WO2006058496A1 - Mimic antigen epitope of her-2 and composition which comprise such epitope - Google Patents

Abstract

A mimic antigen epitope (formula I) was isolated by screening a phage display library. Some derivatives of such antigenic epitope having immunogenic activity were identified through mutative modification research. Peptides comprising such epitope or derivatives and related compositions including other proteins can be used as vaccines for inducing the immune response to HER-2 and further prevent and treat malignancies. The prevent invention synthesized oligonucleotides which encode these peptides and constructed expression vectors comprising these oligonucleotides or fusion nucleotides with other gene and transferred to cells. The present invention also provided methods and pharmaceutical compositions of oligonucleotides, vectors, cells for treating malignancies.

Description

 HER-2 mimetic epitope and peptide containing the same

 The present invention relates to the induction and enhancement of active immunization against HER-2, in particular, the present invention relates to a HER-2 mimetic epitope mimetic peptide isolated by phage display technology and modified, but still immunogenic A derivative of an epitope peptide. The present invention also relates to a vaccine containing such an epitope peptide or a derivative thereof. The vaccine is used for the prevention and treatment of tumors by inducing a humoral and cellular immune response against HER-2. The present invention also relates to nucleotides, nucleotides and other molecules of recombinant fusion proteins encoding the peptides, vectors and cells containing the same, and methods and pharmaceutical compositions for treating tumors using the peptides, nucleic acids, or cells . Background technique

 The HER-2 receptor is a member of the Epidermal growth factor receptor (EGFR) family. Structurally, it includes the extracellular domain of glycosylation, the hydration transmembrane domain, and the intracellular tyrosine kinase domain [1]. No ligands for HER-2 have been found yet. HER-2 plays an important regulatory role in the signaling pathway initiated by the EGFR family. HER-2 acts by forming a heterodimer with EGFR, ErbB-3, ErbB-4 [2]. Heterodimers can form high-affinity binding with EGF-like ligands while activating multiple downstream signaling pathways [3]. The proto-oncogene HER-2/c-erbB2/neu has gene amplification and overexpression in a variety of malignant tumors, especially in breast cancer, ovarian cancer, gastric adenocarcinoma, and colon cancer. HER2 overexpression is associated with poor prognosis, recurrence, and low survival in cancer patients [4]. .

 For the past decade, HER-2 has been recognized as one of the ideal targets for tumor immunotherapy. This is not only because overexpression of HER-2 is seen in many human tumors, but its overexpression is associated with poor prognosis in malignant tumors such as breast cancer. In addition, HER-2 expression is low in normal adult tissues, and HER-2 is stably expressed in both primary and metastatic tumors [5,6]. Therefore, anti-HER-2 immunotherapy can produce a specific therapeutic effect against tumors.

In passive immunotherapy, a variety of monoclonal antibodies against the extracellular domain of HER-2 have been obtained. Antibodies, some antibodies inhibit tumor growth. One of the antibodies, Herceptin (Trastuzumab), has been clinically evaluated and approved by the US FDA for clinical treatment in September 1998 [8]. Herceptin is the first biological preparation for the treatment of breast cancer, which can be used alone or in combination with chemotherapeutic drugs [7,8]. Because of the high price of Herceptin, the amount of drug used is large and needs to be used repeatedly, making the general patient economically unbearable.

 In addition to the passive immunotherapy described above, it is also an effective immunotherapeutic method for the patient to generate an active immune response against HER-2. HER-2 has many advantages as a potential tumor vaccine. First, some cancer patients with positive HER-2 expression have an immune response against HER-2, suggesting that the body can overcome immune tolerance against its own protein. Second, because HER-2 is overexpressed in tumor cells and low in normal tissues, the patient's immune response against HER-2 is tumor-specific, with little or no toxicity to normal tissues. Finally, HER-2 acts as an important growth factor receptor, and humoral immune responses to HER-2 produced in patients can induce tumor cell death through a variety of mechanisms.

 Pupa et al. first reported in 1993 that HER-2 overexpressing breast cancer patients had serum antibody and T cell responses against HER-2 [10,11]. In addition, other reports have demonstrated endogenous humoral and cellular immune responses to HER-2 in breast cancer patients. ' .

 Disis et al. found that among 127 breast cancer patients, 14 (11%) had serum anti-HER-2 antibody titers greater than 1:100, and none of the 100 normal women detected anti-HER-2 antibodies. In particular, five patients with early breast cancer had a strong humoral immune response with a serum antibody titer greater than 1:5000 [12]. The presence of high titers of anti-HER-2 antibodies in serum is associated with early primary cancer HER-2 overexpression [12,13]. However, this correlation was not found in patients with advanced breast cancer, and HER-2 extracellular domain protein (ECD) was detected in the serum of patients [14], but the antibody detection rate in vivo was significantly lower than that in early cancer patients [12]. . Anti-HER-2 antibodies are also detected in the serum of patients with colon cancer [13]. In addition, antibody responses to all EGFR receptors can be detected in patients with different types of epithelial malignancies [74].

A helper T cell immune response against HER-2 was detected with anti-HER-2 antibodies [10]. The anti-HER-2 antibody in serum is mainly IgG or IgA [12, 13, 65], The transitional response of antibodies from IgM to IgG or IgA requires the help of T cells, a process that requires HER-2 to contain helper T cell epitopes. Potential helper T cell epitopes are typically selected by computer algorithms. The activity of small peptides was assessed by synthesizing peptides corresponding to these epitopes and detecting their ability to induce cytokine production or to stimulate proliferation of peripheral blood lymphocytes [10, 16, 18]. A study by Kobayashi et al. found a series of helper T cell epitopes with HLA-DR binding properties. One of the peptides induces a HER-2 specific HLA-DR restricted helper T cell response in vitro. In addition, small peptide-activated helper T cells recognize the naturally-presented HER-2 protein on the surface of antigen-presenting cells [17].

 HER-2 reactive cytotoxic T lymphocytes (CTL) can also be detected in HER-2 overexpressing tumor patients [19, 20, 21]. These CTL cells can be isolated and cultured in vitro, and CTL cells are amplified by stimulation with their own intrinsic tumor cells [19, 22, 23]. Since the induction of HER-2 specific CTL cells requires the presentation of small peptides and exposure on the cell surface, some HLA type-restricted HER-2 CTL small peptide epitopes have been found. These peptides have homologous sequences that bind to a particular HLA species. These potential CTL epitopes stimulate dendritic cells and further produce CTL cells that cleave HER-2 transfected immortalized cells or their own intrinsic tumor cells [23,24,25,26]. Table 1 details the HER-2 CTL epitopes and helper T cell epitopes that have been identified.

 HER-2 specific CTL cells cleave their own intrinsic tumor cells, suggesting that a variety of HER-2 derived epitopes can be exposed to the cell surface by natural presentation. In fact, by washing tumor cells with an acidic eluate, HER-2 antigen peptides exposed on HLA class I molecules on the surface of tumor cells can be obtained [20, 27]. Some tumors, such as breast cancer [20], ovarian cancer [20,24], non-small cell lung cancer [27], pancreatic cancer [75], renal cell carcinoma [23,26], and colon cancer [23], are detectable. Expression to the HER-2 CTL epitope. In addition, some completely different types of epithelial tumors share the same HER-2 CTL epitope [20,23].

 In summary, these studies suggest that HER-2 can be presented not only on the surface of tumor cells, but also in humoral and cellular immune responses in tumor patients.

While discovering the immune response in the patient, an important question has been raised: Does the immune response have an anti-tumor effect? Some studies suggest that the immune response in a patient is beneficial.

In a study of more than 1000 patients with breast cancer, HER-2 overexpression suggests a better prognosis in stage I patients with primary lymphoplasmacytic infiltration (LPI) [28]. Recent studies have found that patients with lymph nodes not affected by tumors, if there is no LPI response, HER-2 overexpression suggests a poor prognosis; patients with LPI have a better prognosis [29]. T cells can be detected in primary breast cancer tumors, but HER-2 overexpression is not detected, because in HLA-A2-positive breast cancer patients, the host's immune response can remove HER-2 overexpressing tumors. The cells, therefore, have a negative response to HER-2 detection [30, 31]. These findings suggest that in the early stages of tumorigenesis, immune response can delay the progression of tumors.

Table 1 HER-2. Helper T cell epitopes and cytotoxic T cell epitopes Helper T cells Fine-packaged T cells HLA typing Tumors showing CTL epitopes

 42-56 N/A

 48-56 HLA-A2.1 N/A

 63-72 HLA-A24 Ovarian Cancer

 369-377 HLA-A2.1 Ovarian Cancer

 A series of tumors (gastric cancer, renal cell carcinoma, colon cancer, ovarian cancer, melanoma)

 396-406

 435-443 HLA-A2.1 Ovarian cancer, melanoma, renal cell carcinoma

474-487

 654-662 HLA-A2.1 Breast, Ovarian, Pancreatic, Renal Cell, Colon Cancer 665-673 HLA-A2.1 Ovarian Cancer

 689-697 HLA-A2.1 Gastric cancer, ovarian cancer, melanoma, renal cell carcinoma

 754-762 HLA-A3

 767-775 HLA-A2.1 N/A

773-781 HLA-A2.1 a series of tumors

777-789 HLA-DR4 ―

 780-788 HLA-A2402 N/A

 783-797 N/A ―

 785-793 HLA-A2.1 N/A

 HLA-DRl,

 883- 892 HLA-D 4 ―

 HLA-DR52, HLA-D 53

884- 899

 952-960 HLA-A2.1 Ovarian Cancer

 971-980 Ovarian cancer numbers represent the location of the amino acid of the HER-2 protein;

The N/A representative did not evaluate.

However, the current findings only reflect the immune response of a small number of patients. Whether the intrinsic T cell and specific antibody response is truly beneficial requires extensive epidemiological studies and long-term follow-up to verify.

 The presence of an anti-HER-2 immune response in the patient suggests that the vaccine can induce and enhance the immune response against HER-2. In recent years, many animal models have demonstrated that vaccines can elicit an immune response against HER-2. The anti-HER-2 vaccine applied to animals has been shown to be immunogenic and safe and effective.

 The primary goal of a tumor vaccine is to elicit a specific immune response against a tumor antigen that prevents tumorigenesis and establishes long-term immune memory. The application form of the immunogen should be considered when designing vaccines and immunological methods. Since HER-2 is a self-protein, tolerance and autoimmune toxicity should also be considered for anti-HER-2 vaccines. Transgenic mice can be used to assess the immune tolerance of the vaccine against HER-2. Two neu transgenic mice have been established, one is the introduction of the wild type mouse neu cDNA [32] regulated by the murine mammary tumour virus (MMTV) 3 and the long terminal repeat promoter in the genome. Due to the overexpression of murine neu, female mice develop spontaneous orthotopic breast cancer. These tumors are histologically similar to human breast cancer, so transgenic mice provide a good model for assessing whether vaccines can overcome immune tolerance. In another transgenic mouse genome, an activated form of neu [32,33] with a point mutation was introduced, and spontaneous breast cancer occurred in mice due to activation of the neu proto-oncogene. For both transgenic mice, the effect of the vaccine can be assessed by examining whether the animal is spontaneously tumor.

 Bernards et al. first reported that mice were injected with a neuroblastoma cell line expressing a mutant rat neu protein, and no tumor occurred in the mouse. This study used a vaccinia virus recombinant expressing the extracellular domain of rat neu as a vaccine. However, the same method was applied to rats, and after the injection of the rat tumor cell line, the tumor still occurred in the rat, indicating that the rat developed tolerance to its own neu protein [34]. Similarly, Disis et al. reported that the use of intact neu protein did not elicit an anti-neu immune response in mice [15].

In order to overcome the immune tolerance, a rat was immunized with a recombinant human HER-2 extracellular region highly homologous to rat neu, and it was concluded that this immunization method would cause a cross-immunoreaction against rat neu, thereby injecting the animal. Tumors no longer occur after tumor cells. Result rat A cross-immunoreaction to HER-2 and rat neu was generated. However, the induced cross-immunization response is very weak, and tumors can still occur in rats after subcutaneous injection of neu-transfected rat tumor cells [35].

 Recently, the use of transgenic animals has yielded some promising results. Esserman et al. reported that the use of neu extracellular domain proteins for immunization induced animals to develop an immune response against their own proteins [36]. This study used a N202 transgenic mouse line that overexpresses the wild-type rat neu gene. Immunization of transgenic mice with neu extracellular regions produces anti-neu fluid and cellular immune responses, and 50% of immunized transgenic mice do not develop tumors [36]. Reilly et al. also reported that a similar transgenic mouse model was used, and although the mice were significantly tolerant to the transgene, the neu-specific immune response produced by the mice prior to immunization was similar to that observed in breast cancer patients. More importantly, the application of radiation-irradiated intact cells and recombinant vaccinia virus as a neu-specific vaccine can enhance the specific humoral and cellular immunity of transgenic mice against neu. After injection of neu-expressing tumor cells, transgenic mice no longer develop tumors. Spontaneous tumor formation is delayed [37]. In another study, a transgenic mouse model with activated rat neu gene was used with a heterologous cell vaccine. Although transgenic mice produced a neu-specific anti-tumor response and did not produce spontaneous tumors or formed xenografts, the application of a vaccine pair was formed. Spontaneous tumors have no effect [38].

 In conclusion, although the body is resistant to HER-2, it is also feasible to induce and enhance the HER-2 specific immune response by immunization. Whether immune tolerance can be overcome is not clear, but immune tolerance in specific transgenic mice is not completely present. In addition, the main difficulty in applying HER-2 or cellular vaccines is the production and preservation of vaccines, and the potential for vaccine contamination is high, which will hinder the clinical application of such vaccines.

 The use of synthetic peptides offers new prospects for vaccine strategies. Synthetic peptides have several advantages as vaccines: The peptides are very simple, the synthesis process is economical and can induce specific immune responses. Furthermore, studies suggest that synthetic peptides can prevent the occurrence of tolerance [15]. Currently, a variety of peptide vaccines are in the evaluation stage.

The manner in which peptide antigens are transported in vivo has a major impact on their immunogenicity. The currently applied methods are: peptide vaccine combined with immunological adjuvant [39], constructing a polysaccharide-peptide complex or directly attaching the peptide to the surface of spleen cells or dendritic cells [40]. Gu et al. constructed hydrophobic polysaccharides/ The proto-oncoprotein complex vaccine makes it easier for the body to transport a 147 amino acid long HER-2 protein fragment that includes one or more T cell epitopes directed against the MHC class I pathway [72].

 Peptide epitopes that have been identified to be recognized by helper T cells or CTL cells are the primary basis for designing anti-HER-2 vaccines. Disis et al. found that although the entire rat neu protein is not immunogenic, immunization of rats with various helper T cell epitope peptides derived from rat neu protein can induce strong humoral and helper T cell responses. [15]. Recently, the study found that a variety of human HER-2 protein-assisted T cell epitope peptides are used, and patients with breast cancer and ovarian cancer can produce a helper T cell response specific for peptides and HER-2 [76].

 Multiple tumors may have the same CTL epitope, so peptide vaccines based on CTL epitopes can be applied to a wider population. Nagata et al. found that the CTL epitope peptide vaccine can successfully induce CTL responses, thereby inhibiting tumor formation in mice, but does not cause any autoimmune toxicity [40]. Further studies suggest that the same peptide, such as p63 or p780, can sensitize peripheral blood lymphocytes (PBMC) in tumor patients or normal subjects in vitro [41,73]. Induced HER-2 specific HLA-A24-restricted CTL responses cleave HER-2 overexpressing tumor cells. Peptide p63 has been used in clinical trials [73].

 Dakappagari et al. found that the application of B cell epitopes can also cause tumor suppressive immune responses. The use of peptides located closest to the transmembrane region in the extracellular region of HER-2 is sufficient to induce tumor suppressor antibody responses [9,77]. The Herceptin epitope is also located in the juxtamembrane region [23], suggesting that this region can effectively enhance the protective immune response.

 DNA vaccines include direct inoculation of expression plasmids. The injected DNA—but absorbed by the cell, can cross the nuclear membrane and persist as a non-replicating free gene molecule, resulting in longer-term expression of the foreign protein. Therefore, DNA vaccines have potential advantages for inducing long-term immune responses against expressed antigens [78].

Some research groups have successfully induced anti-HER-2 immune responses using this method [42, 43, 44]. Concetti et al. first reported that injection of rat neu full-length DNA into mice produces anti-mouse neu autoantibodies [45]. The use of neu DNA vaccine in neu transgenic tumor-bearing mice prevents breast tumor growth and reduces metastatic capacity [42]. In another study, transgenic mice were challenged with a DNA vaccine encoding a rat neu transmembrane and extracellular domain plasmid. The neu antibody response, although only partially inhibiting tumor cell formation, is clearly controlled [46].

 However, the effects of DNA vaccines are also limited [42]. Studies have found that DNA vaccines cannot break through CTL tolerance [77]. In addition, whether DNA vaccines have the potential for mutational integration, and whether the application of plasmid DNA has an impact on tumor development, is not systematically evaluated [47].

 In recent years, complex animal models have been used to perform in vivo immunological evaluation of the HER-2 vaccine. The results suggest that induction of an anti-HER-2 immune response is possible and effective. Although Disis et al., and others have found that immunization with intact HER-2 protein or extracellular regions can lead to the development of immune tolerance [15,34], studies using transgenic mouse models that are very similar to clinical conditions It has been found that the use of larger HER-2 molecules overcomes immune tolerance [36, 37, 38]. In fact, tumor patients with endogenous anti-HER-2 immunity have overcome or partially overcome tolerance to HER-2 [10,62]. Effective anti-HER-2 immunity includes activation of an endogenous natural immune response against a range of self-epitope. Further studies by Cefai et al. suggest that anti-HER-2 vaccines can induce specific immune responses against spontaneous HER-2 expressing tumors.

 Obviously, if an anti-HER-2 immune response has already occurred, the potential autoimmune toxicity should be assessed. The low expression of HER-2 in normal tissues allows the immune response to target only tumors and tumor cells without autoimmune toxicity. To date, all studies have suggested that the body's neu-specific immunity does not cause an autoimmune response in animals [15, 40, 42, 45]. However, because HER-2 is widely expressed in fetal tissues, it is necessary to assess whether the fetus is toxic [48].

Animal experiments have shown that the vaccine is sufficient to cause the animal to have the ability to inhibit the formation of xenografts or spontaneous tumors [37, 38] and to delay the progression of proliferative lesions [42, 46]. For tumors that have already formed in the body, the vaccine cannot play the above role [46]. This suggests that already formed tumors have special properties that evade immune surveillance. The immune escape mechanism can be regulated by the microenvironment of the tumor [49, 50]. Furthermore, down-regulation of HLA class I molecules in many breast cancers [51] and other tumors [52, 53] may limit the role of CTL-dependent vaccines [37, 54, 55]. Experiments have shown that treatment of tumor cell HER2/neu can effectively reverse the malignant phenotype of tumor caused by HER-2/neu overexpression. The HER-2 humanized antibody Herceptin has been approved by the US FDA for the treatment of metastatic breast cancer with HER-2 overexpression and has achieved good clinical results. Herceptin is currently in clinical trials in the country, but its price is quite expensive, and most patients are economically unbearable.

 Although the application of tumor suppressor antibodies by passive immunization has a good clinical effect, there are also some problems, such as: production of anti-idiotypic antibodies, inadequate tissue allocation, large doses, high prices, etc. Passive immunotherapy.

 In contrast, the use of vaccines induces the body to produce endogenous tumor suppressor antibodies and stimulates immune memory, which may make it easier for patients to have long-term effective effects and is more economical. Summary of the invention

 The inventors obtained a small peptide capable of specifically binding to Herceptin by screening the phage 12 peptide library using the Herceptin antibody already on the market.

 Phage display technology is a technology developed in recent years. It has a wide range of applications in the fields of epitope analysis, protein molecule binding characteristics and discovery of lead compounds. The use of phage display technology to obtain active peptides has also been used in recent years. Common methods of drug development [7]. Phage peptide library technology is an ideal tool for studying macromolecular interactions. Phage peptide library technology can be used to screen peptides or proteins that bind to receptors, enzymes, DNA-binding proteins, cytokines, antibodies, etc., for the study of natural protein binding, in the absence of a structural/functional relationship. Characteristics, identification of enzyme substrates with high affinity and specificity, localization of antibody binding epitopes, and the like. The 55 amino acid peptide EP531 isolated from the HER-2 gene fragment phage library using the anti-HER-2 antibody N21 can induce an active immune response against HER-2 in mice, and the produced antibody can effectively inhibit tumor cell proliferation. [60].

In this study, a small peptide capable of specifically binding to Herceptin was obtained by screening the phage 12 peptide library using the commercially available Herceptin antibody. Due to the conventional target protein coating process, proteins are adsorbed on the plastic surface by hydrophobic interaction, and this adsorption can lead to the protein part. Fractionation [71, 58, 59]; and solid phase adsorption may screen a series of short peptides rich in tyrosine and tryptophan, which bind to plastic and are not blocked by BSA [79]. Therefore, in the screening process, the inventors applied Protein A-Sepharose 4B beads to adsorb the antibody and then carried out the liquid phase Bio-panning process, comparing the previous solid phase adsorption process, which greatly enhanced the chance of phage display small peptides and antibodies. Therefore, positive clones can be effectively screened. At the same time, in order to reduce the non-specific adsorption in the Bio-panning process and increase the screening positive rate, the inventors pre-adsorbed the original phage peptide library with normal human serum IgG to achieve the purpose of removing some non-specific binding phage. In addition, in order to prevent the conventional elution step from eluting the phage which binds to the binding protein of the target protein, the inventors omitted the elution step, and added the mixture of Protein A-Sepharose 4B, Herceptin and phage to Escherichia coli. Amplification was performed. Through the improvement of the Bio-panning technology route, the screening positive rate was 2-8% [60] of the general solid phase adsorption, reaching 13.7%.

 By screening Herceptin, the inventors obtained only two small peptide sequences, one of which was not expressed by Herceptin after prokaryotic expression. The single positive sequence obtained may be related to library propensity. The reasons for the current library propensity have not yet been fully elucidated, but there is indeed an increase or decrease in the ability of certain recombinant phage infections in the same library. For example, Burritt et al. found that protein display was less than expected [61], and the study by Blond-Elguindi showed that clones containing Gly in the library were easy to select, while clones containing Cys were not easily selected [62].

 The inventors obtained a small peptide H 98 which specifically binds to Herceptin by screening the phage 12 peptide library, and the peptide has the following sequence:

 LLGPYEL WELSH

 The small peptide H98 screened by the inventors contained a Gly without the involvement of Cys. Kay et al. found that clones containing singly cysteine in exogenous short peptides are difficult to amplify. The reason is that this cysteine may form a disulfide bond with any of the eight natural cysteines of pill, thereby affecting the phage infectivity [63].

Currently, phage display peptide library technology is widely used in the study of identifying antibody binding epitopes. The binding epitope of an antibody, ie, an antigenic determinant, can be broadly classified into two types: a continuous epitope and a discontinuous epitope. A continuous epitope is also known as a linear epitope or a sequence epitope. This type Epitopes generally consist of a number of amino acids that are consecutively arranged on a primary structure. Antibodies against such epitopes can recognize a continuous epitope of a denatured protein or a native antigen. A non-continuous epitope, also known as a conformational epitope, can be composed of amino acid residues that are distant from each other in the primary structure but close together after a series of folds. Such epitopes are generally composed of multiple amino acid molecules. Space structure of cracks or grooves, grooves, etc. From the phage display library, it is generally impossible to screen a non-continuous epitope that is identical or homologous to the native epitope, and only a so-called "mimotope" that can mimic the binding characteristics of the original natural epitope [64] can be screened. The inventors screened and obtained the positive phage clone H98 for sequencing and Blast comparison. The results showed that the H98 small peptide has no obvious sequence homology with HER-2, so the small peptide mimics the natural conformation of HER-2 "mimotope", ie Tertiary structure, not a certain amino acid sequence of HER-2. The inventors reported on the three-dimensional structure 1N8Z of Herceptin interacting with HER-2 obtained in the literature and the PDB database, and constructed the three-dimensional structure of the interaction between H98 small peptide and Herceptina using the Homology module in the Insightll software package. From the interaction between the simulated H98 and the active site of Herceptin, it can be seen that H98 has electrostatic interaction with important residues in the active site of Herceptin, hydrogen bonding, (- (conjugated interaction. According to the literature, Herceptin The targeted HER-2 epitope is composed of three circular structures dispersed in different regions, which are folded in space rather than a continuous peptide on the peptide chain. Small peptide H98 can mimic two of them. The important amino acid of HER-2 is _56. D and HER-2 ₅₇₃ F, HER-2 ₅₇₂ P. If Η98^ is mutated to Q, that is, in the third cyclic structure, Herceptin forms a hydrogen bond interaction with HER. -2 ₆ . ₂ Q, H98iQ can form a hydrogen bond interaction with Herceptin A30N. This mutation may enhance the affinity of H98 small peptide to Herceptin. Further, the inventors mutated the small peptide by genetic techniques. Get a series of scorpions. The structure of each scorpion is as follows: H98 LLGPYEL WELSH

 N10 LLGPYELWEL

N8 LLGPYELW

 N6 LLGPYE

 CIO GPYEL WELSH

 C8 YEL WELSH

 C6 LWELSH

 M8 GPYEL EL

 M6 PYELWE

 MutN3-4 LLVAYEL WELSH

 MutC 1-2 LLGPYEL WELGA

 MutNl -2 GAGPYEL WELSH

 MutNl ^LGPYEL WELSH

 CyclicH98 CLLGPYELWELSHC The inventors fused the mutated peptide to GST, and the ELISA results indicated that the mutants CIO, MutNl-2, MutNl and CyclicH98 have affinity with Herceptin. Among them, MutNl mutated Η98^ to Q, which enhanced the affinity of H98 small peptide to Herceptin.

 In addition, the inventors' segmental expression of the fusion form of H98 and GST fusion results suggest that the two amino acids at the carboxy terminus and the amino acids at the amino terminus of the amino terminus play an important role in the binding of the small peptide to Herceptin. A small peptide fragment of several amino acids does not bind to Herceptin. This and the small peptide H98 analyzed by software can form an electrostatic interaction with Herceptin, hydrogen bonding, (- (the conjugated amino acids are not completely identical.

One aspect of the present invention is a peptide which is a HER-2 mimetic epitope which comprises, in a forward or reverse direction, continuously or intermittently a plurality of peptides comprising only one amino acid sequence represented by the following formula (I): X9X1X2GPX3X4X5X6X7X8SHX10, ( I ) , where XI may or may not be a natural amino acid residue,

 X2 may or may not be present as a hydrophobic amino acid residue.

 X3 is a polar amino acid,

 X4 is a polar amino acid,

 X5 is a hydrophobic amino acid,

 X6 is a polar amino acid

 X7 is a polar amino acid and can be the same or different from X4.

 X8 is a hydrophobic amino acid which may be the same as or different from X5.

 Wherein X9 and X10 are natural amino acids, which may or may not be present, and the peptide of formula (I) may be linear or cyclized.

 Preferably ,

 Where XI may or may not exist as L, I, V, M, A, F, G, Q or N,

X2 may or may not exist, L, I, V, M, A or F, G

 X3 is Y, W, F, T or S

 X4 is E or D,

 X5 is L, I, V, M, A or F

 X6 is W, : Y^ F, ,

 X7 is E. or D, which can be the same or different from X4, ' ' , ' ^

X8 is L, I, V, M, A or F, which can be the same or different from X5.

 X9 and X10 may or may not be present, either € or 8.

 More preferably,

 Where ', XI may or may not exist, is L, G or Q,

 X2 may or may not exist, L or A,

 X3 is Y,

 X4 is E,

 X5 is L,

 X6 is W,

 X7 is E,

X8 is L, X9 and X10 may or may not be present.

 Among them, several amino acid sequences of the formula I verified in the examples are

 H98 LLGPYEL WELSH

 CIO GPYEL WELSH

 MutNl-2 GAGPYEL WELSH

 MutNl Q.LGPYEL WELSH or

 CyclicH98 £LLGPYELWELSH£. Usually, an amino acid sequence containing 1-10 amino acids is called an oligopeptide, and more than 10 amino acids, but an amino acid sequence having a molecular weight of less than 10,000 Daltons is called a polypeptide, and an amino acid sequence having a molecular weight of more than 10,000 Daltons. It is called a protein. Oligopeptides and shorter polypeptides are often referred to as small peptides. For convenience of description, oligopeptides, small peptides, polypeptides and proteins are collectively referred to herein as peptides.

 The natural amino acids of the present invention include polar amino acids: serine (Ser), threonine (Th), cysteine (Cys), tyrosine (Tyr), aspartic acid (Asp), asparagine ( Asn), glutamic acid (Glu), glutamine (Gin), lysine (Lys), arginine (Arg) and histidine (His); hydrophobic amino acids: glycine (Gly), alanine (Ala), valine (Val), leucine (Leu), isoleucine (lie), proline (Pro), phenylalanine (Phe), tryptophan (Try), and sulphur Amino acid (Met).

 Those skilled in the art will recognize that the conservatively substituted mutants of the above peptides have full biological activity for their specific binding to Herceptin. By conservative substitution, it is meant replacing an existing amino acid with an amino acid of similar physicochemical properties.

Preferably, each amino acid can be replaced with the most similar amino acid, as described in the following table:

 An important aspect of the present invention is a peptide comprising the above-described mimotope peptide of the present invention which specifically binds to Herceptin due to the presentation of a mimotope peptide, and induces humoral and cellular immunity against HER-2, It can be used for tumor treatment, wherein the mimotope of the present invention occurs multiple times or only once in the peptide in a continuous or reverse direction in a continuous or reverse direction.

The peptides of the invention can be synthesized by conventional solid phase synthesis methods known to those skilled in the art. For example, the peptides of the present invention can be synthesized by solid phase chemistry using an Applied Biosystem synthesizer or a PioneerTM peptide synthesizer as described by Steward and Young (65). It is also possible to synthesize multiple segments first and then join together to form larger segments. For solid phase peptide synthesis See (66) for an introduction to many techniques. Generally, these methods involve the sequential addition of one or more amino acids or appropriately protected amino acids to the growing peptide chain. Typically, the amino or carboxyl group of the first amino acid is protected with a suitable protecting group, and the protected amino acid is then attached to an inert solid support, followed by the addition of the corresponding amino or carboxyl group to the appropriately protected sequence under conditions suitable for the formation of an amide bond. The next amino acid in the. The protecting group is then removed from the newly added amino acid residue, followed by the next amino acid suitably protected if necessary, and the procedure is repeated. When all amino acids are joined in the correct order, any remaining protecting groups and solid support are removed sequentially or simultaneously to yield the final polypeptide. By simply modifying this general procedure, more than one amino acid can be added to the growth chain at one time.

The peptide of the present invention can also be obtained by expressing a polynucleotide containing the peptide or fusion protein coding sequence of the present invention in a suitable host and then purifying the expressed peptide product. The forward and reverse strands of the nucleotide sequence encoding the small peptide of the present invention can be synthesized on a DNA synthesizer by a solid phase phosphite amide triester method well known in the art. The synthetic complementary antisense and antisense strands are annealed in an appropriate buffer to obtain an oligonucleotide encoding a small peptide of the present invention. During this synthesis, cohesive end sequences for cloning can be introduced on both sides of the oligonucleotide. Then, the oligonucleotide may encode small peptides of the present invention and with the corresponding restriction endonuclease digestion of a nucleic acid containing a polypeptide or another suitable carrier protein coding sequence using T ₄ ligase to obtain a DNA sequence encoding the fusion protein. The coding sequences of the other polypeptide or protein are generally known, some may be purchased as a vector, or may be synthesized by conventional methods or cloned from known organisms. The nucleotide sequence of the gene of the present invention obtained as described above, or various DNA fragments can be determined by a conventional method such as the dideoxy chain termination method (67). 'This type of nucleotide sequence determination can also be used in commercial sequencing kits and the like. Of course, appropriate promoters, ribosome binding sites, terminators and the like should be included in the expression vector. To express the location of the product in the cell compartment, an appropriate leader sequence can be added upstream of the polypeptide coding sequence. Selection of suitable vectors and promoters is well known to those of ordinary skill in the art. An efficient expression vector suitable for use in bacteria can be constructed by: Inserting a structural DNA sequence encoding a protein of interest, along with appropriate translation initiation and termination signals, into a steerable reading frame with a functional promoter. Methods for constructing vectors containing the nucleotide sequences of the invention, as well as suitable transcriptional and translational regulatory elements, are well known to those of ordinary skill in the art. Know by those skilled in the art, according to The type and characteristics of the expression vector or construct into which the DNA sequence of the present invention is inserted select a suitable host to express the protein of interest. Hosts suitable for expressing a polypeptide of the invention include, but are not limited to, prokaryotic hosts, such as E. coli, Bacillus, Streptomyces, etc.; eukaryotic hosts, such as: Saccharomyces, Aspergillus, insect cells, such as fly S2 and Spodoptera frugiperda Sf; animal cells such as CHO, COS (monkey kidney fibroblast cell line), and other cell lines capable of expressing compatible vectors. Methods for introducing constructs into the above host cells are well known to those skilled in the art and include, but are not limited to, calcium chloride mediated transformation, calcium phosphate transfection, DEAE-dextran mediated transfection, electroporation, microscopy. Injection, particle bombardment or gene gun methods (68, 68, 69). The transformed host strain or cell is cultured in appropriate culture conditions and culture medium, and after growth to the appropriate cell density, the selected promoter is induced by an appropriate method (for example, temperature shift or chemical induction), and The cells are cultured for a while. The culture conditions and culture medium corresponding to the different host strains or cell selections and the properties of the expressed protein of interest are within the knowledge of those skilled in the art. The expressed polypeptide or fusion protein is isolated and purified from the culture by conventional methods such as centrifugation, precipitation, various chromatography, HPLC, and the like.

 The peptide of the present invention is likely to induce a stronger humoral and cellular immune response than Her HER-2, a Herceptin-specific binding small peptide having a similar epitope to HER-2 as a HER-2 antigen mimotope Inducing an immune response. The peptides of the present invention are useful for the treatment of solid tumors and carcinomas such as the following organs: breast, colon, rectum, lung, oropharynx, hypopharynx, esophagus, stomach, pancreas, liver, biliary, bile duct, small intestine , kidney, bladder, urinary tract epithelial cervix, uterus, ovary, choriocarcinoma and gestational dystrophy male genital tract, including prostate, sperm and testis, thyroid, adrenal and pituitary angiopoiesis, melanoma, Sarcoma and Kaposi's sarcoma from bone or soft tissue; tumors of the brain, nerves, eyes and meninges, including astrocytoma, glioma, glioblastoma, retinoblastoma, neuroma, neurogenic Cell tumors, schwannomas, and meningiomas; solid tumors from hematopoietic malignancies such as leukemia, including green tumors, plasmacytoma, and cutaneous T-cell tumors/leukemia; lymphomas, including Hodgkin's lymphoma And non-Hodgkin's lymphoma. The peptides of the invention are also useful for preventing the metastasis of such tumors.

The peptide of the present invention is used as a pharmaceutical composition, especially when used as a vaccine, and is commonly used in the art. The immune-enhancing cytokine or protein, other common tumor vaccines or commonly used vectors are mixed or form a recombinant protein. The cytokines are interleukin-2 (IL-2), interleukin-12 (IL-12), colony stimulating factor (GM-CSF), CCL2, CCL5, CCL7, CCU 9, CCL21, CCL20 CXCL9, CXCL10 CXCL12> CXCL15, XCL1, FTL3L, CD40L, etc., the proteins are heat shock proteins, etc. Among them, the commonly used vaccines mainly refer to oncogenes, mutant tumor suppressor genes, tumor-associated antigens, and the carrier is a keyhole. Hemoglobin, serum albumin, inactivated bacterial toxins, etc. Among them, oncogenes such as CEA, mutant tumor suppressor genes such as p53, tumor-associated antigens such as melanoma-related antigens, etc., wherein the serum albumin may be bovine serum albumin or human serum albumin, etc., the bacterial toxin is tetanus , diphtheria toxin or tuberculin.

 When the peptide of the present invention is used for immunization, it is mixed with a carrier which is conventionally used in the art. Vectors useful in the present invention are, for example but not limited to: keyhole limpet hemocyanin (KLH), serum albumin such as bovine serum albumin (BSA), inactivated bacterial toxins such as tetanus (TT) or diphtheria toxin (DT) Or tuberculin (PPD), a cytokine or other tumor antigen as a carrier protein, can play a multifunctional vaccine.

 When the peptide of the present invention is used for immunization, it is mixed with an adjuvant commonly used in the art, and the adjuvant includes, but is not limited to, Freund's complete adjuvant and Freund's incomplete adjuvant aluminum or calcium hydroxide or phosphate. .

 The immunogen of the present invention may comprise the aforementioned peptide, i.e., the immunogen of the present invention is a peptide comprising the mimotope of the present invention or a derivative thereof or a recombinant protein with other molecules.

 The present invention also encompasses gene therapy, i.e., by transferring a gene encoding a polypeptide or polypeptide fusion protein of the present invention into a patient to express the polypeptide or polypeptide fusion protein of the present invention in vivo, thereby producing a therapeutic effect. A variety of methods are known in the art for transferring or delivering DNA to cells for expression of a gene product protein, such as described in "Gene Transfer in Mammalian Somatic Cells" (70). Gene therapy involves the incorporation of DNA sequences into somatic cells or germ cells for ex vivo or in vivo treatment.

The present invention also encompasses gene therapy, that is, by transferring a nucleotide encoding a peptide of the present invention into a cell of a patient to express the polypeptide of the present invention in vivo, thereby producing a therapeutic effect. The nucleotide may exist independently or may be combined with an immunoenhanced cell commonly used in the art. The gene or protein, other tumor-usaged vaccines or genes of commonly used vectors are mixed or form a recombinant nucleic acid molecule. The cytokines are interleukin-2 (IL-2), interleukin-12 (IL-12), colony stimulating factor (GM-CSF), CCL2, CCL5, CCL7, CCL19, CCL21, CCL20, CXCL9, CXCL10, CXCL12, CXCL15, XCL1, FTL3L, CD40L, etc., wherein the protein is heat shock protein, etc., and the commonly used vaccines for tumors mainly refer to oncogenes, mutant tumor suppressor genes, tumor-associated antigens, wherein the carrier is a keyhole. Hemoglobin, serum albumin, inactivated bacterial toxins, etc. Among them, oncogenes such as CEA, mutant tumor suppressor genes such as p53, tumor-associated antigens such as melanoma-related antigens, etc., wherein the serum albumin may be bovine serum albumin or human serum albumin, etc., the bacterial toxin is tetanus , diphtheria toxin or tuberculin.

 A variety of methods are known in the art for transferring or delivering DNA to cells for expression of a gene product protein, such as described in "Gene Transfer in Mammalian Somatic Cells in vivo" (70). Gene therapy involves the incorporation of DNA sequences into somatic or germ cells for treatment in vitro or in vivo.

Gene therapy gene transfer methods fall into three broad categories: (1) physical (eg, electroporation, direct gene transfer, and particle bombardment), (2) chemical (eg, lipid-based vectors and other non-viral vectors) and ( 3) Biological (eg viral vectors). For example, a non-viral vector such as a liposome coated with DNA can be intravenously injected into a patient. Gene vector or "dew trees" DNA may be directly injected into the desired organ, tissue or tumor metastasis by targeting a therapeutic DNA ₀

 Methods for basic gene transfer include ex vivo gene transfer, in vivo gene transfer, and in vitro gene transfer. The DNA is introduced into the patient's cells while in the patient's body.

 Accordingly, the invention further relates to a plasmid or viral vector comprising a polynucleotide of the invention, and a cell comprising a polynucleotide or vector of the invention. ,

 Accordingly, the present invention relates to polynucleotides, vectors or cells of the polypeptides of the invention as gene therapy drugs.

Accordingly, the present invention relates to a pharmaceutical composition for treating cancer comprising a nucleotide, a nucleotide-encoded polypeptide of the present invention, and a fusion protein, vector or cell recombinant with other molecules, and if necessary, pharmaceutically acceptable Especially for excipients for gene therapy. Finally, the invention relates to a method of treating cancer comprising administering to a patient in need of such treatment a therapeutically effective amount of a polypeptide, polypeptide fusion protein, nucleotide, vector or cell as defined herein.

 The following examples are intended to illustrate the invention without any limitation on the scope of the invention. DRAWINGS

 Figure 1 Western blot analysis of Herceptin binding to GST fusion protein or GST. Figure 2. Inhibition of Herceptin binding to HER-2 by a protein or small peptide.

 Figure 3 HER-2 or small peptide H98 inhibits the binding of Herceptin to GST-H98.

 Figure 4. Effect of small peptides on Herceptin inhibition of cell proliferation.

 Figure 5 Humoral immune response in mice immunized with GST-H98 or GST.

 Figure 6 Immunoprecipitation - Western blot analysis of HER-2 antibodies in immune sera.

 N. Normal mouse serum 1 : 100 dilution; 1-5. Different mouse serum immunized with GST-H98

1 : 100 dilution; 6. GST-immunized mice were diluted 1 : 100 in serum. According to the map, No. 2

GST-H98-immunized murine serum can react with denatured HER-2 protein.

 Figure 7 T, cell proliferation assay.

 Figure 8 shows the structural analysis of Insight 11 (2000), where ' , ;

 A. Three-dimensional continuation of Herceptin binding to HER-2. B. The three-dimensional structure of Herceptin binding to small peptide 1198.

Figure 9. Identification of the recombinant plasmid pGEX-4Tl-X. M. marker; 1 is pEEX-4Tl-H98 double-digested with EcoRV/Hindlll; 2- 10, respectively pGEX-4Tl-N10, N8 ₅ N6, CIO, C8, C6, M8, M6, MutNl via EcoRV single enzyme Cut; 1,1 for pGEX-4Tl double digestion with EcoRV/Hindll. It can be seen from the figure that the recombinant pGEX-4Tl-X small peptide vector can be translated into a 1700 bp fragment after digestion, while the pGEX-4Tl original vector has no fragment release after digestion.

Figure 10 SDS-PAGE analysis of expression of fusion protein GST-X in E. coli BL21. M, marker; The singular lanes in the figure are the total protein of the cells which are not induced after transfection of the plasmid, and the even lanes are the total protein of the cells induced by IPTG. Two or two pairs in turn, 1 with 2 (GST), 3 and 4 (GST-H98), 5 and 6 (GST-N10), 7 and 8 (GST-N8), 9 and 10 (GST-N6), 11 and 12 (GST-C10), 13 and 14 (GST-C8), 15 and 16 (GST-C6), 1 and 18 (GST-M8), 19 and 20 (GST-M6), 21 and 22 (GST-MutNl). As can be seen from the figure, the target protein has a higher level of expression.

 Figure 11 SDS-PAGE analysis of the purified fusion protein GST-X, where M, marker;

1, GST; 2, GST-H98; 3, GST-NIO; 4, GST-N8; 5, GST-N6; 6, GST-C10;

7, GST-C8; 8, GST-C6; 9, GST-M8; 10, GST-M6; l l, GST-MutNl.

 Figure 12 ELISA detects the binding of Herceptin to GST-X. Wherein, 1, GST; 2, GST-H98; 3, GST-NIO; 4, GST-N8; 5, GST-N6; 6, GST-C10; 7, GST-C8;

8, GST-C6; 9, GST-M8; 10, GST-M6; 11, GST-MutN3-4; 12, GST-MutCl-2; 13, GST-MutNl-2; 14, GST-MutNl; GST-CyclicH98.

 Figure 13 Western blot analysis of Herceptin binding to GST-X. Of which 1, GST;

2, GST-H98; 3, GST-N10; 4, GST-N8; 5, GST-N6; 6, GST-C10; 7, GST-C8; 8, GST-C6; 9, GST-M8; GST-M6; 11, GST-MutN3-4; 12, GST-MutCl-2; ' 13, GST-MutNl-2; 14, GST-MutNl; 15, GST-CyclicH98.

 The following examples are merely illustrative of the invention and are not intended to limit the invention. detailed description

 First, the experimental materials

 (1) Expression vector, strain and molecular cloning reagent.

 The prokaryotic expression vector pGEX-4Tl and Escherichia coli strain BL21 of glutathione thiotransferase were all stored in the biochemical laboratory of Beijing Cancer Institute. The various restriction enzymes used for molecular cloning, T4 DNA ligase, are products of New England Biolabs.

 (2) Antibodies, laboratory animals and related materials

HRP-goat anti-human IgG antibody (1:2500) was purchased from Zhongshan Company. Horseradish peroxidase-labeled mouse anti-Ml 3 phage monoclonal antibody (1:5000) is a product of Amersham Biosciences. Experimental animals: Kunming rats were purchased from the Experimental Animal Center of the Chinese Academy of Medical Sciences and were raised by the Animal Department of Peking University School of Clinical Oncology.

(iii) Phage display random I ² peptide library and its reagents

 1. Phage display random 12 peptide library

The phage display 12 peptide random short peptide library kit is a product of New England Biolabs, including a 12-mer phage display library 100 μl (1.5χ10 ¹³ ρήι/ιη1), stored in 50% glycerol-TBS with a diversity of 2.7χ 10 ⁹ . The M13 phage host ER2738 was an F-positive E. coli purchased from New England Biolabs.

 -28 gill sequencing primer: 5, gtatgggatttgctaaacaac 3,

 -96 gill sequencing primer: 5, ccctcatagttagcggaacg 3,

 2. Phage manipulation reagent

 (1) (1) (1) LB liquid medium: 10 g of tryptone for bacteria, 5 g of yeast extract, 5 g of NaCl, and stored at room temperature after autoclaving.

 (2) (2) (2) Tetracycline: Prepare 20mg/ml stock solution with absolute ethanol, store it after storage, -20Ό.

(3) LB (Tet ⁺ ) solid culture plate: 15 g of agar was added per liter of the above LB medium, autoclaved, and the temperature was lowered to 70 (C or less, and 1 ml of tetracycline stock solution (20 mg/ml) was added.

Store at 4 ° C in the dark.

 (4) IPTG/Xgal: Add 1.25 g of IFTG and 1 g of Xgal to 25 ml of dimethylformamide, and store at -20 °C in the dark.

(5) LB (Tet ⁺ ) / IPTG / Xgal plate:

Add 30ul IPTG/Xgal to 300ul LB medium, mix it and add it to LB (Tet+) solid culture plate, stick it with glass rod, dry it and keep it at 4°C in the dark.

 (6) Agarose Top: 1000 ml

Bacterial trypsin 10 g, yeast extract 5 g, NaCl 5 g, MgCl ₂ (6H ₂ 0 1 g, agarose 7 g.

 (7) TBS solution: 50 mmol/L Tris-HCl pH 7.5, 150 mmol/L NaCl. After autoclaving, store at 4 (C.

(8) PEG/NaCl: 20% (w/v) PEG 8000, 2.5 mol/L NaCl. Preserved after autoclaving At room temperature.

 (9) Nal Buffer: 10 mmol/L Tris-HCl pH 8.0, 1 mmol/L EDTA, 4 mol/L NaI.

 (4) Reagents for purification of E. coli expression proteins

1. Bacterial lysate: 1 mmol/L PMSF, 1 mg/mL Lysozyme in PBS.

 2. Glutathione-Sepharose 4B affinity chromatography elution buffer:

 15 mmol/L GSH (reduced glutathione), 50 mmol/L Tris-HCl (pH 8.0), 120 mmol/L NaCl.

 II. Example:

Example 1

 (I) Herceptin screening of phage display 12 peptide library

 1. Preservation and resuscitation of ER2738 strain

The ER2738 broth was stored in 50% glycerol and stored in a -70 ° C refrigerator. The bacteria were inoculated on LB (Tet ⁺ ) agar plates during the resuscitation, and cultured in a 4 ° C refrigerator after incubating at 37 ° C for 10 h. The storage time should not exceed 3 weeks.

 2. Determination of titer and recombination rate of 12-mer phage display short peptide library

A single resuscitated ER2738 single colony was picked and inoculated into 2 ml LB (Tet ⁺ ) and amplified to log mid-term (OD ₆ . . . = 0.5-0.6). The original library Peptide libraries were made ^{810-9, 1010-11} diluted 10 ', 10 ". Each dilution was added to the bacteria 200μ1. Standing at room temperature 5min, added 3ml pre-warmed to 45 ° C in Agarose Top, mix quickly, pour on LB (Tet+) plate pre-warmed to 37 ° C and coated with 30 μl IPTG/X-gal. Shake the plate to evenly coat Agarose Top. After incubation at 37 ° C for about 10 h, count Blue plaques were calculated, and the original library titer and exogenous fragment recombination rate were calculated. The titration results showed that the phage titer was about 1.5 x 10 ¹³ pfu/ml. All phages were blue, and the exogenous fragment recombination rate was 100%. .

 3. Bio-panning of phage display short peptide library

 Single colonies of ER2537 were picked and expanded in 2 ml and 20 ml. LB (Tet+) medium for titration and amplification of the eluate.

Take normal human serum IgG lOO g , Herceptin 50 g and Protein respectively The A-Sepharose 4B beads were shaken at 4 ° C for 3 h and washed 3 times with TBST (0.1% Tween-20). The original library phage (1.5 ^x 10 ⁿ pfu) was added to a mixture of normal human IgG and Protein A-Sepharose 4B beads for non-specific adsorption. After shaking at 4 ° C for 2 h, the supernatant was centrifuged to add a mixture of Herceptin and Protein A-Sepharose 4B beads for specific adsorption. After shaking at 4 ° C for 1 h, centrifugation, the reaction mixture was washed 5 times with TBST (0.1% Tween), and a small amount of the reaction mixture (about Ι μΐ) was added, and 200 μl was added to the middle of the logarithmic ER2537 solution, and left at room temperature for 5 min. Add 3 ml of pre-warmed Agarose Top, quickly mix and pour the mixture onto LB (Tet ⁺ ) / IFTG / Xgal plates, and shake evenly to distribute the Agarose Top evenly. Incubate for 10 h at 37 ° C, count plaques and calculate the first round of Output titer.

The remaining eluate was added to 20 ml logarithmic early (OD _6QQ = 0.3-0.4) ER2738 broth and expanded at 37 ° C for 225 rpm for 4.5 h. The bacteria were pelleted by centrifugation, and 80% supernatant was added to a 1/6 volume of PEG/NaCl precipitate overnight (or at 4 ° C for more than 1 h). Centrifuge at 10,000 rpm for 15 min at 4 °C. Discard the supernatant and centrifuge again to discard the residual supernatant. The pellet was suspended in 1 ml of TBS, and 1/6 volume of PEG/NaCl was added to precipitate again on ice for 15-60 min. Centrifuge at 10 ° C for 10 min, discard the supernatant, and centrifuge again to discard the residual supernatant. The pellet was suspended by 20 (^1 TBS. Centrifuge for 1 min, and the residual insoluble matter was precipitated. The supernatant was transferred into another sterile centrifuge tube, which was the eluate after amplification, and used for the next round of Bio-Panning. After dilution, the first round of amplification titer is determined, that is, the second round of Input titer.

 Repeat the Bio-Panning process 3 times. From the second round, the time to bind the phage library to the coated receptor was gradually shortened and the concentration of Tween-20 in the wash was increased to 0.5%.

After three rounds of Bio-Panning, the short peptide library was gradually enriched (Table 1), but the enrichment phenomenon was not obvious.

Enrichment of 12 peptide libraries during Herceptin screening

 Round of Input phages Output phages Relative yield panning (Pfu) (Pfu) (Pfu)

1st 8.2x l0 ⁴ 5.5x l0 ^-7

2nd 3.7x l0 ¹² 9x l0 ⁵ 2.4X 10- ⁷

3rd 3χ 10 ¹² 3.7x l0 ⁶ 1.2xl (T ⁶

 X

 4. Preparation of high titer monoclonal phage o

 Titrate the last round of Bio-Panning eluate, select a plaque of less than 100 blistering jm, and select well-separated monoclonal plaques. When picking up plaques, insert the plastic tip into the LB plate, aspirate the complete plaque, and blow it into the ER2537 solution in the early 1 ml logarithmic growth phase, and amplify for 4.5 h at 37 ° C and 225 rpm. . The bacteria were pelleted by centrifugation, and the supernatant was a high titer monoclonal phage solution, which was stored at 4 °C.

 Example 2 Screening and Identification of Positive Phage Clones

 1. Positive screening of positive clones by ELISA

96-well plates were coated with 5 μl/πι1 Heceptin and normal human IgG, respectively, overnight at 4 °C. The coating solution was discarded, and 200 μl of blocking solution was added to each well at 4 ° C overnight. After discarding the blocking solution, the plate was washed 4 times with TBST (0.1% Tween-20), and 40 μl of the bacteriophage-containing expanded bacterial supernatant was added to each well (two parallel wells per clone). After combining with l-2 h at room temperature, the plate was washed 6 times, and the enzyme-labeled anti-M13 monoclonal antibody (1:5000) was added. The mixture was combined at room temperature for 1 hour, and the plate was washed 6 times. Ι Ι μΙ OPD substrate solution was added to each well, and the color was developed for 10-30 min at room temperature, and the reaction was terminated and the OD _{492 was} read.

The phage clones after 300 third rounds of Bio-Panning were amplified and identified by ELISA. A total of 41 positive phage clones were obtained, which specifically bind to Herceptin but not to normal human serum IgG. Table 2 lists 8 positive clones. The positive rate was about 13.7%. Detection of binding of phage clones to Herceptin by ELISA

 With Herceptin and normal people

 Cloning sequence binding IgG binding

OD ₄₉₂ OD ₄₉₂

 H15 1.552 0.233

 H22 1.620 0.234

 H31 1.512 0.271

 H57 1.576 0.243

 H63 1.692 0.247

 H70 1.687 0.240

 H75 1.593 0.298

 H98 1.677 0.251

 , beginning library hage 0.253 0.243

 2. Sequencing of positive clones

 A positive phage clone sequencing template was prepared. Freshly amplified 1 ml of phage supernatant was centrifuged at 10,000 rpm for 15 min. 0.5 ml of the phage supernatant was transferred to another sterile centrifuge tube, 200 μl of PEG NaCr solution was added, mixed by inversion, and allowed to stand at room temperature for 10 min to precipitate the phage. Centrifuge at 10,000 rpm for 10 min, discard the supernatant, centrifuge briefly again, and carefully discard the residual supernatant. The pellet was completely suspended in ΙΟΟμΙ Ι Ι Buffer, added to 250 μl of ethanol, and allowed to stand at room temperature for 10 min. During this process, the single-stranded DNA of the phage will preferentially precipitate, and the phage protein will remain in the solution. The phage DNA was pelleted by centrifugation at 10,000 rpm for 10 min. The precipitate was washed once with 70% ethanol. After drying, the pellet was suspended by adding 20 μl of TE Buffer. In order to fully suspend the precipitate, it can be repeatedly shaken after adding TE, and centrifuged 3-5 times. Samples of ΙΟμΙ template were sent to Shanghai Shenyou for DNA sequencing, and the rest were stored at -20 °C. The sequencing uses -96 gill sequencing primers.

 Among the 41 positive clones, 26 of the phage clones were sequenced and identified. Among them, 25 cloned sequences were identical, and only one cloned sequence was different from the others. A clone with 25 identical sequences was named H98.

Among them, H98 is: LLGPYELWELSH Example 3 Prokaryotic expression and purification of GST-H98 fusion protein

 1. Construction of GST-H98 fusion protein expression vector pGEX-4Tl-H98

 1.1 Annealing reaction of small peptide sequences

The small peptide H98 sense and antisense single-stranded DNA fragments were designed based on the sequencing results of the Herceptin-binding positive small peptide H98 screened from the phage 12 peptide library, and introduced into the primers for cloning.

And /1 cohesive end sequence, and a stop codon and HindJIl cleavage site were introduced at the end of the small peptide sequence for restriction enzyme digestion of the recombinant plasmid (Table 3).

Table 3 Oligonucleotide sequences encoding small peptides

Small peptide name amino acid contained. Primer orientation Primer sequence

 Justice Primer 5'-GATCCfH98 TGA AAGCTTG

H98 H98 12 amino acids

 Antisense Primer S'-TCGACAAGCTT TCA(H98)G sense primer 5'-GATCCiN10 TGA GATATCG Li H98 amino terminus 10 amino acids

 Antisense Primer 5,-TCGACGATATC TCA(N10)G sense primer 5'-GATCC(N8)TGA GATATCG

N8 H98 amino terminus 8 amino acids

 Antisense primer 5'-TCGACGATATC TCA(N8)G sense primer 5'-GATCC(N6 TGA GATATCG

N6 H98 amino terminus 6 amino acids

 Antisense Primer 5'- TCGACGATATC TCA(N6)G Sense Primer 5'-GATCCfC10 TGA GATATCG

C10 H98 carboxyl end 10 amino acids

 Antisense Primer S'-TCGACGATATC TCA(C10)G Sense Primer 5'-GATCC(C8)TGA GATATCG

C8 H98 carboxyl end 8 amino acids

 Antisense primers . 5'-TCGACGATATC TCA(C8)G sense primer 5'-GATCCiC6)TGA GATATCG

C6 H98 carboxyl end 6 amino acids

Antisense Primer 5'-TCGACGATATC TCA(C6)G

Justice Primer 5'-GATCCfM8)TGA GATATCG

 Molecular 3-10 of M8 H98

 Antisense Primer 5'-TCGACGATATC TCA(M8)G Sense Primer 5'-GATCC to A GATATCG

 Molecular 4-9 of M6 H98

 Antisense Primer 5'-TCGACGATATC TCA(M6)G

 H98 amino terminus 3, 4 sense primer 5'-GATCC (MutN3-4) TGA AAGCTTG

MutN3-4

Amino acid mutated small peptide antisense primer 5 ^f -TCGACAAGCTT TCA(MutN3-4)G

H98 carboxyl terminus 1, 2 sense primer 5'-GATCC (MutCl-2) TGA GATATCG

MutCl-2

 Amino acid mutated small peptide antisense primer 5'-TCGACGATATC TCA(MutCl-2)G

H98 amino terminus 1, 2 sense primer 5'-GATCaMutNl-2 A GATATCG

MutNl-2

 Amino acid mutated small peptide antisense primer 5'-TCGACGATATC TCA(MutNl-2)G

H98 amino terminus 1st sense primer 5'-GATCCrMutNl)TGA GATATCG

MutNl

 Amino acid mutated small peptide antisense primer 5'- TCGACGATATC TCAfMutNDG

H98 amino terminus, carboxy terminus, respectively, sense primer 5'-GATCCiCvcIicH98)TGA GATATCG

CyclicH98

The cysteine-added small peptide antisense primer 5'-TCGACGATATC TCA (CyclkH98) G is digested into spots under the underline, with a stop codon at the box and a small peptide sequence in the parentheses.

The primers were separately dissolved in TE buffer to a final concentration of ^g/ml. Add lul sense and antisense primers to 18μ1 Η ₂ 0 and mix. The DNA was denatured in a 75 ° C water bath for 5 min, and the DNA was renatured by slowly dropping it to room temperature.

 1.2 Digestion of the vector pGEX-4T1 and its ligation to the H98 small peptide DNA fragment The endonuclease BamHl/Sail digestion vector pGEX-4Tl was recovered by the QIAGEN gel DNA purification kit, and the 30 ng annealed H98 fragment and vector were pGEX-4Tl was ligated and transformed into BL21 calcium chloride competent bacteria. Finally, the plasmid was digested and the recombinant plasmid pGEX-4Tl-H98 was digested with Hindlll/EcoRV.

 Results: Since the HifidUI restriction site was introduced into the H98 oligonucleotide fragment, the pGEX-4T1 vector did not have a cleavage site, but had an EcoRV restriction site. Therefore, the recombinant plasmid pGEX-4Tl-H98 was passed through Hindlll/EcoR. Double digestion revealed a 1700 bp fragment; whereas the empty vector pGEX-4T1 without the clone insert was digested with Hindlll/EcoR, the plasmid was cleaved but no fragment was released, and the results were consistent with the prediction (Fig. 9).

 2. Induction and expression of small batches of recombinant proteins

(1) A sterile tip picks a single clone from the transformation plate, inoculates it in 2 ml of LB (Amp ⁺ ) medium, and incubated at 225 rpm at 37 ° C overnight;

(2) Take the above-mentioned bacterial solution 300μ1 to 3ml (l:10 or 1:5) LB (Amp ⁺ ) for the next day, continue to culture for 2 h, until OD ₆₀₀ =1, and aspirate 1.5 ml for the uninduced negative control. 1.5 ml plus IPTG to a final concentration of 0.5 mmol / L or 1 mmol / L, continue to culture for 3 h;

 (3) Centrifuge in a benchtop centrifuge for 30 seconds (12,000-15,000 111), discard the supernatant, add PBS 50μ1 and 2xSDS-PAGE to load buffer 5 (^l, mix, boil for 3-5min;

 (4) The above sample ΙΟ μΙ 12% SDS-PAGE electrophoresis, 100 V, 2-3 h;

(5) The gel was removed and stained in Coomassie brilliant blue dye for 45 min-1 h, and the decolorizing solution was decolorized for 30 min to observe the expression of recombinant protein.

 3. Large expression of recombinant protein

 (1) Sterilely aspirate a small amount of positive bacteria (10-20μ1) that has been identified by a small sample, add it to 100 ml of LB (Amp+) medium, and incubate overnight at 37 °C;

(2) Dilute the above culture medium with LB (Amp+)l:10 and continue to culture for 2-3 h until OD ₆₀₀ =1 or so.;

 (3) Add IPTG to a final concentration of 0.5 mmol/L, and continue to culture for 5-6 h at 30 °C;

 (4) Centrifuge at 5,000 rpm for 10 minutes at 4 °C;

 (5) The precipitate is washed with PBS, dispensed, and stored at -20 °C for later use.

 4. Glutathione-Sephorose 4B gel purification fusion protein GST-H98

 (1) A large number of induced cell pellets were added to the bacterial lysate 20ml (10ml bacterial lysate / 100ml bacterial solution), and allowed to stand on water for 30min;

 (2) Add Triton-X 100 to a concentration of 1%, ice bath for 10-30 min;

 (3) Intermittent ultrasonic lysis on ice, 18KHz, ultrasonic 15s, stop for 15s, repeated 6 times, until the liquid becomes clear.

 (4) Centrifuge at 12,000 rpm for 20 min at 4 ° C, and collect the supernatant;

 (5) Take 200μ1 Glutathione-Sepharose 4B gel and wash it with PBS 3 times, add the supernatant after ultrasonication, and shake gently at 4 °C for 2 hours;

 (6) Centrifuge at 5,000 rpm for 5 min at 4 ° C, and wash the pellet three times with PBS;

 (7) Add 200 (1 elution buffer, shake gently at 4 ° C for 20 min;

 (8) Centrifuge at 12,000 rpm for 20 s at 4 ° C, repeat 2-3 times, and collect the supernatant as a purified fusion protein;

 (9) Perform 12% SDS-PAGE protein electrophoresis, quantify and store at -20 °C.

 Result:

 The recombinant plasmid pGEX-4Tl-H98 was transformed into E. coli BL21, and the fusion protein GST-H98 was expressed at 30 °C, 0.5 mmol/L IPTG for 5-6 h, and the molecular weight was about 26KD, which was consistent with the prediction. E. coli BL21 of pGEX-4T1 expressed a 26 kD GST protein (Fig. 10). Since the induction temperature and the concentration of the inducer were both low, the fusion protein was soluble and both were in the supernatant after ultrasound, and no inclusion bodies were formed. The GST-H98 fusion protein was purified by Glutathione-Sepharose 4B gel to obtain a GST-H98 soluble protein with a purity of >95% (Fig. 11).

 Example 4: Identification of the biological activity of GST-H98. fusion protein

 1. ELISA detection of Herceptin binding activity to GST-H98

96-well plates were coated with 5 g/ml GST-H98, GST, overnight at 4 °C. Discard the package Add liquid to each well, add 200 (1 blocking solution, overnight at 4 ° C. Discard the blocking solution and wash the plate 4 times with PBST (0.05 % Tween), add 0, 0.1, 0.5, 1, 5 g/ml concentration per well. Herceptin 50μ1 (two parallel wells per concentration), combined with 1-2 h at room temperature, 6 times after washing, HRP-goat anti-human IgG anti-(1:2500), combined with lh at room temperature, washed 6 times. Add 100 (1 OPD substrate solution to the wells for 10-30 min at room temperature, and read at OD ₄₉₂ after termination of reaction.

 Herceptin binds to GST-H98, and its binding increases with Herceptin concentration, while Herceptin does not bind to GST (Figure 12). Tip Herceptin specifically binds to GST-H98.

 2. Western blot analysis of the binding activity of Herceptin to GST-H98

GST protein, GST-H98, GST-HER-2, DHFR-H98 fusion protein 2μ _δ plus 2 (SDS-PAGE gel loading buffer, boil for 3-5min, denature protein, 12% SDS -PAGE protein electrophoresis, after transfection, the antibody Herceptin was used as the primary antibody, and horseradish peroxidase-labeled goat anti-human IgG (1:2500) was used as the secondary antibody. The binding of the protein to Herceptin was detected by Western blot.

 The results showed that Herceptin and GST-H98 and DHFR-H98 had a specific reaction band at a molecular weight of approximately 26KD, and a positive reaction band at a molecular weight of approximately 44KD with the positive control GST-HER-2, but no corresponding to GST. reaction. The anti-GST monoclonal antibody specifically binds to GST protein, GST-H98, and GST-HER-2; whereas normal human serum IgG does not react with the above four proteins (Fig. 1).

 3. Competition inhibition experiment.

 The ELISA method was used to detect whether the small peptide H98 blocked the binding of Herceptin to HER-2. In other words, whether the binding site of Herceptin and GST-H98 can be occupied by HER-2. '

96-well plates were coated with 5 g/ml NIH3T3-erbB2 cell membrane protein (1% TritonX-100, ImM EDTA, ImM PMSF, ^g/ml aprotinin), or 5 g/ml GST-H98, respectively. , 4 ° C overnight. The coating solution was discarded, and 200 μl of blocking solution was added to each well at 4 ° C overnight. The membrane proteins of H98, F56, GST, GST-H98 and NIH3T3-erbB2 at 0, 0.5, 5, 10, 50 g/ml were mixed with 0.5 g/ml Herceptin 50μ1, pre-incubated for 1 h at room temperature, and then blocked. 96-well plates (two parallel holes per reaction concentration), After combining with 1-2 h at room temperature, the plate was washed 5 times and then HRP-goat anti-human IgG (1:2500) was added. _{5 At} room temperature for lh, the plate was washed 5 times. ΙΟΟμΙ OPD substrate solution was added to each well, and the color was developed for 10-30 min at room temperature, and the reaction was terminated and the OD _{492 was} read. Calculate the percentage of inhibition according to the formula:

(ODHerceptin-ODnerceptin with Protein)/ODHerceptin ^X 100%.

 The results of ELISA indicated that both GST-H98 and small peptide H98 blocked the binding of Herceptin to HER-2, and this blocking effect gradually increased with the increase of GST-H98 and H98 concentrations. However, GST and the small peptide F56 had no effect on the interaction between Herceptin and HER-2 (Fig. 2).

 In addition, the results suggest that both HER-2 and small peptide H98 block the binding of Herceptin to GST-H98, and this blocking effect is gradually enhanced with increasing HER-2 concentration (Fig. 3). The above results further demonstrate that H98 shares similar epitopes with HER-2.

 4. Effect of small peptide H98 on the growth of Herceptin inhibiting tumor cells

The effect of Herceptin on the growth of tumor cells was detected by MTT colorimetric assay. SKBR3 cells were treated with l xlO ⁴ /well in 96-well plates. The cells were adhered for 24 h, and a mixture of lg/ml Herceptin and 0, 3, 30, 60, 120 g/ml H98 small peptide or F56 small peptide was added. Lg/ml normal mouse IgG was added to the control wells. Continue to culture for 72h, add 10mg/ml MTT 5g/well, incubate for 4h, gently aspirate the supernatant, add dimethyl sulfoxide 150μ1/well, shake well, measure optical density OD ₄₉₂ at wavelength 492nm, take two The average of the parallel wells was calculated and the cell growth inhibition rate was calculated. Cell inhibition rate (%) = (OD normal person)

IgG-ODH _eree ptin+H98/F56y OD Normal human i _g G ^x 100 ^O /o.

The experiment showed that the concentration of Herceptin was lg/ml ', which inhibited the growth of SKBR3 cells. The small peptide H98 blocked the inhibition of Herceptin on cell growth. This effect was enhanced with the increasing concentration of H98, when the concentration of small peptide H98 was increased. is 60μ β _/ πι1, Herceptin SKBR3 cell proliferation inhibition decreased 12.5%. The same concentration of the irrelevant small peptide F56 had no effect on the cell proliferation inhibition of Herceptin (Fig. 4).

 Example 5: Animal experiment

 5.1 Animal immunity

Female Kunming mice aged 6-8 weeks were purchased from the Animal Center of the Chinese Academy of Medical Sciences. The primary immunization was 40 ug of purified antigen GST-H98, GST and an equal volume of complete Freund's adjuvant (CF A). Mix well until a small drop is not spread in water, and the mice are immunized at multiple points. The booster immunization was performed once every 3 weeks, and the equal amount of purified antigen was mixed with incomplete Freund's adjuvant (IFA) in the same volume and emulsified. A total of 5 immunizations. Before the immunization, and the third time, the tail vein blood of the mice was taken 7-10 days after the fifth immunization to detect the antibody titer by ELISA.

 5.2 ELISA for detection of antibody activity in immune serum

 The ELISA method was used to detect anti-H98 and anti-HER-2 immune responses in the serum of immunized mice. The pQE40-H98 expression vector was constructed and the purified DHFR-H98 fusion protein was expressed and used to detect the humoral immune response against the H98 small peptide in the immune serum. The 96-well plate was coated with 5 g/ml DHFR-H98, and the immunized mouse serum diluted 1:1000 was added, and the conventional ELISA was performed with HRP enzyme goat anti-mouse IgG, and DHFR plate was used as a negative control.

NIH3T3-erbB2 cells were plated in 1 x 10 ⁴ /well 96-well plates. The cells were adhered for 24 hours. The cells were fixed with 0.25% glutaraldehyde. After blocking, the serum of immunized mice was diluted 1:100, and the goat anti-HRP enzyme was used. The murine IgG was subjected to a conventional ELISA to detect the humoral immune response against the HER-2 protein in the immune serum, and the NIH3T3 cell plate was used as a negative control.

 RESULTS: Five mice developed an immune response against the H98 small peptide (Fig. 5A) and the anti-HER-2 protein (Fig. 5B) after the fifth immunization. One of the mice had a weaker anti-HER-2 response, which was associated with individual differences in mice. The immune response against the H98 small peptide was detected after the third immunization, that is, the anti-H98 response of the GST-H98-immunized rat serum after the third immunization was significantly different from the anti-H98 reaction of the GST-immunized rat serum (P .<0.05). After the fifth immunization, the anti-HER-2 response was detected in the serum of mice, that is, the anti-HER-2 response of GST-H98-immunized murine serum after the fifth immunization was compared with the anti-HER-2 response of GST-immunized murine serum. There was a significant difference (P < 0.05). No anti-H98 small peptide and anti-HER-2 immune response was detected in the serum of mice immunized with GST protein alone.

 5.3 Immunoprecipitation - Western blot analysis of antibody activity in immune serum

50 g Herceptin and 50 μl Protein A-Sepharose 4B beads were shaken at 4 ° C for 3 h, and the reaction mixture was washed 3 times with PBST (0.05% Tween), and then extracted with 1.5× ^{10 7} NIH3T3-erbB2 cells (cell lysate: l % TritonX-100, ImM EDTA, ImM PMSF, lg/ml aprotinin) 4 h at 4 ° C, the precipitation complex was washed 3 times with PBST (0.05% Tween), denatured and subjected to 8% SDS-PAGE electrophoresis, NC film The serum of different immunized mice diluted 1:100 was used as the primary antibody, and HRP-goat anti-mouse IgG was used as the secondary antibody for Western blot. The serum of the immunized mice was tested for anti-HER-2 humoral immune response. Normal mouse serum IgG was a negative control.

 RESULTS: It was found that one of the immunized mice had a specific reaction band at a molecular weight of approximately 185 KD, which was similar in size to the human HER-2 gene expression product, and the GST-immunized mouse serum and the normal mouse IgG were primary antibodies. No reaction bands were seen at 185 KD (Figure 6). Description The anti-HER-2 immune response produced by one of the 5 mice reacted with the degenerated HER-2.

 5.4 Effect of H98 small peptide on T cell proliferation

The small peptide H98 was dissolved in sterile PBS at a concentration of 0, 1, 10, 100 g/ml, coated in a 96-well plate, and coated at 37 ° C for 2 h. Discard the solution and wash the plate 2 times with sterile PBS. Two mice immunized 4 times with GST-H98 and GST-unrelated small peptides were randomly selected. Spleen cells were aseptically taken on the 7th day after the last immunization, and inoculated into the coated H98 small peptide at a concentration of 2× ^{10 5} /well. In a 96-well plate, continue to incubate at 37 °C for 72 h, then add 10 mg/ml MTT 5μ1/well. After 4 h of incubation, gently aspirate the supernatant, add 150 μl/well of sulfhydryl sulfoxide, shake well, and measure light at a wavelength of 492 nm. Density OD ₄₉₂ , taking the average of two parallel wells and calculating the cell proliferation rate. Cell proliferation rate (%) = (OD _H9 8-OD untreated well) / OD Untreated well X 100%

 The results suggest that small peptide H98 can stimulate the proliferation of GST-H98-immunized murine T cells, but this proliferation stimulation is weak, only when the small peptide concentration reaches 100 g/ml, compared with GST-independent small peptide-immunized murine T cell proliferation. There was a significant difference (P < 0.0.5). The GST-independent small peptide-immunized mice showed no significant T cell proliferative response (Fig. 7).

 Example 6 Three-dimensional structure analysis of small peptide H98

 According to the literature report [56] and the three-dimensional structure of Herceptin and HER-2 obtained in the PDB database, the Homology module in the Insight II software package was used to construct the simulated structure of the interaction between H98 small peptide and Herceptin.

The literature reports [56] and the three-dimensional structure of Herceptin interacting with HER-2 obtained in the PDB database. 1N8Z suggests that several discrete peptides on HER-2 can interact with Herceptin light (A) and heavy (B) chains. The surface of the active site of Herceptin A, B chain is represented by a solution-accessible surface, and the HER-2 moiety is represented by a secondary structure, which has an active The residues used are represented by a ball and stick model (Fig. 8A). As can be seen from the figure: (1) HER-2 protein HER-2 ₅₅₇ P-HER-2 ₅₆ HER-2 ₅₆₀ D in iQ has hydrogen bonding interaction with A, B chain A94T and B50R. The active sites of the A, B chain (B33Y, B50R, B59R, B52Y, B54T, B55N, B57Y) form an active pocket, and HER-2 ₅₅₈ E directly extends into the active pocket, forming a hydrogen bond interaction with B50R, B59R. (2) The interaction between the active pocket formed by the active sites of A, B chain (B102-103G, B105Y, A92Y, A93T, A94T) and the HER-2 ₅₇₀ D-HER-2 ₅₇₃ F (DPPF) sequence In the cyclic structure, the HER-2 ₅₇₃ F benzene ring is directly inserted into the active pocket, forming a benzene ring with the B33Y, B105Y side chain (- (conjugated interaction. (3) HER-2 _{6. 2} Q and A ₃ QN Hydrogen bond interactions are formed (see Table 4 for specific hydrogen bond interactions). (4) From the order of action, HER-2 from HER-2 _56. D-HER-2 ₅₆₇ H is a coiled structure, HER-2 ₅₆₈ Y-HER-2 _57. D is a beta folded sheet with a HER-2 _57Q D at the end, followed by a slewing ring structure formed by the DPPF sequence, which leads to HER-2 ₅₇₃ F and HER-2 ₅₆ . D is close to each other, and HER-2 _{56 is} observed from a three-dimensional structure. D, HER-2 ₅₇₃ F, and HER-2 ₅₇₂ P are close to each other to form an active site.

The structure of the H98 small peptide was constructed using the Homology module in the Insightll software package. The H98 small peptide was applied to the active site of Herceptin using the Docking module to obtain a binding conformation as shown in Figure 8B. The structure of H98 small peptide is represented by a linear ribbon diagram, the NH3-end is LEU, the COOH-terminus is HIS, and the residues H98 ₅ Y, H98 ₆ E, H98 ₉ E interacting with Herceptin are represented by a stick figure. In the Herceptin part, the blue line indicates the A chain, and the purple line indicates the B chain. According to reports in the literature, the active site of Herceptin is composed of four loops (A90-A96, B96-B109, B25-B35, B50-B60) formed by the two chains A and B of Herceptin. Residues such as B33Y, B105Y, B50R, A94T, and A3 ON in the active site of Herceptin have a very important role. These residues form a strong electrostatic interaction with the receptor HER-2, hydrogen bonding, (- (conjugated) Interactions, etc. [56], from the interaction of the simulated H98 with the active site of Herceptin, it can be seen that H98 has a similar effect on these residues in the active site of Herceptin. H98 ₆ E, H98 _{5 of} H98 The three residues of Y, H98 ₄ P act on Herceptin A, and the active pocket of the B chain forms a three-dimensional action form similar to Herceptin A and B chain (H98 ₆ E corresponding to HER-2 "DFPF" described above. HER-2 ₅₆ . D, H98 ₅ Y corresponds to HER-2 ₅₇₃ F, H98 ₄ P corresponds to HER-2 ₅₇₂ P), and H98 ₆ E can replace HER-2 ₅₆ . D, H98 ₆ E has a side chain than HER-2 ₅₆ . D is a methyl group, which can form a hydrogen bond interaction with A94T and B50R in Herceptin A, B chain; H98 ₅ Y can replace HER-2 ₅₇₃ F, H98 ₅ Y benzene ring is directly inserted into the active pocket, and B33Y, B105Y The benzene ring forms (- (conjugated interaction. H98 ₉ E may act on the A, B chain forming active pocket, forming a hydrogen bond interaction similar to HER-2 ₅₅₈ E and B50R, B59R (Table 5) In addition, if Η98^ is mutated to Q, which corresponds to HER-2 ₆₀₂ Q, Η98^ can form a strong hydrogen bond interaction with A3 ON. This mutation may enhance the affinity of small peptide H98 with Herceptin.

Table 4 Hydrogen bonding interaction between HER-2 and Herceptin

 Table 4 H bonds between HER-2 and Herceptin

 Donor Acceptor Distance Angle

 1N8Z: B50R: HH11 1N8Z: C558E: 0E1 2.47 121.08

 1N8Z: A94T: HG1 1N8Z: C560D: OD2 1.84 158.94

 1N8Z: B50R: HH21 1N8Z: C560D: OD2 1.92 120.99

 1N8Z: A30N: HD22 1N8Z: C602Q: OE1 2.45 131.5

 1N8Z: A30N: HD22 1N8Z: C602Q: NE2 2.13 160.13

 1N8Z: C602Q: HE22 1N8Z: A30N: ND2 2.23 143.86

 Hydrogen bonding interaction between H98 and Herceptin

 H bonds between H98 and Herceptin

 Donor Acceptor Distance Angle

 H98:6:HN 1N8Z:A94:0G1 2.16 154.2

 1N8Z: B33: HH H98: l: OXT 1.61 167.73

 1N8Z: B50: NE H98: 5: OH 2.91 NA

 H98:5:HH 1N8Z:B50:NE 1.95 167.75

 1N8Z: B50: HH11 H98: 9: 0E1 1.94 173.05

 H98:9:HE2 1N8Z:B57:0 1.9 142.55

 1N8Z: B102: HD2 Dragon: 1:0 1.58 163.45

1N8Z: B105: HH H98: l: OXT 1.65 170.29 Example 7 Activity Analysis of H98 Small Peptide Truncates

 1. Segmental expression of H98 small peptide

 1.1 Construction of GST-X fusion protein expression vector pGEX-4Tl-X

 The small peptide X sense and antisense single-stranded DNA fragments were designed based on the sequencing results of the Herceptin-binding positive small peptide H98 screened from the phage 12 peptide library, and S HI and /I viscosities for cloning were introduced at both ends of the primers. The terminal sequence, and a stop codon and a JScoRV cleavage site were introduced at the end of the small peptide sequence for restriction enzyme digestion of the recombinant plasmid (Table 3). X represents N10, N8, N6, CIO, C8, C6, M8, M6, MutN3-4> MutCl-2, MutN3-4, MutNl, CyclicH98, respectively.

 The primers were separately dissolved in TE buffer to a final concentration of 1 g/ml. The sense and antisense primers were annealed and ligated with the endonuclease BamHl/Sall-digested vector pGEX-4Tl fragment and transformed into BL21 calcium chloride competent bacteria. Finally, the plasmid was extracted and the recombinant plasmid pGEX-4Tl-X was identified by CORV digestion.

 RESULTS: Based on the DNA sequence of the positive small peptide H98 and the three-dimensional structural analysis of H98, synthetic truncated small peptides (the small peptides described below are represented by X) and the justices of N10, N8, N6, C10, C8, C6, M8, M6, etc. The antisense single-stranded DNA fragment was annealed and inserted into the pGEX-4Tl vector. Since the coRV restriction site was introduced into the X oligonucleotide fragment, the EcoRV restriction site was also found in the vector pGEX-4T 1 , and thus the recombinant plasmid pGEX-4Tl-X was cleavable by EcoRV to release a fragment of 1700 bp in size; The empty vector pGEX-4T1 without the insertion of the cloned fragment was digested with 'coRV, and the plasmid was cleaved but no fragment was released, and the results were in agreement with the prediction (Fig. 9).

 1.2 Induction expression and purification methods of GST-X fusion protein are as described above

 2. Identification of binding activity of GST-X fusion protein to Herceptin

 2.1 ELISA detection of Herceptin and GST-X binding activity

5 g/ml GST, GST-H98, GST-N10, GST-N8, GST-N6, GST-C10 GST-C8, GST-C6, GST-M8, GST-M6, GST-MutN3-4, GST -MutCl-2, GST-MutNl-2, GST-MutNl, GST-CyclicH98 were coated in 96-well plates at 4 °C overnight. The coating solution was discarded, and 200 μl of blocking solution was added to each well at 4 ° C overnight. Discard the blocking solution and wash the plate 4 times with PBST (0.05 % Tween), adding 0, 0.1, 0.5 to each well. 1, 2, 5 g / ml Herceptin 50μ1 (two parallel holes per concentration), combined with 1-2 h at room temperature, 6 times after washing, add HRP-goat anti-human IgG (l: 2500), combined at room temperature Lh, wash the plate 6 times. ΙΟΟμΙ OPD substrate solution was added to each well, and the color was developed for 10-30 min at room temperature, and the reaction was terminated and the OD _{492 was} read.

 2.2 Western blot detection of Herceptin and GST-X binding activity

 GST, GST-H98, GST-N10, GST-N8, GST-N6, GST-C10, GST-C8, GST-C6, GST-M8, GST-M6, GST-MutN3-4, GST-MutCl-2, GST-MutNl-2, GST-MutNl, GST-CyclicH98 fusion protein 2 g plus 2 (SDS-PAGE gel loading buffer, mix, boil for 3-5 min, denature the protein, 12% SDS-PAGE protein After electrophoresis, the antibody Herceptin was used as the primary antibody, and the peroxidase-labeled goat anti-human IgG (1:2500) was used as the secondary antibody. The binding of the fusion protein to Herceptin was detected by Western blot.

 The results of ELISA and Western blot showed that Herceptin can be combined with GST-H98 (original small peptide), GST-C10 (a small peptide containing 10 amino acids at the carboxy terminal of H98), GST-MutNl-2 (amino acid at positions 1 and 2). Small peptide), GST-MutNl (small peptide with amino acid mutation at amino terminus 1) and GST-Cyclic H98 (small peptide with a cysteine introduced at the amino terminus and the carboxy terminus, respectively). Their affinity with Herceptin is from strong to weak: GST-MutNl>GST-H98>GST-MutNl-2>GST-C10>GST-CyclicH98. Herceptin does not bind to many other GST small peptide fusion proteins (Figure 12, 13). The results suggest that the 2 amino acids at the carboxy terminus and the 笫 3, 4 amino acids at the amino terminus play an important role in the binding of the small peptide to Herceptin, which is not completely consistent with the results of the software analysis. In addition, by mutating Η98^ to Q, the affinity of H98 small peptide with Herceptin was enhanced, indicating that software analysis has certain guiding significance for experimental design.

 The following references are incorporated herein by reference in their entirety.

 references

1. Coussens L, Yang-Feng TL, Liao YC, Chen E, et al (1985) Tyrosine kinase receptor with extensive homology to EGF receptor shares chromosomal location with neu oncogene. Science 230:1132 2. Tzahar E, Pinkaskramarski R, Moyer JD, Kapper LN, et al (1997) Bivalence of EGF-like ligands drives the ErbB signaling network. EMBO J 16:4938

 3. Olayioye MA, Neve RM, Lane HA, Hynes NE (2000) The ErbB signaling network: receptor heterodimerization in development and cancer. EMBO J 19:3159

 4. Klapper LN, Kirschbaum MH, Sela M, Yarden Y (2000) Biochemical and clinical implications of the ErbB/HER signaling network of growth factor receptors. Adv Cancer Res 77:25

 5. Cirisano FD, Karlan BY (1996) The role of the HER-2/neu oncogene in gynecologic cancers. J Soc Gynecol Investig 3:99

 6. Niehans GA, Singleton TP, Oykoski D, Kiang DT (1993) Stability of HER-2/neu expression over time and at multiple metastatic sites. J Natl Cancer Inst 85:1230

 7. Shak. S (1999) Overview of the trastuzumab (Herceptin) anti-HER2 monoclonal antibody clinical program in HER2-overexpressing metastatic breast cancer. Herceptin Multinational Investigator Study Group. Semin Oncol 26:71

 8. Schaller G, Bangemann N, Becker C, Buhler H, et al (1999) Therapy of metastatic breast cancer with humanized antibodies against the HER2 receptor protein. J Cancer Res Clin Oncol 125:520

 9. Yip YL, Smith G, Koch J, Dubel S, et al (2001) identification of epitope regions recognized by tumor inhibitory and stimulatory anti-erbb-2 monoclonal antibodies: implications for vaccine design. J Immunol 166:5271

 10. Disis ML, Calenoff E, McLaughlin G, Murphy AE, et al (1994) Existent T-cell and antibody immunity to HER-2 Neu protein in patients with breast cancer. Cancer Res 54:16

11. Pupa SM. Menard S, Andreola S, Colnaghi MI (1993) Antibody Response against the c-erbB-2 oncoprotein in breast carcinoma patients. Cancer Res 53:5864

 12. Disis ML, Pupa SM, Gralow JR, Dittadi R, et al (1997) High-titer HER-2/neu protein-specific antibody can be detected in patients with early-stage breast cancer. J Clin Oncol 15:3363

 13. Ward RL, Hawkins NJ, Coomber D, Disis ML (1999) Antibody immunity to the HER-2/neu oncogenic protein in patients with colorectal cancer. Hum Immunol 60:510

 14. Visco V, Bei R, Moriconi E, Gianni W, et al (2000) ErbB2 Immune response in breast cancer patients with soluble receptor ectodomain.

Am J Pathol 156:1417

 15. Disis ML, Gralow JR, Bernhard H, Hand SL, et al (1996) Peptide-based, but not whole protein, vaccines elicit immunity to HE -2/neu, an oncogenic selfprotein. J Immunol 156:3151

16. Fisk B, Hudson JM, Kavanagh J, Wharton JT, et al (1997) Existent proliferative responses of peripheral blood mononuclear cells from healthy donors and ovarian cancer patients to HER-2 peptides. Anticancer Res 17:45

 17. Kobavashi H, Wood M, Song Y, Appella E, et al (2000) Defining promiscuous MHC class II helper T-cell epitopes for HER2/neu tumor antigen. Cancer Res 60:5228

 18. Tutde TM, Anderson BW, Thompson WE, Lee JE, et al (1998) Proliferative and cytokine responses to class II HER-2/neu-associated peptides in breast cancer patients. Clin Cancer Res 4:2015

19. loannides CG, Fisk B, Fan D, Biddison WE, et al (1993) Cytotoxic T cells isolated from ovarian malignant ascites recognize a peptide derived From the HER-2/neu proto-oncogene. Cell Immunol 151 :225 20. Peoples GE, Goedegebuure PS, Smith R, Linehan DC, et al (1995) Breast and ovarian cancer-specific cytotoxic T lymphocytes The same HER2/ brain-derived peptide. Proc Natl Acad Sci USA 92:432 21. Yoshino I, Peoples GE, Goedegebuure PS, Maziarz R, et al (1994) Association of HER2/neu expression with sensitivity to tumor-specific CTL in Human ovarian cancer. J Immunol 152:2393 22. Kono K, Rongcun Y, Chard J, Ichihara F, et al (1998) Identification of HER2/neu-derived peptide epitopes recognized by gastric cancer-specific cytotoxic T lymphocytes, Int J Cancer 78:202

 23. Yoshino L, Goedegebuure PS, Peoples GE, Parikh AS, et al (1994) HER2/Neu- derived peptides are shared antigens among human non-small cell lung cancer and ovarian cancer. Cancer Res 54: 3387

24. Lustgarten J, Theobald M, Labadie C, Laface D, et al (1997) Identification of HER-2/Neu CTL epitopes using double transgenic mice expressing HLA-A2.1 and human CD8. Human Immunol 52: 109

25. Rongcun Y, Salazar-Onfray F, Charo J, Malmberg KJ, et al (1999) Identification of new HE 2/neu- derived peptide epitopes that can elicit specific CTL against autologous and allogeneic carcinomas and melanomas. J Immunol 163:1037

 26. Seliger B, Rongcun Y, Atkins D, Hammers S, et al (2000) HER-2/neu is expressed in human renal cell carcinoma at heterogeneous levels independently of tumor grading and staging and can be recognized by HLA-A2. -restricted cytotoxic T lymphocytes, Int J Cancer 87:349

27. Peoples GE, Smith RC, Linehan DC, Yoshino L, et al (1995) Shared T cell epitopes in epithelial tumors. Cell Immunol 164:279

28. Rilke F, Colnaghi MI, Cascinelli N, Andreola S, et al (1991) Prognostic significance of HER-2/neu expression in breast cancer and its relationship to other prognostic factors. Int J Cancer 49:44

29. Tagliabue E, Menard S, Robertson JF, Harris L (1999) c-erbB-2 expression in primary breast cancer. Int J Biol Markers 14:16 Nistico P, Mottolese M, Cascioli S, Benevolo M, et al (1990) Host immunosurveiliance contributes to the control of erbB-2 overexpression in HLA-A2-breast-cancer patients, Int J Cancer 84:598

Nistico P, Mottolese M, Mammi C, Benevolo M, et al (1997) Low frequency of ErbB-2 proto-oncogene overexpression in human leukocyte antigen- A2-positive breast cancer patients. J Natl Cancer Inst 89:319

 Guy CT, Webster MA, Schaller M, Parsons T J, et al (1992) Expression of the neu protooncogene in the mammary epithelium of transgenic mice induces metastatic disease. Proc Natl Acad Sci USA 89: 1057.

 Mailer WJ, Sinn E, Pattengale PK, Wallace R, et al (1988) Single-step induction of mammary adenocarcinoma in transgenic mice bearing the activated c-neu oncogene. Cell 54: 105

Bernards R, Destree A, McKenzie S, Gordon E, et al (1987) Effective tumor immunotherapy directed against an oncogene-encoded product using a vaccinia virus vector. Proc Natl Acad Sci USA 84:6854

 Taylor P, Gerder M, Moros Z, Feldmann M (1996) Humoral and cellular responses raised against human HER2 oncoprotein are cross-reactive with the homologous product of the new proto-oncogene, but do not protect manufacturers against B104 tumors expressing mutated neu Cancer Immunol Immunother 42:179

Esserman LJ, Lopez T, Monies R, Bald LN, et al (1999) Vaccination with the extracellular domain of pl85neu prevents mammary tumor development in neu transgenic mice. Cancer Immunol Immunother 47:337

Reilly RT, Gottlieb MB, Ercolini AM, Machiels JP, et al (2000) HER-2/neu is a tumor rejection target in tolerized HER-2 neu Transgenic mice. Cancer Res 60:3569

38. Cefai D, Morrison BW, Sckell A, Favre L, et al (1999) Targeting HER-2/neu for active-specific immunotherapy in a mouse model of spontaneous breast cancer. Int J Cancer 83 :393

39. Disis ML, Bernhard H, Shiota FM, Hand SL, et al (1996) Granulocyte-macoph colon colony-stimulating factor - an effective adjuvant for protein and peptide-based vaccines. Blood 88:202

 40. Nagata Y, Furugen R, Hiasa A, Ikeda H, et al (1997) Peptides derived from a wild-type murine proto-oncogene c-erbB-2/HER2/neu can induce CTL and tumor suppression in syngeneic hosts. J Immunol 159: 1336

 41. Ikuta Y, Okugawa T, Furugen R, Nagata Y, et al (2000) A HER2/NEU-derived peptide, a K(d)-restricted murine tumor rejection antigen, induces HE 2-specific HLA-A2402-restricted CD8 (+) cytotoxic T lymphocytes. Int J Cancer 87: 553

 42. Amici A, Venanzi FM, Concetti A (1998) Genetic immunization against neu/erbB2 transgenic breast cancer. Cancer Immunol Immunother 47: 183

43. Chen Y, Hu D, Eling DJ, Robbins J, et al (1998) DNA vaccines encoding full-length or truncated Neu in protective immunity against Neu-expressing mammary tumors. Cancer Res 58: 1965

44. Wei WZ, Shi WP, Galy A, Lichlyter D, et al (1999) Protection against mammary tumor growth by vaccination with full-length, modified human ErbB-2 DNA. Int J Cancer 81 :748

 45. Concerti A, Amici A, Petrelli C, Tibaldi A, et al (1996) Autoantibody to l 85 (Erbb2/Neu) oncoprotein by vaccination with xenogenic DNA. Cancer Immunol Immunother 43 : 307

46. Rovero S, Amici A, Carlo ED, Bei R, et al (2000) DNA vaccination Against rat her-2/Neu pi 85 more actually inhibits carcinogenesis than transplantable carcinomas in transgenic BALB/c mice [In Process Citation] . J Immunol 165: 5133

 Mahon BP, Moore A, Johnson PA, Mills KH (1998) Approaches to new vaccines, Crit Rev Biotechnol 18:257

 Quirke P, Pickles A, Tuzi NL, Mohamdee O, et al (1989) Pattern of expression of c-erbB-2 oncoprotein in human fetuses. Br J Cancer 60:64

Costello RT, Gastaut JA, Olive D (1999) Mechanisms of tumor escape from immunologic response. Rev Med Interne 20:579

 Hersey P (1999) Impediments to successful immunotherapy. Pharmacol Ther 81 :111

 Cabrera T, Angustias Fernandez M, Sierra A, Garrido A, et al (1996)

High frequency of altered HLA class I phenotypes in invasive breast carcinomas. Hiim Immunol 50:127

 Cabrera T, Collado A, Fernandez MA, Ferron A, et al (1998) High frequency of altered HLA class I phenotypes in invasive colorectal carcinomas. Tissue Antigens 52:114

 Cabrera T, Salinero J, Fernandez MA, Garrido A, et al (2000) High frequency of altered HLA class I phenotypes in laryngeal carcinomas [in Process Citation]. Hum Immunol 61 :499

 Algarra I, Cabrera T, Garrido F (2000) The HLA crossroad in tumor immunology. Hum Immunol 61 : 65

 Hicklin DJ, Marincola FM, Ferrone S (1999) HLA class I antigen downregulation in human cancers: T-cell immunotherapy revives an old story. Mol Med Today 5:178

Baselga J, Norton L, Albanell J, et al (1998) Recombinant humanized anti-HER2 antibody (Herceptin) enhances the antitumor activity of paclitaxel and doxorubicin against (Herceptin) enhances the Antitumor activity of paclitaxel and doxorubicin against HER2/neu overexpressing human breast cancer xenografts. Cancer Res 58 : 2825

 57. Li J, Wang Y, Li QX, et al (1998) Cloning of 3H11 mAb variable region gene and expression of 3H11 human-mouse chimeric light

Chain. World J Gastroenterol 4:41

 58. Cwirla SE, Peters EA, Barret RW, et al (1990) Peptides on phage: a vast library for identifying ligands. Proc Natl Acad Sci U.S.A. 87: 6378

59. Devlin JJ, Panganiban LC, Devlin PE (1990) Basic peptide libraries: a source of protein binding molecules. Science 404-406 60. An Ping, Meng Lin, Dong Zhiwei, Shou Chengchao (2001) VEGF receptor Flt in short peptide library -1 Improvement in screening conditions for antagonists. Peking University Journal (Medical Edition) 33: 398

61 Burritt JB, Bond CW, Doss KW, et al (1996) Filamentous phage display of oligopeptide libraries. Anal Biochem 238: 1

 62. Blond-Elguini S, Cwirla SE, Dower WJ, et al (1993) Affinity panning of a library of peptides displayed on bacteriophages reveals the binding specificity of BiP. Cell 75: 717

 63. Kay BK, Adey NB, He YS, et al (1993) An Ml 3 phage library displaying random 38-amino-chemical peptides as a source of novel sequences with affinity to selected targets. Gene 128: 59

 64. Stephen PW, Helminen P, Lane DP (1995) Characterization of epitopes on human p53 using phage displaying peptide libraries: insights into antibody-phage interactions. J Mol Biol 248: 58

 65. Steward, J. M. and Young, J. D., Solid Phase Peptide Synthesis,

2nd Ed., Pierce Chemical Company, Rockford, 111., (1984))

66. Steward, JM and Young, JD, Solid Phase Peptide Synthesis, WH Freeman Co. (San Francisco), 1963 and J. Meienhofer, Hormonal Proteins and Peptides, vol. 2, p. 46, Academic Press (New York), 1973 67 (Sanger et al., PNAS, 1977, 74: 5463-5467) 68 Sambrook, J. (1989), Molecular Cloning, a Laboratory Manual,

Cold Spring Harbor Press;

 68 Plainview, N.Y.; Ausubel, F.M. (1989) Current Protocols in Molecular Biology,

 69 John Wiley & Sons, N.Y. ; Hobbs, S. et al., McGraw Hill Yearbook of Science and Technology (1992),

 70. N. Yang, Crit. Rev. Biotechn. 12(4): 335-356 (1992)

 71. Smith GP (1985) Filamentous fusion phage: vovel expression vectors that display cloned antigens on the viron surface. Science 228: 1315

72. Gu XG, Schmitt M, Hiasa A, Nagata Y, et al (1998) A novel hydrophobized polysaccfiaride/oncoprotein complex vaccine induces in vitro and in vivo cellular and humoral immune responses against HER2-expressing murine sarcomas. Cancer Res 58:3385

 73. Okugawa T, Ikuta Y, Takahashi Y, Obata H, et al (2000) A novel human HE 2-derived peptide homologous to the mouse K(d)-restricted tumor rejection antigen can induce HLA-A24-restricted cytotoxic T lymphocytes In ovarian cancer patients and healthy individuals. Eur J Immunol 30:3338

 74. Bei R, Masuelli L, Moriconi E, Visco V, et al (1999) Immune responses to all ErbB family receptors detectable in serum of cancer patients. Oncogene 18: 1267

 75. Peiper M, Goedegebuure PS, Linehan DC, Ganguly E, et al (1997) The HER2/neu-derived peptide p654 662 is a tumor-associated antigen in human pancreatic cancer recognized by cytotoxic T lymphocytes. Eur J Immunol 27:1115

76. Disis ML, Grabstein KH, Sleath PR, Cheever MA (1999) Generation of immunity to the HER-2/neu oncogenic protein in patients with breast and ovarian cancer using a peptide-based vaccine. Clin Cancer Res 5:1289

77. Dakappagari NK, Douglas DB, Triozzi PL, Stevens VC, et al (2000)

Prevention of mammary tumors with a chimeric HER-2 B-cell polypeptide peptide vaccine. Cancer Res 60:3782

78 Minev BR, Chavez FL, Mitchell MS (1998) New trends in the development of cancer vaccines, In Vivo 12:629

 79. Lowman HB, Bass SH, Simpson N, et al (1991) Selecting high-initiative binding proteins by monovalent phage display. Biochemistry 30: 10832

 80. Cho HS, Mason K, Ramyar KX, Stanley AM, et al (2003) Structure of the extracellular region of HER2 alone and in complex with the Herceptin Fab. Nature 421 :756

Claims

Claim

1. A peptide comprising a plurality of or only one amino acid sequence represented by the following general formula (I) in a continuous or reverse direction: X9X1X2GPX3X4X5X6X7X8SHX10,

(I)

 among them,

 XI may or may not be a natural amino acid residue,

 X2 may or may not be present, being a hydrophobic amino acid residue,

 X3 is a polar amino acid,

 X4 is a polar amino acid,

 X5 is a hydrophobic amino acid,

 X6 is a polar amino acid

 X7 is a polar amino acid and can be the same or different from X4.

 X8 is a hydrophobic amino acid which may be the same as or different from X5.

 Wherein X9 and X10 are natural amino acids, which may or may not be present, and the peptide of formula (I) may be linear or cyclized.

 2. The peptide of claim 1

 Where XI may or may not exist as L, I, V, M, A, F, G, Q or N,

X2 can exist or not exist, is L, I, V, M, eight or? , G

 X3 is Y, W, F, T or S

 X4 is E or D,

 X5 is L, I, V, M, A or F

 X6 is W, Y or F,

 X7 is E or D and can be the same or different from X4.

 X8 is L, I, V, M, A or F, which can be the same or different from X5.

 X9 and X10 may or may not be present (or 8).

 3. The peptide of claim 2,

 Where XI may or may not exist as L, G or Q,

X2 may or may not exist, L or A, X3 is Y,

 X4 is E,

 X5 is L,

 X6 is W,

 X7 is E,

 X8 is L,

 X9 and X10 may or may not exist, C.

 The peptide of claim 3, wherein the amino acid sequence represented by the formula (I) is: H98 LLGPYEL WELSH (SEQ ID NO: 1)

 CIO GPYEL WELSH ( SEQ ID NO: 2 )

 MutNl-2 GAGPYEL WELSH ( SEQ ID NO: 3 )

 MutNl ^LGPYEL WELSH (SEQ ID NO: 4) or CyclicH98 CLLGPYELWELSHC (SEQ ID NO: 5).

 5. A conservative replacement mutant of the peptide of claim 4.

 6. A peptide according to any one of claims 1 to 5 which is used to induce the production of a humoral and fine-package immune response against HER-2.

 7. A peptide according to any one of claims 1 to 5 for use in the prevention and treatment of tumors.

 A pharmaceutical composition comprising the peptide according to any one of claims 1 to 5 and a pharmaceutically acceptable carrier.

 9. The pharmaceutical composition of claim 8 for use in the treatment and prevention of primary or metastatic tumors and cancers of the following organs: breast, colon, rectum, lung, oropharynx, hypopharynx, esophagus, stomach, pancreas, liver, Cholesterol, bile duct, small intestine, kidney, bladder, urinary tract epithelial cervix, uterus, ovary, choriocarcinoma, gestational trophoblastic disease, prostate, sputum, testis, thyroid, adrenal gland, pituitary angiopoiesis, melanoma, Tumors that occur from bone or soft tissue, sarcoma, Kaposi's sarcoma, brain, nerves, eyes, and meninges, from hematopoietic malignant diseases.

 The pharmaceutical composition according to claim 8 or 9, wherein the peptide of any one of claims 1 to 5 is compatible with an immunostimulating cytokine or protein, other tumor-prepared vaccine or a commonly used carrier commonly used in the art. Mix or form recombinant proteins.

1 1. The pharmaceutical composition according to claim 10, wherein the cytokine is an interleukin -2 (IL-2), interleukin-12 (11^-12), colony stimulating factor (GM-CSF), CCL2, CCL5, CCL7, OTL19, CCL2K CCL20, CX (9, CXCL10, CXCL12 CXCL15, XCL1 , FTL3L, CD40L, etc., wherein the protein is a heat shock protein, etc., wherein the commonly used vaccines mainly refer to oncogenes, mutant tumor suppressor genes, tumor-associated antigens, wherein the vector is keyhole limpet hemocyanin, serum white Protein, inactivated bacterial toxins, etc.

 The pharmaceutical composition according to claim 11, wherein the oncogene is, for example, CEA or the like, a mutant tumor suppressor gene such as p53, a tumor-associated antigen such as a melanoma-associated antigen, or the like, wherein the serum albumin may be bovine serum albumin or human. Serum albumin, etc., bacterial toxins are tetanus, diphtheria toxin or tuberculin.

 13. A pharmaceutical composition according to any one of claims 8 to 12 which is a vaccine.

 14. A nucleotide sequence encoding the peptide of any of claims 1-5, which may be present independently or in combination with a cytokine or protein encoding a booster commonly used in the art, a vaccine commonly used in other tumors or a commonly used The genes of the vector are mixed or form a recombinant nucleic acid molecule.

 15. A plasmid or viral vector comprising the nucleotide of claim 14.

 16. A cell comprising the broad granule or vector of claim 15.

 A pharmaceutical composition comprising the nucleotide of claim 14, the shield granule or viral vector of claim 15 or the cell of claim 16 and a pharmaceutically acceptable carrier.

18. The pharmaceutical composition according to claim 17, wherein the cytokines are interleukin-2 (IL-2), interleukin-12 (IL-1 ² ), colony stimulating factor (GM-CSF), CCL2, CCL5 > CCL7, CCL19, CCL21, CCL20, CXCL9, CXCL10, CXCL12, CXCL15, XCL1, FTL3L, CD40L, etc. The proteins are heat shock proteins, etc. The commonly used vaccines for cancer mainly refer to oncogenes and mutant tumor suppressor genes. , tumor-associated antigen, wherein the carrier is a keyhole limpet hemocyanin, serum albumin, inactivated bacterial toxin, and the like.

The pharmaceutical composition according to claim 18, wherein the oncogene is, for example, CEA or the like, a mutant tumor suppressor gene such as p53, a tumor-associated antigen such as a melanoma-related antigen, or the like, wherein the serum albumin may be bovine serum albumin or human. Serum albumin, etc., bacterial toxins are broken Wind, diphtheria toxin or tuberculin.

 20. A pharmaceutical composition according to any of claims 17-19 for use in inducing a humoral and fine-package immune response against HER-2.

 A pharmaceutical composition according to any one of claims 17 to 20 for use in the prevention and treatment of tumors.

22. The pharmaceutical composition according to claim 21, wherein the tumor and the cancer for prevention are breast, colon, rectum, lung, oropharynx, hypopharynx, esophagus, stomach, pancreas, liver, biliary fistula, bile duct, small intestine, kidney, bladder, Urinary tract epithelial cervix, uterus, ovary, choriocarcinoma, gestational trophoblastic disease, prostate, sputum, testis, thyroid, adrenal gland cancer or tumor, pituitary angiogenic tumor, melanoma, from bone or soft tissue Tumors of sarcoma, Kaposi's sarcoma, brain, nerves, eyes and meninges, tumors that occur from hematopoietic malignancies.

 23. A pharmaceutical composition according to any one of claims 17-22 which is a vaccine which may be a protein vaccine or a nucleotide vaccine.