BIOT-4206). Spore suspensions were heat-shocked at 50 ⁰C for 10 min. They were then mixed with the E. coli donor strain, which had been washed twice with 2xTY, in a ratio of 3:1 Streptomycete to E. coli, and the mixture shaken at 37 ⁰C, 300 rpm, 2.5 cm throw for 1.5 - 2 h. The conjugation mixture was then plated on R6 medium and incubated at 37 ⁰C. After -20 h, the plates were overlaid with 2xTY containing apramycin sulphate and nalidixic acid and incubation continued at 37 ⁰C. Plasmids with pKC1 139B01 backbone are not able to self- replicate in Streptomycetes at 37 ⁰C and are forced to integrate into the genome. For more details on the screening procedure for conjugants see below.

Culture broth sample extraction and analysis Culture broth (0.9 ml.) were extracted with ethyl acetate (0.9 ml.) in a 2 ml. Eppendorf tube. The broth was mixed with the solvent for 15 min on a shaking platform (vibrax) at 400 rpm. The phases are then separated by centrifugation (2 min, 13,200 rpm). An aliquot of the organic layer (0.1 ml.) is then transferred to either a clean glass LC-vial or a vial containing 5 μg of pimecrolimus (as an internal standard for quantification). The solvent is removed in vacuo (3 min) and then re-dissolved in methanol (1 ml.) by gentle agitation on a shaking platform (5 min).

Analysis by LCMS

The HPLC system comprised an Agilent HP1 100 equipped with a Hyperclone ODS2, C18, 3 micron 4.6 x 150 mm column (Phenomonex). Injection volume 10 μl_, oven 50⁰C, A: 0.1% formic acid, B: 0.1 % formic acid in MeCN. 1 mL/min; 0-1 min 65% B; 6.5 min 100% B; 10 min 100% B; 10.05 min 65% B, 12 min 65% B. The HPLC system described above was coupled to a Bruker Daltonics Esquire3000 electrospray mass spectrometer. Positive- negative switching was used over a scan range of 500 to 1000 Dalton.

Alternatively, LC samples that have been spiked with 0.005 mg/mL pimecrolimus were analysed on the same instrument and with the same chromatographic conditions. However the MS was conducted in multiple reaction monitoring mode (MRM mode) in order to quantify the amount of FK analog in the sample. Details of the quantification are:

negative scan mode, m/z = 450-850

MRM setup: transitions [Da] fragmentation amplitude [V] pimecrolimus (IS): 808.4 → 548.3 1.15 FK520 790.5 → 548.3 1.15

FK506 802.4 → 560.3 1.15

all parent ions are isolated with a width of 3 amu.

All FK520 and FK506 analogues can be quantified in this manner, with the parent ion isolated as [M-H]^" and the transition to 548.2 (for Fk520 analogues) or 560.2 (for FK506 analogues) used.

The amount of analyte present is then calculated by dividing the integral for the analyte transition (as detailed above) with that for the internal standard, pimecrolmius. This ratio is then compared with a standard calibration curve for FK520 or FK506 up to 100 ng on column with 50 ng on column pimecrolimus.

NMR spectra (¹H, ¹³C, DQF-COSY, TOCSY, HMQC, HMBC, NOESY) of purified material were recorded on a Bruker Advance DRX500 spectrometer which operated at 500 MHz (for proton derived spectra, pro rata for other nuclei) at 27 ⁰C,. Chemical shifts are described in parts per million (ppm) and are referenced to solvent signal e.g. CHCI₃ at δ_H 7.26 (¹H) and CHCI₃ at δ_c 77.0 (¹³C). J values are given in Hertz (Hz).

Example 1 - Generation of a Streptomyces hygroscopicus subsp. hygroscopicus strain in which the loading module of the FK520 PKS (comprising DHCHCA CoA ligase-like domain, enoyl CoA reductase and ACP) is replaced by the loading module of the avermectin PKS (comprising AT and ACP) from Streptomyces avermitilis. 1 . 1 C l o n i n g of th e l eft fl a n ki n g seq u e n ce l ocated upstream of the FK520 loading module.

Oligos PCR11 F and PCR1 1 R were used to amplify a 2.19 kb region of DNA from Streptomyces hygroscopicus subsp. hygroscopicus (DSM40822) using genomic DNA template (Kieser et al., 2000) and the KOD Polymerase kit from Novagen. PCR samples were supplemented with 10% DMSO. Annealing temperatures between 65 and 70 ⁰C and extension for 1 min at 70 ⁰C were used. A 5' extension was designed for each oligo to introduce restriction sites (Spel, Λ/αtel) to aid cloning of the amplified fragment. The Nde\ site of PCR1 1 R comprises the loading module start codon (ATG), and the 3 non-coding bases upstream are mutated to CAT (replacing TCC). The 2.19 kb PCR fragment was ligated with Sma\ digested and SAP-treated pUC19, resulting in plasmid pUC19 PCR11. The insert sequence was verified by sequencing. PCR11 F (Seq ID 4) CGACTAGTGCAGCGCGAGCGTGTTGACGAACATGCCGATCAGG Spel

PCR11 R (Seq ID 5) GGCATATGAACACCTTTCTCTCGACCAACCGCACAACAGCACG

Λfctel

1.2 Cloning of the right flanking sequence located downstream of the FK520 loading module and covering the region containing FK520 KS1 and part of AT1.

Oligos PCR13F2 and PCR13R were used to amplify a 2.20 kb region of DNA from Streptomyces hygroscopicus subsp. hygroscopicus (DSM40822) using genomic DNA template (Kieser et al., 2000) and KOD Polymerase. PCR samples were supplemented with 10% DMSO. Annealing temperatures between 65 and 70 ⁰C and extension for 1 min at 70 ⁰C were used. A 5' extension was designed for each oligo to introduce restriction sites (Nhe\, Xba\) to aid cloning of the amplified fragment. The 2.20 kb PCR fragment was ligated with Sma\ digested and SAP-treated pUC19. A construct was selected with the insert orientated such that the Nhe\ site of the PCR fragment would be close to the Nde\ site of pUC19. This was relevant for the subsequent cloning procedure and the resulting plasmid was named pUC19 PCR13F. The insert sequence was verified by sequencing. PCR13F2 comprises the 5' end of KS1 and the choice of Nhe\ introduces a mutation resulting in the KS1 N-terminal sequence of 'DPLA' instead of the original FK520 KS1 sequence 'DPVA'. PCR13F2 (Seq ID 6)

CTCGGCTCCGGCGACCCGCTAGCGATCGTCGGCATGGCGT Nhe\ PCR13R (Seq ID 7)

GCTCTAGACACCGGCTCGGTCACCCAGGCGCTGTCCAC Xba\

1.3 Cloning of a DNA fragment coding for the loading module of avermectin PKS (comprising

AT and ACP)

Oligos PCR12F and PCR12R were used to amplify a 1.46 kb region of DNA from

Streptomyces avermitilis (DSM41443J using genomic DNA template (Kieser et al., 2000) and

KOD Polymerase. PCR samples were supplemented with 1 0% DMSO . Annealing temperatures between 65 and 70 ⁰C and extension for 1 min at 70 ⁰C were used. A 5' extension was designed for each oligo to introduce restriction sites (Λ/αtel, Apa\) to aid cloning of the amplified fragment. The 1.46 kb PCR fragment was ligated with Sma\ digested and

SAP-treated pU C1 9, resulting in plasmid pUC 1 9 PCR22 and the insert verified by sequencing. PCR12F comprises the 5' end of ave loading module and the choice of Nde\ introduces a mutation resulting in the N-terminal sequence of the loading module being 'MQR' instead of 'VQR' in the avermectin PKS. PCR12R comprises the 5' end of KS1 and as mentioned for PCR13F2 the choice of Nhe\ introduces a mutation resulting in the KS1 N- terminal sequence of 'DPLA' instead of 'DPVA' in the FK520 cluster and 'DPIA' in the avermectin cluster. PCR12F (Seq ID 8)

TTCATATGCAGAGGATGGACGGCGGGGAAGAACCCCGCCCTGCGG

Λfctel PCR12R (Seq lD 9)

TTGCTAGCGGGTCGTCCGCCGCTGCCGTGCCTCCGTGGCCGCT Nhe\

1.4 Assembly of pUS4 which carries the replacement loading module and the two flanking fragments

The Spe\ Nde\ fragment of pUC19PCR11 was ligated with Spe\ Nde\ cut pKC1139B01 resulting in pUS1. The Nde\ Nhe\ fragment of pUC19PCR12 was ligated with Nde\ Nhe\ cut pUC19PCR13F resulting in pUS2. The Nde\ Xba\ fragment of pUS2 was then cloned into pUS1 digested with Nde\ Xba\, the final plasmid being pUS4. 1.5 Transformation of Streptomyces hygroscopicus subsp. hygroscopicus Escherichia coli ET12567 (pUZ8002) was transformed with pUS4. This strain was used to transform Streptomyces hygroscopicus subsp. hygroscopicus by spore conjugation (as described in Materials & Methods). Exconjugants were plated on R6 agar, incubated at 37 ⁰C and overlaid with nalidixic acid (25 mg/L) and apramycin (50 mg/L) the next day. pUS4 is not able to self-replicate in Streptomyces hygroscopicus subsp. hygroscopicus at 37 ⁰C and is forced to integrate into the genome by recombination. Six days later, transformants were subcultured on MAM plates containing apramycin (50 mg/L) at 37 ⁰C to ensure the pUS4 plasmid with resistance marker was present. Subculturing for two subsequent rounds at 37 ⁰C on MAM plates without apramycin was carried out to allow secondary recombination. This event would either cause the loss of the plasmid via the second region of homology, not the one by which it had originally integrated resulting in the desired gene replacement; or the loss of the plasmid via the same region of homology as the original integration resulting in a wildtype revertant. Unexpected recombination events could occur as well. This required single spore isolation of subcultured patches. The transformants were subcultured on MAM plates without apramycin at 28°C and subsequently incubated at 28 ⁰C on ISP3 plates for spore harvest. Serial dilutions were made from the collected spores and plated on MAM plates to achieve single colonies.

1.6 Screening for secondary crosses

Single colonies were patched in duplicate onto MAM supplemented with 50 mg/L apramycin and MAM containing no antibiotics, and grown at 28 ⁰C for 3-4 days. Patches that grew on the no antibiotic plate but did not grow on the apramycin plate were screened for production to test if the desired double recombination event had occurred. A 6 mm circular plug from each patch that had lost the marker was used to inoculate individual 50 mL falcon tubes containing 7 mL FK seed medium (see Media Recipes) without antibiotics and grown for 2 days at 28 ⁰C, 300 rpm, 2.5 cm throw. These were then used to inoculate (0.5 mL into 7 mL - 7% inoculum) FK production medium (see Media Recipes) in a 50 mL falcon tube and incubated at 28 ⁰C, 300 rpm, 2.5 cm throw. The cultures were harvested after 6 days growth and analysed by LC-MS, using the methods described above. 61 out of 93 apramycin sensitive strains tested had undergone the desired recombination event. These strains produced FK520 derivates arising from the use of isobutyrate and 2-methylbutyrate starter units, most of them producing FK520 as well. Six of these strains were selected and feeding experiments were undertaken . After inoculation of FK production medium (see above), tubes were incubated at 28 ⁰C, 300 rpm, 2.5 cm throw. After 24 h, each falcon tube was fed with 50 μL 0.32 M cyclobutyl carboxylic acid to give a final concentration of 2.12 mM acid and shaking incubation was continued for five days. Culture extracts were analysed by LC-MS, using the methods described above. All six isolates used cyclobutyl carboxylic acid as starter. One strain was ultimately selected, designated "#1-9". This strain was later assigned "BIOT-4225".

Example 2 - Generation of a Streptomyces hygroscopicus subsp. hygroscopicus strain in which the loading module and KS1 of the FK520 PKS are replaced by the loading module and KS1 of the avermectin PKS from Streptomyces avermitilis.

2.1 Cloning of the left flanking sequence located upstream of the FK520 loading module, (see 1.1 ) Plasmid pUC19PCR11 from section 1.1 was used to provide the left flanking region.

2.2 Cloning of the right flanking sequence located downstream of the FK520 loading module + KS1

Oligos PCR23F and PCR23R were used to amplify a 2.15 kb region of DNA from Streptomyces hygroscopicus subsp. hygroscopicus using genomic DNA template (Kieser et al., 2000) and KOD Polymerase. PCR samples were supplemented with 10% DMSO. Annealing temperatures between 65 and 70 ⁰C and extension for 1 min at 70 ⁰C proved to be most successful. A 5' extension was designed for each oligo to introduce restriction sites {Apa\, Xba\) to aid cloning of the amplified fragment. The 2.15 kb PCR fragment was ligated with Sma\ digested and SAP-treated pUC19. A construct was selected with the insert orientated such that the Apa\ site of the PCR fragment would be close to the Nde\ site of pUC19. This was relevant for the subsequent cloning procedure and the resulting plasmid was named pUC19 PCR23F. The insert sequence was verified by sequencing. Choosing Apa\ will introduce a silent mutation with the translated code still being 'GP'. PCR23F (Seq ID 10)

TTGGGCCCTCGCGTGTGGAGTCGGGTGGTGATGGGTTG

Apa\ PCR23R (Seq lD 1 1 )

TGTCTAGACGCCTCGGCGACCGCGAGCCACTCCAACCG Xba\

2.3 Cloning of a DNA fragment coding for S. avermitilis loading module and KS1 Oligos PCR12F and PCR22R were used to amplify a 2.75 kb region of DNA from Streptomyces avermitilis using genomic DNA template (Kieser et al., 2000) and KOD Polymerase. PCR samples were supplemented with 10% DMSO. Annealing temperatures between 65 and 70 ⁰C and extension for 1.5 min at 70 ⁰C proved to be most successful. A 5' extension was designed for each oligo to introduce restriction sites (Λ/c/el, Apa\) to aid cloning of the amplified fragment. The 2.75 kb PCR fragment was ligated with Sma\ digested and SAP-treated pU C1 9, resulting in plasmid pUC 1 9 PCR22 and the insert verified by sequencing. PCR12F comprises the 5' end of ave loading module and the choice of Λ/c/el introduces a mutation resulting in the N-terminal sequence of the loading module being 'MQR' instead of 'VQR' in the avermectin PKS. PCR22R was designed such that the sequence of the amplified fragment ends slightly downstream of the KS1 gene where Apa\ links to the FK520 sequence.

PCR12F (Seq ID 12)

TTCATATGCAGAGGATGGACGGCGGGGAAGAACCCCGCCCTGCGG

Λ/c/el

PCR22R (Seq ID 13) TTGGGCCCCGGCGCCTCCTCCAAAATCACATGCGCATTCGTGC

Apa\

2.4 Assembly of the two flanking fragments and the replacement module.

The Spel Λ/c/el fragment of pUC19PCR11 was ligated with Spel Λ/c/el cut pKC1139B01 resulting in pUS1. Since the pUC19PCR22 insert contains 2 internal Apa\ sites, a third single- cutting restriction enzyme (C/al) was chosen to aid cloning. C/al is affected by dam methylation. The dam^" dcm^" strain E. coli JM1 10 was transformed with pUC19PCR22 and the isolated plasmid digested with Λ/c/el C/al and C/al Apa\. A 3-part ligation was performed with the 1.76 kb Λ/c/el C/al fragment, the 0.98 kb C/al Apa\ fragment and pUC19PCR23F cut with Λ/c/el Apa\ resulting in plasmid pUS3. The Λ/c/el Xba\ fragment of pUS3 was then cloned into pUS1 digested with Λ/c/el Xba\, the final plasmid being pUS5.

2.5 Transformation of Streptomyces hygroscopicus subsp. hygroscopicus

Escherichia coli ET12567 (pUZ8002) was transformed with pUS5 by electroporation to generate the E. coli donor strain for conjugation . This strain was used to transform Streptomyces hygroscopicus subsp. hygroscopicus by spore conjugation (as described in Materials & Methods). Exconjugants were plated on R6 agar, incubated at 37°C and overlaid with nalidixic acid (25 mg/L) and apramycin (50 mg/L) the next day. pUS5 is not able to self- replicate in Streptomyces hygroscopicus subsp. hygroscopicus at 37 ⁰C and is forced to integrate into the genome by recombination. Six days later, transformants were subcultured on MAM plates with apramycin (50 mg/L) at 37 ⁰C to ensure the pUS5 plasmid with resistance marker was present. Subculturing for two subsequent rounds at 37 ⁰C on MAM plates without apramycin was carried out to allow secondary recombination. This event would either cause the loss of the plasmid via the second region of homology, not the one by which it had originally integrated resulting in the desired gene replacement; or the loss of the plasmid via the same region of homology as the original integration resulting in a wildtype revertant. Unexpected recombination events could occur as well. This required single spore isolation of subcultured patches. The transformants were subcultured on MAM plates without apramycin at 28 ⁰C and subsequently incubated at 28 ⁰C on ISP3 plates for spore harvest. Serial dilutions were made from the collected spores and plated on MAM plates to achieve single colonies.

2.6 Screening for secondary crosses

Single colonies were patched in duplicate onto MAM supplemented with 50 mg/L apramycin and MAM containing no antibiotics, and grown at 28 ⁰C for 3 - 4 days. Patches that grew on the no antibiotic plate but did not grow on the apramycin plate were screened to test if the desired double recombination effect had occurred. A 6 mm circular plug from each patch that had lost the marker was used to inoculate individual 50 ml. falcon tubes containing 7 ml. FK seed medium (see Media Recipes) without antibiotics and grown for 2 days at 28 ⁰C, 300 rpm, 2.5 cm throw. These were then used to inoculate (0.5 ml. into 7 ml. - 7% inoculum) FK production medium (see Media Recipes) in a 50 ml. falcon tube and incubated at 28 ⁰C, 300 rpm, 2.5 cm throw. The cultures were harvested after 6 days growth and analysed by LC-MS, using the methods described above. 2 out of 93 apramycin sensitive strains tested had undergone the desired recombination event. These strains produced FK520 derivates arising from the use of isobutyrate and 2-methylbutyrate starter units (FK520 background). Feeding experiments were undertaken with the two strains to further confirm the integration of the ave loading module sequence. After inoculation of FK production medium (see above), tubes were incubated at 28 ⁰C, 300 rpm, 2.5 cm throw. After 24 h, each falcon tube was fed with 50 μl_ 0.32 M cyclobutyl carboxylic acid to give a final concentration of 2.12 mM acid and shaking incubation was continued for five days. Culture extracts were analysed by LC-MS, using the methods described above. Both isolates designated "#1-7" and "#1-8" incorporated cyclobutyl carboxylic acid as a starter unit.

Example 3 - Generation of a Streptomyces tsukubaensis strain in which the loading module of the FK506 PKS (comprising DHCHCA CoA ligase-like domain, enoyl CoA reductase and ACP) is replaced by the loading module of the avermectin PKS (comprising AT and ACP) from Streptomyces avermitilis. 3.1 Sequence information for fkbO, P, B of the FK506 biosynthetic cluster of Streptomyces tsukubaensis.

The sequence information of FK506 fkbO,P,B is needed for the construction of ave load variants of BIOT-3119. 454 Sequencing of BIOT-31 19 gave two contigs covering part of the

FK506 cluster including fkbO and fkbP, but neither of them covering fkbB sufficiently. The 5 positive cosmids obtained via hybridization of the BIOT-31 19 cosmid library with an FK506 fkbO probe (see Materials & Methods) were end-sequenced. The alignment of end sequences with the FK520 cluster sequence (AF235504) showed that two of the cosmids contained fkbO, P, B completely. One of them, 3G9, was sequenced (Cambridge University

DNA Sequencing Facility). The sequence relevant for the cloning procedure described in

Example 3 and 4 is shown in Fig. 1.

3.2 C l o n i n g of th e l eft fl a n ki n g s eq u e n ce l ocated upstream of the FK506 loading module.

Oligos UES4_For and UES4_Rev were used to amplify a 2.27 kb region of DNA from Streptomyces tsukubaensis no. 9993 using cosmid 3G9 template and KOD Polymerase. PCR samples were supplemented with 10% DMSO. Annealing temperatures of 66 and 71 ⁰C and extension for 1 .5 min at 68 ⁰C were used. A 5' extension was designed for each oligo to introduce restriction sites (Spel, Λ/αtel) to aid cloning of the amplified fragment. The Nde\ site of UES4_For comprises the loading module start codon (ATG), and the 3 non-coding bases upstream are mutated to CAT (replacing TCC). The 2.27 kb PCR fragment was ligated with Sma\ digested and SAP-treated pUC19, resulting in plasmid 'pUC19 fkbP'O 506 left'. The insert sequence was verified by sequencing. UES4_For (Seq lD 13)

CGACTAGTGCAGCGCGAGCGTGTTGACGAACATGCCGATGAGG

Spel

UES4_Rev (Seq ID 14) GGCATATG

AACGCCTTTCTCTCGGCTGACCGTACGGCAGCACG

Λfctel

3.3 Clon i ng of the right flan ki ng seq uence located downstream of the FK506 loading module and covering the region containing FK506 KS1 and part of AT1. Oligos UES7_For and UES7_Rev were used to amplify a 2.29 kb region of DNA from Streptomyces tsukubaensis no. 9993 using 3G9 cosmid and KOD Polymerase. PCR samples were supplemented with 10% DMSO. Annealing temperatures between 66 and 71 ⁰C and extension for 1 .5min at 68 ⁰C proved to be successful. A 5' extension was designed for UES7_Rev to introduce an Xba\ site. UES7_For comprises the internal Pvu\ site at the 5' end of ave KS1 followed by the internal Pvu\ site of FK506 KS1 which was mutated to 'CCATCG'. The 2.29 kb PCR fragment was ligated with Sma\ digested and SAP-treated pUC19 resulting in plasmid 'pUC19 fkbB' 506 right'. The insert sequence was verified by sequencing. UES7_For (Seq lD 15) TTCGATCGCCATCGTCGGCATGGCCTGCCGACTGCCGGGCGGCGT

Pvu\ UES7_Rev (Seq ID 16)

GCTCTAGACGGATGGGCGCTGCACTCGACGAAGAGGGAGCCGT

Xba\

3.4 Cloning of a DNA fragment coding for the loading module of avermectin PKS (comprising

AT and ACP)

Oligos PCR12F and UES5_Rev were used to amplify a 1.46 kb region of DNA from

Streptomyces avermitilis using genomic DNA template (Kieser et al., 2000) and KOD Polymerase. PCR samples were supplemented with 10% DMSO. Annealing temperatures between 66 and 71 ⁰C and extension for 1 .5 min at 68 ⁰C were used. A 5' extension was designed for PCR12F to introduce an Nde\ site, whereas UES5_Rev comprises the internal

Pvu\ site at the 5'-end of ave KS1. The 1.46 kb PCR fragment was ligated with Sma\ digested and SAP-treated pUC19, resulting in plasmid 'pUC19 ave load middle' and the insert verified by sequencing. PCR12F comprises the 5' end of ave loading module and the choice of Nde\ introduces a mutation resulting in the N-terminal sequence of the loading module being 'MQR' instead of 'VQR' in the avermectin PKS. UES5_Rev comprises the 5' end of ave KS1 and introduces a mutation resulting in the KS1 N-terminal sequence of 'EPIA' instead of 'DPIA' in the avermectin cluster and as 'EPIA' in the FK506 cluster (see 3.5). PCR12F (Seq lD 8)

TTCATATGCAGAGGATGGACGGCGGGGAAGAACCCCGCCCTGCGG

Λfctel UES5_Rev (Seq ID 17)

TTCGATCGGTTCGTCCGCCGCTGCCGTGCCTCCGTGGCCGCTGGGTG Pvu\ 3.5 Assembly of the two flanking fragments and the replacement module.

The Spe\ Nde\ fragment of 'pUC1 9 fkbP'O 506 left' was ligated with Spe\ Nde\ cut pKC1139B01 resulting in pUS1 1. A 3-fragment ligation was performed with the 4.72 kb Nde\ Xba\ fragment of pUS11 , the 1.46 kb Nde\ Pvu\ fragment of 'pUC19 ave load middle' and the 2.29 kb Pvu\ Xba\ fragment of 'pUC19 fkbB' 506 right'. The resulting plasmid was named pUS14.

3.6 Transformation of Streptomyces tsukubaensis

Escherichia coli ET12567 (pUZ8002) was transformed with pUS14 by electroporation to generate the E. coli donor strain for conjugation . This strain was used to transform Streptomyces tsukubaensis by spore conjugation (as described in Materials & Methods). Exconjugants were plated on R6 agar and incubated at 37°C. pUS14 is not able to self- replicate in Streptomyces tsukubaensis at 37 ⁰C and must integrate into the genome. Transformants were subcultured onto MAM plates with apramycin (100 mg/L) and nalidixic acid (50 mg/L) at 37 ⁰C and subcultured again onto MAM plates with apramycin (50 mg/L) and nalidixic acid (25 mg/L) at 37 ⁰C, and once more onto MAM plates containing apramycin (50 mg/L), to ensure that the pUS14 plasmid with resistance marker had integrated. Subculturing to allow secondary recombination was carried out as follows: the transformants were subcultured for three subsequent rounds at 37 ⁰C on MAM plates with no antibiotic and a final time at 28 ⁰C. The transformants from the last subculture on antibiotic free plates were plated for spore harvest on ISP4 medium at 28 ⁰C. Serial dilutions were made from the filtered collected spores and plated on MAM plates to achieve single colonies.

3.7 Screening for secondary crosses Single colonies were patched in duplicate onto MAM supplemented with 50 mg/L apramycin and MAM containing no antibiotics, and grown at 28 ⁰C for 7 - 8 days. A selection of patches that grew on the no antibiotic plate but did not grow on the apramycin plate were screened to test if the desired double recombination event had occurred. A 6 mm circular plug from each patch that had lost the marker was used to inoculate individual 50 mL falcon tubes containing 7 mL NGY (See Media Recipes) without antibiotics and grown for 2 days at 28 ⁰C, 300 rpm, 2.5 cm throw. These were then used to inoculate (0.5 mL into 7 mL - 7% inoculum) PYDG+MES medium (See Media Recipes) in a 50 mL falcon tube at 28 ⁰C, 300 rpm, 2.5 cm throw. After 24 h, each falcon tube was fed with 50 μL 0.32 M cyclobutyl carboxylic acid, to give a final concentration of 2 mM acid, and shaking incubation was continued as before. The cultures were sampled after 6 days total growth and analysed by LC-MS. A total of 26 out of 51 isolates had undergone the desired double recombination event. A selection of isolates were re-tested in triplicate and ultimately a strain was selected as the FK506 ave-load strain. This strain was designated as "BIOT-4276".

Example 4 - Generation of a Streptomyces tsukubaensis strain in which the loading module and KS1of the FK506 PKS are replaced by the loading module and KS1 of the avermectin PKS from Streptomyces avermitilis.

4.1 Cloning of the left flanking sequence located upstream of the FK506 loading module, (see 3.1 )

Plasmid 'pUC19 fkbP'O 506 left' from section 3.2 was used to provide the left flanking region.

4.2 Cloning of the right flanking sequence located downstream of the FK506 loading module + KS1 (within FK506 fkbB) Oligos UES10_For and UES10_Rev were used to amplify a 2.23 kb region of DNA from Streptomyces tsukubaensis using cosmid 3G9 template and KOD polymerase. PCR samples were supplemented with 10% DMSO. Annealing temperatures between 66 and 71 ⁰C and extension for 1 .5 min at 68 ⁰C were used. A 5' extension was designed for each oligo to introduce restriction sites {Sfo\, Xba\) to aid cloning of the amplified fragment. The 2.23 kb PCR fragment was ligated with Sma\ digested and SAP-treated pUC19 resulting in plasmid 'pUC19 fkbB" 506 right'. The insert sequence was verified by sequencing. The choice of Sfo\ as restriction site immediately downstream of fkbB KS1 introduces a mutation (GTG to GCG) with the translated code changing from VPEVS' to 'APEVS' (see 4.4). UES10_For (Seq lD 18) TTGGCGCCGGAGGTTTCGGTCTCTCCCACAGAGTCGTCCGGTG

Sfo\ UES10_Rev (Seq ID 19)

GCTCTAGAGGGCGGGCATATCGGTGAGGTCGGTGAGGTCGTCC

Xba\

4.3 Cloning of a DNA fragment coding for S. avermitilis loading module and KS1

Oligos PCR12F and UES9_Rev were used to amplify a 2.75 kb region of DNA from Streptomyces avermitilis (DSM41443J using genomic DNA template (Kieser et al., 2000) and KOD Polymerase. PCR samples were supplemented with 1 0% DMSO . Annealing temperatures between 66 and 71 ⁰C and extension for 1.5 min at 68 ⁰C proved to be most successful. A 5' extension was designed for each oligo to introduce restriction sites (Λ/αtel, Afe\) to aid cloning of the amplified fragment. The 2.75 kb PCR fragment was ligated with Sma\ digested and SAP-treated pUC19, resulting in plasmid 'pUC19 ave load/KS1 middle' and the insert verified by sequencing. PCR12F comprises the 5' end of ave loading module and the choice of Nde\ introduces a mutation resulting in the N-terminal sequence of the loading module being ' MQR' instead of 'VQR' in the avermectin PKS. Through the introduction of an Afe\ site downstream of KS1 and the subsequent blunt end ligation {Afe\/Sfo\) with the right hand Fk506 fragment, the translated code of the sequence following KS1 would be 'EAP' (as with avermectin PKS) rather than 'GVP' (as with FK506 PKS). PCR12F (Seq lD 8) TTCATATGCAGAGGATGGACGGCGGGGAAGAACCCCGCCCTGCGG

Λfctel UES9_Rev (Seq ID 20)

GGAGCGCTTCCTCCAAAATCACATGCGCATTCGTGCCGCCGATCC

Afe\

4.4 Assembly of pUS16 which carries the replacement module and the two flanking fragments The Spe\ Nde\ fragment of 'pUC1 9 fkbP'O 506 left' was ligated with Spe\ Nde\ cut pKC1139B01 resulting in pUS1 1. A 3-fragment ligation was performed with the 4.72 kb Nde\ Xba\ fragment of pUS1 1 , the 2.75 kb Nde\ Afe\ fragment of 'pUC19 ave load/KS1 middle' and the 2.23 kb Pvu\ Xba\ fragment of 'pUC19 fkbB" 506 right'. The resulting plasmid was named pUS16.

4.5 Transformation of Streptomyces tsukubaensis

Escherichia coli ET12567 (pUZ8002) was transformed with pUS16 by electroporation to generate the E. coli donor strain for conjugation . This strain was used to transform Streptomyces tsukubaensis by spore conjugation (as described in Materials & Methods). Exconjugants were plated on R6 agar and incubated at 37°C. pUS16 is not able to self- replicate in Streptomyces tsukubaensis at 37 ⁰C and must integrate into the genome. Transformants were subcultured onto MAM plates with apramycin (100 mg/L) and nalidixic acid (50 mg/L) at 37 ⁰C and subcultured again onto MAM plates with apramycin (50 mg/L) and nalidixic acid (25 mg/L) at 37 ⁰C, and once more onto MAM plates containing apramycin (50 mg/L), to ensure that the pUS16 plasmid with resistance marker had integrated. Subculturing to allow secondary recombination was carried out as follows: the transformants were subcultured for three subsequent rounds at 37 ⁰C on MAM plates with no antibiotic and a final time at 28 ⁰C. The transformants from the last subculture on antibiotic free plates were plated for spore harvest on ISP4 medium at 28 ⁰C. Serial dilutions were made from the filtered collected spores and plated on MAM plates to achieve single colonies.

4.6 Screening for secondary crosses Single colonies were patched in duplicate onto MAM supplemented with 50 mg/L apramycin and MAM containing no antibiotics, and grown at 28 ⁰C for 7 - 8 days. A selection of patches that grew on the no antibiotic plate but did not grow on the apramycin plate were screened to test if the desired double recombination event had occurred. A 6 mm circular plug from each patch that had lost the marker was used to inoculate individual 50 ml. falcon tubes containing 7 ml. NGY (See Media Recipes) without antibiotics and grown for 2 days at 28 ⁰C, 300 rpm with a 2.5 cm throw. These were then used to inoculate (0.5 ml. into 7 ml. - 7% inoculum) PYDG+MES medium (See Media Recipes) in a 50 ml. falcon tube at 28 ⁰C, 300 rpm with a 2.5 cm throw. After 24 h, each falcon tube was fed with 50 ml. 0.32 M cyclobutyl carboxylic acid, to give a final concentration of 2 mM acid, and shaking incubation was continued as before. The cultures were sampled after 6 days total growth and analysed by LC-MS. A total of 18 out of 42 isolates had undergone the desired double recombination event.

Example 5 - Array feeding to BIOT-4276 with various starter units

Spore stocks of BIOT-4276 (section 3.7) were prepared after growth on ISP4 medium and preserved in 20% (w/v) glycerol in distilled water and stored at -80 ⁰C. Spore stocks were recovered on plates of ISP4 medium and incubated from 5 - 21 days at 28 ⁰C. Vegetative cultures (seed cultures) were prepared by removing one agar plug (6 mm in diameter) from the ISP4 plate and inoculating into 7 ml. medium NGY in 50 ml. centrifuge tubes with foam plugs. The culture tubes were incubated at 28 ⁰C, 300 rpm (2.5 cm throw) for 48 h. From the seed culture 0.5 ml. was transferred into 7 ml. production medium PYDG + MES in 50 ml_ centrifuge tubes with foam plugs. Cultivation was carried out at 28 ⁰C and 300 rpm (2.5 cm throw). For production of FK506 analogues, 0.05 ml. of a 0.32 M methanolic solution of the feed compound was added to each tube at 24 hours post inoculation to give a final concentration of 2.12 mM. Cultivation was continued for additional five days post feeding at 28 ⁰C and 300 rpm (2.5 cm throw). A series of acids were fed to BIOT-4276 and production of FK506 analogues was observed by LC-MS.

References

Armstrong, V.W. and Oellerich, M. (2001 ) New developments in the immunosuppressive drug monitoring of cyclosporine, tacrolimus and azathioprine. Clinical Biochemistry 34(1 ): 9-16

Aparicio, J. F., Molnar, I., Schwecke, T., Konig, A., Haydock, S. F., Khaw, L. E., Staunton, J., and Leadlay, P. F. (1996) Organization of the biosynthetic gene cluster for rapamycin in Streptomyces hygroscopicus: analysis of the enzymatic domains in the modular polyketide synthase. Gene 169: 9-16. Baker, H., Sidorowicz, A., Sehgal, S. N., and Vezina, C. (1978) Rapamycin (AY-22,989), a new antifungal antibiotic. III. In vitro and in vivo evaluation. Journal of Antibiotics 31 : 539-545.

Bierman, M., Logan, R., O'Brien, K., Seno, E. T., Nagaraja Rao, R., and Schoner, B. E. (1992) Plasmid cloning vectors for the conjugal transfer of DNA from Escherichia coli to

Streptomyces spp. Gene 116: 43-49.

Blanc, V., Lagneaux, D., Didier, P., Gil, P., Lacroix, P., and Crouzet, J. (1995) Cloning and analysis of structural genes from Streptomyces pristinaespiralis encoding enzymes involved in the conversion of pristinamycin II_B to pristinamycin II_A (PII_A): PH_A synthase and NADH:riboflavin 5'-phosphate oxidoreductase. Journal of Bacteriology 177: 5206-

5214.

Blanc, V., Gil, P., Bamas-Jacques, N., Lorenzon, S., Zagorec, M., Schleuniger, J., Bisch, D., Blanche, F., Debussche, L., Crouzet, J., and Thibaut, D. (1997) Identification and analysis of genes from Streptomyces pristinaespiralis encoding enzymes involved in the biosynthesis of the 4-dimethylamino-L-phenylalanine precursor of pristinamycin I.

Molecular Microbiology 23: 191-202.

Cannell, RJ. P, Ed., (1998) "Natural Products Isolation", Methods in Biotechnology, 4, Humana Press.

Cao, W., Mohacsi, P., Shorthouse, R., Pratt, R. and Morris, R. E. (1995). Effects of rapamycin on growth factor-stimulated vascular smooth muscle cell DNA synthesis. Inhibition of basic fibroblast growth factor and platelet-derived growth factor action and antagonism of rapamycin by FK506. Transplantation 59(3): 390-395.

Carlson, R. P., Hartman, D.A., Tomchek, L.A., Walter, T. L., Lugay, J. R., Calhoun, W., Sehgal, S. N., Chang, J.Y. (1993). Rapamycin, a potential disease-modifying antiarthritic drug. J. Pharmacol. Exp. Ther. 266(2):1 125-38.

Carter, G.T., Nietsche, J.A., Hertz, M. R., Williams, D. R., Siegel, M. M., Morton, G.O., James, J. C, Borders, D. B. (1988). LL-F28249 antibiotic complex: a new family of antiparasitic macrocyclic lactones. Isolation, characterization and structures of LL-F28249 alpha, beta, gamma, lambda. J. Antibiot. 41(4): 519-529. Chambraud, B., Radanyi, C, Camonis, J. H., Shazand, K., Rajkowski, K., and Baulieu, E. E. (1996) FAP48, a new protein that forms specific complexes both immunophilins FKBP59 and FKBP12. Prevention by the immunosuppressant drugs FK506 and rapamycin. Journal of Biological Chemistry 271 : 32923-32929. Chang, J.Y., Sehgal, S. N., and Bansbach, CC. (1991 ) FK506 and rapamycin: novel pharmacological probes of the immune response. Trends in Pharmacological

Sciences 12: 218-223. Chen, J., Zheng, X. F., Brown, EJ. , and Schreiber, S. L. (1995) Identification of an 1 1-kDa FKBP12-rapamycin-binding domain within the 289-kDa FKBP12-rapamycin- associated protein and characterization of a critical serine residue. Proceedings of the National Academy of Sciences of the United States of America 92: 4947-4951. Choi, S-S., Hur, Y-A., Sherman, D.H., Kim, E-S. (2007) Isolation of the biosynthetic gene cluster for tautomycetin, a linear polyketide T-cell specific immunomodulator from Streptomyces sp. CK4412 Microbiology 153:1095-1 102

DiLeIIa, A.G., and Craig, RJ. (1991 ) Exon organization of the human FKBP-12 gene: correlation with structural and functional protein domains. Biochemistry 30: 8512- 8517.

Du, L.C., Sanchez, C, Chen, M., Edwards, DJ., and Shen, B. (2000) The biosynthetic gene cluster for the antitumor drug bleomycin from Streptomyces verticillus ATCC15003 supporting functional interactions between nonribosomal peptide synthetases and a polyketide synthase. Chemistry & Biology 7: 623-642. Dudkin, L., Dilling, M. B., Cheshire, PJ., Harwood, F. C, Hollingshead, M., Arbuck, S. G.,

Travis, R., Sausville, E.A., Houghton, PJ. (2001 ). Biochemical correlates of mTOR inhibition by the rapamycin ester CCI-779 and tumor growth inhibition. Clin. Cancer Res. 7(6): 1758-64

Dumont, F., Staruch, MJ., Koprak, S. L., Siekierka, Lin, CS. , Harrison, R., Sewell, T., Kindt, V.M., Beattie, T.R., Wyvratt, M. and Sigal, N. H. (1992)The immunosuppressive and toxic effects of FK506 are mechanistically related: Pharmacology of a novel antagonist of FK506 and Rapamycin. Journal of Experimental Medicine, 176:751-760 (1992)

Dutton, C. J., S. P. Gibson, et al. (1991 ). "Novel avermectins produced by mutational biosynthesis." J. Antibiot. 44(3): 357-365. Fang, J., Zhang, Y., Huang, L., Jia, X., Zhang, Q., Zhang, X., Tang, G. and Liu, W. (2008). Cloning and characterisation of the tetrocarcin A gene cluster from Micromonospora chalcae NRRL 11289 reveals a highly conserved strategy for tetronate biosynthesis in spirotetronate antibiotics. J. Bact. 190(17): 6014-6025

Fehr, T., Sanglier, J-J., Schuler, W., Gschwind, L., Ponelle, M., Schilling, W., Wioland, C. (1996). Antascomicinc A, B, C, D and E: Novel FKBP12 binding compounds from a

Micromonospora strain. J. Antibiot. 49(3): 230-233.

Findlay J.A, and Radics, L. (1980) Canadian Journal of Chemistry 58:579.

Fishbein, T.M., Florman, S., Gondolesi, G., Schiano, T., LeLeiko, N., Tschernia, A., Kaufman,

S. (2002). Intestinal transplantation before and after the introduction of sirolimus. Transplantation. 73(10): 1538-42.

Foey, A., Green, P., Foxwell, B., Feldmann, M., Brennan, F. (2002). Cytokine-stimulated T cells induce macrophage IL-10 production dependent on phosphatidylinositol 3-kinase and p70S6K: implications for rheumatoid arthritis. Arthritis Res. 4(1):64-70. Epub

2001 Oct 10.

Gaisser, S., Reather, J., Wirtz, G., Kellenberger, L., Staunton, J., and Leadlay, P. F. (2000) A defined system for hybrid macrolide biosynthesis in Saccharopolyspora erythraea.

Molecular Microbiology 36: 391-401. Galat, A. (2000) Sequence diversification of the FK506-binding proteins in several different genomes. European Journal of Biochemistry 267: 4945-4959. Garrity, G. M., Heimbuch, B. K., Motamedi, H., Shafiee, A. (1993) Genetic relationships among Actinomycetes that produce the immunosuppressant macrolides FK506,

FK520/FK523 and rapamycin. Journal of Industrial Microbiology 12(1): 42-47 Gregory, C. R., Huie, P., Billingham, M. E. and Morris, R. E. (1993). Rapamycin inhibits arterial intimal thickening caused by both alloimmune and mechanical injury. Its effect on cellular, growth factor and cytokine response in injured vessels. Transplantation 55(6):1409-1418.

Guba, M., von Breitenbuch, P., Steinbauer, M., Koehl, G., Flegel, S., Hornung, M., Bruns,

CJ. , Zuelke, C, Farkas, S., Anthuber, M., Jauch, K.W., and Geissler, E. K. (2002)

Rapamycin inhibits primary and metastatic tumor growth by antiangiogenesis: involvement of vascular endothelial growth factor. Nature Medicine 8: 128-135. Hamilton, G. S., and Steiner, J. P. (1998) Immunophilins: Beyond immunosuppression. Journal of Medicinal Chemistry 41 : 5119-5143. Hatanaka, H., Kino, T., Miyata, S., Inamura, N., Kuroda, A., Goto, T., Tanaka, H., Okuhara,

M. (1988). FR-900520 and FR-900523, novel immunosuppressants isolated from a

Streptomyces. II. Fermentation, isolation and physico-chemical and biological characteristics. J. Antibiot. (Tokyo). 41(11):1592-601.

Hatanaka H, Kino T, Asano M, Goto T, Tanaka H, Okuhara M. (1989). FK-506 related compounds produced by Streptomyces tsukubaensis No. 9993. J. Antibiot. (Tokyo).

42(4):620-2.

Hendrickson, B.A., Zhang, W., Craig, R. J., Jin, Y.J., Bierer, B. E., Burakoff, S., and DiLeIIa, A.G. (1993) Structural organization of the genes encoding human and murine FK506- binding protein (FKBP)13 and comparison to FKBP1. Gene 134: 271-275. Hopwood, D.A. (1997) Genetic contributions to understanding polyketide synthases.

Chemical Reviews 97: 2465-2497.

Hosted, T.J., and Baltz, R. H. (1997) Use of rpsL for dominance selection and gene replacement in Streptomyces roseosporus. Journal of Bacteriology 179: 180-186.

Hung, D.T., and Schreiber, S. L. (1992) cDNA cloning of a human 25 kDa FK506 and rapamycin binding protein. Biochemical and Biophysical Research Communications

184: 733-738. Hung, DT. , Jamison, T. F., and Schreiber, S. L. (1996) Understanding and controlling the cell cycle with natural products. Chemistry & Biology 3: 623-639. Jain, S., Bicknell, G. R., Whiting, P. H., Nicholson, M. L. (2001 ). Rapamycin reduces expression of fibrosis-associated genes in an experimental model of renal ischaemia reperfusion injury. Transplant Proc. 33(1 -2):556-8. Jin, Y.J., Burakoff, S. J., and Bierer, B. E. (1992) Molecular cloning of a 25-kDa high affinity rapamycin binding protein, FKBP25. Journal of Biological Chemistry 267: 10942- 10945.

Kahan, B. D., Chang, J.Y., and Sehgal, S.N. (1991 ) Preclinical evaluation of a new potent immunosuppressive agent, rapamycin. Transplantation 52: 185-191. Kahan, B. D., and Camardo, J. S. (2001 ) Rapamycin: Clinical results and future opportunities. Transplantation 72:1181-1 193. Kapturczak, H. U., Meier-Kriesche, and Kaplan, B. (2004) Pharmacology of Calcineurin

Antagonists. Transplantation Proceedings 36(supp 2S): 25S-32S Khaw, L.E., Bohm, G.A., Metcalfe, S., Staunton, J., and Leadlay, P. F. (1998) Mutational biosynthesis of novel rapamycins by a strain of Streptomyces hygroscopicus NRRL

5491 disrupted in rapL, encoding a putative lysine cyclodeaminase. Journal of Bacteriology 180: 809-814.

Kieser, T., Bibb, M.J., Buttner, M.J., Chater, K.F., and Hopwood, D.A. (2000) Practical

Streptomyces Genetics, John lnnes Foundation, Norwich. Kirby, B., and Griffiths, C. E. M. (2001 ) Psoriasis: the future. British Journal of Dermatology

144:37-43. Kirchner, G.I., Winkler, M., Mueller L., Vidal, C, Jacobsen, W., Franzke, A., Wagner, S.,

Blick, S., Manns M. P., and Sewing K.-F.(2000) Pharmacokinetics of SDZ RAD and cyclosporin including their metabolites in seven kidney graft patients after the first dose of SDZ RAD. British Journal of Clinical Pharmacology 50:449-454. Konig, A., Schwecke, T., Molnar, I., Bohm, G., Lowden, P.A.S., Staunton, J., and Leadlay, P. F. (1997) The pipecolate-incorporating enzyme for the biosynthesis of the immunosuppressant rapamycin. Nucleotide sequence analysis, disruption and heterologus expression of rapP from Streptomyces hygroscopicus. European Journal of Biochemistry 247: 526-534.

Konz, D. and M. A. Marahiel (1999). "How do peptide synthetases generate structural diversity?" Chemistry & Biology 6(2): R39-R48.

Lowden, P.A.S., Bohm, G., Staunton, J., and Leadlay, P. F. (1996) The nature of the starter unit for the rapamycin polyketide sythase. Angewandte Chemie 35: 2249-2251.

Lowden, P. A. S., (1997) Ph.D. Dissertation, University of Cambridge. "Studies on the biosynthesis of rapamycin".

Lowden, P.A.S., Wilkinson, B., Bohm, G.A., Handa, S., Floss, H. G., Leadlay, P. F., and Staunton, J. (2001 ) Origin and true nature of the starter unit for the rapamycin polyketide synthase. Angewandte Chemie-lnternational Edition 40: 777-779.

Lyons, W. E., George, E. B., Dawson, T.M., Steiner, J. P., and Snyder, S. H. (1994)

Immunosuppressant FK506 promotes neurite outgrowth in cultures of PC12 cells and sensory ganglia. Proceedings of the National Academy of Sciences of the United States of America 91 :3191 -3195.

MacNeil, DJ. , Gewain, K.M., Ruby, C. L., Dezeny, G., Gibbons, P. H., and MacNeil, T. (1992) Analysis of Streptomyces avermitilis genes required for avermectin biosynthesis utilizing a novel integration vector. Gene 111 : 61-68.

Maes, B. D. and Vanrenterghem, Y.F.Ch. (2004) Cyclosporine: Advantages Versus Disadvantages Vis-a-vis Tacrolimus. Transplantation Proceedings 36 (Suppl 2S):

40S-49S

Marahiel, M.A., Stachelhaus, T., and Mootz, H. D. (1997) Modular peptide synthetases involved in nonribosomal peptide synthesis. Chemical Reviews 97: 2651-2673.

Margulies et al., (2005) Genome sequencing in microfabricated high-density picolitre reactors. Nature 437: 376-380

March, J. Advanced Organic Chemistry - Reactions, Mechanisms and Structure. 4^th Edition. Wiley Interscience.

Meingassner, J. G., Grassberger, M., Fahrngruber, H., Moore, H. D., Schuurman, H. and

Stutz., A. (1997) A novel anti-inflammatory drug, SDZ ASM 981 , for the topical and oral treatment of skin diseases: in vivo pharmacology. British Journal of Dermatology

137:568-576

Molnar, I., Aparicio, J. F., Haydock, S. F., Khaw, L. E., Schwecke, T., Konig, A., Staunton, J., and Leadlay, P. F. (1996) Organisation of the biosynthetic gene cluster for rapamycin in Streptomyces hygroscopicus: analysis of genes flanking the polyketide synthase. Gene 169: 1-7.

Morice, M. C, Serruys, P.W., Sousa, J. E., Fajadet, J., Ban Hayashi, E., Perin, M., Colombo, A., Schuler, G., Barragan, P., Guagliumi, G., Molnar, F., Falotico, R. (2002). RAVEL Study Group. Randomized Study with the Sirolimus-Coated Bx Velocity Balloon- Expandable Stent in the Treatment of Patients with de Novo Native Coronary Artery Lesions. A randomized comparison of a sirolimus-eluting stent with a standard stent for coronary revascularization. N. Eng.l J. Med. 346(23): 1773-80. Motamedi, H., Shafiee, A., Cai, SJ. , Streicher, S. L., Arison, B. H., and Miller, R.R. (1996)

Characterization of methyltransferase and hydroxylase genes involved in the biosynthesis of the immunosuppressants FK506 and FK520. Journal of Bacteriology

178: 5243-5248. Motamedi, H., Cai, S. J., Shafiee, A., and Elliston, K. O. (1997) Structural organization of a multifunctional polyketide synthase involved in the biosynthesis of the macrolide immunosuppressant FK506. European Journal of Biochemistry 244: 74-80. Motamedi, H., and Shafiee, A. (1998) The biosynthetic gene cluster for the macrolactone ring of the immunosuppressant FK506. European Journal of Biochemistry 256: 528-534. Muramatsu, H., Mokhtar, S. I., Katsuoka, M. and Ezaki, M. (2005) Phylogenetic Analysis of

Immunosuppressant FK506-Producing Streptomycete Strains. Actinomycetologica

19:33-39 Myckatyn, T. M., Ellis, R.A., Grand, A.G., Sen, S. K., Lowe, J. B. 3rd, Hunter, D.A., Mackinnon,

S. E. (2002). The effects of rapamycin in murine peripheral nerve isografts and allografts. Plast. Reconstr. Surg. 109(7):2405-17.

Navia, M.A. (1996) Protein-drug complexes important for immunoregulation and organ transplantation. Current Opinion in Structural Biology 6: 838-847. Nghiem, P., Pearson, G., and Langley, R. G. (2002) Tacrolimus and pimecrolimus: From clever prokaryotes to inhibiting calcineurin and treating atopic dermatitis. Journal of the American Academy of Dermatology 46: 228-241

NCCLS Reference Method for Broth Dilution Antifungal Susceptibility Testing for Yeasts:

Approved Standard M27-A, vol. 17 No. 9. (1997). Okazaki, T., Ono, M., Aoki, A., Fukuda, R. (1983) Milbemycins, a new family of macrolide antibiotics: producing organism and its mutants. J. Antibiot. (1983) 36(4): 438-441 Oliynyk, M., Stark, C.B.W., Bhatt, A., Jones, M.A., Hughes-Thomas, Z.A., Wilkinson, C,

Oliynyk, Z., Demydchuk, Y., Staunton, J., Leadlay, P. F. (2003) Analysis of the biosynthetic gene cluster for the polyether antibiotic monensin in Streptomyces cinnamonensis and evidence for the role of monB and monC genes in oxidative cyclization MoI. Micro. 49(5): 1 179-1 190 Paget, M.S. B., Chamberlin, L., Atrih, A., Foster, SJ. , and Buttner, MJ. (1999) Evidence that the extracytoplasmic function sigma factor σ^E is required for normal cell wall structure in Streptomyces coelicolor A3(2). Journal of Bacteriology 181 : 204-21 1 ) Paiva, N. L., Demain, A.L., and Roberts, M. F. (1991 ) Incorporation of acetate, propionate, and methionine into rapamycin By Streptomyces hygroscopicus. Journal of Natural Products 54: 167-177.

Paiva, N. L., Demain, A.L., and Roberts, M. F. (1993) The immediate precursor of the nitrogen- containing ring of rapamycin is free pipecolic acid. Enzyme and Microbial Technology

15: 581-585. Patterson, C. E., Schaub, T., Coleman, E. J., and Davies E. C. (2000) Developmental regulation of FKBP65. An ER-localized extracellular matrix binding-protein. Molecular Biology of the Cell 11 :3925-3935.

Pfeifer, B.A., Admiraal, SJ. , Gramajo, H., Cane, D.E., and Khosla, C. (2001 ) Biosynthesis of complex polyketides in a metabolically engineered strain of E. coli. Science 291 :

1790-1792.

Powell, N., Till, S., Bungre, J., Corrigan, C. (2001 ). The immunomodulatory drugs cyclosporin A, mycophenolate mofetil, and sirolimus (rapamycin) inhibit allergen-induced proliferation and IL-5 production by PBMCs from atopic asthmatic patients.

J. Allergy Clin. Immunol. 108(6):915-7 Rabinovitch, A., Suarez-Pinzon, W. L., Shapiro, A.M., Rajotte, R.V., Power, R. (2002).

Combination therapy with sirolimus and interleukin-2 prevents spontaneous and recurrent autoimmune diabetes in NOD mice. Diabetes. 51(3):638-45.

Rawlings, BJ. (2001 ) Type I polyketide biosynthesis in bacteria (Part A). Natural Product

Reports 18: 190-227. Reitamo, S., Spuls, P., Sassolas, B., Lahfa, M., Claudy, A., Griffiths, C. E.; Sirolimus

European Psoriasis Study Group. (2001 ). Efficacy of sirolimus (rapamycin) administered concomitantly with a subtherapeutic dose of cyclosporin in the treatment of severe psoriasis: a randomized controlled trial. Br. J. Dermatol. 145(3):438-45. Reynolds, K.A., and Demain, A.L. (1997) "Rapamycin, FK506 and Ascomycin-related

Compounds" pp497-520, Biotechnology of Antibiotics: Second Edition, Revised and

Expanded. W.R.Strohl, Ed. Rosen, M. K., and Schreiber, S. L. (1992) Natural products as probes of cellular function: studies of immunophilins. Angewandte Chemie-lnternational Edition in English 31 :

384-400. Roy, J. N., Barama, A., Poirier, C, Vinet, B. Roger, M. (2006) Cyp3A4, Cyp3A5, and MDR-1 genetic influences on tacrolimus pharmacokinetics in renal transplant recipients Pharmacogenetics 16(9): 659-665

Roymans, D., and Siegers, H. (2001 ) Phosphaditidylinositol 3-kinases in tumor progression.

European Journal of Biochemistry 268:487-498. Schwarzer, D., and Marahiel, M.A. (2001 ) Multimodular biocatalysts for natural product assembly. Naturwissenschaften 88: 93-101. Sambrook, J., Fritsch, E. F., and Maniatis, T. (1989) Molecular cloning: a laboratory manual,

2nd ed. Cold Spring Harbor Laboratory Press, N.Y. Sambrook, J., and Russell, D.W. (2001 ) Molecular cloning: a laboratory manual, 3rd ed. Cold

Spring Harbor Laboratory Press, N.Y. Schreiber, S. L., and Crabtree, G. R. (1992) The mechanism of action of cyclosporine A and

FK506. Immunology Today λZ: 136-142. Schwecke, T., Aparicio, J. F., Molnar, I., Konig, A., Khaw, L. E., Haydock, S. F., Oliynyk, M.,

Caffrey, P., Cortes, J., Lester, J. B., Bohm, G.A., Staunton, J., and Leadlay, P. F.

(1995) The biosynthetic gene cluster for the polyketide immunosuppressant rapamycin. Proceedings of the National Academy of Sciences of the United States of

America 92: 7839-7843. Sedrani, R., Cottens, S., Kallen, J., and Schuler, W. (1998) Chemical modifications of rapamycin: the discovery of SDZ RAD. Transplantation Proceedings 30: 2192-2194. Sehgal, S. N., Baker, H., and Vezina, C. (1975) Rapamycin (AY-22,989), a new antifungal antibiotic II. Fermentation, isolation and characterization. The Journal of Antibiotics 28:

727-733. Shepherd, P. R , Withers, DJ. , and Siddle K. (1998) Phosphoinositide 3-kinase: the key switch mechanism in insulin signalling. Biochemical Journal 333: 471-490. Shima, J., Hesketh, A., Okamoto, S., Kawamoto, S., and Ochi, K. (1996) Induction of actinorhodin production by rpsL (encoding ribosomal protein S12) mutations that confer streptomycin resistance in Streptomyces lividans and Streptomyces coelicolor A3(2). Journal of Bacteriology 178: 7276-7284.

Sigal, N. H., and Dumont, FJ. (1992) Cyclosporine A, FK-506, and rapamycin: pharmacological probes of lymphocyte signal transduction. Annual Review of

Immunology 10: 519-560.

Sigal, N. H., Dumont, F., Durette, P., Siekierka, JJ., Peterson, L., Rich, D., Dunlap, B. E., Staruch, MJ., Melino, M. R., Koprak, S. L., Williams, D., Witzel,B. and Pisano, J. M.

(1991 ) Is Cyclophilin Involved in the Immunosuppressive and Nephrotoxic Mechanism of Action of Cyclosporin A? Journal of Experimental Medicine 173:619-628 Staunton, J., and Weissman, KJ. (2001 ) Polyketide biosynthesis: a millennium review.

Natural Product Reports 18: 380-416. Steiner, J. P., Hamilton, G. S., Ross, D. T., Valentine, H. L., Guo, H., Connolly, M.A., Liang, S.,

Ramsey, C, Li, J.-H J., Huang, W., Howorth, P., Soni, R., Fuller, M., Sauer, H.,

Nowotnik, A.C., and Suzdak, P. D. (1997) Neutrophic immunophilin ligands stimulate structural and functional recovery in neurodegenerative animal models. Proceedings of the National Academy of Sciences of the United States of America 94:2019-2024. Strassler, C, Linden, A., and Heimgartner, H. (1997) Novel heterospirocyclic 3-amino-2/-/- azirines as synthons for heterocyclic α-amino acids. HeIv. Chim. Acta. 80: 1528-1554 Tamura, S., Tokunaga, Y., Ibuki, R., Amidon, G. L., Sezaki, H. and Yamashita, S. (2003) The site specific transport and metabolism of Tacrolimus in the rat small intestine. The

Journal of Pharmacology and Experimental Therapeutics 306: 310-316 Takiguchi, Y., Mishima, H., Okuda, M., Terao, M., Aoki, A., Fukuda, R. Milbemycins, a new family of macrolide antibiotics: fermentation, isolation and physico-chemical properties. J. Antibiot. (1980) 33(10): 1120-7 Van Duyne, G. D., Standaert, R.F., Karplus, P.A., Schreiber, S. L., and Clardy, J. (1993)

Atomic structures of the human immunophilin FKBP-12 complexes with FK506 and rapamycin. Journal of Molecular Biology 229: 105-124. Vilella-Bach, M., Nuzzi, P., Fang, Y.M., and Chen, J. (1999) The FKBP12-rapamycin-binding domain is required for FKBP12-rapamycin-associated protein kinase activity and Gi progression. Journal of Biological Chemistry 274: 4266-4272. Waller, J. R., and Nicholson, M. L. (2001 ) Molecular mechanisms of renal allograft fibrosis.

British Journal of Surgery 88:1429-1441. Warner, L. M., Adams, L.M., Chang, J.Y., Sehgal, S.N. (1992). A modification of the in vivo mixed lymphocyte reaction and rapamycin's effect in this model. Clin. Immunol.

Immunopathol. 64(3):242-7. Ward, D. E., Ross, R.P., Van der Weijden, C. C, Snoep, J. L., Claiborne, A.L. Catabolism of branched-chain . alpha. -keto acids in Enterococcus faecalis: the bkd gene cluster, enzymes, and metabolic route. J. Bad (1999), 181(17): 5433-5442.

Wei, X., Liang, Y., Zheng, Y. Enhancement and Selective Production of Oligomycin through

Inactivation of Avermectin's Starter Unit in Streptomyces avermitilis. Biotechnology

Letters (2006), 28(12), 91 1-916

Wilkinson, B., Foster, G., Rudd, B.A.M., Taylor, N. L., Blackaby, A.P., Sidebottom, PJ. , Cooper, D. J., Dawson, MJ. , Buss, A.D., Gaisser, S., Bohm, I. U., Rowe, CJ., Cortes,

J., Leadlay, P. F. and Staunton, J. (2000). Novel octaketide macrolides related to 6- deoxoerythronolide B provide evidence for iterative operation of the erythromycin polyketide synthase. Chemistry & Biology 7: 1 11-1 17.

Wu, K., Chung, L., Revill, W. P., Katz, L., and Reeves, CD. (2000) The FK520 gene cluster of Streptomyces hygroscopicus var. ascomyceticus (ATCC 14891 ) contains genes for biosynthesis of unusual polyketide extender units. Gene 251 : 81-90. Yem, A.W., Tomasselli, A.G., Heinrikson, R. L., Zurcher-Neely, H., Ruff, V.A., Johnson, R.A., and Deibel, M. R. (1992) The Hsp56 component of steroid receptor complexes binds to immobilized FK506 and shows homology to FKBP-12 and FKBP-13. Journal of Biological Chemistry 267: 2868-2871.

Yu, K., Toral-Barza, L., Discafani, C, Zhang, W. G., Skotnicki, J., Frost, P., Gibbons, JJ. (2001 ) mTOR, a novel target in breast cancer: the effect of CCI-779, an mTOR inhibitor, in preclinical models of breast cancer. Endocrine-Related Cancer 8:249-258. Zhu, J., Wu J., Frizell, E., Liu, S.L., Bashey, R., Rubin, R., Norton, P., Zern, M.A. (1999).

Rapamycin inhibits hepatic stellate cell proliferation in vitro and limits fibrogenesis in an in vivo model of liver fibrosis. Gastroenterology. 117(5): 1198-204.

Throughout the specification and the claims which follow, unless the context requires otherwise, the word 'comprise', and variations such as 'comprises' and 'comprising', will be understood to imply the inclusion of a stated integer, step, group of integers or group of steps but not to the exclusion of any other integer, step, group of integers or group of steps.

All documents referred to herein, including patents and patent applications, are incorporated by reference in their entirety.

Claims

1. A compound of formula (I)

wherein

(A) wherein R_4, R₅ and Re independently represent F, Cl, CrC₄ alkyl, OR₇, SR₇ or NHR₇ and R₇ represents H, d-C₄ alkyl or d-C₄ acyl, wherein two or three of R₄-R₆ are CrC₄ alkyl;

wherein R₂i represents H, F, Cl, CrC₄alkyl, OR22, SR22 or NHR22, and R22 represents H, Ci-C₄ alkyl or Ci-C₄ acyl

(G)

wherein R₂₃ and R₂₄ independently represent H, F, Cl, CrC₄ alkyl, OR₂5, SR₂5 or NHR₂₅ and R₂₅ represents H, Ci-C₄ alkyl or Ci-C₄ acyl ;

wherein R₃₀ R₃₁ and R₃₂ independently represent H, F, Cl, CrC₄ alkyl, OR₃₃, SR₃₃ or NHR₃₃ and R₃₃ represents H, CrC₄ alkyl or CrC₄ acyl;

(J) wherein R₃₈ R39 and R₄₀ independently represent H, F, Cl, CrC₄ alkyl, OR₄i, SR₄i or NHR₄₁ and R₄i represents H, CrC₄ alkyl or CrC₄ acyl, save that OR₄₁ shall not represent OH;

wherein R₅₂ R53, Rs₄ and R55 independently represent H, F, Cl, CrC₄ alkyl, OR₅6, SR₅6 or NHR₅₆ and R₅₆ represents H, CrC₄ alkyl or CrC₄ acyl, save that OR₅₆ shall not represent OH;

(L) wherein R₅₇ and R₅₈ independently represent H, F, Cl, CrC₄ alkyl, OR₅₉, SR₅₉ or NHR₅₉ and R₅₉ represents H, CrC₄ alkyl or CrC₄ acyl. or a physiologically functional derivative thereof.

2. A compound according to claim 1 wherein R₃ represents =0

3. A compound according to claim 1 or claim 2 wherein X^a represents a bond.

4. A compound according to claim 1 or claim 2 wherein X^a represents CH₂.

5. A compound according to any one of claims 1 to 4 wherein R₂ represents - CH₂CH=CH₂.

6. A compound according to any one of claims 1 to 4 wherein R₂ represents -CH₂CH₃.

7. A compound according to any one of claims 1 to 6 wherein R₁ represents [A].

8. A compound according to any one of claims 1 to 6 wherein R₁ represents [B].

9. A compound according to any one of claims 1 to 6 wherein R₁ represents [C].

10. A compound according to any one of claims 1 to 6 wherein R₁ represents [D].

1 1. A compound according to any one of claims 1 to 6 wherein Ri represents [E].

12. A compound according to any one of claims 1 to 6 wherein Ri represents [F].

13. A compound according to any one of claims 1 to 6 wherein Ri represents [G].

14. A compound according to any one of claims 1 to 6 wherein Ri represents [H].

15. A compound according to any one of claims 1 to 6 wherein Ri represents [J].

16. A compound according to any one of claims 1 to 6 wherein Ri represents [K].

17. A compound according to any one of claims 1 to 6 wherein Ri represents [L].

18. A compound according to claim 1 selected from:

and physiologically functional derivatives thereof.

19. A compound according to any one of claims 1 to 18 for use as a pharmaceutical.

20. A pharmaceutical composition comprising a compound according to any one of claims 1 to 18 together with one or more physiologically acceptable diluents or carriers.

21. A compound according to any one of claims 1 to 18 for use in the treatment or prophylaxis of organ rejection after transplantation, autoimmune diseases, fungal infections, cancer, neurodegeneration, psoriasis, rheumatoid arthrisis, fibrosis and/or other hyperproliferative disorders.

22. Use of a compound according to any one of claims 1 to 18 in the manufacture of a medicament for the treatment or prophylaxis of organ rejection after transplantation, autoimmune diseases, fungal infections, cancer, neurodegeneration, psoriasis, rheumatoid arthrisis, fibrosis and/or other hyperproliferative disorders.

23. A method of treatment or prophylaxis of organ rejection after transplantation, autoimmune diseases, fungal infections, cancer, neurodegeneration, psoriasis, rheumatoid arthrisis, fibrosis and/or other hyperproliferative disorders which comprises administering to a subject in need thereof a therapeutically effective amount of a compound according to any one of claims 1 to 18.

24. A method of producing compounds of formula (I) according to any one of claims 1 to 18 comprising:

(a) generating a recombinant strain of a FK506 or FK520 producing host that contains a biosynthetic cluster that encodes polypeptides involved in FK506 and FK520 analogue synthesis in which the natural loading module has been replaced by the loading module from the avermectin or an avermectin-like PKS; and

(b) feeding a non-natural non-natural starter unit to said recombinant strain;

25. A method of producing compounds of formula (I) according to any one of claims 1 to 18 comprising:

(b) culturing said strain; and

(c) optionally isolating compounds of formula (I).

26. A method of producing compounds of formula (I) according to any one of claims 1 to 18 comprising:

(a) generating a recombinant strain of a non-FK506 or FK520 producing host that contains a biosynthetic cluster that encodes polypeptides involved in FK506 and FK520 analogue synthesis in which the natural loading module has been replaced by the loading module from the avermectin or an avermectin-like PKS; and (b) feeding a non-natural non-natural starter unit to said recombinant strain;

(c) culturing said strain; and

(d) optionally isolating compounds of formula (I).

27. A method of producing compounds of formula (I) according to any one of claims 1 to 18 comprising: (a) feeding a non-natural non-natural starter unit to a recombinant strain of a non-FK506 or FK520 producing host that contains a biosynthetic cluster that encodes polypeptides involved in FK506 and FK520 analogue synthesis in which the natural loading module has been replaced by the loading module from the avermectin or an avermectin-like PKS;

(b) culturing said strain; and

(c) optionally isolating compounds of formula (I)

28. A method according to any one of claims 24 to 27 in which the part or all of the KS of the first extension module of the recombinant strain is from avermectin or an avermectin-like PKS.

29. A hybrid PKS containing extension modules for producing FK506 or FK520 and the loading module of avermectin or an avermectin-like PKS optionally in which part or all of the KS of the first extension module is from avermectin or an avermectin-like PKS.

30. An engineered FK506 or FK520 producing strain containing a hybrid PKS according to claim 29.

31. An engineered non- FK506 or FK520 producing strain containing a hybrid PKS according to claim 29.

32. A strain according to claim 30 or 31 in which one or more starter unit genes have been deleted or inactivated.

33. A strain according to any one of claims 30 to 32 in which one or more pipecolic acid biosynthesis genes have been deleted or inactivated.

34. A strain according to any one of claims 30 to 33 in which one or more post PKS modification genes have been deleted or inactivated.

35. A process for producing a polyketide which comprises culturing an engineered strain according to any one of claims 30 to 34 in the presence of a starter acid and optionally isolating said polyketide.