WO2008112297A2

WO2008112297A2 - Methods of treating cancer by interfering with igf-i receptor signaling

Info

Publication number: WO2008112297A2
Application number: PCT/US2008/003393
Authority: WO
Inventors: Hong Sun; Papia Ghosh; Yongsoon Kim
Original assignee: Yale University; Nevada Cancer Institute
Priority date: 2007-03-13
Filing date: 2008-03-13
Publication date: 2008-09-18
Also published as: WO2008112297A3

Abstract

The invention includes methods of reducing proliferation, causing apoptosis and treating cancer through the inhibition of ASM, the disruption of lipid rafts and the interference with IGF-IR and Racl signaling using a variety of compounds including siRNA, anti-ASM antibodies, anti-ceramide antibodies, short- chain ceramide derivatives, desipramine, clomipramine, mangostin and/or sphingomyelin substrate analogues.

Description

TITLE

METHODS OF TREATING CANCER BY INTERFERING WITH IGF-I RECEPTOR SIGNALING

BACKGROUND OF THE INVENTION

The insulin-like growth factor receptor (IGF-IR) signaling pathway is an important regulator of cell proliferation, apoptosis, and protein translation. The AKT and Ras/Raf/MEK/ERK signaling cascades are two known important transducers of the IGF-IR signal after IGF-I activation of the receptor. In addition, the mTORCl complex is a key regulator of protein translation downstream of the IGF-IR.

The IGF-IR pathway is associated with cancer, as demonstrated by molecular studies, animal model studies and human epidemiology studies. Dysregulation of the IGF-IR signaling system has been associated with various types of cancers, including breast, prostate, colon, and lung (Haluska et al. , 2006, Cancer Res 66:362-371).

The IGF-IR pathway is evolutionally conserved among human, mice, Drosophila and C. elegans. In C. elegans, the insulin/IGF-IR-like signaling pathway is known to regulate resistance towards reactive oxygen species (ROS), animal lifespan and dauer formation, the latter being essentially a hibernation stage. Decreased signaling in this pathway, achieved either by partial loss-of-function alleles of daf-2 (encoding the insulin/IGF-IR-like molecule) or age- 1 (encoding the phosphatidylinositol 3 kinase (PI3K) catalytic subunit homolog), each lead to increased animal lifespan and enhanced resistance towards ROS. On the other hand, increased signaling of this pathway, as observed in mutants with loss-of-function of daf-18 (encoding the C. elegans homolog of PTEN), leads to increased sensitivity to reactive oxygen species (ROS) and reduced animal lifespan (Mihaylova et al, 1999, Proc. Natl. Acad. Sci. USA 96:7427-7432; Kim and Sun, 2007, Aging Cell 6:489- 503).

The IGF-IR is a tetrameric protein consisting of two extracellular binding alpha subunits and two transmembrane beta subunits, which have a cytoplasmic kinase domain. Binding of the insulin-like growth factor (IGF-I) induces a conformational change in the beta subunits resulting in trans-autophosphorylation of the tyrosine kinase domains (LeRoith and Roberts, 2003., Cancer Lett 195: 127-137). This allows for additional autophosphorylation to occur, including one in the receptor juxtamembrane domain that then acts as a docking site for adaptor proteins, such as insulin receptor substrate-1 (IRS-I) and She (O'Conner, 2003, Horm Metab Res 35:771-777). The IRS and She adaptors activate two well-characterized signaling cascades downstream of the IGF-IR, the PI3K and MAPK/ERK signaling cascades.

Growth factor stimulation of IGF-IR causes the activation of the PI3K/AKT/mTOR signaling cascade (Kooijman, 2006, Cytokine Growth Factor Rev 17:305-323). After ligand binding, autophosphorylation of the receptor subunits leads to the binding of the adaptor protein, IRS-I, to the IGF-IR. Tyrosine phosphorylation of IRS-I results in the recruitment of p85, the regulatory subunit of PI3K. After the catalytic subunit of PI3K is also localized to the membrane, activated PI3K phosphorylates the D3 position of the lipid phosphoinositide-3,4-5-trisphosphate (PIP3) (Harrington et al, 2005, Trends Biochem Sci 30:35-42). PTEN (phosphatase and tensin homologue deleted on chromosome 10), an established tumor suppressor is able to negatively regulate the PI3-kinase pathway by dephosphorylating the D3 position in the inositol ring of PIP3 (Maehama and Dixon, 1998, J Biol Chem 273: 13375-13378). PIP3 is able to recruit proteins containing pleckstrin homology domains, such as the serine/threonine kinase (AKT) and the dependant kinase phosphoinositide-dependant kinase 1 (PDKl). Full activation of AKT requires phosphorylation at two of its residues, at threonine 308 by PDKl and at serine 473 by the mTOR-containing complex, mTORC2 (Alessi et al, 1997, Curr Biol 7:261-269; Cohen et al, 1997, FEBS Lett 410:3-10; Sarbassov et al,, 2005, Science 307: 1098- 1101). AKT is a major mediator of various downstream signals involved in cell cycle regulation, transcription, apoptosis, and protein translation. Since cells require a certain cellular mass before progressing into mitosis, the induction of protein translation is involved in the regulation of cellular proliferation. The main downstream target for AKT regulation of protein translation is the mTORCl signaling complex. Upon activation, AKT phosphorylates and inactivates the tuberous sclerosis complex, TSC1/TSC2 (Manning, 2004, J Cell Biol 167, 399-403). Since TSC1/TSC2 can act as a GTPase towards the small G protein, Rheb, AKT activation eventually leads to Rheb activation (Li et al, 2004, Trends Biochem Sci 29:32-38). Rheb in turn has been shown to increase mTORCl activity (Long et al, 2005, Curr Biol 15:702- 713).

The IGF-IR also regulates protein translation and cell proliferation through the serine/threonine kinases, ERK 1 and ERK 2. ERK 1 and ERK 2 are required for protein translation and cell proliferation (Chambard et al, 2006, Biochim Biophys Acta; Pages et al, 1993, Proc Natl Acad Sci USA 90:8319-8323). ERK 1/ERK2 is activated by binding of the adaptor protein She to the activated IGF-IR receptor, resulting in the consequent activation of the Ras/Raf/MEK/ERK signaling cascade (LeRoith and Roberts, 2003, Cancer Lett 195: 127-137). ERK has been shown to phosphorylate and disrupt the function of the TSC1/TSC2 complex, thereby activating Rheb and consequently mTORC 1 -mediated translation (Ma et al, 2005, Cell 121: 179-193; Wullschleger et al. , 2006, Cell 124:471-484). mTOR, the mammalian target of rapamycin, has been shown to be a common subunit in two multi-protein signaling complexes, mTORCl and mTORC2. mTORC2 is involved in the regulation of the actin cytoskeleton and phosphorylation of AKT at S473 (Wullschleger et al, 2006, Cell 124:471-484; Jacinto et al, 2004, Nat Cell Biol 6, 1122-1128; Sarbassov et al, 2005, Science 307: 1098-1101). mTORC 1 , on the other hand, is considered to be the main regulator of protein translation downstream of AKT (Sarbassov et al, 2005, Science 307: 1098-1101 ; Wullschleger et al, 2006, Cell 124:471-484). mTORCl regulates protein translation via two substrates, S6-kinase and 4E-BP1. Active mTORCl phosphorylates threonine 389 within the hydrophobic motif of S6K, thereby allowing S6K to promote ribosomal biogenesis (Avruch et al, 2006, Oncogene, 25: 6361-6372; Weng et al, 1998, J Biol Chem 273: 16621-29; Wullschleger et al , 2006, Cell 124:471-484).

Racl is a Rho family member GTPase (Fitz and Kaina, 2006, Curr Cancer Drug Targets 6:1-14). It cycles between a GTP-bound active form and a GDP-bound inactive form. Several guanidine-nucleotide exchange factors (GEFs) for Racl contain a pleckstrin-homology domain and thus are able to be activated by an increased phosphoinositide PIP3 level upon ligand binding to PDGF, EGF and IGF-I receptor tyrosine kinases. Racl has also been implicated in transformation mediated by the oncogenic Ras (Irani et al, 1997, Science 275: 1649-1652). Racl is also known to be involved in the regulation of Gl cell cycle progression, actin polymerization and cell migration. Rac 1 has been shown to be an important mitogenic signaling molecule downstream of PI3K/PTEN pathway and regulates levels of cyclin Dl and p27 (Harrell, 2006, PhD Thesis, Yale University). Interestingly, it has also been shown that Racl preferentially binds to cholesterol-rich plasma membrane microdomains (i.e., lipid rafts) and such localization can be blocked by the prevention of cell attachment or by cholesterol depletion (Del Pozo et al, 2004, Science 303:839-842). It has been shown that the lipid raft localization of Racl is essential for it to signal to its downstream effector PAKl (Del Pozo et al, 2004, Science 303:839-842).

The cellular plasma membrane contains areas that are in a liquid- ordered phase in which lipids are tightly packed and structured but still maintain lateral movement (Kusumi and Suzuki, 2005, Biochim Biophys Acta 1746:234-251; London, 2005, Biochim Biophys Acta 1746:203-220). Isolation of lipid rafts through various methods has shown that lipid rafts are very heterogeneous, meaning that within the plasma membrane different types of rafts consist of different ratios of lipids, sterols, and proteins (Pike, 2004, Biochem J 378:281-292). Sphingomyelin is composed of a hydrophobic sphingoid long chain base (sphingosine), a fatty acid, and phosphorylcholine headgroup (Futerman and Hannun, 2004, EMBO Rep 5:777-782; Reynolds et al, 2004, Cancer Lett 206: 169-180). In the liquid-ordered eukaryotic membrane, there are areas of high sphingomyelin and cholesterol concentration. Hydrophilic interactions between the headgroups of the sphingolipids stabilize the interactions of the sphingomyelin lipids. Additional van der Waals interactions between cholesterol and sphingomyelin result in the separation of sphingomyelin- cholesterol domains from the rest of the membrane. These segregated domains appeared to 'float' in the membrane, and hence have been termed rafts (Simons and Ikonen, 1997, Nature 387:569-572). Sphingomyelin is mainly located in the outer leaflet of the cell membrane in a ratio of 6: 1. Therefore these sphingomyelin- containing membrane rafts are also believed to be located on the outer leaflet of the membrane (Bollinger et al, 2005, Biochim Biophys Acta 1746:284-294; Pike, 2004, Biochem J 378:281-292).

Lipid rafts are areas of the plasma domain that are highly enriched in cholesterol and sphingolipids (Pike, 2005, Biochim Biophys Acta 1746:260-273) and have a domain size of 10-220 run (Pike, 2006, J Lipid Res 47: 1597-1598). A lipid raft's highly ordered structure makes it resistant to solubilization with non-ionic detergents at low temperatures (Bollinger et al, 2005, Biochim Biophys Acta 1746:284-294; Brown and Rose, 1992, Cell 68:533-544). Lipid rafts have been operationally defined by their non-ionic detergent insolubility and flotation at the interface of a 5-30% discontinuous sucrose gradient due to their lighter buoyant density (Hope and Pike, 1996, MoI Biol Cell 7:843-851). Through detergent isolation and direct visualization of raft proteins, it has been shown that various proteins associate with lipid rafts (such as Flottilin-2) (Wang and Paller, 2006, J Invest Dermatol 126:951-953).

Although rafts generally contain sphingomyelin and cholesterol, rafts are very heterogeneous structures, with varying lipid and protein composition at any given time (Pike, 2004, Biochem J 378:281-292; Roper et al, 2000, Nat Cell Biol 2:582-592). Immunofluorescence has been used to demonstrate lipid raft heterogeneity (Gomez-Mouton et al, 2001, Proc Natl Acad Sci USA 98:9642-9647). Rafts are also heterogeneous in relation to time; it has been shown that lipid rafts form and dissipate over time and in response to stimuli (Pike, 2004, Biochem J 378:281-292).

Lipid rafts have been implicated in various cellular processes due to the localization of various proteins within the rafts. Most interestingly, receptor localization to lipid rafts has been shown to affect receptor signaling (Gulbins and Grassme, 2002, Biochim Biophys Acta 1585: 139-145). For example, the EGF receptor is localized to lipid rafts, but after EGF stimulation the receptor is lost from lipid rafts and is able to signal to its downstream target, ERK (Chen and Resh, 2002, J Biol Chem 277:49631-49637). CD95 receptor induction of apoptosis is also dependant on its localization in the lipid raft (Grassme et al, 2001, J Biol Chem 276:20589-20596).

Acidic sphingomyelinase (ASM; also known as sphingomyelin phosphodiesterase 1, acid lysosomal (SMPDl)) is an enzyme in mammalian cells that hydrolyzes sphingomyelin, a membrane sphingolipid, into ceramide (Yamaguchi and Suzuki, 1977, J Biol Chem 252:3805-3813). In mammalian cells, one gene (i.e., SMPDl) encodes ASM, but due to post-translational modification, at least two forms of ASM are present (Gulbins, 2003, Pharmacol Res 47:393-399). ASM can be transported from intracellular vesicles to the outer leaflet of the plasma membrane where it co-localizes with sphingomyelin in lipid rafts (Grassme et al, 2001, J Biol Chem 276:20589-20596; Grassme et al, 2001, Biochem Biophys Res Commun 284: 1016-1030) and hydrolyzes sphingomyelin into the amide ester, ceramide, which then becomes exposed on the outer leaflet of the cell membrane (Bollinger et al, 2005, Biochim Biophys Acta 1746: 284-294; Rotolo et al, 2005, J Biol Chem 280: 26425-34). The hydrolysis of sphingomyelin forms ceramide (sphingosine and fatty acid) and phosphorylcholine. Ceramide, when produced at the cellular membrane from sphingomyelin by ASM, tends to self-associate and form large ceramide- enriched domains referred to as platforms (Bollinger et al, 2005, Biochim Biophys Acta 1746:284-294.; Holopainen et al. , 1998, Biochemistry 37: 17562-17570.; Kolesnick et al, 2000, J Cell Physiol 184:285-300). In this way, ASM production of ceramide at the cell surface results in a reorganization of the lipid membrane. It is thought that ceramide-rich platforms function to cluster receptors and thereby potentiate their activation and signaling.

The phenomenon of receptor clustering in lipid rafts has been observed for various pro-apoptotic receptors including CD95 and TNF-R (Bollinger et al, 2005, Biochim Biophys Acta 1746:284-294; Gulbins and Grassme, 2002, Biochim Biophys Acta 1585: 139-145). Membrane ASM has previously been known to be involved in CD95 and TRAIL receptor signaling for the induction of apoptosis (Dumitru and Gulbins, 2006, Cancer Cell 9: 153-155; Grassme et al, 2001, J Biol Chem 276:20589-20596; Gulbins, 2003 Pharmacol Res 47:393-399). CD95 stimulation of apoptosis is abrogated in ASM-deficient cells, while wild-type cells undergo rapid cell death (Grassme et al, 2001, J Biol Chem 276:20589-20596). Microscopy studies showed that ASM co-localizes with sphingolipid lipid rafts at the membrane after CD95 treatment (Grassme et al, 2001, J Biol Chem 276:20589- 20596). Once in the lipid raft, ASM is able to generate membrane ceramide from sphingomyelin (Bollinger et al, 2005, Biochim Biophys Acta 1746:284-294; Rotolo et al, 2005, J Biol Chem 280:26425-26434). ASM has also been shown to regulate stress-induced signaling, including UV-C light induced ASM association with the lipid raft and consequent induction of apoptosis. After UV-C treatment, ASM activity separates to the low-density raft fraction of a sucrose gradient after centrifugation (Charruyer et al, 2005, J Biol Chem 280:19196-19204). These studies have demonstrated under pathologic conditions, activation of ASM leads to activation of a death receptor, which in turn leads to induction of apoptosis.

Although the IGF-IR is generally not considered a canonical oncogene, increased levels of downstream signaling components of the IGF-I signaling pathway have been associated with various tumor types (Garcia-Echeverria et al, 2004, Cancer Cell 5;231-239; Miller and Yee, 2005, Cancer Res 65: 10123-10127). Moreover, increased levels of IGF-I correlate with increased risk of developing breast, prostate, and colon cancer (Miller and Yee, 2005, Cancer Res 65: 10123-10127). In a recent study, IGF-IR inhibition, using a neutralizing antibody or a specific kinase inhibitor, inhibited serum-stimulated proliferation of over 75 different hematologic and solid tumor cell lines (Mitsiades et al, 2004, Cancer Cell 5:221-230), suggesting that IGF- IR may act as a permissive factor for other types of growth receptors in tumor cells.

The IGF-IR signaling system has been associated with various types of cancers, including breast, prostate, colon, and lung. Clearly, there exists a need to interfere with the IGF-IR signaling system to diminish cell proliferation, to trigger cell death and to treat cancer. The current invention fulfills this need.

SUMMARY OF THE INVENTION

In one embodiment, the invention is a method of interfering with IGF- IR signaling comprising contacting a cell with an ASM inhibitor, wherein the contact of the cell with the ASM inhibitor reduces ASM activity, and wherein the reduction of ASM activity interferes with IGF-IR signaling. In some embodiments, the ASM inhibitor is at least one selected from the group consisting of amitriptyline, butriptyline, amoxapine, clomipramine, desipramine, dosulepin hydrochloride, dothiepin hydrochloride, doxepin, imipramine, dibenzepin, iprindole, lofepramine, nortriptyline, opipramol, protriptyline, trimipramine, and combinations thereof. In other embodiments, the ASM inhibitor is at least one selected from the group consisting of clomipramine, desipramine, and combinations thereof. In other embodiments, the ASM inhibitor is an antibody that specifically binds to ASM. In other embodiments, the ASM inhibitor is an siRNA targeting ASM RNA. In other embodiments, the ASM inhibitor is a mangostin compound. In certain embodiments, the mangostin compound is at least one of the group consisting of alpha-mangostin, beta-mangostin, gamma-mangostin, methoxy-beta-mangostin, dimethylmangostin and combinations thereof. In other embodiments, the ASM inhibitor is a sphingomyelin substrate analogue. In certain embodiments, the sphingomyelin substrate analogue is a least one of the group consisting of a nitrogen analogue, a thiourea derivative, and combinations thereof. In some embodiments, the reduction of ASM activity interferes with IGF-IR signaling to mTORC 1. In other embodiments, the reduction of ASM activity interferes with IGF-IR signaling to Racl . In other embodiments, the interference with IGF-IR signaling diminishes ROS production. In some embodiments, the interference with IGF-IR signaling diminishes proliferation of the cell or a population of cells. In other embodiments, the interference with IGF-IR signaling induces apoptosis of the cell. In certain embodiments, the cell is a cancer cell. In certain embodiments, the cell is a human cell.

In another embodiment, the invention is a method of interfering with IGF-IR signaling comprising contacting a cell with an antibody that specifically binds to ceramide, wherein the contact of the cell with the antibody that specifically binds to ceramide interferes with IGF-IR signaling. In some embodiments, the contact of the cell with the antibody that specifically binds to ceramide interferes with IGF-IR signaling to mTORC 1. In other embodiments, the contact ot the cell with the antibody that specifically binds to ceramide interferes with IGF-IR signaling to Rac 1. In some embodiments, the contact of the cell with the antibody that specifically binds to ceramide diminishes ROS production. In other embodiments, the interference with IGF-IR signaling diminishes proliferation of the cell or a population of cells. In some embodiments, the interference with IGF-IR signaling induces apoptosis of the cell. In certain embodiments, the cell is a cancer cell. In certain embodiments, the cell is a human cell.

In another embodiment, the invention is a method of interfering with IGF-IR signaling comprising contacting a cell with a short-chain ceramide derivative, wherein the contact of the cell with the short-chain ceramide derivative interferes with IGF-IR signaling. In certain embodiments, the short-chain ceramide derivative is C6- ceramide. In some embodiments, the contact of the cell with the short-chain ceramide derivative interferes with IGF-IR signaling to mTORC 1. In other embodiments, the contact of the cell with the short-chain ceramide derivative interferes with IGF-IR signaling to Racl . In some embodiments, the contact of the cell with the short-chain ceramide derivative diminishes ROS production. In other embodiments, the interference with IGF-IR signaling diminishes proliferation of the cell or a population of cells. In some embodiments, the interference with IGF-IR signaling induces apoptosis of the cell. In certain embodiments, the cell is a cancer cell. In certain embodiments, the cell is a human cell.

In another embodiment, the invention is a method of interfering with IGF-IR signaling comprising contacting a cell with methyl-β-cyclodextrin, wherein the contact of the cell with methyl-β-cyclodextrin interferes with IGF-IR signaling. In some embodiments, the contact of the cell with methyl-β-cyclodextrin interferes with IGF-IR signaling to mTORCl . In other embodiments, the contact of the cell with methyl-β-cyclodextrin interferes with IGF-IR signaling to Rac 1. In some embodiments, the contact of the cell with methyl-β-cyclodextrin diminishes ROS production. In other embodiments, the interference with IGF-IR signaling diminishes proliferation of the cell or a population of cells. In some embodiments, the interference with IGF-IR signaling induces apoptosis of the cell. In certain embodiments, the cell is a cancer cell. In certain embodiments, the cell is a human cell.

In another embodiment, the invention is a method of interfering with IGF-IR signaling comprising contacting a cell with a statin, wherein the contact of the cell with the statin interferes with IGF-IR signaling. In some embodiments, the contact of the cell with the statin interferes with IGF-IR signaling to mTORC 1. In other embodiments, the contact of the cell with the statin interferes with IGF-IR signaling to Racl . In some embodiments, the contact of the cell with the statin diminishes ROS production. In other embodiments, the interference with IGF-IR signaling diminishes proliferation of the cell or a population of cells. In some embodiments, the interference with IGF-IR signaling induces apoptosis of the cell. In certain embodiments, the cell is a cancer cell. In certain embodiments, the cell is a human cell.

In another embodiment, the invention is a method of interfering with Racl signaling comprising contacting a cell with an ASM inhibitor, wherein the contact of the cell with the ASM inhibitor reduces ASM activity, and wherein the reduction of ASM activity interferes with Racl signaling. In some embodiments, the ASM inhibitor is at least one selected from the group consisting of amitriptyline, butriptyline, amoxapine, clomipramine, desipramine, dosulepin hydrochloride, dothiepin hydrochloride, doxepin, imipramine, dibenzepin, iprindole, lofepramine, nortriptyline, opipramol, protriptyline, trimipramine, and combinations thereof. In other embodiments, the ASM inhibitor is at least one selected from the group consisting of clomipramine, desipramine, and combinations thereof. In some embodiments, the ASM inhibitor is an antibody that specifically binds to ASM. In other embodiments, the ASM inhibitor is an siRNA targeting ASM RNA. In some embodiments, the ASM inhibitor is a mangostin compound. In certain embodiments, the mangostin compound is at least one of the group consisting of alpha-mangostin, beta-mangostin, gamma-mangostin, methoxy-beta-mangostin, dimethylmangostin and combinations thereof. In other embodiments, the ASM inhibitor is a sphingomyelin substrate analogue. In certain embodiments, the sphingomyelin substrate analogue is a least one of the group consisting of a nitrogen analogue, a thiourea derivative, and combinations thereof. In some embodiments, the interference with Racl signaling diminishes ROS production. In other embodiments, the interference with Rac 1 signaling diminishes proliferation of the cell or a population of cells. In some embodiments, the interference with Racl signaling induces apoptosis of the cell. In certain embodiments, the cell is a cancer cell. In certain embodiments, the cell is a human cell.

In another embodiment, the invention is a method of interfering with Racl signaling comprising contacting a cell with an antibody that specifically binds to ceramide, wherein the contact of the cell with the antibody that specifically binds to ceramide interferes with Racl signaling. In some embodiments, the contact of the cell with the antibody that specifically binds to ceramide diminishes ROS production. In other embodiments, the interference with Rac 1 signaling diminishes proliferation of the cell or a population of cells. In some embodiments, the interference with Racl signaling induces apoptosis of the cell. In certain embodiments, the cell is a cancer cell. In certain embodiments, the cell is a human cell.

In another embodiment, the invention is a method of interfering with Racl signaling comprising contacting a cell with a short-chain ceramide derivative, wherein the contact of the cell with the short-chain ceramide derivative interferes with Racl signaling. In certain embodiments, the short-chain ceramide derivative is C6- ceramide. In some embodiments, the contact of the cell with the short-chain ceramide derivative diminishes ROS production. In other embodiments, the interference with Racl signaling diminishes proliferation of the cell or a population of cells. In some embodiments, the interference with Racl signaling induces apoptosis of the cell. In certain embodiments, the cell is a cancer cell. In certain embodiments, the cell is a human cell.

In another embodiment, the invention is a method of interfering with Racl signaling comprising contacting a cell with methyl-β-cyclodextrin, wherein the contact of the cell with methyl-β-cyclodextrin interferes with Racl signaling. In some embodiments, the contact of the cell with methyl-β-cyclodextrin diminishes ROS production. In other embodiments, the interference with Racl signaling diminishes proliferation of the cell or a population of cells. In some embodiments, the interference with Racl signaling induces apoptosis of the cell. In certain embodiments, the cell is a cancer cell. In certain embodiments, the cell is a human cell.

In another embodiment, the invention is a method of interfering with Racl signaling comprising contacting a cell with a statin, wherein the contact of the cell with the statin interferes with Racl signaling. In some embodiments, the contact of the cell with the statin diminishes ROS production. In other embodiments, the interference with Racl signaling diminishes proliferation of the cell or a population of cells. In some embodiments, the interference with Racl signaling induces apoptosis of the cell. In certain embodiments, the cell is a cancer cell. In certain embodiments, the cell is a human cell.

BRIEF DESCRIPTION OF THE DRAWINGS

For the purpose of illustrating the invention, there are depicted in the drawings certain embodiments of the invention. However, the invention is not limited to the precise arrangements and instrumentalities of the embodiments depicted in the drawings.

Figure 1 depicts a graphic representation of ASM hydrolyzing sphingomyelin, which is a membrane sphingolipid, into ceramide and pho sphocholine .

Figure 2, comprising Figures 2a, 2b, 2c, and 2d, depicts example assays demonstrating that ASM is required for mTORC 1 signaling and for cell proliferation. Figure 2a: Actively growing, asynchronous U87-MG and Wi-38 cells were treated with increasing concentrations of desipramine (as indicated) for 24 hours. Cell lysates (40 μg each) were subjected to SDS-PAGE and Western blot analysis using the indicated antibodies. Figure 2b: U87-MG and H1299 cells were transfected with either control siRNA (100 nm) or ASM siRNA (100 nM, 200 nM) and harvested 96 hours post-transfection. Cell lysates (40 μg each) were subjected to SDS-PAGE and Western blot analysis using the indicated antibodies. Figure 2c: Top panel - U87-MG were transfected with ASM.2 siRNA or control siRNA (100 nM) for 96 hours before harvesting. Bottom panel - ASM was silenced in U87-MG cells for 96 hours, and lysate was harvested for sphingomyelinase assay. Lysate was incubated with 14C-sphingomyelin and release of radioactive phosphorylcholine was measured by a scintillation counter. Figure 2d: Cell proliferation of H1299 cells after silencing of ASM for 96 hours was determined by measuring DNA synthesis using a bromodeoxyuridine (BrDU) incorporation kit. BrDU incorporation is shown as relative light units detected as compared to control siRNA. Data presented is representative of three independent experiments.

Figure 3, comprising Figures 3a, 3b, 3c, and 3d, depicts example assays demonstrating that ASM is necessary for IGF-I receptor signaling after IGF-I stimulation. Figure 3a: ASM siRNA or control siRNA (100 nM) were transfected into H1299 cells that were then starved for 48 hours. Starved cells were stimulated with 100 ng/mL of IGF-I for 5, 15, or 30 minutes. Lysate was harvested and used for SDS-PAGE and Western blot analysis with the indicated antibodies. Figure 3b: ASM siRNA or control siRNA (100 nM) were transfected into H 1299 cells that were then starved for 48 hours. Starved cells were stimulated with 100 ng/mL of IGF-I for 1 , 3, 6, 12, 18, or 24 hours. Lysate was harvested and used for SDS-PAGE and Western blot analysis with the indicated antibodies. Figure 3c: H1299 cells were transfected with ASM siRNA, serum-starved for 48 hours and then IGF-I stimulated for the indicated times. Equal amounts of lysate were immunoprecipitated with anti-IGF-IRβ antibody. The immunoprecipitates were analyzed by SDS-PAGE and Western blot analysis with anti-P(Y), anti-p85, and anti-IGF-IRβ antibodies. Immunoprecipitations were run in duplicate for each time point. Figure 3d: MCF-7 and H 1299 were treated as described in Figure 3 c, but lysate was immunoprecipitated with anti-P(Y) antibody (4G10), and analyzed by Western blot with anti-IRS-1 antibody. Lysate not subjected to immunoprecipitation is shown as control.

Figure 4, comprising Figures 4a, 4b, 4c, and 4d, depicts example assays demonstrating that IGF-IR localization in membrane lipid rafts is dependant on ASM. Figure 4a: Cells were harvested either by lysis in 1% Brij 58 or by using a non-detergent method. Lysate was loaded at the bottom of a 5-30% linear sucrose gradient and spun. Fractions (500 ul) were taken from the top (low-density) to the bottom (high density) of the gradient. Flottilin-2 is shown as a rat marker. Figure 4 b: Lysate of starved Hl 299 cells either treated with vehicle control or IGF-I for 90 minutes were fractionated on sucrose gradient. A portion of the gradient fraction was resolved on SDS-PAGE gel. Figure 4c: H1299 cells were transfected with ASM siRNA and cells were harvested in 1% Brij 58 96 hours trans fee tion and separated by centrifugation on a discontinuous sucrose gradient Figure 4d: Anti-ceramide (10 μg/mL) or anti-ASM (10 μg/mL) antibody was incubated with cells for 30 minutes prior to 90 minutes of IGF-I stimulation. Rabbit IgG (10 μg/mL) was used as control.

Figure 5, comprising Figures 5a, 5b, 5c, and 5d, depicts example experiments demonstrating that cholesterol mediates IGF-IR signaling and localization in the lipid raft. Figure 5a: H 1299 cells were treated with increasing concentrations of methyl-β-cyclodextrin (MβCD) or α-cyclodextrin (αCD) for 30 minutes prior to 90 minutes of IGF-I treatment. Figure 5b: Cells were treated with 10 mM MβCD for 30 minutes before replenishment with a cholesterol/MβCD complex. IGF-I treated cells received increasing concentrations of cholesterol/MβCD of 0.25, 0.5, 1, 1.25 μM while nonstimulated cells received 0.25, 0.5, 1 μM. Figure 5c: After MβCD (10 mM) and IGF-I treatment, H1299 cell lysate was fractionated on a sucrose gradient. Figure 5d: Top panel - Lysate from IGF-I stimulated or stimulated cells was fractionated on a sucrose gradient. A portion of the fraction was denatured in sample buffer and resolved on a SDS-PAGE gel. Western blot with an anti-P(Y) antibody detected a 150 kD tyrosine phosphorylated protein. Bottom panel - H 1299 cells were transfected with control or ASM siRNA and lysate fractionated on a sucrose gradient. A 150 kD protein was detected with an anti-P(Y) antibody.

Figure 6 depicts graphic representation of a model of IGF-IR signaling from the lipid rafts. IGF-IR is separated into two groups in the plasma membrane: a raft-associated and non-raft associated. The raft-associated signals mainly to mTORCl, and Racl, after IGF-I stimulation, while the non-raft signals to AKT and ERK. ASM is necessary for the production of ceramide, which, with cholesterol, organizes the IGF-IR lipid raft. Racl may also be directly recruited to the ASM- dependent lipid rafts. IGF-I stimulation may result in recruitment of additional factors to the IGF-IR containing lipid raft that potentiates IGF-IR signaling to mTORCl .

Figure 7 depicts the results of an example experiment demonstrating the inhibition of cell proliferation after treatment with the ASM inhibitors desipramine and clomipramine. Logarithmically-growing glioblastoma U87-MG cells were treated with DMSO, desipramine (50 μM) or clomipramine (25 μM) for 24 hours. Cells were pulse-labeled with bromodeoxyuridine (BrdU). DNA synthesis was measured using BrdU incorporation kit. The data is presented as relative BrdU incorporation to the control sample (treated with vehicle DMSO).

Figure 8 depicts the results of an example experiment demonstrating interference with the IGF-IR signaling system. Human glioblastoma U87-MG cells were treated with vehicle control (DMSO) or desipramine or clomipramine at the concentrations (μM) indicated at the top of the lanes of the blot. After 24 hours, cell lysates were prepared and analyzed by SDS-PAGE and Western blot analysis with the indicated antibodies.

Figure 9 depicts the results of an example experiment demonstrating the induction of apoptosis after treatment with the ASM inhibitors desipramine or clomipramine. Treatment of glioblastoma U87-MG cells with desipramine (50 μM) or clomipramine (25 μM) induced apoptosis.

Figure 10 depicts the results of an example experiment demonstrating that pharmacological inhibition of ROS affects downstream components of the IGF- IR signaling pathway. Actively growing, asynchronous U87-MG cells were treated with increasing concentrations of n-acetylcysteine (as indicated) or desipramine (as indicated) or LY294002 (as indicated) for 24 hours. Cell lysates were subjected to SDS-PAGE and Western blot analysis using the indicated antibodies.

Figure 11 depicts the results of an example experiment demonstrating that desipramine and MβCD interfere with IGF-IR signaling and block ROS production.

Figure 12 depicts the results of an example experiment demonstrating that a short-chain ceramide derivative, C6-ceramide, interferes with IGF-IR signaling, in a manner similar to that of desipramine.

Figure 13 depicts the results of an example experiment demonstrating that inactivation of C. elegans asm-3 by RNAi lead to an increase in mean lifespan, while the lifespan extension phenotype was completely abolished when the RNAi- mediated asm-3 gene inactivation was carried out in a daf- 16 null background (/. e. , daf-16(mgDF47)), suggesting that asm-3(RNAi) extends lifespan in a daf-16 dependent manner.

Figure 14 depicts the results of an example experiment demonstrating that a C. elegans mutant having a chromosomal deletion allele in the asm-3 gene (i.e., ok 1744) exhibits a longer lifespan phenotype when compared with its wild-type counterpart.

Figure 15 depicts the results of an example experiment demonstrating that asm-3 inactivation by either asm-3(RNAi) (left panel) or asm-3(okl744) mutation (right panel) confers resistance to paraquat, which is known to generate ROS after metabolizing in cells. Figure 16 depicts the results of an example experiment demonstrating that the diminution of either asm-3 or daf-2 leads to the rapid activation of the daf-16 transcription factor and its subsequent activation of a Psod-3::gfp reporter gene.

Figure 17 depicts the results of an example experiment demonstrating that the diminution of asm-3 reduced daf-2 signaling in the dauer formation assay. Using the daf-2(el370) mutant strain, at a semipermissive temperature, diminution of expression of the asm-3 gene by RNAi increased dauer formation.

DETAILED DESCRIPTION OF THE INVENTION

The present invention encompasses novel methods for treating cancer by interfering with IGF-IR signaling. That is, using the methods disclosed elsewhere herein, the skilled artisan can readily diminish cell proliferation and/or treat cancer by interfering with IGF-IR signaling. As the skilled artisan would appreciate based upon the disclosure provided herein, such interference with IGF-IR signaling may be useful for, inter alia, disrupting the progress of a variety of proliferative disorders. This is because, as demonstrated by the data disclosed herein, interfering with IGF-IR signaling results in a diminution of cell proliferation and/or an increase in apoptosis.

The present invention also contemplates novel methods for treating cancer by interfering with Rac 1 signaling. That is, using the methods disclosed elsewhere herein, the skilled artisan can readily diminish cell proliferation and/or treat cancer by interfering with Racl signaling. As the skilled artisan would appreciate based upon the disclosure provided herein, such interference with Rac 1 signaling may be useful for, inter alia, disrupting the progress of a variety of proliferative disorders.

Previous studies have reported that ASM is important for death receptor-induced or radiation-induced cell death. Therefore, ASM and ceramide have traditionally been viewed as inducers of apoptosis. Surprisingly, as the data disclosed herein demonstrate, the physiologic level of ASM, as well as its enzymatic product ceramide, are pro-proliferation and pro-survival through positive regulation of the IGF-I-mediated and Racl -mediated events. Therefore, interfering with IGF-I- mediated and/or Rac 1 -mediated events by using the methods of the invention can interfere with cell proliferation and survival of cancer cells.

The invention disclosed herein contemplates methods of treating cancer through the diminution of the amount, stability, or of the activity, of components of the IGF-IR signaling system, including ASM, ceramide, cholesterol, Racl , and the IGF-IR. As disclosed herein, interfering with the IGF-IR signaling system causes a potent inhibition of the growth and/or proliferation of cancer cells. These effects are mediated through inhibition of IGF-IR-dependent cell proliferation and survival.

A variety of components of the IGF-IR signaling system can serve as targets for the anti-proliferation and anti-cancer methods of the invention. By way of non-limiting examples, the methods of the invention include interference with the IGF-IR signaling system by using siRNA targeting ASM RNA; by using chemical compounds, that interfere with ASM protein stability, enzymatic activity, or cellular localization, such as desipramine, clomipramine, mangostin, or sphingomyelin substrate analogues; by using antibodies that bind to ASM, or to its enzymatic product ceramide; by using short-chain derivatives of ceramide, which interfere with ceramide in the lipid raft; or by using agents that deplete cholesterol. It is an aspect of the invention that any of the compounds and methods for interfering with IGF-IR signaling disclosed herein can be used either alone or in combination with the other compounds and methods disclosed herein, as well as in combination with other compounds and methods disclosed elsewhere. By employing these methods of the invention, alone or in combination, cell proliferation can be diminished and/or cell death can be caused.

As disclosed herein, the diminution of ASM causes potent inhibition of the growth and/or proliferation of cancer cells. These effects are mediated through interference with IGF-IR-dependent cell proliferation and survival. In various embodiments, interference of the IGF-IR signaling system is achieved by diminishing the amount, stability or activity of ASM, or by altering the cellular localization of ASM. In some embodiments, the diminution of the amount, stability or activity of ASM is achieved by using siRNA or by contacting ASM with an anti-ASM antibody. In other embodiments, the alteration of the cellular localization of ASM is achieved by using siRNA or by contacting ASM with an anti-ASM antibody. In various embodiments, the diminution of the amount or activity of ASM is achieved by using chemical compounds, such as desipramine or clomipramine, which interfere with ASM protein stability or enzymatic activity. In other embodiments, the alteration of the cellular localization of ASM is achieved by using chemical compounds, such as desipramine or clomipramine, that interfere with ASM protein stability, enzymatic activity, or cellular localization.

In various embodiments, interference with the IGF-IR signaling system is achieved by diminishing IGF-IR localization to the lipid raft. In some embodiments, the diminution of IGF-IR localization to the lipid raft is achieved by the disruption of lipid rafts by, for example, cholesterol depletion or, for example, by neutralization of surface ceramide using an anti-ceramide antibody, or, for example, by use of soluble, short-chain ceramide.

In various embodiments, interference with the IGF-IR signaling system is achieved by diminishing Racl localization to the lipid raft. In some embodiments, the diminution of Racl localization to the lipid raft is achieved by the disruption of lipid rafts by, for example, cholesterol depletion or, for example, by neutralization of surface ceramide using an anti-ceramide antibody, or, for example, by use of soluble, short-chain ceramide.

ASM has previously been shown to generate ceramide in membrane rafts. As disclosed herein, ASM is also required for IGF-IR plasma membrane microdomain localization and for signaling from ceramide-enriched lipid rafts. In some embodiments of the invention, siRNA-mediated diminution of ASM can prevent IGF-IR localization in the lipid raft and diminish cellular proliferation. Moreover, as disclosed herein, ASM-dependant IGF-IR localization in the ceramide- enriched and cholesterol-containing lipid raft is critical for IGF-IR signaling to mTORCl. In some embodiments of the invention, siRNA-mediated diminution of ASM can prevent IGF-IR signaling to mTORCl and diminish cellular proliferation and/or cause apoptosis. In other embodiments of the invention, siRNA-mediated diminution of ASM can interfere with Racl signaling, where Racl receives signals from IGF-IR, or from other receptors' tyrosine kinases or from Ras, and diminish cellular proliferation and/or cause apoptosis.

Cholesterol is known to be a critical component of membrane lipid rafts. In some embodiments of the invention, agents that interfere with cholesterol metabolism or with cholesterol' s membrane localization can be used to interfere with the IGF-IR signaling system. In other embodiments, ASM inhibitors can be used together with the inhibitors of cholesterol biosynthesis, which can also interfere with the IGF-IR signaling system, and thereby increase the effectiveness of the anti- proliferation and anti-cancer methods of the invention. It is an aspect of the invention that the effectiveness of the interference of the IGF-IR signaling pathway can be achieved by combining the use of the ASM inhibitors of the invention with statins.

Because ASM is known to be localized at the outer leaflet of the plasma membrane, ASM can be available to and sensitive to, for example, small molecule inhibitors that do not possess the property of cell permeability, or, for example, to macromolecule inhibitors such as antibodies. In some embodiments, interference of the IGF-IR signaling system is achieved by contacting ASM with a small molecule inhibitor, including those that do not possess the property of cell permeability. In other embodiments, interference of the IGF-IR signaling system is achieved by contacting ASM with an anti-ASM antibody. In further embodiments, interference of the IGF-IR signaling system is achieved by contacting ceramide with an anti-ceramide antibody. In still further embodiments, interference of the IGF-IR signaling system is achieved by disturbing the function of ceramide in the lipid raft using small molecules such as soluble, short-chain ceramide.

IGF-IR and mTORCl is required for IGF-IR-mediated activation mTORCl plays an important role in the regulation of cell proliferation and has been implicated in the regulation of cell survival. The data disclosed herein demonstrate that ASM is required for IGF-IR-mediated mTORCl activation. In one embodiment of the invention, the diminution of ASM, in asynchronously growing cells for example, by either pharmacological inhibition or by siRNA, can inhibit mTORCl -dependant phosphorylation of its substrates, S6K and 4E-BP1. In another embodiment, diminution of ASM, in IGF-I stimulated cells for example, can inhibit mTORCl -dependent phosphorylation of S6K and 4E-BP1. In other embodiments, antibody neutralization of surface ASM, or of ceramide, can reduce IGF-I stimulated activation.

The data disclosed herein demonstrate that IGF-IR signaling through an ASM-dependent lipid raft is important for activation of mTORC 1 and phosphorylation of its downstream targets S6K and 4E-BP1. In one embodiment of the invention, the inhibition of localization of IGF-IR to the lipid raft can be used to interfere mTORC 1 activity.

IGF-IR localization in lipid rafts The data disclosed elsewhere herein demonstrate that the IGF-IR is localized to lipid rafts prior to IGF-I stimulation and its abundance in the raft is not altered by IGF-I stimulation. These data also demonstrate that the IGF-IR is localized to a particular subset of the lipid rafts that are ceramide-enriched and also contain cholesterol. Thus, in one embodiment of the invention, antibody neutralization of ceramide can be used to interfere with the IGF-IR signaling system. In another embodiment, antibody neutralization of ASM, which is involved in generating ceramide at the plasma membrane, can be used to interfere with the IGF-IR signaling system. It is an aspect of the invention that antibody neutralization of ASM, of ceramide, or of both, can be used to interfere with signaling from the IGF-IR. Further, it is an aspect of the invention that antibody neutralization of ASM, of ceramide, or of both, can be used to interfere with signaling from the IGF-IR to mTORC 1.

It is known that lipid rafts are composed of various lipids, sterols, and proteins, and that diminution of some of these components can disrupt the stability of a raft. As disclosed elsewhere herein, depletion of cholesterol with MβCD reduced IGF-IR presence in the low-density fraction of a sucrose gradient and reduced IGF- IR/mTORCl signaling. In one embodiment of the invention, the depletion of cholesterol, with, for example, MBCD, can be used to disrupt the stability of the membrane lipid raft and interfere with the IGF-IR signaling system.

The data disclosed herein establish that there are at least two groups of the IGF-IR in the plasma membrane and that they represent distinct signaling functions of the IGF-IR after IGF-I stimulation. One group is ASM-dependant and localized to the cholesterol-containing ceramide lipid rafts. This group is responsible for signaling to mTORC 1 from the IGF-IR. In various embodiments of the invention, the diminution of ASM by using siRNA, chemical compound inhibitors, such as desipramine and clomipramine, and/or anti-ASM antibody, can interfere with the IGF-IR signaling following IGF-I stimulation.

IGF-IR regulation of AKT

The data disclosed herein suggest IGF-IR-mediated phosphorylation of AKT S473 is differentially regulated in asynchronously growing cells as compared with IGF-I stimulated cells. For example, in asynchronously growing cells, ASM is required for IGF-IR-mediated AKT S473 phosphorylation. Although not wishing to be bound by any particular theory, these data suggest that the steady state levels of AKT S473 in asynchronously growing cells are regulated by IGF-IRs that are located in the lipid raft.

Further, the regulation of AKT by IGF-IR after IGF-I stimulation appears to be distinct from non-stimulated regulation. Upon IGF-I stimulation, there is an initial increase in AKT S473 phosphorylation from 1 through 6 hours. Although not wishing to be bound by any particular theory, that this increase was observed even in ASM-deficient cells suggests that IGF-IR stimulation of AKT S473 is likely from a non-raft group of the IGF-IR. Interestingly, in cells containing ASM, AKT S473 phosphorylation begins to decrease while S6K T389 phosphorylation levels are maintained after IGF-I stimulation. It has been previously reported that mTOR- dependant activation of S6K can down-regulate IRS-I, an adaptor molecule important for IGF-IR signaling to AKT (Easton et al, 2006, Cancer Cell 9: 153-155). This provides for a negative feedback from S6K to IRS-1/AKT and suggests that while IGF-I may initially stimulate both the non-raft and raft IGF-IR population, prolonged treatment results in activated S6K produced from the raft population down-regulating IGF-IR signaling from the non-raft population, thereby reducing AKT S473 phosphorylation. This proposition is further supported by the data disclosed herein that demonstrates that while the duration of S6K T389 phosphorylation after IGF-I stimulation is shortened by the diminution of ASM, the duration of AKT S473 actually increases, perhaps reflecting the diminution of the negative S6K/IRS-1/AKT feedback loop. Similarly, although not wishing to be bound by any particular theory, a non-raft IGF-IR group that is not dependant on ASM may also explain the initial increase in S6K T389 and 4E-BP1 phosphorylation seen even in the absence of ASM. The initial S6K and 4E-BP1 phosphorylation may be a result of the AKT-dependent, non-raft mTORCl signaling pathway. Prolonged maintenance of S6K and 4E-BP1 phosphorylation by IGF-I stimulation, however, appears to require signaling from the raft associated IGF-IR to the mTORCl complex.

Acidic sphingomyelinase promotion of proliferation

While earlier research focused on the role of ASM in the induction of apoptosis after pro-apoptotic stimuli, the data disclosed herein demonstrate that ASM is critical for pro-survival signals in both primary and cancer cells. Furthermore, the data disclosed herein demonstrate that ASM is required for proliferation of cells growing in serum and as well as cells exposed to growth factor stimulation, for example, IGF-I.

The data disclosed herein demonstrate that ASM is not necessary for IGF-IR tyrosine phosphorylation, since diminution of ASM did not significantly reduce tyrosine phosphorylation of the IGF-IR. Therefore, although not wishing to be bound by any particular theory, the general activation of the receptor appears likely not altered by IGF-IR lipid raft localization.

As disclosed herein, neither IRS-I nor p85 recruitment to the receptor was affected by the diminution of ASM. Furthermore, the data disclosed herein demonstrate that IRS-I was found entirely in the soluble fraction of a sucrose gradient, suggesting another adaptor protein may be involved in IGF-IR signaling to mTORCl . Since the IGF-IR is a tyrosine kinase, the ceramide-raft was evaluated for any substantially tyrosine phosphorylated proteins in the ceramide-raft that were IGF- I and ASM dependant.

The data disclosed herein demonstrate that Racl, of the Rho family of GTPases, is localized to the ASM-dependent lipid raft. Racl is known to stimulate ROS production (Sundaresan et ah, 1996, Biochem J 318:379-382) and has been shown to be involved in Ras oncogene-mediated transformation (Irani et al., 1997, Science 275: 1649-1652). In one embodiment of the invention, the diminution of ASM activity or stability, by, for example, pharmacological inhibition or siRNA, can interfere with Racl signaling. In other embodiments, antibody neutralization of surface ASM, or of ceramide, can interfere with Racl signaling.

The data disclosed herein demonstrate a 150 kD protein that is highly phosphorylated after IGF-I stimulation and that is localized to the low-density fraction in a sucrose gradient (Figure 5d). In one embodiment, the method of the invention contemplates interference with the 150 kD protein or complex, or interference with its phosphorylation.

The data disclosed herein demonstrate that cholesterol is an important component of the IGF-IR containing lipid raft. In addition to a decrease in activity, AKT S473 phosphorylation is also somewhat decreased by cholesterol depletion in IGF-I treated cells, establishing that AKT S473 signaling occurs in a cholesterol-raft dependant fashion. Interestingly, however, neutralization of ASM or ceramide with their respective antibodies did not reduce AKT S473 phosphorylation, a discrepancy that could be the result of ASM neutralization being less efficient at disrupting the lipid rafts than is cholesterol depletion. However, since ASM depletion by siRNA also does not affect AKT S473, it is also likely that AKT S473 from the IGF-IR occurs from a separate ASM-independent group of the IGF-IR receptor. Although not wishing to be bound by any particular theory, this suggests the ASM-independent pathway regulates AKT S473 signaling from IGF-IRs that are in an area of the membrane that is sensitive to cholesterol content, but is not sensitive to ceramide content.

Acidic sphingomyelinase and cancer therapy

The data disclosed herein demonstrate IGF-IR localization in the membrane lipid raft, dependant on ASM activity, and therefore provides a novel approach for the interference of IGF-IR signaling system in cancer cells. In one embodiment, interference with IGF-IR signaling can be achieved by inhibiting ASM stability or enzyme activity, or its cellular localization, through the use of a pharmacological inhibitor, such as, for example, desipramine or clomipramine. Desipramine and clomipramine have been used clinically as a tricyclic antidepressant (Kerr et al, 2001, Emerg Med J 18: 236-241; Montgomery et al, 2008, Int Clin Psychopharmacol, 22:323-329). Moreover, because ASM is expressed on the extracellular membrane surface, and because it is necessary for IGF-IR-mediated signaling, ASM can be targeted for inhibition by using, for example, anti-ASM antibodies. In an aspect of the invention, treatment of cells with anti-ASM antibodies, specifically inhibits IGF-I stimulation of the pathway, but does not also inhibit the AKT pathway. In some embodiments, the methods of the invention interfere with IGF-IR signaling in a human cell. In other embodiments, the methods of the invention interfere with Racl signaling in a human cell.

The data disclosed herein demonstrate that cholesterol is an important component of IGF-IR containing ceramide-enriched lipid rafts. It has been reported that the cholesterol-lowering statins have anti-cancer effects in some model systems (Li et al, 2006, Am. J Pathol 168: 1107-11 18). In one embodiment of the invention, anti-cholesterol drugs, alone or in combination with the various methods of the invention disclosed herein can be used to interfere with the IGF-IR signaling system, to diminish proliferation, and to treat cancer.

It has been shown that IGF-IR inhibition, through the use of specific kinase inhibitors sensitizes cells to other anticancer drugs (Mitsiades et al. , 2004, Cancer Cell 5: 221-230). It is an embodiment of the invention that the various methods of the invention disclosed herein can be used in combination with other anticancer therapies to enhance their anti-cancer effects.

C. elesans ASM-3 Positively Mediates the DAF-2 Signaling Pathway Involved in Regulation of ROS Resistance, Lifespan and Dauer Development

The data disclosed herein demonstrate that the diminution of C. elegans asm-3 increases C. elegans lifespan, increases dauer formation, and increases ROS resistance, in a manner that suggests that C. elegans asm-3 functions in the daf-2 signaling pathway. Although not wishing to be bound by any particular theory, the data disclosed herein are consistent with a hypothesis that endogenous ceramide production by C. elegans ASM-3, through the hydrolysis of sphingomyelin, facilitates the signaling of the DAF-2 receptor. The data disclosed herein demonstrate a new mechanism for interfering the DAF-2 signaling pathway by interfering with the biosynthesis of sphingomyelin and by interfering with sphingomyelin's hydrolysis to ceramide.

Antibodies

As will be understood by one skilled in the art, any antibody that can recognize and specifically bind to a cell component involved in IGF-IR signaling is useful in the present invention. The invention should not be construed to be limited to any one type of antibody, either known or heretofore unknown, provided that the antibody can specifically bind to a cell component involved in IGF-IR signaling. Methods of making and using such antibodies are well known in the art. For example, the generation of polyclonal antibodies can be accomplished by inoculating the desired animal with the antigen and isolating antibodies which specifically bind the antigen therefrom. Monoclonal antibodies directed against full length or peptide fragments of a protein or peptide may be prepared using' any well known monoclonal antibody preparation procedures, such as those described, for example, in Harlow et al. (1989, Antibodies, A Laboratory Manual, Cold Spring Harbor, New York) and in Tuszynski et al. (1988, Blood 72: 109-115). Quantities of the desired peptide may also be synthesized using chemical synthesis technology. Alternatively, DNA encoding the desired peptide may be cloned and expressed from an appropriate promoter sequence in cells suitable for the generation of large quantities of peptide. Monoclonal antibodies directed against the peptide are generated from mice immunized with the peptide using standard procedures as referenced herein. However, the invention should not be construed as being limited solely to methods and compositions including these antibodies, but should be construed to include other antibodies, as that term is defined elsewhere herein.

One of skill in the art will further appreciate that the present invention encompasses the use of antibodies derived from camelid species. That is, the present invention includes, but is not limited to, the use of antibodies derived from species of the camelid family. As is well known in the art, camelid antibodies differ from those of most other mammals in that they lack a light chain, and thus comprise only heavy chains with complete and diverse antigen binding capabilities (Hamers-Casterman et ah, 1993, Nature 363:446-448). Such heavy-chain antibodies are useful in that they are smaller than conventional mammalian antibodies, they are more soluble than conventional antibodies, and further demonstrate an increased stability compared to some other antibodies.

Camelid species include, but are not limited to Old World camelids, such as two-humped camels (C bactrianus) and one humped camels (C. dromedarius). The camelid family further comprises New World camelids including, but not limited to llamas, alpacas, vicuna and guanaco. The use of Old World and New World camelids for the production of antibodies is contemplated in the present invention, as are other methods for the production of camelid antibodies set forth herein.

The production of polyclonal sera from camelid species is substantively similar to the production of polyclonal sera from other animals such as sheep, donkeys, goats, horses, rabbits, mice, chickens, rats, and the like. The skilled artisan can prepare high-titers of antibodies from a camelid species with no undue experimentation. As an example, the production of antibodies in mammals is detailed in such references as Harlow et al. (1989, Antibodies: A Laboratory Manual, Cold Spring Harbor, New York). Camelid species for the production of antibodies and sundry other uses are available from various sources, including but not limited to, Camello Fataga S. L. (Gran Canaria, Canary Islands) for Old World camelids, and High Acres Llamas (Fredricksburg, TX) for New World camelids.

The isolation of camelid antibodies from the serum of a camelid species, like the isolation of antibodies from the serum of other animals such as sheep, donkeys, goats, horses, rabbits, mice, chickens, rats, and the like, can be performed by many methods well known in the art, including but not limited to ammonium sulfate precipitation, antigen affinity purification, Protein A and Protein G purification, and the like. As an example, a camelid species may be immunized to a desired antigen, or fragment thereof, using techniques well known in the art. The whole blood can them be drawn from the camelid and sera can be separated using standard techniques. The sera can then be absorbed onto a Protein G-Sepharose column (Pharmacia, Piscataway, NJ) and washed with appropriate buffers, for example 20 mM phosphate buffer (pH 7.0). The camelid antibody can then be eluted using a variety of techniques well known in the art, for example 0.15M NaCl, 0.58% acetic acid (pH 3.5). The efficiency of the elution and purification of the camelid antibody can be determined by various methods, including SDS-PAGE, Bradford Assays, and the like. The fraction that is not absorbed can be bound to a Protein A-Sepharose column (Pharmacia, Piscataway, NJ) and eluted using, for example 0.15M NaCl, 0.58% acetic acid (pH 4.5). The skilled artisan will readily understand that the above methods for the isolation and purification of camelid antibodies are exemplary, and other methods for protein isolation are well known in the art and are encompassed in the present invention.

The present invention further contemplates the production of camelid antibodies expressed from nucleic acid. Such methods are well known in the art, and are detailed in, for example U.S. Patents 5,800,988; 5,759,808; 5,840,526, and 6,015,695, which are incorporated herein by reference in their entirety. Briefly, cDNA can be synthesized from camelid spleen mRNA. Isolation of RNA can be performed using multiple methods and compositions, including TRIZOL (Gibco/BRL, La Jolla, CA) further, total RNA can be isolated from tissues using the guanidium isothiocyanate method detailed in, for example, Sambrook et al. (1989, Molecular Cloning, A Laboratory Manual, Cold Spring Harbor, New York). Methods for purification of mRNA from total cellular or tissue RNA are well known in the art, and include, for example, oligo-T paramagnetic beads. cDNA synthesis can then be obtained from mRNA using mRNA template, an oligo dT primer and a reverse transcriptase enzyme, available commercially from a variety of sources, including Invitrogen (La Jolla, CA). Second strand cDNA can be obtained from mRNA using RNAse hr and E. coli DNA polymerase I according to techniques well known in the art. Identification of cDNA sequences of relevance can be performed by hybridization techniques well known by one of ordinary skill in the art, and include methods such as Southern blotting, RNA protection assays, and the like. Probes to identify variable heavy immunoglobulin chains (V_HH) are available commercially and are well known in the art, as detailed in, for example, Sastry et al. (1989, Proc. Nat'l. Acad. Sci. USA 86:5728). Full-length clones can be produced from cDNA sequences using any techniques well known in the art and detailed in, for example, Sambrook et al. (1989, Molecular Cloning, A Laboratory Manual, Cold Spring Harbor, New York).

The clones can be expressed in any type of expression vector known to the skilled artisan. Further, various expression systems can be used to express the V_HH peptides of the present invention, and include, but are not limited to eukaryotic and prokaryotic systems, including bacterial cells, mammalian cells, insect cells, yeast cells, and the like. Such methods for the expression of a protein are well known in the art and are detailed elsewhere herein.

The V_HH immunoglobulin proteins isolated from a camelid species or expressed from nucleic acids encoding such proteins can be used directly in the methods of the present invention, or can be further isolated and/or purified using methods disclosed elsewhere herein.

The present invention is not limited to V_HH proteins isolated from camelid species, but also includes V_HH proteins isolated from other sources such as animals with heavy chain disease (Seligmann et al, 1979, Immunological Rev. 48: 145-167, incorporated herein by reference in its entirety). The present invention further comprises variable heavy chain immunoglobulins produced from mice and other mammals, as detailed in Ward et al. (1989, Nature 341 :544-546, incorporated herein by reference in its entirety). Briefly, V_H genes were isolated from mouse splenic preparations and expressed in E. coli. The present invention encompasses the use of such heavy chain immunoglobulins.

Nucleic acid encoding the monoclonal antibody obtained using the procedures described herein may be cloned and sequenced using technology which is available in the art, and is described, for example, in Wright et al. (1992, Critical Rev in Immunol 12: 125-168) and the references cited therein. Further, the antibody of the invention may be "humanized" using the technology described in Wright et al. (supra) and in the references cited therein, and in Gu et al. (1997, Thrombosis and Hematocyst 77:755-759).

To generate a phage antibody library, a cDNA library is first obtained from mRNA which is isolated from cells, e.g., the hybridoma, which express the desired protein to be expressed on the phage surface, e.g., the desired antibody. cDNA copies of the mRNA are produced using reverse transcriptase. cDNA which specifies immunoglobulin fragments are obtained by PCR and the resulting DNA is cloned into a suitable bacteriophage vector to generate a bacteriophage DNA library comprising DNA specifying immunoglobulin genes. The procedures for making a bacteriophage library comprising heterologous DNA are well known in the art and are described, for example, in Sambrook et al. (1989, Molecular Cloning: A Laboratory Manual, Cold Spring Harbor, New York).

Bacteriophage which encode the desired antibody, may be engineered such that the protein is displayed on the surface thereof in such a manner that it is available for binding to its corresponding binding protein, e.g., the antigen against which the antibody is directed. Thus, when bacteriophage which express a specific antibody are incubated in the presence of a cell which expresses the corresponding antigen, the bacteriophage will bind to the cell. Bacteriophage which do not express the antibody will not bind to the cell. Such panning techniques are well known in the art and are described for example, in Wright et al. (supra).

Processes such as those described above, have been developed for the production of human antibodies using Ml 3 bacteriophage display (Burton et al., 1994, Adv. Immunol. 57: 191-280). Essentially, a cDNA library is generated from mRNA obtained from a population of antibody-producing cells. The mRNA encodes rearranged immunoglobulin genes and thus, the cDNA encodes the same. Amplified cDNA is cloned into Ml 3 expression vectors creating a library of phage which express human Fab fragments on their surface. Phage which display the antibody of interest are selected by antigen binding and are propagated in bacteria to produce soluble human Fab immunoglobulin. Thus, in contrast to conventional monoclonal antibody synthesis, this procedure immortalizes DNA encoding human immunoglobulin rather than cells which express human immunoglobulin.

The procedures just presented describe the generation of phage which encode the Fab portion of an antibody molecule. However, the invention should not be construed to be limited solely to the generation of phage encoding Fab antibodies. Rather, phage which encode single chain antibodies (scFv/phage antibody libraries) are also included in the invention. Fab molecules comprise the entire Ig light chain, that is, they comprise both the variable and constant region of the light chain, but include only the variable region and first constant region domain (CHl) of the heavy chain. Single chain antibody molecules comprise a single chain of protein comprising the Ig Fv fragment. An Ig Fv fragment includes only the variable regions of the heavy and light chains of the antibody, having no constant region contained therein. Phage libraries comprising scFv DNA may be generated following the procedures described in Marks et al. (1991, J MoI Biol 222:581-597). Panning of phage so generated for the isolation of a desired antibody is conducted in a manner similar to that described for phage libraries comprising Fab DNA.

The invention should also be construed to include synthetic phage display libraries in which the heavy and light chain variable regions may be synthesized such that they include nearly all possible specificities (Barbas, 1995, Nature Medicine 1 :837-839; de Kruif et al. , 1995, J MoI Biol 248:97-105).

The invention encompasses polyclonal, monoclonal, synthetic antibodies, and the like. One skilled in the art would understand, based upon the disclosure provided herein, that the crucial feature of the antibody of the invention is that the antibody specifically bind with cell component involved in IGF-IR signaling.

Small interfering RNA CsiRNA)

A small interfering RNA (siRNA) is an RNA molecule comprising a set of nucleotides that is targeted to a gene or polynucleotide of interest. As used herein, the term "siRNA" encompasses all forms of siRNA including, but not limited to (i) a double stranded RNA polynucleotide, (ii) a single stranded polynucleotide, and (iii) a polynucleotide of either (i) or (ii) wherein such a polynucleotide, has one, two, three, four or more nucleotide alterations or substitutions therein.

An siRNA in the form of a double stranded polynucleotide comprises about 18 base pairs, about 19 base pairs, about 20 base pairs, about 21 base pairs, about 22 base pairs, about 23 base pairs, about 24 base pairs, about 25 base pairs, about 26 base pairs, about 27 base pairs, about 28 base pairs, about 29 base pairs or about 30 base pairs in length. The double stranded siRNA is capable of interfering with the expression and/or the activity of a component of the IGF-IR signaling system, such as, for example, ASM. A single stranded siRNA comprises a portion of an RNA polynucleotide sequence that is targeted to a gene or polynucleotide of interest. A single stranded siRNA comprises a polynucleotide of about 18 nucleotides, about 19 nucleotides, about 20 nucleotides, about 21 nucleotides, about 22 nucleotides, about 23 nucleotides, about 24 nucleotides, about 25 nucleotides, about 26 nucleotides, about 27 nucleotides, about 28 nucleotides, about 29 nucleotides or about 30 nucleotides in length. The single stranded siRNA is capable of interfering with expression and/or activity of a component of the IGF-IR signaling system, such as, for example, ASM. The single strand siRNA is also capable of annealing to a complementary sequence to result in a dsRNA that is capable of interfering with the expression and/or the activity of a component of the IGF-IR signaling system, such as, for example, ASM.

In yet another aspect, the siRNA comprises a polynucleotide comprising either a double stranded or a single stranded polynucleotide, wherein the siRNA has one, two, three, four or more nucleotide alterations or substitutions therein.

An siRNA polynucleotide is an RNA nucleic acid molecule that interferes with RNA activity that is generally considered to occur via a post- transcriptional gene silencing mechanism. An siRNA polynucleotide preferably comprises a double-stranded RNA (dsRNA) but is not intended to be so limited and may comprise a single-stranded RNA (see, e.g., Martinez et al, 2002, Cell 1 10:563- 74). The siRNA polynucleotide included in the invention may comprise other naturally occurring, recombinant, or synthetic single-stranded or double-stranded polymers of nucleotides (ribonucleotides or deoxyribonucleotides or a combination of both) and/or nucleotide analogues as provided herein (e.g., an oligonucleotide or polynucleotide or the like, typically in 5' to 3' phosphodiester linkage). Accordingly it will be appreciated that certain exemplary sequences disclosed herein as DNA sequences capable of directing the transcription of the siRNA polynucleotides are also intended to describe the corresponding RNA sequences and their complements, given the well established principles of complementary nucleotide base-pairing.

An siRNA may be transcribed using as a template a DNA (genomic, cDNA, or synthetic) that contains a promoter for an RNA polymerase promoter. For example, the promoter can be the U6 promoter or the H 1 RNA polymerase III promoter. Alternatively, the siRNA may be a synthetically derived RNA molecule. In certain embodiments, the siRNA polynucleotide may have blunt ends. In certain other embodiments, at least one strand of the siRNA polynucleotide has at least one, and preferably two nucleotides that "overhang" (i.e., that do not base pair with a complementary base in the opposing strand) at the 3' end of either strand of the siRNA polynucleotide. In a preferred embodiment of the invention, each strand of the siRNA polynucleotide duplex has a two-nucleotide overhang at the 3' end. The two- nucleotide overhang is preferably a thymidine dinucleotide (TT) but may also comprise other bases, for example, a TC dinucleotide or a TG dinucleotide, or any other dinucleotide. The overhang dinucleotide may also be complementary to the two nucleotides at the 5' end of the sequence of the polynucleotide that is targeted for interference. For a discussion of 3' ends of siRNA polynucleotides see, e.g., WO 01/75164.

Preferred siRNA polynucleotides comprise double-stranded polynucleotides of about 18-30 nucleotide base pairs, preferably about 18, about 19, about 20, about 21, about 22, about 23, about 24, about 25, about 26, or about 27 base pairs, and in other preferred embodiments about 19, about 20, about 21, about 22 or about 23 base pairs, or about 27 base pairs, whereby the use of "about" indicates that in certain embodiments and under certain conditions the processive cleavage steps that may give rise to functional siRNA polynucleotides that are capable of interfering with expression of a selected polypeptide may not be absolutely efficient. Hence, siRNA polynucleotides, may include one or more siRNA polynucleotide molecules that may differ (e.g., by nucleotide insertion or deletion) in length by one, two, three, four or more base pairs as a consequence of the variability in processing, in biosynthesis, or in artificial synthesis of the siRNA. The siRNA polynucleotide of the present invention may also comprise a polynucleotide sequence that exhibits variability by differing (e.g., by nucleotide substitution, including transition or transversion) at one, two, three or four nucleotides from a particular sequence. These differences can occur at any of the nucleotide positions of a particular siRNA polynucleotide sequence, depending on the length of the molecule, whether situated in a sense or in an antisense strand of the double-stranded polynucleotide. The nucleotide difference may be found on one strand of a double-stranded polynucleotide, where the complementary nucleotide with which the substitute nucleotide would typically form hydrogen bond base pairing, may not necessarily be correspondingly substituted. In preferred embodiments, the siRNA polynucleotides are homogeneous with respect to a specific nucleotide sequence. Polynucleotides that comprise the siRNA polynucleotides of the present invention may in certain embodiments be derived from a single-stranded polynucleotide that comprises a single-stranded oligonucleotide fragment (e.g., of about 18-30 nucleotides) and its reverse complement, typically separated by a spacer sequence. According to certain such embodiments, cleavage of the spacer provides the single-stranded oligonucleotide fragment and its reverse complement, such that they may anneal to form, optionally with additional processing steps that may result in addition or removal of one, two, three or more nucleotides from the 3' end and/or the 5' end of either or both strands, the double-stranded siRNA polynucleotide of the present invention. In certain embodiments the spacer is of a length that permits the fragment and its reverse complement to anneal and form a double-stranded structure (e.g., like a hairpin polynucleotide) prior to cleavage of the spacer, and optionally, subsequent processing steps that may result in addition or removal of one, two, three, four, or more nucleotides from the 3' end and/or the 5' end of either or both strands. A spacer sequence may therefore be any polynucleotide sequence as provided herein that is situated between two complementary polynucleotide sequence regions which, when annealed into a double-stranded nucleic acid, result in an siRNA polynucleotide. Preferably, the spacer sequence comprises at least 4 nucleotides. In certain embodiments, the spacer may comprise 5, 6, 7, 8, 9, 10, 1 1, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21-25, 26-30, 31-40, 41-50, 51-70, 71-90, 91-1 10, 1 11-150, 151-200 or more nucleotides. Examples of siRNA polynucleotides derived from a single nucleotide strand comprising two complementary nucleotide sequences separated by a spacer have been described (e.g., Brummelkamp et al, 2002, Science 296:550; Paddison et al, 2002, Genes Develop 16:948; Paul et al, 2002, Nat Biotechnol 20:505-508; Grabarek et al, 2003 BioTechniques 34:734-44).

Polynucleotide variants may contain one or more substitutions, additions, deletions, and/or insertions such that the activity of the siRNA polynucleotide is not substantially diminished. The effect of any such alterations in nucleotide content on the activity of the siRNA polynucleotide may generally be assessed as described elsewhere herein. Variants preferably exhibit at least about 75%, 78%, 80%, 85%, 87%, 88% or 89% identity and more preferably at least about 90%, 92%, 95%, 96%, or 97% identity. The percent identity may be readily determined by comparing sequences of the polynucleotides to the corresponding portion of the target polynucleotide, using any method including using computer algorithms well known to those having ordinary skill in the art. These include the Align or the BLAST algorithm (Altschul, 1991, J MoI Biol 219:555-565; Henikoff and Henikoff, 1992, Proc. Natl. Acad. Sci. USA 89: 10915-10919).

Certain siRNA polynucleotide variants can be substantially homologous to a portion of a polynucleotide encoding a target polypeptide. Single- stranded polynucleotides derived from these polynucleotide variants are capable of hybridizing under moderately stringent conditions to a naturally occurring DNA or RNA sequence encoding the target polypeptide. An siRNA polynucleotide that detectably hybridizes to the polynucleotide sequence encoding the target polypeptide under moderately stringent conditions may have a nucleotide sequence that includes at least 10 consecutive nucleotides, more preferably 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29 or 30 consecutive nucleotides that are complementary to a particular target polynucleotide. In certain preferred embodiments, such an siRNA sequence (or its complement) will be unique to a single particular polynucleotide encoding the target polypeptide for which interference with expression is desired. In certain other embodiments, the .sequence (or its complement) may be shared by two or more related polynucleotides encoding the target polypeptide for which interference with polypeptide expression is desired.

Suitable moderate stringent conditions include, for example, pre- washing the polynucleotide in a solution of 5X SSC, 0.5% SDS, 1.0 niM EDTA (pH 8.0); hybridizing the polynucleotide at 50°C-70°C, 5X SSC for 1-16 hours (e.g., overnight); followed by washing the polynucleotide once or twice at 22-65°C for 20- 40 minutes with one or more each of 2X, 0.5X and 0.2X SSC containing 0.05-0.1% SDS. For additional stringency, hybridization conditions may include an additional wash in 0.1 X SSC and 0.1% SDS at 50-60⁰C for 15-40 minutes. Those of ordinary skill in the art will understand that, variations in stringency of hybridization conditions may be achieved by altering the time, temperature, and/or concentration of the solutions used for the pre-hybridization, hybridization, and wash steps. Suitable conditions may also depend in part on the particular nucleotide sequences of the probe used, and of the blotted, probed nucleic acid sample. Accordingly, it will be appreciated that suitably stringent conditions can be readily selected, without undue experimentation, when a desired selectivity of the polynucleotide is identified, based on its ability to hybridize to one or more certain probed sequences while not hybridizing to certain other probed sequences. Sequence specific siRNA polynucleotides of the present invention may be designed using one or more of several criteria. For example, to design an siRNA polynucleotide that has about 21 consecutive nucleotides identical to a sequence encoding a polypeptide of interest, the open reading frame of the polynucleotide sequence may be scanned for about 21 -base sequences length that have one or more of the following characteristics: (1) an A+T/G+C ratio of approximately 1 : 1 but no greater than 2: 1 or 1 :2; (2) an AA dinucleotide or a CA dinucleotide at the 5' end; (3) an internal hairpin loop melting temperature less than 55°C; (4) a homodimer melting temperature of less than 37°C (melting temperature calculations as described in (3) and (4) can be determined using computer software known to those skilled in the art); (5) a sequence of at least 16 consecutive nucleotides not identified as being present in any other known polynucleotide sequence. Alternatively, an siRNA polynucleotide sequence may be designed and chosen using a computer software available commercially from various vendors, e.g., OligoEngine.TM. (Seattle, WA); Dharmacon, Inc. (Lafayette,CO); Ambion Inc. (Austin, TX); and QIAGEN, Inc. (Valencia,CA)). See also Elbashir et al, 2000, Genes & Development 15: 188-200; Elbashir et al., 2001, Nature 411 :494-98. The siRNA polynucleotide may then be tested for the ability to interfere with the expression of the target polypeptide according to methods known in the art and described elsewhere herein. The determination of the effectiveness of an siRNA polynucleotide includes not only consideration of its ability to interfere with the expression of the target polypeptide, but also whether the siRNA polynucleotide is toxic to the host cell. For example, a desirable siRNA would exhibit an RNA interference activity and would also not exhibit an unwanted biological consequence.

Based on the present disclosure, it should be appreciated that the siRNAs of the present invention may effect silencing of the target polypeptide expression to different degrees. The siRNAs thus must first be tested for their effectiveness. Selection of siRNAs are made therefrom based on the ability of a given siRNA to interfere with or modulate the expression of the target polypeptide. Accordingly, identification of specific siRNA polynucleotide sequences that are capable of interfering with expression of a desired target polypeptide requires production and testing of each siRNA.

One skilled in the art will readily appreciate that as a result of the degeneracy of the genetic code, many different nucleotide sequences may encode the same polypeptide. That is, an amino acid may be encoded by one of several different codons, and a person skilled in the art can readily determine that while one particular nucleotide sequence may differ from another, the polynucleotides may in fact encode polypeptides with identical amino acid sequences. As such, polynucleotides that vary due to differences in codon usage are specifically contemplated by the present invention.

Polynucleotides of the siRNA may be prepared using any of a variety of techniques, which are useful for the preparation of specifically desired siRNA polynucleotides. For example, a polynucleotide may be amplified from a cDNA prepared from a suitable cell or tissue type. Such a polynucleotide may be amplified via polymerase chain reaction (PCR). Using this approach, sequence-specific primers are designed based on the sequences provided herein, and may be purchased or synthesized directly. An amplified portion of the primer may be used to isolate a full- length gene, or a desired portion thereof, from a suitable DNA library using well known techniques. A library (cDNA or genomic) is screened using one or more polynucleotide probes or primers suitable for amplification. Preferably, the library is size-selected to include larger polynucleotide sequences. Random primed libraries may also be preferred in order to identify 5' and other upstream regions of the genes. Genomic libraries are preferred for obtaining introns and extending 5' sequences. The siRNA polynucleotide contemplated by the present invention may also be selected from a library of siRNA polynucleotide sequences.

For hybridization techniques, a partial polynucleotide sequence may be labeled (e.g., by nick-translation or end-labeling with ³²P) using well known techniques. A bacterial or bacteriophage library may then be screened by hybridization to filters containing denatured bacterial colonies (or lawns containing phage plaques) with the labeled probe (see, e.g., Sambrook et al., Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratories, Cold Spring Harbor, N.Y., 2001). Hybridizing colonies or plaques are selected and expanded, and the DNA is isolated for further analysis.

Alternatively, numerous amplification techniques are known in the art for obtaining a full-length coding sequence from a partial cDNA sequence. Within such techniques, amplification is generally performed via PCR. One such technique is known as "rapid amplification of cDNA ends" or RACE (see, e.g., Sambrook et al, Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratories, Cold Spring Harbor, N.Y., 2001).

Specific siRNA polynucleotide sequences useful for interfering with target polypeptide expression are presented in the Examples and in the Sequence Listing included herein. siRNA polynucleotides may generally be prepared by any method known in the art, including, for example, solid phase chemical synthesis. Modifications in a polynucleotide sequence may also be introduced using standard mutagenesis techniques, such as oligonucleotide-directed site-specific mutagenesis. Further, siRNAs may be chemically modified or conjugated with other molecules to improve their stability and/or delivery properties. Included as one aspect of the invention are siRNAs as described herein, wherein one or more ribose sugars has been removed therefrom.

Alternatively, siRNA polynucleotide molecules may be generated by in vitro or in vivo transcription of suitable DNA sequences (e.g., polynucleotide sequences encoding a target polypeptide, or a desired portion thereof), provided that the DNA is incorporated into a vector with a suitable RNA polymerase promoter (such as for example, T7, U6, Hl, or SP6 although other promoters may be equally useful). In addition, an siRNA polynucleotide may be administered to a mammal, as may be a DNA sequence (e.g., a recombinant nucleic acid construct as provided herein) that supports transcription (and optionally appropriate processing steps) such that a desired siRNA is generated in vivo.

In one embodiment, an siRNA polynucleotide, wherein the siRNA polynucleotide is capable of interfering with expression of a target polypeptide can be used to generate a silenced cell. Any siRNA polynucleotide that, when contacted with a biological source for a period of time, results in a significant decrease in the expression of the target polypeptide is included in the invention. Preferably the decrease is greater than about 10%, more preferably greater than about 20%, more preferably greater than about 30%, more preferably greater than about 40%, about 50%, about 60%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95% or about 98% relative to the expression level of the target polypeptide detected in the absence of the siRNA. Preferably, the presence of the siRNA polynucleotide in a cell does not result in or cause any undesired toxic effects.

In another embodiment, the siRNA polynucleotide that, when contacted with a biological source for a period of time, results in a significant decrease in the expression of the target polypeptide Preferably the decrease is about 10%-20%, more preferably about 20%-30%, more preferably about 30%-40%, more preferably about 40%-50%, more preferably about 50%-60%, more preferably about 60%-70%, more preferably about 70%-80%, more preferably about 80%-90%, more preferably about 90%-95%, more preferably about 95%-98% relative to the expression level of the target polypeptide detected m the absence of the SiRNA

In yet another embodiment, the siRNA polynucleotide that, when contacted with a biological source for a peπod of time, results in a significant decrease in the expression of the target polypeptide Preferably the decrease is about 10% or more, more preferably about 20% or more, more preferably about 30% or more, more preferably about 40% or more, more preferably about 50% or more, more preferably about 60% or more, more preferably about 70% or more, more preferably about 80% or more, more preferably about 90% or more, more preferably about 95 % or more, more preferably about 98% or more relative to the expression level of the target polypeptide detected in the absence of the siRNA

As such, the invention compnses an siRNA polynucleotide, such as siRNAs as exemplified m SEQ ID NOs 1 and 2 SEQ ID NOs 1 and 2 are sequences of ASM The polynucleotide and polypeptide sequences for vaπous components of IGF-IR signaling may be found at computeπzed databases known to those of ordinary skill in the art One such database is the National Center for Biotechnology Information's Genbank and GenPept databases The nucleic acid sequences for these known genes may be amplified, combined with the sequences disclosed herein (e g , ligated) and/or expressed using the techniques disclosed herein or by any technique that would be know to those of ordinary skill in the art (e g , Sambrook et al , Molecular Cloning A Laboratory Manual, Cold Spπng Harbor Laboratoπes, Cold Spπng Harbor, N Y , 2001) Though a nucleic acid may be expressed in an in vitro expression system, in preferred embodiments the nucleic acid compnses a vector for in vivo replication and/or expression

Following the generation of the siRNA polynucleotide of the present invention, a skilled artisan will understand that the siRNA polynucleotide will have certain characteristics that can be modified to improve the siRNA as a therapeutic compound Therefore, the siRNA polynucleotide may be further designed to resist degradation by modifying it to include phosphorothioate, or other linkages, methylphosphonate, sulfone, sulfate, ketyl, phosphorodithioate, phosphoramidate, phosphate esters, and the like (see, e.g., Agrwal et al, 1987, Tetrahedron Lett. 28:3539-3542; Stec et al, 1985, Tetrahedron Lett. 26:2191-2194; Moody et al, 1989, Nucleic Acids Res. 12:4769-4782; Eckstein, 1989, Trends Biol. Sci. 14:97- 100; Stein, In: Oligodeoxynucleotides. Antisense Inhibitors of Gene Expression, Cohen, ed., Macmillan Press, London, pp. 97-117 (1989)).

Any polynucleotide of the invention may be further modified to increase its stability in vivo. Possible modifications include, but are not limited to, the addition of flanking sequences at the 5' and/or 3' ends; the use of phosphorothioate or 2' O-methyl rather than phosphodiester linkages in the backbone; and/or the inclusion of nontraditional bases such as inosine, queosine, and wybutosine and the like, as well as acetyl- methyl-, thio- and other modified forms of adenine, cytidine, guanine, thymine, and uridine.

Mango stin

Mangostin is compound isolated from the Mangosteen tree (Garcinia mangostanά) having a xanthone core structure (Hamada, 2003, Bioorganic Medicinal Chem Lett, 13:3151-3153; Matsumoto, 2005, Bioorganic Medicinal Chem Lett, 13:6064-6069). Mangostin compounds useful in the methods of the invention include, but are not limited to, alpha-mangostin, beta-mangostin, gamma-mangostin, methoxy- beta-mangostin, dimethylmangostin and their derivatives. In some embodiments of the invention, mangostin is used in combination with other compounds able to interfere with IGF-IR signaling. In other embodiments of the invention, mangostin is used in combination with other compounds able to interfere with Racl signaling.

Sphingomyelin substrate analogues

In some embodiments, the method of the invention employs derivatives and analogues of sphingomyelin that are able to interact with ASM and thereby inhibit its activity. In some embodiments of the invention, a sphingomyelin substrate analogue can be used in combination with other compounds able to interfere with IGF-IR signaling. In other embodiments of the invention, a sphingomyelin substrate analogue can be used in combination with other compounds able to interfere with Racl signaling. One example of a nitrogen analogue of sphingomyelin can be found in Hakogi, 2003, Organic Lett 16:2801-2803. One example of a thiourea derivative sphingomyelin can be found in Darroch, 2005, J Lipid Res 46:2315-2324.

Statins

Statins (or HMG-CoA reductase inhibitors) are a class of cholesterol- lowering drugs. Statins lower cholesterol by inhibiting the enzyme HMG-CoA reductase, an enzyme in the cholesterol synthesis pathway. Examples of statins useful in the methods of the invention include, but are not limited to, cerivastatin, rosuvastatin, atorvastatin, simvastatin, lovastatin, pravastatin, pitavastatin, mevastatin and fluvastatin. In some embodiments of the invention, a statin can be used to interfere with IGF-IR signaling. In other embodiments of the invention, a statin can be used to interfere with Racl signaling. In some embodiments of the invention, a statin can be used in combination with other agents to interfere with IGF-IR signaling. In other embodiments of the invention, a statin can be used in combination with other agents to interfere with Racl signaling.

Definitions:

The articles "a" and "an" are used herein to refer to one or to more than one (i.e. to at least one) of the grammatical object of the article. By way of example, "an element" means one element or more than one element.

The term "about" will be understood by persons of ordinary skill in the art and will vary to some extent on the context in which it is used.

By the term "specifically binds," as used herein, is meant an antibody which recognizes and binds its target (for examples, ASM or ceramide) but does not substantially recognize or bind other molecules in a sample.

The terms "interfere," "interferes," "interfering," "interference," are used herein to include that which partially, or completely, impedes, obstructs, restrains, diminishes, retards or the like.

The term "ASM inhibitor," as used herein, includes any agent or compound that inhibits, restrains, retards, diminishes or otherwise interacts with the action, activity, stability or production of ASM protein or RNA, such as, but not limited to, desipramine, clomipramine, an antibody that specifically binds to ASM, an siRNA targeting ASM RNA, a mangostin compound, or a sphingomyelin substrate analogue.

EXPERIMENTAL EXAMPLES

The invention is further described in detail by reference to the following experimental examples. These examples are provided for purposes of illustration only, and are not intended to be limiting unless otherwise specified. Thus, the invention should in no way be construed as being limited to the following examples, but rather, should be construed to encompass any and all variations which become evident as a result of the teaching provided herein.

The materials and methods employed in the experiments disclosed herein are now described.

Cell culture

H 1299 (non-small cell human lung carcinoma), U87-MG (human glioblastoma), and Wi-38 (primary human lung fibroblast) cell lines were obtained from ATCC. H 1299 cells were maintained in RPMI 1640 supplemented with 10% fetal bovine serum (FBS) (Hyclone), 1 mM sodium pyruvate, 10 mM HEPES (pH 7.2 - 7.5), 100 LVmL penicillin and 100 μg/mL streptomycin. U87-MG and Wi-38 were maintained in Dulbecco's Modified Eagle Medium (DMEM) supplemented with 10% FBS (Hyclone), 100 LVmL penicillin, and 100 μg/mL streptomycin. All cells were cultured at 37⁰C in 5% CO₂.

siRNA transfections

For siRNA transfections, cells were transfected with either ASM siRNA, ASM.2 siRNA, or control siRNA duplex using Oligofectamine (Invitrogen). The target sequence for ASM siRNA was CTACCTACATCGGCCTTAA (SEQ ID NO: 1) and for ASM.2 siRNA was ACCGAATTGTAGCCAGGTA (SEQ ID NO:2). The target sequence of the control siRNA from firefly luciferase was AACGTACGCGGAATACTTCGA (SEQ ID NO:3). Cells were transfected with siRNA and then harvested 72-96 hours post-transfection in 0.5% NP40 lysis buffer (0.5% NP40, 50 mM Tris (pH 7.4), 150 mM NaCl) containing 10 μg/mL aprotinin, 1 mM benzamidine, 10 μg/mL leupeptin, 50 mM NaF, 2 mM sodium pyrophosphate, 1 niM sodium vanadate, and 20 mM B-glycerophosphate. Lysates were clarified, normalized, and denatured by boiling in sample buffer (2% SDS, 10% glycerol, 2% β- mercaptoethanol, 40 mM Tris (pH 6.8), and bromophenol blue). Samples were analyzed by SDS-PAGE and immunoblot analysis with the indicated primary antibodies, followed by the appropriate secondary antibodies conjugated to HRP, and developed with enhanced chemi-luminescence.

Antibodies and Reagents

The ASM (H-181), Cyclin A (H-432), Cyclin Dl (M-20), S6K (C-18), IGF-IR (C-20), IRS-I (C-20), and p27 (C- 19) antibodies were obtained from Santa Cruz Biotechnology. Phosphorylated or total antibodies for AKT and 4E-BP1 were obtained from Cell Signaling Technology, as was S6K (T389). The Rb (pi 05), Racl, Flottilin-2, ERKl (T202/Y204) / ERK2 (Tl 83/Yl 85), ERK 1/2 (pan) antibodies were obtained from BD Biosciences. Anti-ceramide antibody was from Alexis Biochemicals. Anti-phospho tyrosine (4G10) and p85 antibodies were obtained from Upstate Cell Signaling Solutions.

The reagents desipramine, clomipramine, MβCD, and αCD were all purchased from Sigma. Clomipramine and desipramine were dissolved in DMSO. MβCD and αCD were dissolved in IX phosphate buffered saline (PBS) (Invitrogen). Human recombinant insulin-like growth factor-I (IGF-I) was obtained from Invitrogen and used at 100 ng/mL. C6-ceramide (Product Number: 860506) was obtained from Avanti Polar Lipids Inc. (Alabaster, AL).

Cholesterol depletion and repletion

For cholesterol depletion experiments, post-confluent cells were serum starved for 48 hours and then treated with either MβCD or α-cyclodextrin, at the concentrations indicated elsewhere herein, for 30 minutes (Grassme et ai, 2001, J Biol Chem 276, 20589-20596). Cells were then stimulated with IGF-I for 90 minutes and then were harvested in 0.5% NP40 lysis buffer for SDS-PAGE or in 1 % Brij 58 lysis buffer for lipid raft isolation on a sucrose gradient.

For cholesterol replenishment experiments, complexes were prepared as previously described (Klein et al, 1995, Biochemistry 34: 13784-13793). Cholesterol was first dissolved in propanol. Then cholesterol/propanol was dissolved in 38 mM MβCD in an 8O⁰C water bath to form water soluble 4 mM cholesterol complexes. For cell treatment, cells were starved for 48 hours, then treated with MβCD for 30 minutes, then treated with cholesterol/MβCD for 60 minutes, and finally treated with 100 ng/mL IGF-I for 90 minutes. Cells were harvested in 0.5% NP40 lysis buffer.

Cell proliferation assay

Cell proliferation was determined by measuring DNA synthesis using a commercially available BrDU incorporation kit, Cell Proliferation BrDU kit (Roche Applied Science). Cells were transfected with ASM siRNA or control siRNA and after 48 hours transferred into 96-well dishes. After an additional 48 hours, cells were labeled with BrDU for 2.5 hours. The BrDU solution was removed and fixation/denaturation solution was added for 30 minutes. The secondary antibody, anti-BrDU-conjugated to peroxidase, was added to the cells for 90 minutes. After incubation with luminol substrate for 5 minutes, chemiluminescence was detected using a luminometer.

Isolation of membrane lipid rafts and sucrose gradient

Cells were harvested for raft isolation using two methods: 1) with 1 % Brij 58 lysis buffer, or 2) using a non-detergent method as described (Charruyer et al, 2005, J Biol Chem 280, 19196-19204).

For detergent isolation, 5 X 10⁶ cells were washed twice in ice-cold IX PBS and then lysed in MBS solution (150 mM NaCl, 25 mM MES pH 6.5) containing 1% (w/v) Brij 58 with 10 μg/mL aprotinin, 1 mM benzamidine, 10 μg/mL leupeptin, 50 mM NaF, 2 mM sodium pyrophosphate, 1 mM sodium vanadate, and 20 mM β- glyerophosphate. After scraping, cells were homogenized with 20 strokes of a Dounce homogenizer. Lysate was clarified by centrifugation at 960xg for 10 minutes at 4⁰C and normalized before loading onto a sucrose gradient. An equal volume of lysate was added to 0.45 mL of 80% sucrose-MBS. This mixture was loaded under 3.4 mL 35% sucrose-MBS, and 0.70 mL of 5% sucrose-MBS. Gradients were centrifuged in a SW 50.1 swinging rotor for 16 hours at 40,600 rpm at 4⁰C. After spinning, ten 0.50 mL fractions were taken from the low-density top (fraction #1), through to the bottom (fraction #10). Fractions were denatured by boiling in sample buffer and analyzed by SDS-PAGE and immunoblot analysis as described. For non-detergent raft isolation, the methodology of Macdonald et al. , was followed (Macdonald and Pike, 2005, J Lipid Res 46: 1061-1067). Cells were washed twice with PBS, scraped into a base buffer (20 mM Tris (pH 8.0), 250 mM sucrose) containing 1 mM CaC12 and 1 mM MgC12 with inhibitors. Cells were pelleted by centrifugation at 250xg for 2 minutes at 4⁰C. The pellet was resuspended in base buffer with cations and inhibitors and syringed 20 times with a 22 gauge needle. Lysate was centrifuged at 1000xg for 10 minutes and the supernatant was collected. Lysis, syringing, and centrifugation were repeated and collected supernatants were combined. An equal volume of lysate was combined with 80% sucrose in 20 mM Tris (pH 8.0). A 35% sucrose-Tris solution of 3.4 mL was poured on top of the 40%-sucrose-lysate mixture, followed by 0.7 mL 5% sucrose-Tris. Centrifugation and analysis were done as described.

Sphingomyelinase assay

Cells were lysed in 0.2% Triton/PBS with inhibitors and the lysate was Dounce homogenized and clarified (Charruyer et al., 2005, J Biol Chem 280, 19196- 19204; Dumitru and Gulbins, 2006, Oncogene 25:5612-5625; Rotolo et al., 2005, J Biol Chem 280:26425-26434). The substrate, (choline-methyl- 14C) sphingomyelin (ARC-772; 55 mCi/mol), was dried, resuspended in substrate buffer (250 mM sodium acetate, 1 mM EDTA, 0.1 % Triton) and sonicated (Dumitru and Gulbins, 2006, Oncogene 25:5612-5625). Then 100 μl of sphingomyelin substrate and 100 μl of lysate were incubated at 37⁰C for 1 hour with occasional vortexing. After one hour, 200 μl of water was added, followed by 800 μl of chloroform:methanol:HCl (100: 100: 1). Samples were vortexed and phases were separated by centrifugation at 1200xg for 5 minutes at room temperature. To determine the amount of released radioactive phosphorylcholine, 250 μl out of 300 μl of the upper aqueous phase was mixed with 5 mL scintillation fluid. This was then subjected to scintillation counting.

Antibody neutralization

Cells were serum-starved for 48 hours and then incubated in starvation media with 0.1 % BSA and either 10 μg/mL anti-ASM antibody or 10 μg/mL anti- ceramide antibody for 30 minutes (Grassme et al, 2001, J Biol Chem 276:20589- 20596). The appropriate rabbit or mouse IgG was used at the same concentration as control. After incubation with an antibody, the cells were then stimulated with 100 ng/mL IGF-I for 90 minutes before harvesting for lysate.

Immunoprecipitation

Cells were lysed in 0.5% NP40 buffer containing 10 μg/mL aprotinin, 1 mM benzamidine, 10 μg/mL leupeptin, 50 mM NaF, 2 mM sodium pyrophosphate, 1 mM sodium vanadate, and 20 mM B-glycerophosphate. Lysates were clarified and equal amounts of lysates were immunoprecipitated with an anti-IGF-IRβ (H-181) or anti-P(Y) (4G10) antibody at 4⁰C overnight. The immuno-complexes were captured using Protein-A-Sepharose beads and washed five times with 0.5% NP40 lysis buffer. The immunoprecipitates were then analyzed by SDS-PAGE and immunoblot analysis conducted with the appropriate antibodies.

RNAi Screen and Lifespan Assay in C. eleeans

The rrf-3(pkl426) strain was obtained from Caenorhabditis Genetics Center at the University of Michigan. The rrf-3(pkl426);daf-16(mgDF47) strain was obtained from Cornell University. The daf-2 RNAi expressing plasmid was constructed using primers corresponding to a genomic region in daf-2 (primer set sjj_Y55D5A_391.b, WormBase) and the polymerase chain reaction fragment was then cloned in the L4440 vector. The daf-18 (T07A9.6) or daf-16 (R13H8.1) RNAi plasmids were obtained from the RNAi library (Fraser et al, 2000, Nature 408, 325- 330; Kamath et al, 2003, Nature 421, 231-237).

For paraquat treatment, worms were transiently soaked for 1 hour in 80 mM paraquat solution and then exposed to ambient air. Alternatively, a 1 mL 80 mM paraquat solution was added to 60-mm plate and after soaking for 1 hour, plates were air-dried for 1 hour in a chemical hood. For 24-well plates, 0.1 mL of paraquat solution was used for each well. Survival of the animals. was monitored daily following the treatment.

The systematic RNAi screen was carried out as described (Fraser et al. , 2000, Nature 408, 325-330; Kamath et al., 2003, Nature 421, 231-237). Synchronized Ll worms from rrf-3(pkl426) were obtained by standard egg preparation procedure, and then seeded (-100 animals/well) on agar (in 24-well plate) that contain bacteria expressing interfering dsRNA for the target gene. Thirty-four hours later, when animals reached L4 stage, paraquat solution was added. After 1 hour of soaking, plates were air-dried in a chemical hood. The survival of animals following treatment was monitored daily afterward, and counts were taken at day 3, 4, 5, 6, and 7. In most cases, worms died nearly completely by day 5. If a particular RNAi clone allowed > 20% survival by day 5, it will be designated as a ROS-resistant clone. These RNAi clones were then assayed for lifespan extension phenotype. In each batch of the screen, a negative control (vector), and a positive control (daf-2 RNAi) were assayed in parallel.

Synchronized Ll worms (~50 animals) were seeded on plates expressing individual RNAi. L4 stage was counted as day 0 in the adult lifespan assay. Lifespan assays were carried out at 20°C. Animals were transferred daily to fresh RNAi plates during the worm reproductive period and then every 2-3 days afterward. Missing animals, and animals that died of apparent physical abnormality, were censored from the final data counts. The mean lifespan and standard deviation for each assay were calculated as previously described (Mihaylova et al, 1999, Proc. Natl Acad. Sci. USA 96:7427-7432). Lifespan assays for each RNAi clone were carried out at least twice and similar results were obtained from both sets of experiments. The strain used for lifespan assay was rrf-3(pkl426) or rrf-3(pkl426); daf-16(mgDF47). N2 animals were also used in comparison for a set of genes and were found to produce similar, although weaker phenotype, likely due to reduced RNAi efficiency in the absence of rrf-3(pkl426) mutation. Statistical analyses were carried out using the log-rank test (Prism, GraphPad software, San Diego, CA, USA), and the data sets for a positive clone and vector control were considered significantly different if the P-value is less than 0.02.

Example 1 : Acidic sphingomyelinase is necessary for IGF-IR-mediated signaling

To evaluate whether ASM is involved in IGF-IR-mediated signaling and cell proliferation, pharmacological inhibition of ASM was assessed for its affects on the downstream components of the IGF-IR signaling pathway.

LY294002, an established inhibitor of PI3K and mTORCl signaling (Brunn et al, 1996, Embo J 15:5256-5267; Li and Sun,.1998, Proc Natl Acad Sci USA 95: 15406-11), was used as a control. It has been shown that U87-MG human glioblastoma cells, which are deficient in PTEN, are sensitive to LY294002 (Li and Sun, 1998, Proc Natl Acad Sci USA 95:15406-15411). As might be expected by the inhibition of PI kinase activity, LY294002 treatment reduced AKT phosphorylation at serine 473 (Figure 2a). LY294002 also reduced Skp2 protein levels. Skp2 is a component of the SCF^skp2 ubiquitin ligase complex that is responsible for the proteasomal degradation of the cdk inhibitor, p27^KIP1. As disclosed herein, the results demonstrated that the PI3K pathway regulates Skp2 protein levels through AKTl. Therefore, it appeared that LY294002 inhibited Skp2 protein levels through AKT.

Racl, a Rho GTPase, regulates Cyclin Dl levels in a PI3K-dependant manner (Jennifer Jonason, 2006, Thesis, Yale Univesity). Although not wishing to be bound by any particular theory, this may be the mechanism by which LY294002 treatment reduces Cyclin Dl levels. However, it is noted that mTORCl has also been shown to regulate CyclinDl levels. Loss of Cyclin Dl results in a consequent decrease in pRB (pi 05) phosphorylation. mTORCl regulates the phosphorylation of the translational regulators, S6 kinase at threonine 389 and 4E-BP1 at serine 65. LY294002 treatment reduced S6K T389 and S65 phosphorylation, which is indicative of mTORCl inhibition.

To evaluate whether ASM is involved in regulating IGF-IR signaling, desipramine was assessed for whether it inhibited IGF-IR signaling pathways, similar to inhibition observed following LY294002 treatment. Desipramine has been shown to inhibit ASM activity by promoting its proteolytic degradation (Kolzer et al. , 2004, FEBS Lett 559:96-98). Treatment of asynchronously growing U87-MG cells with desipramine (25 μM) decreased phosphorylation of RB, AKT at S473, S6K at T389, and 4E-BP1 at S65 (Figure 2a). Desipramine also reduced the protein levels of Cyclin Dl and Skp2. The effect was not cell-type specific because desipramine treatment of the primary lung cells, Wi-38, produced similar effects to those seen in U87-MG. As shown in Figure 2a, desipramine treatment of Wi-38 inhibited pRB, AKT, and S6K phosphorylation. The treatment also reduced Skp2 and Cyclin Dl protein levels. Both Skp2 and Cyclin Dl are known to be regulated by the PI3K/PTEN pathway and are involved in promoting the proteasomal degradation of the cdk inhibitor, p27^KIP1 (Mamillapalli et al, 2001, Curr Biol 11 :263-267; Jonason et al, 2007, Cell Cycle 6:951-961). The data disclosed herein establish that pharmacological inhibition of ASM inhibits signaling in actively growing cells.

To evaluate whether the diminution of endogenous ASM would affect signaling, small interfering RNA (siRNA) was used to diminish ASM protein levels in various cell lines. Both U87-MG and H 1299, a non-small cell lung carcinoma cell line that is also deficient in PTEN activity, were treated with siRNA designed against either ASM or firefly luciferase (control). In both U87-MG and H 1299, the diminution of ASM resulted in inhibition of mTORCl signaling. siRNA-mediated diminution of ASM reduced phosphorylation of AKT S473, pRB, S6K T389, and 4E- BPl S65 as compared with luciferase siRNA (Figure 2b). Furthermore, Skp2 and Cyclin Dl protein levels were decreased, while p27^KIPl levels were increased after ASM siRNA treatment. The IGF-IR can also regulate mTORCl signaling through the Ras/Raf/MEK/ERK signaling cascade. Diminution of ASM did not significantly affect ERKl or ERK2 activating phosphorylation at T202/Y204 or T83/Y185, respectively.

To evaluate the specificity of our ASM oligonucleotides, a second oligonucleotide (ASM.2 siRNA) was designed that targeted a different region of ASM. As shown in Figure 2c, ASM.2 siRNA reduced phosphorylation of S6K T389 and AKT S473 in H1299, while leaving ERK 2 T183/Y185 phosphorylation unchanged. ASM.2 siRNA also reduced Cyclin Dl protein levels. The effects of the ASM.2 siRNA were similar to the effects observed with the ASM siRNA, although the magnitude of the effects was not as great. Because the magnitude of the effects was not as great with ASM.2 siRNA, the remaining siRNA experiments were conducted with ASM siRNA.

The effectiveness of the ASM siRNA was also evaluated the by measuring endogenous ASM activity. After transfection with ASM siRNA, cell lysate was harvested and used in an in vitro ASM activity assay. As shown in Figure 2c, the ASM siRNA reduced endogenous ASM activity by about 75%.

To evaluate whether ASM was involved in cellular proliferation, H 1299 cells were transfected with either control or ASM siRNA, labeled with BrDU incorporation, and assessed by the use of a peroxidase conjugated-anti-BrDU antibody. Diminution of ASM reduced cell proliferation relative to control, indicating that ASM is required for cell proliferation under normal serum conditions (Figure 2d).

To evaluate whether H 1299 cells were sensitive to IGF-I stimulation, the cells serum-starved and then stimulated with IGF-I for the indicated times. As shown in Figure 3 a, acute IGF-I stimulation increased phosphorylation of AKT S473, while ERK 1 (T202/Y204) / ERK 2 (Tl 83/Yl 85) phosphorylation was not increased, potentially due to the high basal level of phosphorylation. Phosphorylation of the mTORCl substrates, S6K and 4E-BP1, also increased after IGF-I treatment. To determine whether IGF-I stimulated signaling was dependant on ASM activity, cells were transfected with either control or ASM siRNAs, stimulated with IGF-I, and the effect on downstream signaling components was examined. Diminution of ASM did not affect the IGF-I-mediated increase in AKT S473 phosphorylation (Figure 3a). Nor did diminution of ASM alter ERK 1 (T202/Y204) / ERK 2 (Tl 83/Yl 85) phosphorylation. Diminution of ASM resulted in a decrease in Cyclin Dl protein levels and an increase in p27^Klpl protein levels as compared to control. Interestingly, transfection with ASM siRNA inhibited IGF-I-mediated phosphorylation of S6K at T389 and at 4E-BP1 at S65 (Figure 3a). Since S6K and 4E-BP1 are both well-known substrates of the mTORCl complex, these data establish that ASM is critical for IGF- I-mediated activation of mTORCl, independent of either AKT or ERK signaling.

The data disclosed herein show that diminution of ASM interferes with IGF-I-mediated signaling to mTORCl and diminishes cell proliferation. To evaluate whether ASM was involved in prolonged IGF-I stimulation of the cell proliferation signaling pathways, cells were treated with IGF-I for 24 hours. Treatment was identical to that of acute IGF-I treatment, except that IGF-I treatment was continued over a 24-hour time-course. In control cells, IGF-I treatment increased AKT S473 phosphorylation and the increased phosphorylation was maintained for 1-6 hours. ERK 1 / ERK 2 phosphorylation was slightly increased by IGF-I treatment (Figure 3b). Both S6K and 4E-BP1 phosphorylation was stimulated by IGF-I treatment and then was maintained for a significant portion of the IGF-I treatment. Diminution of ASM, however, reduced the duration of S6K and 4E-BP1 phosphorylation after IGF-I stimulation as compared to control (Figure 3b), while neither the intensity nor the duration of IGF-I-mediated phosphorylation of AKT S473 or ERK 1/ERK2 was diminished by the diminution of ASM. The diminution of ASM reduced the levels of Cyclin A and Cyclin Dl, while increasing the levels of p27^KIP1, indicating that ASM is required for long-term signaling of the IGF-IR to mTORCl for the maintenance of cell proliferation.

To evaluate whether receptor activation was the mechanism by which ASM regulated IGF-IR-mediated signaling, cells were stimulated with IGF-I. Activation of IGF-IR after IGF-I stimulation binding requires phosphorylation of the receptor at multiple tyrosine residues. IGF-I stimulation for 5 to 30 minutes resulted in an increase in tyrosine phosphorylation of the IGF-IR (Figure 3 c). However, diminution of ASM did not affect IGF-IR tyrosine phosphorylation. It was demonstrated that p85, the regulatory subunit of PI3K, interacted with the IGF-IR after IGF-I stimulation (Figure 3c). Diminution of ASM did not affect IGF-I stimulated p85 recruitment to the IGF-IR. The data disclosed herein indicate that for both H 1299 and MCF-7, a breast cancer cell line which has high levels of IGF-IR, IGF-I treatment increased IRS-I tyrosine phosphorylation (Figure 3d) (Sachdev et al, 2006, Cancer Res 66:2391-2402). Diminution of ASM did not reduce IRS-I tyrosine phosphorylation. The data disclosed herein show that ASM does not grossly affect IGF-IR or IRS-I tyrosine phosphorylation, nor p85 recruitment to the IGF-IR.

Example 2: IGF-IR localization in lipid rafts is dependant on ASM activity

The IGF-IR has been shown to localize to lipid rafts, although the specific components of these domains, and whether they are ASM-dependant, remains unknown (Matthews et al, 2005, Endocrinology 146:5463-5473; Remacle-Bonnet et al., 2005, Am J Pathol 167:761-773). Lipid rafts can be isolated by their insolubility in 1% Triton X-100 at low temperatures and by their flotation on a sucrose gradient (Schuck et al., 2003, Proc Natl Acad Sci USA 100:5795-5800). However, it was shown that 1% Brij 58 was more effective at isolating transmembrane proteins than was 1% Triton X-100 (Pike et al, 2005, Biochim Biophys Acta 1746:260-273). To evaluate whether the IGF-IR is localized to lipid rafts, H 1299 lysates were in harvested in 1% Brij 58 at 4⁰C, and then the lipid rafts were isolated by separation on a 5-35% discontinuous sucrose gradient. As shown, Flotillin-2, an established raft marker (del Pozo et al, 2004, Science 303:839-842; Pike et al, 2005, Biochim Biophys Acta 1746:260-273), mainly localized to the low-density (#2) fraction of the gradient (Figure 4a). Racl, which others have shown to localize to lipid rafts, was also found to be localized in the IGF-IR containing lipid raft fraction (Figure 4a).

To confirm that IGF-IR localization in the lipid raft was not an artifact of the specific detergent used, the lipid raft was also isolated using a non-detergent method (Macdonald and Pike, 2005, J Lipid Res 46: 1061-1067; Pike, 2004, Biochem J 378:281-292). As shown, the IGF-IR is localized to the lipid raft even under non- detergent conditions, as well as is the raft marker, Flotillin-2 (Figure 4a). Further, Racl, also localized to lipid raft even under non-detergent conditions (Figure 4a). To evaluate whether IGF-I stimulation affected IGF-IR localization within the rafts, cells were treated with IGF-I and then the lipid rafts were isolated using 1% Brij 58 lysis buffer. Prior to IGF-I stimulation, the lipid raft is already in existence as evidenced by the localization of the raft maker, Flotillin-2, in the low- density fraction of the gradient (Figure 4b). The data disclosed herein indicate that prior to IGF-I stimulation, a population of the IGF-IRs is already localized to the lipid rafts. Further, the data disclosed herein indicate that prior to IGF-I stimulation, Racl is already localized to the lipid rafts. Treatment of cells with IGF-I for 90 minutes did not alter IGF-IR localization in the lipid rafts, nor did it alter Racl localization to the lipid rafts. Further, IGF-I stimulation also did not alter the general existence of the lipid raft, as evidenced by there being no change in Flotillin-2 as compared to non- stimulated. It was also observed that a shorter treatment with IGF-I (5-30 minutes) did not alter IGF-IR localization within the raft in Hl 299 and MCF-7 cells as compared to untreated controls (data now shown). The data disclosed herein are consistent with previous reports that show the IGF-IR in some type of lipid raft prior to IGF-I or insulin stimulation in colon cancer cells (Huo et al, 2003, J Biol Chem 278: 1 1561- 11569) and 3T3-L1 preadipocytes (Remacle-Bonnet et al, 2005, Am J Pathol 167:761-773).

To evaluate whether ASM was involved in IGF-IR localization to the lipid raft, siRNA transfected cells were stimulated with IGF-I. IGF-I stimulation in control siRNA transfected cells resulted in the IGF-IR separating to the low-density fraction of a sucrose gradient, to which a large amount of Flotillin-2 also separated (Figure 4c). The diminution of ASM only modestly reduced Flotillin-2 separation into the low-density fraction, establishing that lipid rafts in general were not significantly disrupted. However, the diminution of ASM completely abolished IGF-IR localization in the lipid raft, and substantially reduced Racl distribution in the lipid rafts (Figure 4c). These data establish that ASM is required to maintain a particular type of lipid raft in which the IGF-IR and Racl reside.

ASM is transported from intracellular domains to the cell membrane where it is expressed on the extra-cellular leaflet of the plasma membrane (Grassme et al, 2001, Biochem Biophys Res Commun 284: 1016-30). At the surface, ASM is able to generate extra-cellularly oriented ceramide from the hydrolysis of sphingomyelin (Dumitru and Gulbins, 2006, Oncogene 25: 5612-25). Neutralization of surface ceramide by anti-ceramide antibody has been shown to inhibit ASM-dependant death receptor signaling (Grassme et al, 2001, J Biol Chem 276: 20589-96). To evaluate whether extra-cellularly oriented ceramide was required for IGF-IR signaling, cells were treated with either IgG control or anti-ceramide antibody and then stimulated with IGF-I. IGF-I stimulated phosphorylation of AKT S473, S6K T389, or 4E-BP1 S65 even in the presence of the IgG control (Figure 4d). Treatment of cells with anti- ceramide antibody did not affect IGF-I induced AKT S473 phosphorylation. However, ceramide neutralization by anti-ceramide antibody treatment did inhibit IGF-I dependant phosphorylation of S6K T389 and 4E-BP1 S65. To evaluate the importance of ASM's presence on the outer leaflet of the membrane for IGF-IR signaling, an antibody neutralization experiment was performed against ASM. In IgG control cells, IGF-I treatment resulted in the phosphorylation of AKT S473, S6K T389 and 4E-BP1 and S65 (Figure 3d). Anti-ASM antibody treatment did not inhibit AKT S473 phosphorylation after IGF-I stimulation. However, surface ASM neutralization with the antibody did inhibit IGF-I-mediated phosphorylation of the substrates S6K and 4E-BP1 at T389 and S65, respectively, establishing that the extra- cellularly distributed ceramide and ASM are necessary for IGF-IR-mediated signaling to the complex.

Example 3: Cholesterol is a critical component of IGF-IR lipid rafts

To further evaluate the role of lipid rafts in IGF-IR signaling, MβCD was used to disrupt cholesterol-containing lipid rafts. MβCD is a cholesterol binding agent that extracts cholesterol from the plasma membrane (Pike, 2005, Biochim Biophys Acta 1746:260-273). Cells were treated with various concentrations of MβCD followed by IGF-I stimulation. MβCD treatment led to the inhibition of IGF-I stimulated S6K T389 and 4E-BP1 S65 phosphorylation (Figure 5a). While phosphorylation of ERK 1/ERK 2 was not affected, AKT S473 phosphorylation was slightly reduced. As a control, cells were treated with α-cyclodextrin, an inactive stereoisomer of MβCD (Grassme et al, 2001, J Biol Chem 276: 20589-96). IGF-I- mediated phosphorylation of S6K, 4E-BP1, and AKT was not inhibited by αCD (Figure 5 a).

To confirm that the effect of MβCD on cells is specific to cholesterol, cholesterol was replenished in MβCD treated cells (see Zhuang et al, 2005,J Clin Invest 115: 959-68; Zhuang et al., 2002, Cancer Res 62: 2227-31). Cells pre-treated with MβCD were then treated with a cholesterol/MβCD complex. MβCD in the cholesterol/MβCD complex serves as a vehicle to deliver the insoluble cholesterol (Klein et al, 1995, Biochemistry 34: 13784-13793). The data disclosed herein show that cholesterol replenishment rescued the MβCD-mediated decrease in S6K T389 and 4E-BP1 S65 phosphorylation in an IGF-I dependant manner (Figure 5b). Interestingly, cholesterol replenishment also partially rescued AKT S473 phosphorylation in MβCD and IGF-I treated cells. In cells treated with vehicle control, rather than IGF-I, cholesterol replenishment after MβCD treatment did not significantly rescue S6K T389, 4E-BP1 S65, or AKT S473 phosphorylation (Figure 5b).

To assess the involvement of cholesterol in IGF-IR signaling from the lipid rafts, MβCD was evaluated for its affect on IGF-IR localization in the lipid raft. Cells not treated with MβCD harvested and the lysate fractionated on a sucrose gradient. As shown, IGF-IR, Flotillin-2, and Racl all localized to the lipid raft fraction (Figure 5c). In cells treated with MβCD, the treatment entirely prevented IGF-IR localization in the lipid raft fraction. Racl distribution to the lipid raft was also reduced, although not as strongly affected as was IGF-IR distribution by the MβCD treatment. However, Flotillin-2 though modestly reduced, were still present in the low-density sucrose gradient fraction demonstrating that not all lipid rafts were affected. The data disclosed herein establish that a particular group of lipid rafts, to which IGF-IR is localized, were disrupted by the loss of cholesterol. MβCD treatment mimics the effect of diminution of ASM on IGF-IR signaling to mTORC 1 and IGF- IR localization in the lipid raft, establishing that both ASM and cholesterol are important components of IGF-IR containing lipid rafts. Furthermore, ASM hydrolysis of sphingomyelin to ceramide in sphingomyelin-cholesterol lipid rafts may create a particular subset of lipid rafts that are cholesterol and ceramide-enriched and are essential for IGF-IR signaling to mTORC 1.

Example 4: 15OkD tyrosine phosphorylated protein localizes to IGF-IR lipid raft As disclosed herein, ASM-mediated IGF-IR signaling to mTORC 1 after IGF-I stimulation is not regulated by either the AKT or ERKl / ERK2 pathways. This suggests there must exist a novel mechanism of IGF-IR signaling to mTORC 1. In H 1299 cells, IGF-I treatment results in the accumulation of a tyrosine phosphorylated protein in approximate molecular weight of 150 kD (Figure 4d top panel). In comparison, IRS-I tyrosine phosphorylation is not affected (Figure 3d). The majority of this phosphorylated protein is segregated into the low-density fraction of a sucrose gradient. Furthermore, this protein is also localized to the same sucrose gradient fraction as the IGF-IR in both IGF-I stimulated and non-stimulated cells (Figure 5d - top panel). Interestingly, IRS-I was found entirely in the soluble fraction of the gradient. Moreover, cells transfected with ASM siRNA reduced amounts of the phosphorylated 15OkD protein found in the low-density fraction as compared with control cells (Figure 5d - bottom panel). Moreover, MBCD treatment reduced the amount of the phosphorylated 15OkD protein that is localized in the low-density fraction of a sucrose gradient.

Example 5: Inhibition of cell proliferation after treatment with ASM inhibitor

To assess the affect of ASM inhibitors on cell proliferation, logarithmically-growing glioblastoma U87-MG cells were treated with vehicle DMSO, desipramine (50 μM) or clomipramine (25 μM) for 24 hours. Cells were pulse-labeled with bromodeoxyuridine (BrdU). DNA synthesis was measured using BrdU incorporation kit (Roche). Potent inhibition of cell proliferation was observed after treatment with each ASM inhibitor. In Figure 7, the results of an example experiment are depicted as relative BrdU incorporation as compared with the control sample (i.e., the cells treated with vehicle DMSO).

Example 6: Interference with the IGF-IR signaling system after treatment with ASM inhibitor

To assess the affect of ASM inhibitors on the IGF-IR signaling system, glioblastoma U87-MG cells were treated with vehicle control (DMSO, 0 μM), or desipramine at 1, 5, 25, or 50 μM, or clomipramine at 1 , 5, 25, or 50 μM. After 24 hours of treatment, cell lysates were prepared and analyzed by SDS-PAGE and Western blot analysis with the anti-S6K(T389), anti-S6K, anti-4E-BPl(S65), anti-4E- BPl(total), anti-AKT(S473), anti-AKT(T3O8), anti-ERK-P, anti-ERK(pan), anti- Cyclin Dl, anti-p27, and anti-pRB antibodies (as indicated in Figure 8). Both desipramine and clomipramine treatments lead to potent inhibition of the IGF-IR signaling pathway as evidenced by reduced phosphorylation of S6 kinase and 4E-BP1 (see Figure 8). Inhibition of Gl cell cycle progression is evidenced by the decreased level of cyclin Dl, the increased level of p27^KIP1 and the reduced phosphorylation of pRB (see Figure 8). Figure 8 depicts the results of an example experiment demonstrating interference with the IGF-IR signaling system.

Example 7: Induction of apoptosis after treatment with ASM inhibitor

To assess the affect of ASM inhibitors on apoptosis, glioblastoma U87-MG cells were treated with vehicle DMSO, desipramine (50 μM) or clomipramine (25 μM) for 24 or 48 hours. Apoptosis assays were carried out using the Guava EasyCyte instrument (Hayward, CA) according to the manufacturer's instructions. Figure 9 depicts the results of an example experiment demonstrating the induction of apoptosis after 24-hour and 48-hour treatments with desipramine or clomipramine.

Example 8: A short-chain ceramide derivative can interfere with IGF-IR signaling

A short-chain ceramide derivative was evaluated to determine whether it could interfere with IGF-IR signaling. While not wishing to be bound by any particular theory, is possible that a short chain, soluble, ceramide can interact with endogenous ceramide in the lipid raft and disrupt the these lipid rafts and thereby interfere with IGF-IR signaling.

Logarithmically growing WI-38 human lung fibroblasts were treated with the short-chain ceramide derivative, C6-ceramide, or desipramine, for 24 hours at the concentrations indicated in Figure 12. Cells were harvested and cell lysates were prepared. The cell lysates were analyzed by SDS-PAGE and Western blot analysis using the antibodies indicated in Figure 12. The data disclosed herein demonstrate that C6-ceramide interferes with the IGF-IR signaling, as evidenced by reduced S6K T389 phosphorylation (Figure 12). Further, the data disclosed herein demonstrate that C6-ceramide blocks Gl cell cycle progression, as evidenced by reduced SKP2 levels and reduced cyclin Dl levels (Figure 12). The ability of C6- ceramide to interfere with IGF-IR signaling was similar to, and more potent than, that of desipramine (Figure 12).

Example 9: Interfering with IGF-IR signaling with desipramine or MβCD blocks the ROS production

The disclosed herein demonstrate that inhibition of ASM prevents Racl from localizing to lipid rafts (Figure 4c and 5c). As lipid raft localization of Racl is known to be essential for Racl function, ASM inhibition should lead to inactivation of Racl . The reduced levels of cyclin Dl in cells subjected to ASM inhibition suggest this to be the case. Cyclin Dl has been shown to be regulated by Racl in a PI3K/PTEN pathway dependent manner (Jennifer Jonason, 2006, Thesis, Yale University).

To further evaluate Racl function in cells treated with ASM inhibitors, intracellular levels of ROS were evaluated. Racl is known to be a potent regulator of intracellular levels of ROS (Sundaresan et al, 1996, Biochem J 318:379-382). Racl- mediated ROS production has been shown to be essential for transformation by oncogenic Ras (Irani et al, 1997, Science 275: 1649-1652). Whether ROS levels are regulated by IGF-IR signaling was assessed. Desipramine and MβCD were evaluated for their ability to interfere with IGF-IR signaling and to interfere with ROS production. U87-MG cells were treated for six hours with DMSO (control), desipramine, or MβCD. Cells were trypsinised, washed and stained with DCF-DA for ROS levels. DCF-DA is a fluorescence-based, lipid-soluble probe that can detect the intracellular formation of several types of ROS (see Halliwell and Whiteman, 2004, Br J Pharmacol 142:231-255). After staining with DFC-DA, cells were examined with a Perkin Elmer/Evotec Opera automated laser confocal microscope. Cells treated with either desipramine or MβCD displayed a diminished amount of ROS when compared with DMSO-treated control cells (Figure 11). Although not wishing to be bound by any particular theory, the data disclosed herein suggest that ROS production is dependent on both ASM and on lipid raft formation.

Example 10: The antioxidant N-acetylcvsteine potently suppresses mitogenic signaling of the IGF-IR/PI 3-k/PTEN pathway

To further evaluate whether Racl and ROS is involved in IGF-IR- mediated signaling, pharmacological inhibition of ROS was assessed for its affects on the downstream components of the IGF-IR signaling pathway.

LY294002, an established inhibitor of PI3K and mTORCl signaling (Brunn et al, 1996, Embo J 15:5256-5267; Li and Sun, 1998, Proc Natl Acad Sci USA 95: 15406-11), was used as a control. It has been shown that U87-MG human glioblastoma cells, which are deficient in PTEN, are sensitive to LY294002 (Li and Sun, 1998, Proc Natl Acad Sci USA 95:15406-15411). As might be expected by the inhibition of PI kinase activity, LY294002 treatment reduced AKT phosphorylation at serine 473 (Figure 10). LY294002 also reduced Skp2 protein levels. Skp2 is a component of the SCF^skp2 ubiquitin ligase complex that is responsible for the proteasomal degradation of the cdk inhibitor, p27^KIP1. As disclosed herein, the data demonstrate that the PI3K pathway regulates Skp2 protein levels through AKTl. Therefore, it appears that LY294002 inhibited Skp2 protein levels through AKT.

Racl, a Rho GTP ase, regulates Cyclin Dl levels in a PI3K-dependant manner (Jennifer Jonason, 2006, Thesis, Yale University). Although not wishing to be bound by any particular theory, this may be the mechanism by which LY294002 treatment reduces Cyclin Dl levels.

To evaluate whether Racl and ROS are involved in regulating IGF-IR signaling, the antioxidant N-acetylcysteine was assessed for whether it inhibited IGF- IR signaling pathways, similar to the inhibition observed following LY294002 and desipramine treatments. Treatment of asynchronously growing glioblastoma U87-MG cells with N-acetylcysteine (20 mM) decreased phosphorylation of RB and AKT at S473, (Figure 10), as did treatments with LY294002 and with desipramine. N- acetylcysteine also reduced the protein levels of Cyclin Dl and Skp2, as did treatments with LY294002 (20 μM) and with desipramine (25 μM). Both Cyclin D and Skp2 have been shown previously to promote the proteasomal degradation of the cdk inhibitor, p27^KIP1 (Mamillapalli et al, 2001, Curr Biol 11 :263-267; Jonason et al, 2007, Cell Cycle 6:951-961). The data disclosed herein establish that pharmacological inhibition of ROS inhibits IGF-IR signaling in actively growing cells. The data disclosed herein demonstrate that N-acetylcysteine blocks ROS production and mimics the effects of desipramine on blocking mitogenic signaling.

Example 11 : RNAi Screen and Lifespan Assay: C. elegans ASM-3 Positively Mediates the DAF-2 Signaling Pathway Involved in Regulation of ROS Resistance, Lifespan and Dauer Development

The evolutionary conservation of the IGF-IR pathway among human, mice, Drosophila and C. elegans has allowed the use of powerful genetic screens to identify novel genes functioning in this pathway. To identify novel genes, which when inactivated, give rise to ROS-resistance and lifespan-extension phenotypes, similar to that observed when the daf-2 gene is silenced or mutated, a genome-wide RNAi screen was conducted (Kim and Sun, 2007, Aging Cell 6:489-503). The screen identified 84 genes that have a role in regulation of animal lifespan. The data disclosed herein demonstrate that one of these genes, asm-3, plays a positive role in mediating signaling from the DAF-2 insulin/IGF-I-like receptor. Inactivation of asm-3 by RNAi or by chromosomal mutation induces lifespan extension and ROS resistance.

As shown in Figure 13, inactivation of asm-3 by RNAi led to an 52%increase in mean lifespan. The lifespan-extension phenotype was completely abolished when the RNAi-mediated asm-3 gene inactivation was carried out a daf-16 null background (i.e., daf-16(mgDF47)), suggesting that asm-3(RNAi) extends lifespan in a daf-16 dependent manner.

A chromosomal deletion allele in the asm-3 gene (obtained from the C. elegans genome knockout consortium) was identified (Figure 14). This deletion allele, okl744, removes a major portion of the gene sequence coding for the ASM-3 protein, including the conserved region of the catalytic domain of ASM-3, and thus, is likely a null allele. The asm-3(okl744) also exhibits a longer lifespan phenotype (Figure 14), with a 32% increase in mean lifespan, as compared with a wild-type counterpart (i.e., N2 strain control).

Since the original screen was first carried out with a strain having a ROS-resistance phenotype (Kim and Sun, 2007, Aging Cell 6:489-503), asm-3 inactivation was examined to determine whether asm-3 inactivation confers resistance to ROS. As shown in Figure 15, both asm-3(RNAi) (Figure 15 - left panel) and the asm-3(okl744) mutation (Figure 15 - right panel) confers resistance to paraquat, which is known to generate ROS after metabolizing in cells. The observation that both the asm-3 (RNAi) and the chromosomal deletion mutation possess similar pheno types of lifespan extension and ROS resistance suggest that both the asm-3(RNAi) and the asm-3(okl744) chromosomal deletion mutation inactivate the same gene.

The diminution of asm-3 was examined to determine whether it lead to activation of daf-16 transcription factor and the consequent activation daf-16 dependent gene transcription. The sod-3 gene, which encodes a superoxide dismutase, is known to contain the binding sites for DAF-16 at its promoter, and sod-3 transcripts have been shown to be up-regulated in the daf-2 mutant background. The Psod-3::gfp reporter gene has been used to monitor the activation of daf-16 and the reporter gene has been shown to be up-regulated in the daf-2(el370) mutant background. The Psod- 3::gfp reporter gene was used to directly examine whether the daf-16 transcription factor is activated when asm-3 is inactivated by RNAi. As shown in Figure 16, inactivation of asm-3 by RNAi readily activates the Psod-3::gfp reporter gene and leads to an increase in GFP expression. Daf-2(RNAi) was used a positive control and empty vector RNAi was used as a negative control. Consistent with previous studies, diminution of the expression of the daf-2 gene by RNAi potently activated the Psod- 3::gfp reporter (Figure 16). The data disclosed herein demonstrate that the diminution of either asm-3 or daf-2 leads to the rapid activation of the daf-16 transcription factor. These data are consistent with the data disclosed herein demonstrating that asm-3 regulates the animal lifespan in a daf-16 dependent manner (Figure 13).

The daf-2 pathway is known to regulate dauer formation. The diminution of asm-3 was examined to determine whether it further reduced daf-2 signaling in a dauer formation assay. Using the daf-2(el370) mutant strain, at a semipermissive temperature (23⁰C), diminution of the asm-3 gene by RNAi increased dauer formation from 28.2 % (empty vector control) to 38.1% (asm-3 RNAi) (Figure 17). The enhancement was less pronounced than that observed with daf-2 RNAi (100%). In both the dauer formation assay (Figure 17) and lifespan assay (Figure 13), the phenotypes resulting from diminution of asm-3 by asm-3(RNAi) is less than that resulting from daf-2 (RNAi).

Example 12: Cancer treatment in a mouse tumor model

According to the invention, compounds able to interfere with IGF-IR signaling can be evaluated for anti-tumor activity. In this context, compounds able to interfere with IGF-IR signaling can be evaluated for their potential to prevent or delay tumor growth in a human xenograph mouse model in vivo. Compounds able to interfere with ASM, such as for example desipramine and clomipramine, which have been shown to possess anti-tumor growth activity in vitro, can be evaluated for their potential to prevent or delay tumor growth in a human xenograph mouse model in vivo. The human xenograph mouse tumor model can include, but is not limited to, the glioblastoma cell line U87-MG, the non-small cell lung cancer cell line H 1299, the breast cancer cell line MCF-7, the prostate cancer cell line LnCAP, or the melanoma cell line SK-MEL-28.

A subcutaneous human xenograph mouse tumor model is developed, as well as a orthotopic human xenograph mouse tumor model. By way of an example, compounds, such as desipramine or clomipramine, can be delivered either intravenously, intraperitoneally, or orally, for example, in drinking water. The administration of these compounds is evaluated for the ability to delay tumor growth, for example, using a papulation assay. In some assays, derivatives of a tumor cell line engineered to express green fluorescence protein (GFP) are used, and the ability of compounds and methods of the invention to alter tumor size or growth rate are monitored by GFP imaging. In some assays, the ability of these compounds to enhance the efficacy of other anti-cancer activities of other chemotherapeutics or antibody therapy (e.g., antibodies against VEGF or VEGFR, EGFR or HER2 receptors) is examined.

The disclosures of each and every patent, patent application, and publication cited herein are hereby incorporated herein by reference in their entirety. While this invention has been disclosed with reference to specific embodiments, it is apparent that other embodiments and variations of this invention may be devised by others skilled in the art without departing from the true spirit and scope of the invention. The appended claims are intended to be construed to include all such embodiments and equivalent variations.

Claims

CLAIMSWe claim:

1. A method of interfering with insulin-like growth factor receptor (IGF-IR) signaling comprising contacting a cell with an ASM inhibitor, wherein the contact of the cell with the acidic sphingomyelinase (ASM) inhibitor reduces ASM activity, and wherein the reduction of ASM activity interferes with IGF-IR signaling.

2. The method of claim 1, wherein the ASM inhibitor is at least one selected from the group consisting of amitriptyline, butriptyline, amoxapine, clomipramine, desipramine, dosulepin hydrochloride, dothiepin hydrochloride, doxepin, imipramine, dibenzepin, iprindole, lofepramine, nortriptyline, opipramol, protriptyline, trimipramine, and combinations thereof.

3. The method of claim 1, wherein the ASM inhibitor is at least one selected from the group consisting of clomipramine, desipramine, and combinations thereof.

4. The method of claim 1, wherein the ASM inhibitor is an antibody that specifically binds to ASM.

5. The method of claim 1, wherein the ASM inhibitor is an siRNA targeting ASM RNA.

6. The method of claim 1, wherein the ASM inhibitor is a mangostin compound.

7. The method of claim 6, wherein the mangostin compound is at least one of the group consisting of alpha-mangostin, beta-mangostin, gamma- mangostin, methoxy-beta-mangostin, dimethylmangostin and combinations thereof.

8. The method of claim 1 , wherein the ASM inhibitor is a sphingomyelin substrate analogue.

9. The method of claim 8, wherein the sphingomyelin substrate analogue is a least one of the group consisting of a nitrogen analogue, a thiourea derivative, and combinations thereof.

10. The method of claim 1, wherein the reduction of ASM activity interferes with IGF-IR signaling to mTORCl .

1 1. The method of claim 1 , wherein the reduction of ASM activity interferes with IGF-IR signaling to Racl .

12. The method of claim 1, wherein the interference with IGF-IR signaling diminishes ROS production.

13. The method of claim 1, wherein the interference with IGF-IR signaling diminishes proliferation of the cell or a population of cells.

14. The method of claim 1, wherein the interference with IGF-IR signaling induces apoptosis of the cell.

15. The method of claim 1, wherein the cell is a cancer cell.

16. The method of claim 1, wherein the cell is a human cell.

17. A method of interfering with IGF-IR signaling comprising contacting a cell with an antibody that specifically binds to ceramide, wherein the contact of the cell with the antibody that specifically binds to ceramide interferes with IGF-IR signaling.

18. The method of claim 17, wherein the contact of the cell with the antibody that specifically binds to ceramide interferes with IGF-IR signaling to mTORCl.

19. The method of claim 17, wherein the contact of the cell with the antibody that specifically binds to ceramide interferes with IGF-IR signaling to Racl.

20. The method of claim 17, wherein the contact of the cell with the antibody that specifically binds to ceramide diminishes ROS production.

21. The method of claim 17, wherein the interference with IGF-IR signaling diminishes proliferation of the cell or a population of cells.

22. The method of claim 17, wherein the interference with IGF-IR signaling induces apoptosis of the cell.

23. The method of claim 17, wherein the cell is a cancer cell.

24. The method of claim 17, wherein the cell is a human cell.

25. A method of interfering with IGF-IR signaling comprising contacting a cell with a short-chain ceramide derivative, wherein the contact of the cell with the short-chain ceramide derivative interferes with IGF-IR signaling.

26. The method of claim 25, wherein the short-chain ceramide derivative is C6-ceramide.

27. The method of claim 25, wherein the contact of the cell with the short-chain ceramide derivative interferes with IGF-IR signaling to mTORC 1.

28. The method of claim 25, wherein the contact of the cell with the short-chain ceramide derivative interferes with IGF-IR signaling to Racl.

29. The method of claim 25, wherein the contact of the cell with the short-chain ceramide derivative diminishes ROS production.

30. The method of claim 25, wherein the interference with IGF-IR signaling diminishes proliferation of the cell or a population of cells.

31. The method of claim 25, wherein the interference with IGF-IR signaling induces apoptosis of the cell.

32. The method of claim 25, wherein the cell is a cancer cell.

33. The method of claim 25, wherein the cell is a human cell.

34. A method of interfering with IGF-IR signaling comprising contacting a cell with methyl-β-cyclodextrin, wherein the contact of the cell with methyl-β-cyclodextrin interferes with IGF-IR signaling.

35. The method of claim 34, wherein the contact of the cell with methyl-β-cyclodextrin interferes with IGF-IR signaling to mTORCl .

36. The method of claim 34, wherein the contact of the cell with methyl-β-cyclodextrin interferes with IGF-IR signaling to Rac 1.

37. The method of claim 34, wherein the contact of the cell with methyl-β-cyclodextrin diminishes ROS production.

38. The method of claim 34, wherein the interference with IGF-IR signaling diminishes proliferation of the cell or a population of cells.

39. The method of claim 34, wherein ,the interference with IGF-IR signaling induces apoptosis of the cell.

40. The method of claim 34, wherein the cell is a cancer cell.

41. The method of claim 34, wherein the cell is a human cell.

42. A method of interfering with IGF-IR signaling comprising contacting a cell with a statin, wherein the contact of the cell with the statin interferes with IGF-IR signaling.

43. The method of claim 42, wherein the contact of the cell with the statin interferes with IGF-IR signaling to mTORCl .

44. The method of claim 42, wherein the contact of the cell with the statin interferes with IGF-IR signaling to Racl.

45. The method of claim 42, wherein the contact of the cell with the statin diminishes ROS production.

46. The method of claim 42, wherein the interference with IGF-IR signaling diminishes proliferation of the cell or a population of cells.

47. The method of claim 42, wherein the interference with IGF-IR signaling induces apoptosis of the cell.

48. The method of claim 42, wherein the cell is a cancer cell.

49. The method of claim 42, wherein the cell is a human cell.

50. A method of interfering with Racl signaling comprising contacting a cell with an ASM inhibitor, wherein the contact of the cell with the ASM inhibitor reduces ASM activity, and wherein the reduction of ASM activity interferes with Racl signaling.

51. The method of claim 50, wherein the ASM inhibitor is at least one selected from the group consisting of amitriptyline, butriptyline, amoxapine, clomipramine, desipramine, dosulepin hydrochloride, dothiepin hydrochloride, doxepin, imipramine, dibenzepin, iprindole, lofepramine, nortriptyline, opipramol, protriptyline, trimipramine, and combinations thereof.

52. The method of claim 50, wherein the ASM inhibitor is at least one selected from the group consisting of clomipramine, desipramine, and combinations thereof.

53. The method of claim 50, wherein the ASM inhibitor is an antibody that specifically binds to ASM.

54. The method of claim 50, wherein the ASM inhibitor is an siRNA targeting ASM RNA.

55. The method of claim 50, wherein the ASM inhibitor is a mangostin compound.

56. The method of claim 55, wherein the mangostin compound is at least one of the group consisting of alpha-mangostin, beta-mangostin, gamma- mangostin, methoxy-beta-mangostin, dimethylmangostin and combinations thereof.

57. The method of claim 50, wherein the ASM inhibitor is a sphingomyelin substrate analogue.

58. The method of claim 57, wherein the sphingomyelin substrate analogue is a least one of the group consisting of a nitrogen analogue, a thiourea derivative, and combinations thereof.

59. The method of claim 50, wherein the interference with Racl signaling diminishes ROS production.

60. The method of claim 50, wherein the interference with Racl signaling diminishes proliferation of the cell or a population of cells.

61. The method of claim 50, wherein the interference with Rac 1 signaling induces apoptosis of the cell.

62. The method of claim 50, wherein the cell is a cancer cell.

63. The method of claim 50, wherein the cell is a human cell.

64. A method of interfering with Racl signaling comprising contacting a cell with an antibody that specifically binds to ceramide, wherein the contact of the cell with the antibody that specifically binds to ceramide interferes with Racl signaling.

65. The method of claim 64, wherein the contact of the cell with the antibody that specifically binds to ceramide diminishes ROS production.

66. The method of claim 64, wherein the interference with Racl signaling diminishes proliferation of the cell or a population of cells.

67. The method of claim 64, wherein the interference with Racl signaling induces apoptosis of the cell.

68. The method of claim 64, wherein the cell is a cancer cell.

69. The method of claim 64, wherein the cell is a human cell.

70. A method of interfering with Racl signaling comprising contacting a cell with a short-chain ceramide derivative, wherein the contact of the cell with the short-chain ceramide derivative interferes with Racl signaling.

71. The method of claim 70, wherein the short-chain ceramide derivative is C6-ceramide.

72. The method of claim 70, wherein the contact of the cell with the short-chain ceramide derivative diminishes ROS production.

73. The method of claim 70, wherein the interference with Racl signaling diminishes proliferation of the cell or a population of cells.

74. The method of claim 70, wherein the interference with Racl signaling induces apoptosis of the cell.

75. The method of claim 70, wherein the cell is a cancer cell.

76. The method of claim 70, wherein the cell is a human cell.

77. A method of interfering with Racl signaling comprising contacting a cell with methyl-β-cyclodextrin, wherein the contact of the cell with methyl-β-cyclodextrin interferes with Rac 1 signaling.

78. The method of claim 77, wherein the contact of the cell with methyl-β-cyclodextrin diminishes ROS production.

79. The method of claim 77, wherein the interference with Racl signaling diminishes proliferation of the cell or a population of cells.

80. The method of claim 77, wherein the interference with Racl signaling induces apoptosis of the cell.

81. The method of claim 77, wherein the cell is a cancer cell.

82. The method of claim 77, wherein the cell is a human cell.

83. A method of interfering with Racl signaling comprising contacting a cell with a statin, wherein the contact of the cell with the statin interferes with Racl signaling.

84. The method of claim 83, wherein the contact of the cell with the statin diminishes ROS production.

85. The method of claim 83, wherein the interference with Racl signaling diminishes proliferation of the cell or a population of cells.

86. The method of claim 83, wherein the interference with Racl signaling induces apoptosis of the cell.

87. The method of claim 83, wherein the cell is a cancer cell.

88. The method of claim 83, wherein the cell is a human cell.