WO2006050275A2 - Rapid species-specific detection of pathogens - Google Patents

Abstract

The invention provides a method for detecting the presence of a pathogen in a specimen. The method comprises contacting a lysate of the specimen with a capture probe immobilized on a substrate. The lysate can be prepared rapidly from a clinical specimen, obviating the need for specimen culture or bacterial purification prior to assay. The capture probe comprises a first oligonucleotide that specifically hybridizes with a first nucleic acid sequence of the pathogen to be detected. The lysate has been brought into contact with a detector probe that comprises a detectably labeled oligonucleotide that specifically hybridizes with a second nucleic acid sequence of the pathogen. Detection of the second detectable label complexed with the substrate is indicative of the presence of the corresponding pathogen. Variations of the method that optimize detection are described. Also provided are probes and kits for use in the method.

Description

RAPID SPECIES-SPECIFIC DETECTION OF PATHOGENS

This application claims the benefit of United States provisional patent application number 60/623,903, filed November 1, 2004, the entire contents of which are incorporated herein by reference. Throughout this application various publications are referenced. Some of these references are indicated with numerals that refer to the list of references that can be found at the end of Example 1. Additional references noted in Example 2 can be found in the list of literature cited at the end of that example. The disclosures of these publications in their entireties are hereby incorporated by reference into this application in order to describe more fully the state of the art to which this invention pertains.

This invention was made with Government support via Grant No. N66001-00-C-8092, awarded by the National Institutes of Health (NIH). The United States Government has certain rights in this invention.

TECHNICAL FIELD OF THE INVENTION

The present invention relates generally to materials and methods for rapid species- specific detection of bacterial and other pathogens in specimens.

BACKGROUND OF THE INVENTION

Urinary tract infection (UTl) is the most common urological disease in the United States and the second most common bacterial infection of any organ system. UTIs are a major cause of patient morbidity and health-care expenditure for all age groups. UTIs account for approximately 7 million office visits, more than 1 million visits to emergency departments, and approximately 100,000 hospitalizations each year. The estimated annual cost to the United States health-care system is approximately $1.6 billion. In patients who are at risk for complicated UTIs (e.g. obstructive uropathy, immunocompromised state, neurogenic bladder, congenital urinary tract anomalies, and indwelling foreign bodies), delay in diagnosis and initiation of appropriate medical intervention can lead to life threatening systemic infections or permanently reduced renal function.

The traditional basis for the identification of urinary pathogens (uropathogens) is urine culture. The major drawback of the urine culture is the time lapse of approximately 1-2 days between specimen collection and pathogen identification. In the absence of expeditious laboratory diagnosis, clinicians frequently need to decide whether to initiate empiric outpatient or inpatient antimicrobial treatment without supportive laboratory evidence. Injudicious use of antimicrobial agents contributes to the incidence of adverse drug reactions and the emergence of antibiotic resistant pathogens. Urine specimens are the most common type of body fluid submitted for culture to clinical microbiology laboratories. Significant resources at these clinical laboratories are devoted to the time- consuming processing of urine specimens, although the majority of these specimens are negative or yield insignificant quantities of bacteria. A rapid test that could identify the uropathogens, or confirm the presence or absence of clinically significant bacteria with high sensitivity and specificity, would significantly reduce the workload of clinical microbiology laboratories.

The time-consuming and labor-intensive aspects of urine culture have led to expanding interest in developing rapid tests to diagnose UTIs. The most common screening test currently in use is chemical dipstick analysis and urine microscopy. While relatively sensitive when used in combination, these tests lack specificity and do not reveal the identity of the uropathogen. Other rapid screening tests have been developed, but have not achieved wide clinical application.

Molecular biological techniques based on DNA hybridization are increasingly utilized in clinical diagnostic testing, and are especially useful in the identification of infectious agents that cannot be cultured. Hybridization of oligonucleotides to the unique molecular sequence of an organism's DNA or RNA is highly sensitive for pathogen-specific identification, surpassing culturing methods that depend on morphological and biochemical characteristics. More rapid real-time polymerase chain reaction (PCR) quantification involving amplification of target DNA or RNA currently requires technically demanding specimen processing procedures. Despite the inherent advantages of molecular diagnostic approaches, this issue has thus far precluded widespread application of molecular techniques in clinical diagnostics.

Recent advances in sensors and actuators based on microfabrication and bionanotechnology have led to an intense interest in their development for biomedical applications. Microscale devices are particularly compatible to detect and manipulate biological molecules of interest, such as nucleic acids and proteins, with nanoscale precision. As an example of micro-devices well-suited for clinical diagnostic testing, electrochemical sensors offer sensitivity, selectivity, portability and relative low cost for nucleic acids detection. The basic electrochemical sensor design is comprised of a nucleic acid layer coupled with electrochemical transducers to detect sequence-specific hybridization events.

There remains a need for improved tools to permit the rapid and species-specific detection of pathogens. In particular, there is a need for probes capable of detecting and distinguishing the various bacterial pathogens, as well as more rapid methods to obtain assay results needed to guide effective treatment.

SUMMARY OF THE INVENTION

The invention disclosed herein addresses these needs and others by providing methods and materials for rapid, species-specific detection of pathogens. The invention provides oligonucleotide probes that can be used separately or in combination for the detection and distinction of bacterial pathogens commonly found in urological and other patient specimens. In addition, the invention provides methods for using such probes to rapidly assay for pathogens. The invention provides a universal lysis buffer that enables lysis of both gram-negative and gram-positive bacteria, and permits immediate assay of lysed specimens (e.g., urine) without requiring a bacterial purification step, further accelerating the assay. The invention provides a method for detecting the presence of a pathogen in a specimen. In one embodiment, the method comprises contacting a lysate of the specimen with a capture probe immobilized on a substrate. The capture probe comprises a first oligonucleotide that specifically hybridizes with a first nucleic acid sequence of the pathogen to be detected. The lysate has been brought into contact -with a detector probe that comprises a detectably labeled oligonucleotide that specifically hybridizes with a second nucleic acid sequence of the pathogen. The lysate can be brought into contact with the detector probe simultaneously with, prior to, or subsequent to, the contacting of the lysate with the capture probe. Detection of the second detectable label complexed with the substrate is indicative of the presence of the corresponding pathogen.

In one embodiment, the first and second nucleic acid sequences of the pathogen are adjacent to each other, such that no gap remains between the capture probe and the detector probe upon hybridization with the target nucleic acid sequences of the pathogen. In another embodiment, a gap between the first and second nucleic acid sequences is not greater than about 6 base pairs.

The lysate can be prepared by contacting the specimen with a universal lysis buffer capable of lysing both gram-negative and gram-positive bacteria. A representative universal lysis buffer contains Triton X-100, KH₂PO₄, EDTA and lysozyme. Alternatively, the lysate can be prepared by contacting the specimen with a first lysis buffer comprising a non-denaturing detergent (e.g., Triton X-IOO) and lysozyme, or a second lysis buffer comprising NaOH. In another embodiment, the lysing comprises contacting the specimen with both buffers in series, e.g. with the second lysis buffer, either before or after contacting the specimen with the first lysis buffer. The contacting of the specimen with the buffer(s) typically occurs at room temperature. Typically, the specimen is in contact with the lysis buffer for a total of about 10 minutes. Where a first and second lysis buffer is used, the contact with each buffer is typically about 5 minutes. Those skilled in the art are aware that the time and temperature under which the contact with lysis buffer occurs can be varied (e.g. higher temperatures will accelerate the lysis) and also optimized for a particular specimen, target pathogen, and other assay conditions. The oligonucleotide probes are typically less than 60 base pairs in length, preferably 10- 50 base pairs in length, and in most embodiments, the oligonucleotide probes are 20-40 base pairs in length. In one embodiment, the probe is about 40 base pairs in length.

The detectable labels for use with the invention can be selected from many such labels known in die art. In one embodiment, the label comprises a reporter enzyme, such as horseradish peroxidase (HRP). In another embodiment, the HRP is conjugated to an antibody or other binding partner and serves as a secondary label that binds to a primary label on the detector probe. In one example, the primary label on the detector probe is fluorescein and the secondary label is HRP conjugated to an anti-fluorescein antibody. The detectable label can be at the 3' and/ or 5' end of the detector probe. In some embodiments, the detectable label is at the 3' end of the detector probe.

The pathogen is typically a microorganism that can be found in bodily fluids. In one embodiment, the pathogen is a uropathogen. Uropathogens include bacterial and fungal pathogens. In one embodiment, the pathogen is a bacterial pathogen, such as Escherichia coli, Proteus mirabilis, Pseudomonas aeruginosa, Enterococcus spp., Klebsiella pneumoniae, - Enterobacter aerogenes, Enterobacter clocae.

The specimen can be any specimen believed to contain or suspected of containing a pathogen, such as a bodily fluid. Representative bodily fluids include blood and blood products, saliva, semen, prostatic secretions, cerebrospinal fluids and urine. Typically, for the detection of uropathogens, the specimen is urine.

The invention additionally provides an assay kit for use in carrying out the method of the invention. The kit comprises one or more of the probes described herein, and, optionally, a container or substrate therefor. In one embodiment, the kit comprises a substrate to which one or more capture probes of the invention are bound or otherwise immobilized. Optionally, the kit further comprises a container and one or more detector probes corresponding to the capture probes. In one embodiment, the substrate is an electrochemical sensor array. BRIEF DESCRIPTION OF THE FIGURES

FIG. 1A-1D. Components and performance of the electrochemical sensor. (A) The 16- sensor array (2.5 x 7.5 cm) was microfabricated with a thin, optical-grade layer of gold electrodes deposited on plastic (GeneFluidics Inc., Monterey Park, CA). Each sensor in the array contained three electrodes: a central working electrode, a circumferential reference electrode, and a short auxiliary electrode. (B) The chip mounter with contact pins for simultaneous reading of the current output from each of the sensors in the array. (C) Detection strategy: 1. Bacterial lysis to release 16s rRNA target (dashed line); 2. Hybridization of the target with the fluorescein— labeled detector probe; 3. Hybridization of the target with the biotin— labeled capture probe; 4. Binding of anti-fiuorescein antibody conjugated with horseradish peroxidase (HRP) to the target-probe sandwich; and 5. Generation of current by transfer of electrons to the electron transfer mediator, TMB. (D) Current output in an experiment involving a clinical urine specimen containing K. pneumoniae showing signal stabilization from all 16 sensors in the array within 60 seconds.

FIG. 2. Specificity of Entmbacteriaceae-speά&c probe pair. Positive signals were seen for all Enterobacteriaceae spp. tested but not for Gram-positive uropathogens (Eo, Ef, Ss, Sa) or P. aeruginosa (Pa). See footnote of Table 2 (Example 1, below) for bacterial species abbreviations. Mean and standard deviation of experiments performed in duplicate are shown. NC refers to the negative control experiments performed with capture and detector probes but without bacterial lysate.

FIG. 3A-3B. Direct, species-specific detection of uropathogens in representative clinical urine specimens using the electrochemical sensor array. Current output for each of the probe pairs in the array are shown in nanoamperes. The mean current output of duplicate sensors is shown above each bar, error bars represent the standard deviation. The probe pair designation is shown below each bar, their species-specificity is given in Table 2. The urinalysis and microbiological characteristics of each specimen are shown to the right of the bar graph. Background signal level was determined by averaging the log₁₀ results of the NC sensors and the sensors with the four lowest species-specific probe pairs (from among EC, PM, KE, PA, and EF). As described in the text, significant signals were 0.30 log units (5 standard deviations) above background. (A) E. coliva. this clinical urine specimen produced significant signals in the UNI, EB, and EC sensors despite high numbers of white blood cells (WBCs). (B) 16S rRNA from as few as 4 x 10⁴ K. pneumoniae / 'ml in urine produced significant signal levels in the UNI, EB, and KE sensors.

FIG. 4. ¹UTI Chip' Signal Interpretation Algorithm. The three-step algorithm used to interpret the results of electrochemical sensor experiments on 78 specimens that met inclusion criteria are shown. Positive signals were those with a mean log of greater than 0.30 log units (5 standard deviations) over background. "UNI" and "EB" are eubacterial and

probe signals, respectively. "Bkgnd" is the background signal, as defined in the text of Example 1. "MaxSpSp" refers to the maximum species- specific signal. Clinical microbiology results are given in shaded boxes. Two-letter species abbreviations are given in the footnote of Table 2 (Example 1). NSG indicates "No Significant Growth". NG indicates "No Growth". Correct results are in black letters (darkest font), false-positive results are in medium dark letters (1 Sm; 2 NG), false- negative results are in red letters (gray font).

FIG. 5. Model of the electrochemical redox reporter complex. Components of the complex include the horseradish peroxidase (HRP)-Fab conjugate bound to the fluorescein (3' small circle)-modified detector probe (5' small circle). The fluorescein- modified detector probe and rRNA target (dashed line) are anchored to the sensor surface by the biotin-modified capture probe. The relative sizes of the electrochemical redox reporter complex components are provided indicating that the fluorescein of a 3'- modified detector probe would be ≤ 258A from the sensor surface. In contrast, the fluorescein of a 5'-modified detector probe would be ≤ 143A from the sensor surface, indicating a role for steric hindrance to binding of the FIRP-Fab conjugate to fluorescein at the 5' position of the detector probe. FIG. 6. The effect of lysis conditions on electrochemical signal intensity. Εnterococcus organisms were treated with various lysis methods followed by direct electrochemical detection of 16S rRNA in the crude bacterial lysates. Under each condition, 10⁵ Εnterococcus cells were treated at room temperature for a total of 10 min. The lysis methods are: 1) NaOH for 10 min; 2) Triton X-IOO for 5 min, then NaOH for 5 min; 3) Triton X-IOO with lysozyme for 10 min; 4) NaOH for 5 min, then Triton X-IOO with lysozyme for 5 min; 5) Triton X-IOO with lysozyme for 5 min, then NaOH for 5 min. Background current output was measured using negative control (NC) sensors to which no cell lysates were applied. Current output was measured in duplicate for each lysis condition. Signal output was measured in nano-amperes (nA).

FIG. 7. The effect of oligonucleotide length on electrochemical signal intensity. Single stranded oligonucleotides ('Test Probes') ranging from 20-60 bps in length modified at the 5'- and 3'-ends with biotin and fluorescein, respectively, were tested to examine the effect of probe length on signal intensity. Hybridization was not required in these experiments because, as shown in the inset, the double-labeled probes served as a bridge between fluorescein and biotin on the electrochemical sensor surface. The highest signal output was obtained using the 40 bp probe, yielding a lower limit of detection at a concentration of 10 pM. Background current output was measured using negative control (NC) sensors to which no cell lysates were applied. Signal output was measured in nano-amperes (nA). Asterisks indicate lower limits of detection that differ significantly from background (two-tailed t test for paired samples, P < .05).

FIG. 8A-8B. Effects of gap between the probe hybridization sites on signal intensity, probe configuration, and probe modification on signal intensity. In Fig. 8A, same capture probe was paired with different detector probes to examine the effects of removing the short sequence gap between the probe hybridization sites and location of fluorescein modification (5' or 3'). In each experiment, Enterococcm cells were lysed by sequential treatment with the combination of Triton X-IOO and lysozyme followed by NaOH. Fig. 8B shows the results from 5-fold serial dilutions of Enterococcus cells using the detector and capture configuration which confer the highest signal (Fig. 8A, bar 4) and the 'original' EF detector probe (Figure 8A, bar 1). The combination of no gap between the probe hybridization sites and 3' fluorescein modification resulted in 25-fold improvement in the lower limit of detection (7.5 x 10³ versus 1.9 x 10⁵ bacteria) compared to the background. Background current output was measured using negative control (NC) sensors to which no cell lysates were applied. Signal output was measured in nano-amperes (nA). Asterisks denote the lower limits of detection that differ significantly from background (two-tailed t test for paired samples, P < .05).

FIG. 9. Effects of hybridization with a mixture of two detector probes on electrochemical sensor specificity. Detector probes specific for Enterococcus or Escherichia coli 16S rRNA were examined alone and in combination using electrochemical sensors functionalized with an Enterococcus-sτρ&όB.c capture probe. There was no significant decrease in signal intensity for detection of Enterococcus rRNA when hybridization was performed with a mixture of Enterococcus- and E. «>/z-specific detector probes. There was no increase in nonspecific detection of E. coli rRNA for hybridization with a mixture of detector probes. Similar results were obtained with other 2-, 3-, and 5-detector probe mixtures. Background current output was measured using negative control (NC) sensors to which no cell lysates were applied. Signal output was measured in nano-amperes (nA).

FIG. 10. Effects of hybridization with a mixture of seven detector probes on electrochemical sensor specificity. A single electrochemical sensor array immobilized with 7 different capture probes is shown schematically in the inset. 10⁶ Enterococcus cells were lysed and released rRNA hybridized with a mixture of seven different detector probes before application on the sensor array. Background current output was measured using negative control (NC) sensors to which no cell lysates were applied. Signal output was measured in nano-amperes (nA). The results demonstrate species-specific detection of Enterococcus using a mixture of seven detector probes. Asterisks indicate results that differ significantly from background (two-tailed t test for paired samples, P < .05). DETAILED DESCRIPTION OF THE INVENTION

The present invention is based on the discovery and development of materials and methods for a rapid detection assay that permits species-specific detection of pathogens in clinical specimens. The invention provides an electrochemical sensor array and oligonucleotide probes specific for clinically relevant pathogen species as well as methods for rapid and efficient use of same.

Definitions

All scientific and technical terms used in this application have meanings commonly used in the art unless otherwise specified. As used in this application, the following words or phrases have the meanings specified.

As used herein, an "oligonucleotide probe" is an oligonucleotide having a nucleotide sequence sufficiently complementary to its target nucleic acid sequence to be able to form a detectable hybrid probe:target duplex under high stringency hybridization conditions. An oligonucleotide probe is an isolated chemical species and may include additional nucleotides outside of the targeted region as long as such nucleotides do not prevent hybridization under high stringency hybridization conditions. Non- complementary sequences, such as promoter sequences, restriction endonuclease recognition sites, or sequences that confer a desired secondary or tertiary structure such as a catalytic active site can be used to facilitate detection using the invented probes. An oligonucleotide probe optionally may be labeled with a detectable marker such as a radioisotope, a fluorescent moiety, a chemiluminescent moiety, an enzyme or a ligand, which can be used to detect or confirm probe hybridization to its target sequence. "Probe specificity" refers to the ability of a probe to distinguish between target and non- target sequences.

The term "nucleic acid", "oligonucleotide" or "polynucleotide" refers to a deoxyribo- nucleotide or ribonucleotide polymer in either single- or double-stranded form, and unless otherwise limited, encompasses known analogs of natural nucleotides that hybridize to nucleic acids in a manner similar to naturally-occurring nucleotides.

As used herein, a "detectable marker" or "label" is a molecule attached to, or synthesized as part of a nucleic acid probe. This molecule should be uniquely detectable and will allow the probe to be detected as a result. These detectable moieties are often radioisotopes, chemiluminescent molecules, enzymes, haptens, or even unique oligonucleotide sequences.

As used herein, a "hybrid" or a "duplex" is a complex formed between two single- stranded nucleic acid sequences by Watson-Crick base pairings or non-canonical base pairings between the complementary bases.

As used herein, "hybridization" is the process by which two complementary strands of nucleic acid combine to form a double-stranded structure ("hybrid" or "duplex"). "Stringency" is used to describe the temperature and solvent composition existing during hybridization and the subsequent processing steps. Under high stringency conditions only highly complementary nucleic acid hybrids will form; hybrids without a sufficient degree of complementarity will not form. Accordingly, the stringency of the assay conditions determines the amount of complementarity needed between two nucleic acid strands forming a hybrid. Stringency conditions are chosen to maximize the difference in stability between the hybrid formed with the target and the non-target nucleic acid. Exemplary stringency conditions are described hereinbelow.

As used herein, "complementarity" is a property conferred by the base sequence of a single strand of DNA or RNA which may form a hybrid or double-stranded DNA:DNA, RNA:RNA or DNA:RNA through hydrogen bonding between Watson-Crick base pairs on the respective strands. Adenine (A) ordinarily complements thymine (T) or Uracil (U), while guanine (G) ordinarily complements cytosine (C).

As used herein, "adjacent", in the context of nucleotide sequences and oligonucleotides, means immediately next to one another (end to end), such that two adjacent molecules do not overlap with one another and there is no gap between them. For example, two oligonucleotide probes hybridized to adjacent regions of a target nucleic acid molecule have no nucleotides of the target sequence (unpaired with either of the two probes) between them.

As used herein, the phrases "consist essentially of or "consisting essentially of mean that the oligonucleotide has a nucleotide sequence substantially similar to a specified nucleotide sequence. Any additions or deletions are non-material variations of the specified nucleotide sequence which do not prevent the oligonucleotide from having its claimed property, such as being able to preferentially hybridize under high stringency hybridization conditions to its target nucleic acid over non-target nucleic acids.

One skilled in the art will understand that substantially corresponding probes of the invention can vary from the referred-to sequence and still hybridize to the same target nucleic acid sequence. This variation from the nucleic acid may be stated in terms of a percentage of identical bases within the sequence or the percentage of perfectly complementary bases between the probe and its target sequence. Probes of the present invention substantially correspond to a nucleic acid sequence if these percentages are from 100% to 80% or from 0 base mismatches in a 10 nucleotide target sequence to 2 bases mismatched in a 10 nucleotide target sequence. In preferred embodiments, the percentage is from 100% to 85%. In more preferred embodiments, this percentage is from 90% to 100%; in other preferred embodiments, this percentage is from 95% to 100%.

By "sufficiently complementary" or "substantially complementary" is meant nucleic acids having a sufficient amount of contiguous complementary nucleotides to form, under high stringency hybridization conditions, a hybrid that is stable for detection.

By "preferentially hybridize" is meant that, under high stringency hybridization conditions, oligonucleotide probes can hybridize with their target nucleic acids to form stable probe:target hybrids (thereby indicating the presence of the target nucleic acids) without forming stable probe:non-target hybrids (that would indicate the presence of non-target nucleic acids from other organisms). Thus, the probe hybridizes to target nucleic acid to a sufficiently greater extent than to non-target nucleic acid to enable one skilled in the art to accurately detect the presence of E. coli, P. mirabilis, P. aeruginosa, Enterococcus spp., the Klebsiella-Enterobacter group, and the Enterobacteriaceae group and distinguish their presence from that of other organisms. Preferential hybridization can be measured using techniques known in the art and described herein.

As used herein, a "target nucleic acid sequence region" of a pathogen refers to a nucleic acid sequence present in the nucleic acid of an organism or a sequence complementary thereto, which is not present in the nucleic acids of other species. Nucleic acids having nucleotide sequences complementary to a target sequence may be generated by target amplification techniques such as polymerase chain reaction (PCR) or transcription mediated amplification.

As used herein, "room temperature" means about 20-25⁰C.

As used herein, "a" or "an" means at least one, unless clearly indicated otherwise.

Probes of the Invention

The invention provides oligonucleotide probes that are specific for E. coli, P. mirabilis, P. aeruginosa, Enterococcus spp., the K ^" lebsiella-Enterobacter group, and the Enterobacteήaceae group, as well as a universal bacterial detection probe. Direct detection of pathogens using these probes has been demonstrated in both inoculated urine and clinical urine samples from symptomatic patients. The probes include capture probes and detector probes, described in greater detail below. Additional probes are listed in Table 5, in Example 2.

TABLE 1. Sequences of the capture and detector probe pairs used with the electrochemical sensor array. The capture and detector probes are chemically modified at the 5' end with biotin and fluorescein, respectively. The sequence position is with respect to the E. coli 16S rRNA. Probe Position¹ (length) Sequence (5'-3')

Escherichia coli (EC) Capture 449 (35mer)

GTCAATGAGCAAAGGTATTAACTTTACTCCCTTCC (SEQ ID NO: 1) Detector 408 (35mer)

CTGAAAGTACTTTACAACCCGAAGGCCTTCTTCAT (SEQ ID NO: 2)

Proteus mirabilis (PM) Capture 202 (35mer)

GGGTTCATCCGATAGTGCAAGGTCCGAAGAGCCCC (SEQ ID NO: 3) Detector 162 (35mer)

GGTCCGTAGACATTATGCGGTATTAGCCACCGTTT (SEQ ID NO: 4)

Klebsiella & Etitewbacter spp. (KE) Capture 449 (35mer)

GTCAATCGMCRAGGTTATTAACCTYAHCGCCTTCC (SEQ ID NO:5) Detector 408 (35mer)

CTGAAAGTGCTTTACAACCCGAAGGCCTTCTTCAT (SEQ ID NO: 6)

Vsendomonas aeruginosa (PA) Capture 111 (35mer)

CCCACTTTCTCCCTCAGGACGTATGCGGTATTAGC (SEQ ID NO: 7) Detector 70 (35mer)

TTCCGGACGTTATCCCCCACTACCAGGCAGATTCC (SEQ ID NO: 8)

Enterococcus spp. (EF) Capture 207 (35mer)

TTGGTGAGCCGTTACCTCACCAACTAGCTAATGCA (SEQ ID NO: 9) Detector 165 (35mer)

GTCCATCCATCAGCGACACCCGAAAGCGCCTTTCA (SEQ ID NO: 10)

Enterobacteriaceae (EB) Capture 1241 (35mer)

CGGACTACGACATACTTTATGAGGTCCGCTTGCTC (SEQ ID NO: 11) Detector 1137 (35mer)

GAGGTCGCTTCTCTTTGTATATGCCATTGTAGCAC (SEQ ID NO: 12)

Universal Bacterial (UNI) Capture 797 (27mer)

CATCGTTTACGGCGTGGACTACCAGGG (SEQ ID NO:13) Detector 766 (31mer)

TATCTAATCCTGTTTGCTCCCCACGCTTTCG (SEQ ID NO: 14)

^Position of the 5' nucleotide in alignment with the E. coli 16S rRNA molecule. Oligonucleotides may be prepared using any of a variety of techniques known in the art. Oligonucleotide probes of the invention include the sequences shown in Table 1, Table 5, and equivalent sequences that exhibit essentially the same ability to form a detectable hybrid probe:target duplex under high stringency hybridization conditions. Oligonucleotide probes typically range in size from 10 to 100 nucleotides in length. Preferred probes are 20-60 nucleotides in length, with 20-40 nucleotides being optimal for some conditions, as illustrated in the Examples below. A variety of detectable labels are known in the art, including but not limited to, enzymatic, fluorescent, and radioisotope labels.

As used herein, "highly stringent conditions" or "high stringency conditions" are those that: (1) employ low ionic strength and high temperature for washing, for example 0.015 M sodium chloride/0.0015 M sodium citrate/0.1% sodium dodecyl sulfate at 50⁰C; (2) employ during hybridization a denaturing agent, such as formamide, for example, 50% (v/v) formamide with 0.1% bovine serum albumin/0.1% Ficoll/0.1% polyvinylpyrrolidone/50mM sodium phosphate buffer at pH 6.5 with 75O mM sodium chloride, 75 mM sodium citrate at 42⁰C; or (3) employ 50% formamide, 5 x SSC (0.75 M NaCl, 0.075 M sodium citrate), 50 mM sodium phosphate (pH 6.8), 0.1% sodium pyrophosphate, 5 x Denhardt's solution, sonicated salmon sperm DNA (50 μg/ml), 0.1% SDS, and 10% dextran sulfate at 42°C, with washes at 42°C in 0.2 x SSC (sodium chloride/sodium citrate) and 50% formamide at 55⁰C, followed by a high-stringency wash consisting of 0.1 x SSC containing EDTA at 55⁰C. The skilled artisan will recognize how to adjust the temperature, ionic strength, etc. as necessary to accommodate factors such as probe length and the like.

Suitable "moderately stringent conditions" include prewashing in a solution of 5 X SSC, 0.5% SDS, 1.0 mM EDTA (pH 8.0); hybridizing at 50°C-65°C, 5 X SSC, overnight; followed by washing twice at 65°C for 20 minutes with each of 2X, 0.5X and 0.2X SSC containing 0.1 % SDS. Any polynucleotide may be further modified to increase stability. Possible modifications include, but are not limited to, the addition of flanking sequences at the 5' and/or 3' ends; the use of phosphorothioate or 2' O-methyl rather than phosphodiesterase linkages in the backbone; and/ or the inclusion of nontraditional bases such as inosine, queosine and wybutosine, as well as acetyl- methyl-, thio- and other modified forms of adenine, cytidine, guanine, thymine and uridine.

Nucleotide sequences can be joined to a variety of other nucleotide sequences using established recombinant DNA techniques. For example, a polynucleotide may be cloned into any of a variety of cloning vectors, including plasmids, phagemids, lambda phage derivatives and cosmids. Vectors of particular interest include probe generation vectors. In general, a vector will contain an origin of replication functional in at least one organism, convenient restriction endonuclease sites and one or more selectable markers. Other elements will depend upon the desired use, and will be apparent to those of ordinary skill in the art.

Methods of the Invention

The invention provides a method for species-specific detection of pathogens in clinical and other specimens. The pathogens to be detected include those which infect human or animal subjects. Representative pathogens for detection include bacterial pathogens, such as those listed in Tables 1 and 5, and those responsible for fungal infection in body fluids (e.g., Candida albicans and Candida glabratά), as well as others known to those skilled in the art. The method generally comprises contacting one or more probes of the invention with a specimen. For example, one can perform the method using one, two, three, four, five, six or all of the probes described herein, and/ or using one or more of these probes in combination with other probes known in the art. The method can be carried out quickly, with a minimum of specimen preparation prior to assay. In one embodiment, the specimen is lysed with a lysis buffer prior to contact with the probes of the invention. The lysis buffer is sufficient to release nucleic acid molecules from the pathogen to be detected, such that the target regions of the nucleic acid molecules of the pathogen are able to hybridize with the probes. Those skilled in the art will appreciate that the lysis buffer(s) can be selected in accordance with the target pathogen(s).

In one embodiment, the method is performed using an electrochemical sensor. One example of an electrochemical sensor suitable for use with the invention is described in the U.S. patent application assigned publication number 20020123048. The sensor array can be an integral component of a point-of-care system for molecular detection of pathogens in body fluids. Those skilled in the art will appreciate the ease with which the particular method described in detail herein can be adapted for use with other materials, such as an automated sample preparation cartridge or optical sensors, as well as other conventional detection methods, employing the probes described herein.

In one embodiment, the method comprises contacting a lysate of the specimen with a capture probe immobilized on a substrate. The capture probe comprises a first oligonucleotide that specifically hybridizes with a first nucleic acid sequence of the pathogen to be detected. The lysate has been brought into contact with a detector probe that comprises a detectably labeled oligonucleotide that specifically hybridizes with a second nucleic acid sequence of the pathogen. The lysate can be brought into contact with the detector probe simultaneously with, prior to, or subsequent to, the contacting of the lysate with the capture probe. Detection of the second detectable label complexed with the substrate is indicative of the presence of the corresponding pathogen.

In one embodiment, the first and second nucleic acid sequences of the pathogen are adjacent to each other, such that no gap remains between the capture probe and the detector probe upon hybridization with the target nucleic acid sequences of the pathogen. In another embodiment, a gap between the first and second nucleic acid sequences is not greater than about 6 base pairs. As discussed in the examples below, an improved signal is observed with probes directed to adjacent regions of the target nucleic acid sequence. This observation is surprising, given the teaching in the art that a gap between sequences is necessary to avoid steric hindrance due to the presence of modifications in the probes (e.g., biotin and fluorescein) in such systems. Bacteria contained within the specimen can be lysed using one of the lysis preparations described herein. In one embodiment, the lysis preparation comprises the universal lysis buffer containing 1% Triton X-IOO, 0.1 M KH₂PO₄, 2 niM EDTA and 1 mg/ml lysozyme. Use of the universal lysis buffer obviates the need to use separate lysis buffer for gram-positive and gram-negative bacteria. In this embodiment, the time-consuming steps of bacterial RNA and/ or DNA purification are not necessary, permitting direct application of a lysed urine sample to the capture probes, improving speed and efficiency of the assay. Accordingly, the method can be performed by first lysing a specimen of interest to release nucleic acid molecules of the pathogen.

Alternatively, the lysate can be prepared by contacting the specimen with a first lysis buffer comprising a non-denaturing detergent (e.g., Triton X-IOO) and lysozyme, or a second lysis buffer comprising NaOH. Typically, the Triton X-IOO is used at 0.1%, lysozyme at 1 mg/ml, and NaOH at IM. In another embodiment, the lysing comprises contacting the specimen with both buffets in series, e.g. with the second lysis buffer, either before or after contacting the specimen with the first lysis buffer. The contacting of the specimen with the buffer(s) typically occurs at room temperature. Typically, the specimen is in contact with the lysis buffer for a total of about 10 minutes. Where a first and second lysis buffer is used, the contact with each buffer is typically about 5 minutes. Those skilled in the art are aware that the time and temperature under which the contact with lysis buffer occurs can be varied (e.g. higher temperatures will accelerate the lysis) and also optimized for a particular specimen, target pathogen and other assay conditions.

The method comprises contacting a specimen with one or more detector probes of the invention under conditions permitting hybridization of target nucleic acid molecules of pathogens (e.g., bacteria) present in the specimen with the detector probes, resulting in hybridized target nucleic acid molecules. One or more hybridized target probes are brought into contact with one or more capture probes, under conditions permitting hybridization of capture probes with target nucleic acid molecules. Accordingly, the target nucleic acid ultimately hybridizes with both capture probe(s) and detector probe(s). Although these two hybridization steps can be performed in any order, in one embodiment, detector probe hybridizes with the target nucleic acid first, after which the hybridized material is brought into contact with an immobilized capture probe. Following a wash, the dectectortargetcapture combination is immobilized on a surface to which the capture probe has been bound. Detection of probe bound to target nucleic acid is indicative of presence of pathogen.

For use with an electrochemical sensor, such as the sensor array available from GeneFluidics, Inc. (Monterey Park, CA), the method comprises detection of current associated with binding of probe to target. In one embodiment illustrated in the example below, the capture probe is labeled with biotin and immobilized onto a surface treated with streptavidiα. The detector probe in this example is tagged with fluorescein, providing an antigen to which a horse radish peroxidase-labeled antibody binds. This peroxidase, in the presence of its substrate (typically, hydrogen peroxide and tetramethylbenzidine), catalyzes a well-characterized redox reaction and generates a measurable electroreduction current under a fixed voltage potential, thereby providing an electrochemical signal to detect presence of the target nucleic acid. Those skilled in the art are aware of alternative labels and enzymes that can be used in an electrochemical assay.

Kits

For use in the diagnostic applications described herein, kits are also within the scope of the invention. Such kits can comprise a carrier, package or container that is compartmentalized to receive one or more containers such as vials, tubes, and the like, each of the container(s) comprising one of the separate elements to be used in the method. For example, the containers) can comprise a probe that is or can be detectably labeled. The kit can also include a container comprising a reporter-means, such as a biotin-binding protein, e.g., avidin or streptavidin, bound to a detectable label, e.g., an enzymatic, fluorescent, or radioisotope label. In one embodiment, the kit comprises a container and one or more detector probes disclosed herein.

The kit of the invention will typically comprise the container described above and one or more other containers comprising materials desirable from a commercial and user standpoint, including buffers, diluents, filters, needles, syringes, and package inserts with instructions for use. In addition, a label can be provided on the container to indicate that the composition is used for a specific application, and can also indicate directions for use. Directions and or other information can also be included on an insert which is included with the kit

In one embodiment, the kit further comprises a substrate to which one or more capture probes are immobilized. In one embodiment, the substrate comprises an electrochemical sensor array. Capture probes specific for different species of bacteria can be positioned on different sensors of the array. One example of an assay kit comprises all the materials to be used in performance of the assay with the exception of the specimen or sample to be assayed. A typical assay kit comprises an electrochemical sensor array to which a plurality of capture probes have been immobilized and a plurality of corresponding detector probes. In one embodiment, the plurality of probes includes probes specific for each of the bacterial pathogens disclosed herein. Optionally, the kit includes one or more control probes and/or a universal probe.

EXAMPLES

The following examples are presented to illustrate the present invention and to assist one of ordinary skill in making and using the same. The examples are not intended in any way to otherwise limit the scope of the invention.

Example 1: Rapid Species-Specific Detection of Uropathogens Using an Electrochemical Sensor Array

This example demonstrates species-specific detection of bacterial pathogens in clinical specimens using an electrochemical sensor. The sensor array can be an integral component of a point-of-care system for molecular detection of pathogens in body fluids.

Uropathogen isolates and clinical utine specimens. Uropathogen isolates and clinical urine specimens were obtained from the UCLA Clinical Microbiology Laboratory with approval from the UCLA Institutional Review Board and appropriate Health

Insurance Portability and Accountability Act exemption. Isolates were received in vials containing Brucella broth with 15% glycerol (BBL, Maryland) and were stored at -70°C. Overnight bacteria cultures were freshly inoculated into Luria Broth (LB) grown to logarithmic phase as measured by OD₆₀₀. Concentrations in the logarithmic phase specimens were determined by serial plating, typically yielding 10⁷-10⁸ bacteria/ml. The uropathogens grown in LB were stored as frozen pellets at — 70⁰C until time of experimentation. Appropriate dilutions were made when determining the target specificity of the probes such that the different uropathogen numbers were within one order of magnitude of each other.

Probe design. Species- and group-specific capture and detector probe pairs were designed using a bioinformatics-based approach that compared 16S rDNA sequences obtained from the NCBI database (Bethesda, MD) and from uropathogen isolates with estimated hybridization accessibility of 16S rRNA target sequences (14). In addition to species- and group-specific probe pairs, a universal probe pair was designed to hybridize with all bacterial 16S rDNA sequences. Both capture and detector probes were 27-35 bps in length, their hybridization sites typically separated by a gap of 6 bps. Capture and detector probes were synthesized with 5' biotin and 5' fluorescein modifications, respectively (MWG, High Point, NC).

Electrochemical sensor array. Electrochemical sensor arrays were provided by GeneFluidics (Monterey Park, CA). As shown in Figure IA, each sensor in the 16-sensor array consists of a central working electrode, surrounded by a reference electrode and an auxiliary electrode. The single layer electrode design populated with alkanethiolate self- assembled monolayer (SAM) surface modifications was described previously (16) with modifications in the electrode configuration and fabrication process. Sensor arrays used in the current study were batch fabricated by deposition of a 50 ntn gold layer onto a plastic substrate. 40 μl of 0.1 KiMK₃Fe(CN)₆ (potassium hexacyanoferrate, Sigma, St. Louis, MO) was applied to each sensor and cyclic voltammetry (CV) (3) was performed using a chip mounter (Figure IB) and a 16-channel potentiostat (GeneFluidics), as a quality control measure to characterize the alkanethiolate SAM on the sensor surface. Sensors found to have peak CV currents >100 nA were rejected to avoid sensors with incomplete SAM insulation, which would result in excessive background noise during amperometric measurement. This and each of the subsequent steps was followed by washing with a stream of deionized (DI) H₂O applied to the sensor surface for approximately 2-3 sec and drying for 5 sec under a stream of nitrogen. The carboxyl termini of the SAM alkanethiols were activated and functionalized as previously described (17). In brief, each working electrode was incubated with 2.5 μl of NHS /EDC (100 mM JV-hydroxysuccinimide, 400 mM JV-3-dimethylaminopropyl-N- ethylcarbodiimide) for 10 min. Activated sensors were incubated in biotin (5 mg/ml in 50 mM sodium acetate) (Pierce, Rockford, IL) for 10 min. Biotinylated sensors were incubated in 4 μl of 0.5 U/ml of streptavidin in RNase-free H₂O (Cat. No. 821739, MP Biomedicals, Aurora, OH) for 10 min. Stteptavidin-coated sensors were incubated with biotinylated capture probes (4 μl, 1 μM in 1 M phosphate buffer, pH 7.4) for 30 min.

Amperometric detection of bacterial 16S rRNA. An overview of the electrochemical sensor detection strategy is presented in panel C of Figure 1. One ml of bacteria in Luria broth, inoculated clean urine, or clinical urine samples was centrifuged at 10,000 xg for 5 min. The supernatant was discarded and the bacteria were lysed by resuspension of the pellet in 10 μl of 1 M NaOH and incubation at room temperature for 5 min. In some experiments, addition of IM NaOH was preceded by resuspension of the bacterial pellet in 10 μl of 0.1% Triton X-IOO, 2 mM EDTA, and 1 mg/ml lysozyme (Sigma) in 2OmM Tris-HCl, pH 8.0, and incubation at room temperature for 5 min. 50 μl of the detector probe (0.25 μM) in 2.5% bovine serum albumin (Sigma, St. Louis, MO) 1 M phosphate buffer, pH 7.4, were added to the bacterial lysate and incubated for 10 min at 65°C to allow target-probe hybridization. 4 μl of the bacterial lysate/detector probe mixture was deposited on each of the working electrodes in the sensor array and incubated for 15 min at 65⁰C in a humidified chamber. After washing and drying, 4 μl of 0.5 U/tnl anti- fluorescein horseradish peroxidase (HRP) Fab fragments (Roche, diluted in 0.5% casein in 10 mM phosphate buffered saline, pH 7.4) were deposited on each of the working electrodes for 15 min. After washing and drying, a prefabricated plastic well manifold (GeneFluidics, Monterey Park, CA) was bonded to the sensor array. The sensor array was put into the chip reader (Fig. IB) and 50 μl of 3,3'5,5Metramethylbenzidine (TMB), H₂O₂ solution (K-Blue Low Activity TMB Substrate, Neogen, Lexington, KY) was placed on each of the sensors in the array so as to cover all three electrodes of each sensor. Electrochemical measurements are immediately and simultaneously taken for all 16 sensors. For each array, negative control (NC) sensors were tested including the UNI capture probe, detector probe, and 2.5% bovine serum albumin (Sigma, St. Louis, MO) in 1 M phosphate buffer, pH 7.4, instead of bacterial lysate. The entire assay protocol was completed within 45 min from the time when bacterial lysis was commenced. Amperometric current vs. time was measured using a multichannel potentiostat (GeneFluidics). The voltage was fixed at -200 mV (vs. reference), and the electroreduction current was measured at 60 s after the HRP redox reaction reached steady state.

Clinical validity study design. Clinical urine specimens were received from routine urine cultures collected from inpatients and outpatients and submitted to the UCLA Clinical Microbiology Laboratory. Routine plating on tripticase soy agar with 5% sheep blood was performed on each specimen for phenotypic identification and colony counting while an aliquot of each specimen was held at 4°C overnight. On the day after plating, specimens were selected for inclusion in the study on the basis of a rapid indole test for the purpose of including uropathogens other than Escherichia coliv^'a. approximately one-half of the specimens. The other half of the specimens were divided between E. coli- containing specimens and specimens determined to have "no significant growth" or "no growth" (see definitions below). Because most UTIs involve a single uropathogen, specimens determined by the clinical microbiology laboratory to have more than one organism present were excluded. Blinded specimens selected for inclusion in the study- were stripped of patient identifiers and any microbiological data before delivery to the research laboratory for testing with the electrochemical sensor array.

Experiments were performed on all specimens using the 16-sensor array 'UTI Chip', in which the UNI, EB, EC, PM, KE, PA, and EF capture probes (defined in Tables 1 and 2) were tested in duplicate. The two remaining sensors served as negative controls (including capture and detector probes without bacterial lysate). The degree of variance in the electrochemical sensor measurements was determined by comparing duplicate measurements for all experiments. The background signal level was determined by averaging the log₁₀ results of the two negative control sensors and the log₁₀ results of the four lowest species-specific probe pairs (from among the EC, PM, KE, PA, and EF sensors). A receiver operating characteristic (ROC) curve analysis (29, 51) was performed to determine the optimal threshold for a positive result to maximize weighted accuracy, where weighted accuracy was defined as (5*sensitivity + specificity) /6 to account for the greater diagnostic importance of minimizing false negative results than of minimizing false positive results. Sensor results were determined in a three-step algorithm. First, the average of the log₁₀ UNI results was compared with background to determine whether the specimen contained bacteria. Second, for specimens predicted to contain bacteria, the identity of the bacteria in the specimen was determined by comparing the average log₁₀ result of the highest species-specific signal (from among the EC, PM, KE, PA, and EF sensors) with background. Third, if no species-specific signal was positive, then the average log₁₀ result of the EB probe pair was compared with background to determine if the bacteria present in the specimen were members of the Enterobacteήaceae family.

'UTI Chip' results were compared with clinical microbiology data after the electrochemical sensor experiment was completed. Standard clinical microbiology laboratory procedures were followed on all specimens selected for testing. Gram-negative bacilli present in specimens at a concentration ≥ 10,000 bacteria/ml and any species present at a concentration of ≥l 0O₅OOO bacteria/ml were identified. Specimens with <10,000 bacteria/ml of 1-2 species or <50,000 bacteria/ml of >2 species were reported as "no significant growth". Specimens with <l,000 bacteria/ml were reported as "no growth". RESULTS

Amperometric detection of 16S rRNA using the electrochemical sensor array.

When TMB and H₂O₂ were added to electrochemical sensors with surface-bound HRP- probe-target complexes bound to the surface, an amperometric signal was detected that rapidly increased to a steady state level within sixty seconds. In the example shown in panel D of Figure 1, where K pneumoniae 16S rRNA was bound in higher amounts to the UNI, EB, and KE sensors, the steady state current level correlated with the amount of HRP enzyme present on the sensor surface. HRP is involved in the production of amperometric signal because it catalyzes the reactions in the redox relay system that ultimately results in the transfer of electrons from the electrode to H₂O₂, resulting in the formation of H₂O. TMB functions as an electron transfer mediator between the electrode and HRP (11, 16, 27). The interactions of HRP, TMB, and H₂O₂ on the electrode surface are illustrated in schematic form in panel C of Figure 1.

Development of probes for the 'UTI Chip'. The electrochemical sensor was used to determine which probe pairs had the greatest sensitivity and specificity for binding to 16S rRNA in lysates of uropathogens. Capture and detector probes were designed to hybridize to species- and group-specific regions of the 16S rRNA molecule and that are accessible to hybridization with oligonucleotide probes, as determined by prior flow cytometric analysis (14). Candidate probe pairs for E. coli, P. mirabilis, P. aeruginosa, Enterococcm spp, Klebsiella spp., Enterobacter spp., and the Entembacteriaceae group were tested for uropathogen detection sensitivity and specificity using the electrochemical sensor to arrive at the optimal probe set shown in Table 1.

Table 2 summarizes of the observed specificity of the probe pairs using the electrochemical sensor array. Significant sequence similarities between Klebsiella and Enterobacter spp. 16S sequences precluded design of species-specific probes for these organisms. The Enterococcus probe pair (EF) was specific for both E.faecalis and E. faedum. The universal probe pair (UNI) detects all of the uropathogens tested. Figure 2 shows detection by the EB probe pair of all members of the Enterobacteriaceae family tested, but not equal numbers of P. aeruginosa, Staphylococcus or Enterococcus spp. As shown in Table 2 and Figure 2, both the UNI and EB probes detect less common uropathogens such as Citrobacter and Morganella spp., for which the species-specific probes are not yet available.

TABLE 2. Species specificity of the uropathogen probe pairs used with the electrochemical sensor array.

Probe Pair Species detected" Species not detected¹

EC Ec Cf, Ea, El, Eo, Ko, Kp, Pa, Pm

PM Pm Cf, Ea, Ec, El, Eo, Ko, Kp, Pa

KE Ea, El, Ko, Kp Cf, Ec, Pa, Pm

PA Pa Ec, Ef, El, Eo, Kp, Pm

EF Ef, Eo Ec, Kp, Pa, Pm, Sa

EB Cf, Ea, Ec, El, Ko, Kp, Mm, Pm, Ef, Eo, Pa, Sa, Ss

UNI Cf, Ea, Ec, Ef, El, Eo, Ko, Kp, None Mm, Pa, Pm, Ss, Sa

^aSpecies abbreviations. Cf: Citrobacter freundii; Ea: Enterobacter aerogenes; Ec: Escherichia coli; Ef: E. faedum; El: E. cloacae; Eo: Enterococcus faecalis; Pm: Proteus mirabilis; Ko: K. oxytoca; Kp: Klebsiella pneumoniae; Pa: Pseudomonas aeruginosa; Mm: Morganella morganii; Sa: Staphylococcus aureus; Ss: S. saprophytic .

Species-specific detection of uropathogens in clinical urine specimens. To determine analytic validity, bacteria in culture medium, inoculated urine, and clinical urine specimens were tested using the UTI Chip and 7 probe pairs with specificities relevant to the detection of the most prevalent uropathogens. Clinical urine specimens represented the most significant challenge to the electrochemical sensor detection strategy because they frequently also contained high concentrations of host proteins, white blood cells, red blood cells, cellular debris in addition to wide variations in pH. In pilot experiments, the UTI Chip produced accurate results with clinical urine specimens representing a broad range of uropathogen species and concentrations, as well as broad range of urine specimen parameters related to the host inflammatory response to UTI. Figure 3A illustrates that a high signal-to-noise ratio was maintained in the case of a clinical urine specimen from a patient with an E. colt UTI in which a high numbers of white blood cells were present and the pH of the urine was 5.5. The high amperometric signals using the UNI, EB, and EC sensors indicated that the streptavidin coating on the sensor surface remained intact and the target-probe hybridization step of the electrochemical sensor protocol was not inhibited by host cells or changes in urinary pH. The low background signals with the remaining sensors indicated that the SAM layer was also unaffected by exposure to urine. Figure 3B illustrates result obtained in a urine specimen from a patient with a K. pneumoniae UTI containing a relatively low bacterial concentration of 4 x 10⁴ organisms /ml, demonstrating that the detection sensitivity of the sensor was maintained despite urine specimen conditions. Table 3 summarizes the UTI Chip results for detection of uropathogens in clinical urine specimens containing these and several other bacterial species. Accurate results were obtained using the electrochemical sensor array despite high levels of protein, red blood cells and white blood cells, and variations in pH from 5.0 -7.0.

TABLE 3. Urinalysis and microbiological characteristics of representative clinical urine specimens tested with die electrochemical sensor array containing 7 probe pairs ('UTI Chip').

Uropathogen Concentration Urinalvsis Positive

(cfu/ml) pH protein KBC/μl WBC/μl Probes

JB. eoli 2.6 x 10⁸ 5.5 Neg 48 >1000 UNI, EB, EC

P. mirabilis >1.0 x l0⁵ 7.0 2+ >1000 >1000 UNI, EB, PM

K pneumoniae 4.0 x 10⁴ 7.5 Neg 18 60 UNI, EB, KE

E. aerogenes 1.6 x 10⁷ 5.0 Trace 2 556 UNI, EB, KE Pseudomonas sp. >1.0 x l0⁵ 7.0 1+ 177 103 UNI, PA

Enterococcus sp. 1.3 x 10⁶ 7.0 Neg 2 26 UNI, EF

Clinical validity study involving blinded clinical urine specimens. A total of 89 blinded clinical urine specimens were received from the clinical microbiology laboratory. Eleven urine specimens were found to contain more than one organism and were excluded from further analysis. The remaining 78 specimens that were analyzed included 58 with bacteria speciated by the clinical microbiology laboratory, 8 specimens classified by the clinical microbiology laboratory as "no significant growth" and 12 specimens that were "no growth". The 58 positive specimens contained a broad diversity of uropathogens: 26 contained E. coli, 3 contained P. mirabilis, 8 contained K. pneumoniae, 1 contained E. cloacae, 5 contained E. aerogenes, 1 contained P. aeruginosa, 2 contained C. freundii, 1 contained C. koseri, 1 contained S. marcescens, 8 contained Enterococcus spp., and 2 contained S. saprophyticus.

The 16 sensor array allowed each of 8 electrochemical sensor measurements (7 probe pairs plus 1 negative control) to be performed in duplicate. Sensor-to-sensor variance in the clinical study was determined by comparing the results from testing of all 78 samples, which yielded 1248 (= 2 x 8 x 78) paired results. The duplicate residual errors were found to have a log normal distribution. The standard deviation of the duplicates was roughly constant at a value of 0.06 log units for all sensors in the UTI Chip array. An

ROC curve analysis found that optimal UTI chip weighted accuracy was maximal at 91% for a mean log positive over mean log background threshold of 0.25 — 0.33 log units. A 0.30 log unit threshold roughly equal to 5 standard deviations above background was applied for all sensor pairs in the array. As shown in Table 4, this approach yielded an overall sensitivity for detection of uropathogens in clinical urine specimens by the UNI probe pair of 54/58 = 93% (standard error +/- 3.3%). UNI probe specificity to be estimated at 10/12= 83% (standard error +/- 10.8%), although this number could not be determined with great accuracy because there were only 12 "no growth" specimens in the sample. TABLE 4. Results of a study of blinded clinical utine specimens showing a high level of sensitivity for detection of Gram-negative bacteria by the TJTI Chip'.

Clinical Microbiology Uni Sensors EB Sensors Species Sensors Species/Result Positive/Total = Percent Positive/Total = Percent Positive/Total = Percent Mean (range)¹ Mean (range) ^x Mean (range) ^:

Gram-negative bacteria 48/48 = 100% 46/47 = 98%² 43/44= 98%3 1.32 (0.40-1-.84) 1.17 (0.46-1.60) 1.00 (0.34-1.59)

Escherichia coli 26/26= 100% 25/26 = 96% Ec26/26= 100% 1.30 (0.54-1.77) 1.17 (0.46-1.60) 1.06 (0.48-1.59) Klebsiella pneumoniae 8/8 = 100% 8/8 = 100% KE7/8 = 88% 1.22 (0.40-1.84) 1.13 (0.46-1.13) 1.16 (0.76-1.50) Enterobacter aerogenes 5/5 = 100% 5/5 = 100% KE5/5 = 100% 1.35 (0.93-1.65) 1.20 (0.82-1.52) 0.86 (0.37-1.26) Enterobacter cloacae 1/1 = 100% 1/1 = 100% KE 1/1 = 100% 1.43 1.08 0.34 Proteus mirabilis 3/3 = 100% 3/3 = 100% Pm3/3 = 100% 1.41 (1.16-1.66) 1.14(0.92-1.45) 0.74(0.48-0.96) dtrobacter freundii 2/2= 100% 2/2= 100% 0/2= 0% 1.49 (1.43-1.55) 1.32 (1.25-1.38) NA. Citrobacter koseri 1/1 = 100% 1/1 = 100% 0/1 =0% 1.23 1.29 NA. Serratia marcescens 1/1 = 100% 1/1 = 100% False Positive 1.67 1.36 Pa 0.36 Enterobacteriaceae 47/47= 100% 46/47 = 98% 46/47 = 98% 1.32 (0.40-1.84) 1.17 (0.46-1.60) 1.02 (0.34-1.59) Vseudomonas aeruginosa 1/1 = 100% 0/1 = 0% Pa 1/1 = 100% 1.33 N.A. 0.55 Gram-positive bacteria 6/10= 60% 0/10 = 0% 2/8 = 25%³ 0.95 (0.33-1.78) N.A. 0.99 (0.63-1.36) Enterococcus species 5/8 = 63% 0/8 =0% Ef 2/8 = 25% 0.92 (0.33-1.78) N.A. 0.99 (0.63-1.36) Staph, saprophyticus 1/2= 50% 0/2= 0% 0/2 = 0% 1.10 N.A. NA.

Allspecimenswithbacteria 54/58= 93% 46/47 = 98%² 45/52 = 87%³

1.28 (0.33-1.84) 1/17 (0/46-1.60) 1.00 (0.34-1.59)

No Significant Growth 5/8 = 63% 0/8 = 0% Ef l/8 = 13%

0.42 (0.31-0.57) N.A. 0.31

No Growth 2/12 = 17% 0/12 = 0% 0/12 = 0%

0.38 (0.34-0.42) N.A. NA.

Expressed in loglO units over background.

Calculation of Enterobacteriaceae probe results does not include specimens containing Gram-positive bacteria or P. aeruginosa, which were not detectable using the Enterobacteriaceae probe. Calculation, of species-specific probe results for Gram-negative and —positive bacteria does not include specimens containing bacteria for which no species-specific probes were included.

The sensitivity of the UNI probe fat detection of Gram-negative bacteria in clinical urine specimens was 48/48 = 100%, because all four falsely negative specimens contained Gram-positive bacteria. Both the Enterobacteriaceae and species-specific probe pairs 5 demonstrated a similar 98% sensitivity for detection of Gram-negative bacteria in clinical urine specimens. Figure 4 illustrates the three-step UTI Chip signal interpretation algorithm, which showed the high level of accuracy for detection and identification of Gram-negative bacteria in clinical urine specimens. One specimen containing S. marcescens was falsely positive by the PA probe pair and one specimen containing TL 0 pneumoniae was falsely negative using the KE probe pair. The sensitivity of the 'UTI

Chip' was lower for Gram-positive organisms; three specimens containing Enterococd and one specimen containing S. saprophytics were falsely negative using the UNI probe pair.

In this study we describe a novel electrochemical sensor array platform that uses oligonucleotide capture and detector probes for detection and identification of bacterial 5 uropathogens in clinical urine specimens. Amperometric biosensors for detection of in vitro cultivated bacteria have been previously described using antibody capture or nucleic acid hybridization approaches, but not for detection of bacteria in clinical specimens (1, 4, 9, 10, 15, 21, 26, 30, 35, 40, 43). A convergence of technological innovations from several disciplines including microfabrication, materials science, electrochemistry, and 0 molecular microbiology contributed to the design of the electrochemical sensor array and the detection strategy utilized in the current study (16, 17, 42). The resulting biosensor demonstrated a high signal-to-noise ratio and low variance between duplicate sensors that is maintained despite contact with bacteria obtained directly from clinical urine specimens. This is the first report we are aware of describing detection of bacterial 5 pathogens in human body fluids using an electrochemical sensor and the clinical validity of this approach. The sensor technique utilized here is an electrochemical sandwich assay in which target 16S rRNA is bound by both a capture and detector probe (16). The capture probe anchors the target to the sensor and the detector probe provides a means for recognizing target bound on the sensor surface. This sandwich strategy has been successfully employed in several types of electrochemical sensors (5, 7, 46, 50). In our system, as in most electrochemical sandwich assays, the detector probe is linked directly or indirectly to HRP for amperometric detection of redox current (5)} (7, 50). An exception to this approach is an electrochemical sandwich assay involving a ferrocene-modified detector probe (46). When the detector probe is hybridized to the target on the sensor surface, the ferrocene moieties mediate electron transfer to the gold electrode via a phenylacetylene molecular wire embedded in the electrode's SAM. In any microfabricated electrochemical sensor the SAM reduces background current by insulating the working electrode when a potential difference is applied between the working and reference electrodes (3). When our electrochemical sensor results are to be read, the sensor is placed in a potentiostat and a voltage of — 20OmV is applied between the working and auxiliary electrodes, resulting in polarization of the working electrode with negative charges. HRP substrates, such as TMB, then serve to transfer electrons from the electrode surface to HRP across the SAM (11, 16, 27).

Electrochemical sensors directly detect nucleic acid targets by hybridization, so that sensitivity and specificity problems associated with nucleic acid amplification in the presence of biological inhibitors are avoided. Accuracy of the 'UTI Chip' was demonstrated for samples with significant amounts of somatic cells, urinary protein, and ranges of pH. In contrast, PCR detection assays for urine specimens are subject to false negative results due to DNA polymerase inhibitors, which may not be removed even after a nucleic acid purification step (24, 25). Application of PCR assays to complex mixtures of nucleic acids can produce biased target amplification resulting in problems with specificity (36, 44). We and others have encountered sensitivity and specificity problems related to sample contamination and/ or urinary inhibitors in our attempts to use PCR for detection of uropathogens in clinical urine specimens (38, 45) (Møller et a/, unpublished data). Electrical and fluidics systems can be miniaturized, so that electrochemical sensors are potentially less expensive and more portable than sophisticated optical detection systems currently being used in PCR detection assays. These intrinsic advantages may be critical when sensor technology is eventually applied in an automated point-of-care device.

We developed a library of species-specific probes that recognize over 90% of uropathogens submitted to the clinical microbiology laboratory. 16S rRNA was chosen as the sensor target because it exists in high copy number in bacterial cells and is an essential component of ribosomes. 16S rDNA sequences of the relevant species of bacteria are well characterized and contain regions of diversity and conservation that are useful for molecular diagnostic purposes (37). Similar to probes used for 16S rRNA- based fluorescence in situ hybridization assays, the oligonucleotide probes that were developed for use with the electrochemical sensor array hybridize with species-specific and surface-accessible regions of the 16S rRNA target molecule. The panel of probes described in the clinical feasibility study was able to detect and identify a broad range of Gram-negative uropathogens. The absence of a positive signal from the UNI probe effectively rules out a Gram-negative bacterial UTI. Our detection system had reduced sensitivity for Gram-positive uropathogens such as Enterococct/s species and S. saprophytics. The most likely explanation for this problem is resistance of the Gram-positive cell wall to the alkaline lysis method used in our study. Development of alternative lysis methods that would be applicable to all potential uropathogens is an area of active investigation in our laboratory.

A short time from specimen collection to readout is important to an approach intended for a point-of-care application. Our current detection strategy requires approximately 45 minutes: bacterial lysis for 5 mins, probe hybridization for 25 mins, and enzyme amplification for 15 mins. The amperometric reading is currently being measured at 60 sec, by which point the current flow has reached steady state (Fig ID). The reaction kinetics in each step of the protocol is limited by passive diffusion (concentration of molecules versus time). We anticipate that the sample preparation time can be further reduced by optimization of bacterial lysis efficiency and hybridization kinetics.

The optical-grade surface characteristics of the gold electrodes in our electrochemical sensor array allowed for formation of pinhole-free SAMs. Highly insulating SAMs improve sensitivity by reducing sensor background and increasing the signal-to-noise ratio. Sensitivity was also improved by integrating liquid-phase detector probe/target hybridization for maximum signal detection efficiency and solid-phase probe/sensor immobilization for maximum target capture efficiency (16). The standard diagnostic criterion for UTI is greater than 10⁵ cfu/ml from clean-catch voided urine sample (23), although actual concentrations of uropathogens in clinical urine specimens are frequently higher. A robust uropathogen diagnostic system should be able to detect and quantify bacteria over a wide spectrum of bacterial concentrations and urine parameters. The studies presented here indicate that the UTI Chip is able to detect uropathogens over wide range of clinical urine characteristics (Table 3) and bacterial concentrations as low as 4 x 10⁴ cfu/ml (Fig. 3B). The results of the clinical feasibility study proved this to be an appropriate level of sensitivity for detection of clinically relevant concentrations of bacteria in urine. Given that only 4 μl of the 60 μl lysate-probe mixture, or one-fifteenth of the total, are applied to the sensor surface, the ability to detect as few as 4.0 x 10⁴ cfu/ml (Fig. 3B) translates to a total of 2600 bacteria. E. coli contain between 5 x 10³ to 2 x 10⁴ copies of 16S rRNA per cell (31). Therefore, we estimate that the rRNA detection limit of the sensor is within femtomolar (3 x 10^"16) range, which compares favorably to other electrochemical DNA sensors (8). This level of sensitivity is achieved using raw bacterial lysates from actual body fluids, and represents an important advance compared to previous studies.

The studies presented here demonstrated the analytical and clinical validity of an electrochemical DNA sensor for quantitative, species-specific detection of uropathogens. The culture- and PCR-independent molecular identification was achieved in 45 minutes. The ability of the sensor to provide genotypic identification of uropathogens and to differentiate between bacterial pathogens in a rapid time format is clearly superior to current clinical microbiology approaches which are limited by the growth rate of bacteria and typically require at least 48 hours from sample collection to reporting. While the sensor array and the detection assay, in. their present form, are not yet ready for widespread application, these are important steps towards development of a fully automated approach. The electrochemical sensor and the simplicity of its sample preparation requirements are compatible with eventual integration with an automated microfluidics-based sample preparation module. Concentration of bacteria in the urine sample, coupled with active mixing of reagents instead of passive diffusion, would significantly reduce overall sample preparation time and enhance sensitivity. Our studies lay the foundation for analyses of the clinical utility of our UTI chip. Rapid detection and identification of uropathogens at the point-of-care will have a profound impact on clinical decision-making when managing a patient with suspected UTI.

References:

1. Abdel-Hamid, L₅ et al. 1999. Biosens Bioelectron 14:309-16. 2. Albers, J., et al. 2003. Anal Bioanal Chem 377:521-7.

3. Bard, A. J., and L. R. Faulkner. 2001. Electrochemical Methods. Fundamentals and Applications., 2nd ed. John Wiley & Sons, Inc., Hoboken, NJ.

4. Basu, M., et al. 2004. Glycoconj J 21:487-96.

5. Campbell, C. N., et al. 2002. Anal Chem 74:158-62. 6. Chaki, N. K₅ and K Vijayamohanan. 2002. Biosens Bioelectron 17:1-12.

7. Dequaire, M., and A. Heller. 2002. Anal Chem 74:4370-7.

8. Drummond, T. G., et al. 2003. Nat Biotechnol 21 : 1192-9.

9. Ercole, C, et al. 2002. Sens. Actuators B 83:48-52. iθ. Ertl, P., et al. 2003. Biosens Bioelectton 18:907-16. 11. Fanjul-Bolado, P., et al. 2005. Anal Bioanal Chem 382:297-302.

12. Foxman, B., et al. 2000. Ann Epidemiol 10:509-15.

13. Freedman, A. L. 2005. J Urol 173:949-54.

14. Fuchs, B. M., et al. 1998. Appl Environ Microbiol 64:4973-82.

15. Gabig-Ciminska, M., et al. 2004. Microb Cell Fact 3:2. 16. Gau, J. J., et al. 2001. Biosens Bioelectron 16:745-55. 17. Gau, V., et al. 2005. Electrochemical molecular analysis without nucleic acid amplification. Methods 36: [In Press].

18. GoodingJ. J. 2002. Electroanalysis 14:1149-1156.

19. Griebling, T. L. 2005. J Urol 173:1288-94. 20. Griebling, T. L. 2005. J Urol 173:1281-7.

21. Ivnitski, D., et al. 2000. Electrochemistry Communications 2:457-460.

22. Kunin, C. M. 1997. Care of the urinary catheter, Urinary Tract Infections: Detection, Prevention, and Management., 5th ed. Williams & Wϊlkins, Baltimore, MD.

23. Kunin, C. M., et al. 1993. Ann Intern Med 119:454-60. 24. Land, S., et al. 2002. J Clin Microbiol 40:2893-6.

25. Mahony, J., et al. 1998. J Clin Microbiol 36:3122-6.

26. Mazenko, R. S., et al. 1999. J Microbiol Methods 36:157-65.

27. Mecheri, B., et al. 2004. IEEE Sensors Journal 4:171-179.

28. Mehrvar, M., and M. Abdi. 2004. Anal Sci 20:1113-26. 29. Metz, C. E. 1986. Invest Radiol 21:720-33.

30. Mittelmann, A. S., et al. 2002. Anal Chem 74:903-7.

31. Neidhardt, F., and H. Umbarger. 1996. Chemical composition of Escherichia coli, p. 13-16. In F. Neidhardt (ed.), Escherichia coli and Salmonella typliitnurium, Second ed, vol. I. ASM Press, Washington, D.C. 32. Nicolle, L. 2001. Infect Med 18: 153-162.

33. Palecek, E., and F. Jelen. 2002. Crit Rev Anal Chem 3:261-270.

34. Pearson, J. E., et al. 2000. Ann Clin Biochem 37 ( Pt 2):119-45.

35. Perez, F. G., et al. 1998. Anal Chem 70:2380-6.

36. PoIz, M. F., and C. M. Cavanaugh. 1998. Appl Envkon Microbiol 64:3724-30. 37. Relman, D. A. 1999. Science 284:1308-10.

38. Rosenstraus, M., et al. 1998. J Clin Microbiol 36:191-7.

39. Schappert, S. M. 1999. Vital Health Stat 13:i-iv, 1-39.

40. Sippy, N., et al. 2003. Biosens Bioelectron 18:741-9.

41. Stamm, W. E. 1991. AmJ Med 91:65S-71S. 42. Sun, C. P., et al. 2005.. MoI Genet Metab 84:90-9.

43. Susmel, S., et al. 2003. Biosens Bioelectron 18:881-9.

44. Suzuki, M. T., and S. J. Giovannoni. 1996. Appl Environ Microbiol 62:625-30.

45. Toye, B., et al. 1998. J Clin Microbiol 36:2356-8. 46. Umek, R. M., et al. 2001. J MoI Diagn 3:74-84.

47. Wang, J. 2002. Anal Chim Acta 469:63-71.

48. Wang, J. 2002. Trends Anal Chem 21:226-232.

49. Warren, J. W. 1991. Med Clin North Am 75:481-93. 50. Williams, E., et al. 2003. Biosens Bioelectton 19:165-75.

51. Zhou, X., et al. 2002. Statistical methods in diagnosiiic medicine. Wiley & Sons Interscience, NY.

Example 2: Determinants of signal intensity for bacterial pathogen detection using an electrochemical DNA biosensor array This example describes the determinants of electrochemical signal intensity using a sensor assay that involves hybridization of target rRNA to a fluorescein-modified detector probe and a biotin-modified capture probe anchored to streptavidin on the sensor surface. Signal is generated by an oxidation-reduction current produced by the action of horseradish peroxidase (HRP) conjugated to an anti-fluorescein monoclonal Fab bound to the detector probe. A 12-fold increase in electrochemical signal intensity for detection of Enterococcal 16S rRNA was achieved using a two-step approach involving initial treatment with Triton X-100 and lysozyme followed by alkaline lysis. This universal lysis system was shown to be effective for both Gram-positive and Gram- negative organisms. The location of fluoiecein modification was found to be a determinant of signal intensity, indicating that the distance from the sensor surface at which the HRP-Fab conjugate binds to fluorescein is important. Signal intensity was consistently higher for 3'-modified than for 5'-modified detector probes, effectively moving fluorescein away from the sensor surface. Studies with Enterococcal cells found that 3'-fluorescein modification of the detector probe combined with elimination of the gap between the detector and capture probe hybridization sites increased signal intensity by 20-fold. Automation would be greatly simplified by hybridization of target with mixtures of detector probes. A mixture of seven detector probes had no adverse effects on signal intensity and species-specific detection of bacterial 16S rRNA. These studies demonstrate the feasibility of rapid, automated molecular detection of bacterial pathogens using electrochemical DNA biosensors. Electrochemical DNA biosensors contain a recognition layer consisting of single- stranded oligonucleotides commonly known as capture probes. The mechanism of detection used for the electrochemical sensors in this study involves a redox reporter molecule that binds to a second oligonucleotide referred to as a detector probe. Binding of the capture and detector probes to the nucleic acid target functions as a three- component 'sandwich' assay to generate an electronic readout via the reporter molecule. Whole cell bacterial lysates are mixed with fluorescein-labeled detector probes for the initial target-probe hybridization in liquid phase. The target-probe hybrids are deposited on the sensor surface for the second, solid phase hybridization with the capture probe. The resulting capture-detector-target complex anchors the 16S rRNA to the sensor surface and provides for its detection (Fig. 5). Coupling the reporter enzyme (anti- fluorescein monoclonal Fab fragment conjugated to horseradish peroxidase) to the detector probe generates a redox reaction at the sensor surface when the enzyme substrate is added. Application of a fixed potential between the working and reference electrodes enables amperometric detection as the redox substrates are regenerated. The amplitude of the electroreductioii current is related to the nucleic acid target concentration.

As in any assay system, the sensitivity of electrochemical sensors is affected by the signal- to-noise ratio. Reduction of background noise is largely determined by the precision of the microfabrication process and deposition of a uniform alkanethioloate self-assembled monolayer. This example examines a number of determinants of electrochemical signal intensity, namely, 1) Bacterial lysis and release of the 16S rRNA target molecules; 2) The distance of the redox reporter from the sensor surface; 3) The effect of a gap between the target hybridization regions of the capture and detector probes; and 4) Probe-probe and probe-target interactions during hybridization with mixtures of detector probes.

Major improvements in signal intensity were achieved, which will contribute significantly towards our goal of developing a microfluidics-based, 'on-chip', sample preparation strategy for integration with the sensor array. As shown in Fig. 5, the detection system involves hybridization of a biotin-labeled oligonucleotide capture probe and a fluorescein-labeled oligonucleotide detector probe to a nucleotide target (16S rRNA in this case). The biotin-label on the capture probe anchors the probe-target sandwich to the streptavidin self-assembled monolayer on the sensor surface. The fluorescein-label on the detector probe is not used for optical detection, rather as a binding site for the anti-fluorescein monoclonal Fab — horseradish peroxidase (HRP) conjugate. When a bias potential is applied, an electroreduction current is detected by working electrode due to the transfer of electrons by the HRP substrate between HRP and the surface of the working electrode. Signal intensity is correlated with the number of HRP molecules anchored to the sensor surface, which in turn is affected by variables including nucleotide target abundance and the configuration of the probe-target sandwich.

Sensor characterization and surface functional layer preparation. Microfabricated electrochemical sensor arrays with an alkanethiolate self-assembled monolayer (SAM) were obtained from GeneFluidics (Monterey Park, CA). SAM integrity was confirmed by cyclic voltammetry (CV) (1) using a 16-channel potentiostat (GeneFluidics). After CV characterization, sensor arrays were washed and dried. Washing steps were carried out by applying a stream of deionized H₂O to the sensor surface for approximately 2-3 sec followed by 5 sec of drying under a stream of nitrogen. To functionalize the sensor surface, 2.5 μl of 0.5 U/ml streptavidin (Calbiochem, San Diego, CA) in 100 mM phosphate buffered saline, pH 7.4 was added to the alkanethiol activated sensors, incubated for 10 min at room temperature and washed off. Biotinylated capture probes (2.5 μl, 1 μM in GeneFluidics' Probe Diluent) were added to the streptavidin-coated sensors. After 30 min of incubation at room temperature, the sensor array was washed and dried, completing the surface preparation.

Bacterial strains and cultivation. Uropathogenic Enterococcusfecalis and Escherichia coli strains were obtained from the UCLA Uropathogen Strain Collection. Isolation of uropathogens from clinical urine specimens was approved by the UCLA Institutional Review Board. Isolates were inoculated into Brucella broth with 15% glycerol (BBL, Maryland) and were stored at -70⁰C. Bacteria were grown overnight in Luria Broth (LB)₅ inoculated into LB and grown to logarithmic phase as measured by OD₆₀₀. Concentration of the logarithmic phase specimens was determined by serial plating, typically yielding 10⁷-10⁸ bacteria/ml.

Amperometric Detection of bacterial 16S rRNA. Logarithmic phase bacterial cells were concentrated by centrifugation at 10,000 rpm for 5 min. Lysis of bacterial cells was performed by addition of 10 μl of one or more of the following: 1 M NaOH; 0.1% Triton X-IOO in 0.1 M KH₂PO₄, 2 mM EDTA and 1 mg/ml lysozyme (Sigma). After incubation at room temperature, 50 μl of the detector probe (0.25 μM) in GeneFluidics' Probe Diluent with 2.5% bovine serum albumin (Sigma), were added to the bacterial lysate. The detector probe/bacterial lysate mixture was incubated for 10 min at 65°C to allow hybridization of the detector probe to target rRNA. 4 μl of the bacterial lysate/detector probe mixture was deposited on each of the working electrodes in the sensor array. The sensor array was incubated for 10 min at 65⁰C in a humidified chamber. After washing and drying, 2.5 μl of 0.5 U/ml anti-fluorescein horseradish peroxidase (HRP) Fab conjugate (Roche, diluted in 0.5% casein in 100 mM sodium phosphate buffer, pH 7.4) were deposited on each of the working electrodes for 10-15 min. After washing and drying, a prefabricated plastic well manifold (GeneFluidics) was bonded to the sensor array. 50 μl of HRP substrate solution (GeneFluidics) was placed on each of the sensors in the array so as to cover all three of the electrodes.

Measurements were immediately and simultaneously taken for all 16 sensors. A negative control for each sensor was performed in which H₂O was used instead of bacterial lysate. The entire assay protocol was completed within 45 min from the initiation of bacterial lysis. Amperometric current vs. time was measured using a multichannel potentiostat (GeneFluidics). The voltage was fixed at -200 mV (vs. reference), and the electroreduction current was measured at 60 sec after the HRP redox reaction reached steady state. AU samples were analyzed in duplicate. For each experiment, negative control (NC) represents background signals in which H₂O was used as the target. Positive signals are determined by comparing the signals with the background using paired T test.

Oligonucleotide probe design. Oligonucleotide probes were synthesized by MWG Biotech (High Point, NC). Capture probes are synthesized with 5' biotin. Detector probes with synthesized with 5'- and/ or 3'- fluorescein modifications. The fluorescein molecule was used as a binding site for the anti-fluorescein monoclonal Fab — horseradish peroxidase (HRP) conjugate redox reporter. Oligonucleotide probe pairs were designed to bind to species-specific regions of the 16S rRNA molecules of Escherichia coli and Enterococcus faecalis. Studies also included oligonucleotide probe paks specific for Proteus mirabilis, Pseudomonas aeruginosa, the Klebsie/Ia-Enterobacter group, and for species belonging to the family oiEnterobacteriaceae. Most experiments included a universal bacteria oligonucleotide probe pair as a positive control. The Enterococcus and E. rø/z-specific oligonucleotide probe pairs were studied with and without a six nucleotide interprobe gap between the hybridization regions of the capture and detector probes. The sequences of all oligonucleotide probe pairs used in this study are shown in Table 5.

TABLE 5. Sequences (5'-3') of oligonucleotide probes used in Example 2.

Capture Probes

EF C207 (35-mer)

TTGGT GAGCC GTTAC CTCAC CAACT AGCTA ATGCA (SEQ ID NO: 9) EF Cl 65 (35-mer)

GTCCA TCCAT CAGCG ACACC CGAAA GCGCC TTTCA (SEQ ID NO: 10)

UNI C782 (27-mer)

CATCG TTTAC GGCGT GGACT ACCAG GG (SEQ ID NO: 13)

EC C434 (35-mer) GTCAA TGAGC AAAGG TATTA ACTTT ACTCC CTTCC (SEQ LD NO: 1)

EC C430 (35-mer)

GAGCA AAGGT ATTAA CTTTA CTCCC TTCCT CCCCG (SEQ ID NO: 15)

EC C430 (20-mer) ACTTT ACTCC CTTCC TCCCC (SEQ ID NO: 16)

ENTBC C1241 (35-mer)

CGGAC TACGA CRYAC TTTAT GAGGT CCGCT TGCTC (SEQ ID NO: 11)

PM Cl 87 (35-mer) GGGTT CATCC GATAG TGCAA GGTCC GAAGA GCCCC (SEQ ID NO: 3)

KE C434 (35-mer)

GTCAA TCGMC RAGGT TATTA ACCTY AHCGC CTTCC (SEQ ID NO: 5)

PA C102 (35-mer)

CCCAC TTTCT CCCTC AGGAC GTATG CGGTA TTAGC (SEQ ID NO: 7) Detector Probes

EF D165 (35-mer)

GTCCA TCCAT CAGCG ACACC CGAAA GCGCC TTTCA (SEQ ID NO: 10)

EF D207 (35-mer)

TTGGT GAGCC GTTAC CTCAC CAACT AGCTA ATGCA (SEQ ID NO: 9) EF D171 (35-mer)

CCGCG GGTCC ATCCA TCAGC GACAC CCGAA AGCGC (SEQ ID NO: 17)

UNI D751 (31-mer)

TATCT AATCC TGTTT GCTCC CCACG CTTTC G (SEQ ID NO: 14)

EC D393 (35-mer) CTGAA AGTAC TTTAC AACCC GAAGG CCTTC TTCAT (SEQ ID NO: 2)

ENTBC D1237 (35-mer)

GAGGT CGCTT CTCTT TGTAT RYGCC ATTGT AGCAC (SEQ ID NO: 18)

PM D147 (35-mer)

GGTCC GTAGA CATTA TGCGG TATTA GCCAC CGTTT (SEQ ID NO: 4) KE D393 (35-mer)

CTGAA AGTGC TTTAC AACCC GAAGG CCTTC TTCAT (SEQ ID NO: 6)

PA D68 (35-mer)

TTCCGGACGTTATCCCCCACTACCAGGCAGATTCC(SEQIDNO:8) Test probes

20-mer

CGTCA ATGAG CAAAG GTATT (SEQ ID NO: 19)

40-mer CGTCA ATGAG CAAAG GTATT ACTCC CTTCC TCCCC GCTGA (SEQ ID NO: 20)

60-mer

CGTCA ATGAG CAAAG GTATT ACTCC CTTCC TCCCC GCTGA CGTCA ATGAG

CAAAG GTATT (SEQ ID NO: 21)

^*Capture probes were 5'- modified with biotin. Detector probes were 5'- and/ or 3'- modified with fluorescein. Test probes were 5'-modified with biotin and 3'-modified with fluorescein. Probe sequence numbering based on E. coli 16S rDNA. Abbreviations for probe specificity: Enterococcus species (EF), Escherichia coli (EC), Proteus mirabilis (Pm), Pseudomonas aeruginosa (PA), the K/ebsiella-Enferobacter group (KE), the Enterobacteriaceae family (EB), and universal bacterial (UNI) probes.

RESULTS

Universal bacterial lysis strategy for release of 16S rRNA. Treatment of Gram- negative uropathogens such as E. coli with NaOH is an effective method for release of 16S rRNA. In contrast, a one-step alkaline lysis approach was not effective for Gram- positive uropathogens. In this example, we compared a variety of approaches for lysis and effective release of 16S rRNA from the Gram-positive organism, Enterococcus fecalis. Given the thicker peptidoglycan layer of Gram-positive organisms, we considered whether lysozyme would be useful component of a lysis strategy. As shown in Figure 6, NaOH with or without Triton X-IOO did not lyse Enterococcus cells sufficiently to detect 16S rRNA above background signal levels. However, the combination of Triton X-IOO plus lysozyme resulted in signals 4 fold above background. The approach that yielded the greatest signal intensity was a two-step lysis strategy in which Enterococcus cells were initially treated with the combination of Triton X-IOO and lysozyme for 5 min followed by treatment with NaOH for additional 5 min. Treatment of Εnterococcus cells in reverse order, namely treatment with NaOH for 5 min followed by treatment with the combination of Triton X-IOO and lysozyme for 5 min, was also successful but yielded lower signals. Although the results were not significantly better than lysis with NaOH alone, lysis of Gram-negative uropathogens (e.g. E. colt, P. mirabilis, TL pneumoniae, and P. aeruginosa) with Triton X-IOO and lysozyme or Triton X-IOO and lysozyme followed by NaOH resulted in successful electrochemical detection of 16S rRNA. Therefore, this two-step process can be considered a universal lysis strategy for release of bacterial 16S rRNA. Use of various concentrations of the denaturing detergent, sodium dodecyl sulfate, coupled with non-specific proteases (e.g. Proteinase K or Pronase) were not successful.

Distance between fluorescein and the sensor surface. For amperomettic sensors, the detection mechanism depends the electron transfer between the signal transducer and the working electrode. For our detection approach, we considered whether the distance between the fluorescein (the binding site for the anti-fluorescein Fab-HRP conjugate) and the sensor surface would affect signal intensity. To examine this question, we tested a series of oligonucleotides of varying length, called 'Test Probes', which were modified with both biotin and fluorescein. The Test Probe was anchored on the sensor surface by the 5'-biotin modification and allowed binding of the Fab-HRP conjugate via its 3'- fluorescein modification. Because both the anchoring and detection moieties were components of the same oligonucleotide, target hybridization was unnecessary for generation of an electrochemical signal. In this way, hybridization efficiency was eliminated as a confounding variable of signal intensity. Increasing the length of the Test Probe effectively increases the maximum distance between the fluorescein molecule and the sensor surface. As shown in Figure 7, the 40mer Test Probe yielded higher signals than the 20mer Test Probe or the 60mer Test Probe across a range of different concentrations. The lower limit of detection was 10 pM concentration with the 40mer Test Probe. The results of the Test Probe experiments setup indicated that the distance between fluorescein and the sensor surface could affect signal intensity. For this reason, we compared the signal intensity produced using 3'- vs. 5'-fluorescein. detector probes. In the capture-detector-target complex, the fluorescein of 3'-modified detector probes would be farther away from the sensor surface than that of 5'-modified detector probes. Use of 3 '-fluorescein modified detector probes resulted in greater signal intensity than 5'- fluorescein modified detector probes for detection of Enterococcus 16S rRNA (Fig. 8). As shown in Table 6, the effect of the location of fluorescein modification was examined for a variety of detector probes and targets. Some of the detector probes (UNI, ENTBC, EC) were also modified with fluorescein at both the 5' and 3' positions. Use of 3'- modified detector probes consistently yielded higher signals than 5'-modified detector probes, ranging from 1.4-5 fold increased signal intensity. Interestingly, fluorescein- labeling of the detector probe at both the 3' and 5' positions did not enhance signal strength beyond that achieved with 3' modification alone.

TABLE 6. Location of detector probe fluorescein modification and signal intensity¹¹

Target (Probe Pairs) 5' (nA) 3' (nA) (fold change) 5^: & 3' (nA) (fold change)

Ec (ENTBC D1137/C1241) 1122 ± 25 2528 ± 101 (2.2s) 2092 ± 6 (1.9x)

Pm (UNI D751/C782) 1388 ± 10 1502 ± 33 (l.lx)

Ec (UNI D751/C782) 1890 ± 491 2053 ± 189 (l.lx) 1736 ± 251 (0.9x)

Ec (EC D393/C434) 1164 ± 100 1849 ± 141 (1.6x) 1962 ± 244 (1.7x)

Ec (EC D393/C434) 538 ± 31 1338 ± 24 (2.5x)

Ec (EC D399/C434) 451 ± 47 1258 ± 88 (2.8x)

Ec (EC D393/C430) 1588 ± 15 2215 ± 4 (1.4x)

Ec (EC D393/C429) 301 ± 8 672 ± 129 (2.2x)

Pm (PM D187/C147) 420 ± 58 806 ± 44 (1.9x)

Pa (PA D68/C102) 668 ± 73 1295 ± 237 (1.9x)

Pa (PA D932/C972) 393 ± 35 1314 ± 115 (3.3x)

Ef (EF D165/C207) 236 ± 59 1202 ± 85 (5x)

Ef (EF D171/C207) 1093 ± 32 1777 ± 57(1.6x)

"Results expressed as mean of two independent measurements. ^Relative to results obtained with 5'-fluorescein modified detector probes.

Effect of distance between capture and detector probe hybridization sites on signal intensity. In the previous example, the capture and detector probes were typically designed with a 6-nucleotide gap between their hybridization sites. In this example, we addressed the question of whether the distance between the hybridization sites of the capture and detector probes would affect electrochemical signal intensity. Experiments involving a gap of >300 bp between the capture and detector probe produced no significant signal. We next tested capture and detector probes without a gap between their hybridization sites. As shown in Figure 8A, there was a significant increase in signal intensity for probe pairs binding to adjacent regions of Enterococcus rRNA compared to probe pairs with a 6 bp gap between their hybridization sites. The combined effect of eliminating the gap between the capture and detector probe hybridization sites and moving the fluorescein modification from the 5' to the 3' end of the detector probe yielded an overall 7-fold increase in signal output. As shown in

Figure 8B, the increased signal intensity resulted in improved lower limits of detection by 25-fold. Similar trends in signal improvements were observed for modification of the E. colt probes (Table 6), suggesting that the improvements are target sequence independent.

Effects of detector probe mixtures on signal intensity. Use of the electrochemical sensor array to identify unknown bacteria in clinical urine specimens would involve a panel of different capture and detector probes. For this reason, we examined whether hybridization of target 16S rRNA with mixtures of detector probes would affect signal intensity. When mixtures of detector probes are used, probe-probe and probe-target interactions could potentially reduce the sensitivity and specificity of the sensor. A representative experiment is shown in Figure 9 in which Enterococcal 16S rRNA was hybridized with a mixture of the EF and EC detector probes versus EF detector probe alone. When the target-detector probe hybrids were applied to sensors functionalized with an EF capture probe, there was no significant difference in signal intensity between the results generated with the EF + EC detector probe mixture and results generated with the EF detector probe alone. Using the same detector and capture probes with E. coli 16S rRNA resulted in no significant signal, indicating that sensor specificity was retained despite hybridization of the E. coli target with the E. rø/z-specific detector probe. Likewise, no loss of sensitivity or specificity was observed with other 2-detector probe combinations including EC & PM, EC & KE, PA and EF. Similar results were obtained using a 3-detector-probe cocktail (EC, PM, & KE) and a 5-detector-probe cocktail (EC, PM, KE, PA, & EF), showing no significant reduction in overall signal output relative to experiments with single detector probes.

Sample preparation would be greatly simplified by including all the detector probes relevant to an entire sensor array in the target hybridization step. Figure 10 shows results obtained when a 7-detector-probe mixture was hybridized with 16S rRNA derived from 10⁶ uropathogenic Enterococcus. A 16-sensor array was prepared with immobilization of 7 capture probes on pairs of sensors in duplicate. UNI capture probes were immobilized on the two negative control (NC) sensors to determine background signal levels using the 7-detector probe cocktail in the absence of target nucleic acids. The positive signals (EF and UNI) can be easily distinguished from non-specific capture probes and background signal (NC). Similar findings have been obtained when 16S rRNA derived from E. coli, P. mirabilis, P. aeruginosa, and K. pneumoniae was used as the target. These experiments indicate that signal intensity is not adversely affected by detector probe mixtures and that sensor specificity is a function of the immobilized capture probe.

These studies demonstrate that a single detector probe mixture can be used as a common reagent for species-specific detection of uropathogens using an electrochemical sensor array.

This example demonstrates the determinants of signal intensity in a 40-minute DNA sandwich assay for direct molecular detection of uropathogens using a novel electrochemical sensor array. This provides an integrated point-of-care diagnostic system (lab-on-a-chip) for urinary tract infections. The sensor array would serve as the critical sensing component of an automated detection system when coupled with a microfluidics-based sample preparation module. The studies described here demonstrate the dependence of the system on the strategy for bacterial 16S rRNA release, the distance between the capture and detector probe hybridization sites on the rRNA target, and the location of the fluorescein on the detector probe relative to the sensor surface. We also demonstrate the feasibility of hybridizing bacterial target rRNA with a mixture of detector probes, which greatly simplifies the assay when using a sensor array functionalized with a panel of species- and group-specific capture probes.

A fundamental difference between Gram-positive and Gram-negative bacteria is the thicker peptidoglycan cell wall of Gram-positive organisms. We have observed that alkaline lysis is an effective lysis method for Gram-negative, but not Gram-positive, uropathogens. Given the objective of bacterial species identification in clinical specimens, we sought to devise a lysis strategy applicable to all bacterial uropathogens. Detection of intracellular biomarkers such as 16S rRNA requires effective bacterial lysis as the first step. To develop protocols and reagents compatible with eventual integration with a microfluidics-based sample preparation module, our studies were guided by the criteria of speed (< 10 min), universal applicability (both Gram-positive and -negative uropathogens), overall simplicity, and compatibility with the electrochemical sensor array. This example shows that the optimal combination of using a non-denaturing detergent (Triton X-100) with lysozyme followed by alkaline treatment (NaOH) yielded highest the signals. The two-step lysis strategy was similarly effective for detection of Gram-negative bacteria. Use of other reagents such as the denaturing detergent sodium doceyl sulfate (SDS) was not successful; perhaps due to the denaturation of streptavidin on the sensor surface. The concentration of Triton X-100 (0.1%) was found to be a factor, since higher concentrations resulted in loss of surface tension of the crude lysate aliquot on the sensor surface and cross-contamination among adjacent sensors within the array. The total lysis time of 10-minute is a significant improvement over prior reports of 'rapid' bacterial lysis, which may take up to 1 hour incubation time. Using our lysis approach, direct detection of bacterial 16S rRNA without the need for additional nucleic acid purification step was successfully achieved. The mechanism of signal production (i.e. current output) by the electrochemical sensor used in these studies involves cycling of HRP redox reaction products driven by the applied voltage potential at the sensor surface (2, 4). Because cycling is diffusion limited, the proximity of HRP (the signal transducer) and the sensor surface is likely to be an important determinant of overall signal strength. For this reason, we examined the effect of distance between the fluorescein molecule and the sensor surface on signal intensity. Experiments with 5'-biotin and 3'-fl.uorescein double-labeled oligonucleotides showed that signal intensity was higher for 40mers than for 20mers or 60mers (Fig. 9). These studies prompted an examination of the effect of fluorescein modification location of detector probes. As shown in Fig. 8 and Table 6, 3'-fluorescein modified detector probes consistently outperform 5'-fluorescein modified detector probes. The 3' modification effectively moves the fluorescein away from the sensor surface by 35bp or 119 A.

Coupled with the finding that both 3' modification and 40mer Test Probe yielded higher signals compared to their experimental counterparts (5' modification and 20mer Test Probe, respectively) in which the HRP would presumably be 'closer' to the sensor, we conclude that, the while the proximity of the HRP to the sensor surface is important, optimal binding of the bulky anti-fluorescein Fab-HRP complex to the probe-target complex requires approximately 24θA. Although the physical configurations and dimensions of the anti-fluorescein Fab-HRP complex are not known, their individual structures have been previously described: anti-fluorescein Fab fragment is 43 x 44 x 58 A (6) and HRP is 40 x 67 x 117 A (1). Assuming that each base pair adds 3.4 A to the length of the DNA double helix (5),_a 5' fluorescein-modified detector probe will be 36 bp or 122.4 A from the sensor surface, whereas the 3' fluorescein-modified probe will be 70 bp or 238 A.

While the actual size of the hybridization complex and the distance between HRP to the sensor surface in situ are likely dynamic, several mechanisms of signal reduction may be proposed if HRP is too close to the sensor surface. One interpretation of this result is that binding of the anti-fluorescein Fab-HRP to fluorescein may be sterically hindered. The observation that dual modification of the detector probe with 5' and 3' fluorescein molecules did not improve the signal may be explained by steric hindrance of efficient simultaneous binding of the anti-fLuorescein Fab-HRP to both the 5' and 3' fluorescein. If the HRP is in physical contact (even transiently) with the sensor surface, the self- assembled monolayer may be locally disrupted and the electrical conductance impaired. The HRP substrates may also have limited access into the enzyme active site if it is too close to the sensor surface and thus affecting the electron transfer between oxidized substrates and the electrodes. The observations that a relatively short window of optimal distance between the HRP and the sensor surface illustrates the specificity of the detection strategy and that binding of detector probes to other regions of the 16S rRNA molecule would be unlikely contribute to signal intensity.

This example demonstrates that signal intensity is higher using Enterococcus and E.coli- specific capture and detector probe pairs that lack a gap between their hybridization sites. DNA sandwich assays typically involve a short gap distance between the hybridization sites of the capture and detector probes or the utilization of a intervening unlabeled oligonucleotide. Recently, Metfies et al, have suggested that inclusion on a short unlabeled oligonucleotide between the capture and detector probe led to improved signals in their optical-based detection (3). In previous studies we noted that the shorter UNI probes, which have no gap between the capture and detector probe hybridization sties, consistently yielded higher signals (1.5-4 fold) then the species-specific probes which has 6 bp gap between the hybridization sites. We tested the effect of a 6 bp gap between the capture and detector probe hybridization sites, independent of the target sequence of the 16S rRNA and the length of the probes. Figure 8A shows that for using EF probes of same length targeting the same region, removal of the iαterprobe gap distance (Figure 8A, bar 1 and 2) resulted in 4-fold improvement of the signal output. Similar results are seen with removing the gap for EC probe hybridization site.

Without being bound by any particular theory, we postulate various non-mutually exclusive explanations for the improvement in signal strength by removal of the gap distance between the capture and detector probes. Changes in probe sequences by 6 bp to 'close the gap' may affect the hybridization kinetics by increasing the CG bps relative to AT bps. The observation that the improvement appears to hold across different sequences across 16S rRNA is suggestive that other physical characteristics irrespective of the sequence may explain that absence of a gap between capture and detector probes may be more thermodynamically stable. A single stranded gap sequence may be thermodynamically less favorable towards the hybridization of flanking capture and detector probes; whereas the absence of such single stranded sequences may render a more stable configuration. For RNA targets with complex secondary structures such as 16S rRNA, binding of the first probe may result in unwinding of rRNA helix structures and stabilize binding of the second probe. The thermodynamic advantages of such unwinding may be best realized with sequential binding of a flanking probe binding to a site immediately adjacent to the first probe. Others have suggested the use of an unlabeled bridging oligonucleotide between capture and detector probes to improve electrochemical signals (3). RNA degradation could affect the success of the sandwich formation if the probe hybridization sites are not contiguous are situated far apart.

In previous studies, detector probes were added separately to the bacterial lysate for hybridization then deposited on the sensor surface containing the capture probe. For each capture probe, therefore, a separate detector probe is added. Since the capture probes are designed from different areas within the 16S rDNA, a 'universal' detector probe from a fixed region of the 16S rDNA is not possible since the distance between the capture probes and the universal detector probe is likely too large. We tested whether it would be possible to mix the detector probes as a cocktail. In order for the use of detector probe mixtures to be successful, the following criteria need to be met: 1) species-specificity conferred by capture probe; 2) no loss in signal output due to probe- probe hybridization; and 3) no significant increase in background noise resulting from non-specific binding of the detector probes to the target and the sensor surface.

Representative results shown in Fig. 9 indicate that comparable positive signals are obtained with the 2-detector-probe cocktail with the appropriate target compared to using a single detector probe. Specificity of the capture probes was retained despite using detector probe combinations. The 2-detector probe mixture did not contribute to higher background signals. The use of probe mixtures would greatly simplify the detection protocol when using a multiple detector probe mixture for identification of uropathogens in a clinical urine specimen. The advantage of using a detector probe mixture is indicated in Fig. 10 in which a IJTI Chip' containing different capture probes is used to query a cultured specimen containing Enterococcus using the detector probe cocktail. The use of a detector probe mixture would facilitate the design and fabrication of the microfluidics-based sample preparation module since a single reservoir and channel can be used as supposed to individual reservoir and channel for each detector probe. We have initiated a clinical validation study using the detector probe mixture to test against unknown clinical urine specimens.

This example examines several aspects of an electrochemical DNA biosensor system for uropathogen detection to identify the determinants of signal intensity. A 'universal' lysis cocktail was developed, capable of releasing target nucleic acids from both Gram-positive and -negative uropathogens. The effects of probe length, fluorescein modification position, and distance between capture and detector probe hybridization sites were examined. Finally, the feasibility of a detector probe cocktail was demonstrated. Our findings will improve the performance of electrochemical sensors for detection of bacterial pathogens in clinical specimens. Simplified sample preparation will greatly reduce the design complexity of the microfluidics component when the sensor array is eventually integrated into an automated device. This provides for the development of a portable, point-of-care pathogen detection system that would revolutionize the diagnosis and management of infectious diseases.

Literature cited:

1. Bard AJ and Faulkner LR. Potential Sweep Methods. In: Electrochemical Methods: fundamentals and applications (second ed.). Hoboken: John Wiley & Sons, Inc., 2001, p.226- 260.

2. Berglund GI, et al. Nature 417: 463-468, 2002. 3. Drummond TG, et al. Nat Biotechnol 21: 1192-1199, 2003. 4. Gau JJ, et al. Bioseαs Bioelectron 16: 745-755, 2001.

5. Griebling TL. J Urol 173: 1288-1294, 2005.

6. Griebling TL. J Urol 173: 1281-1287, 2005.

7. Metfies K, et al. Biosens Bioelectron 20: 1349-1357, 2005. 8. Pearson JE, et al. Ann Clin Biochem 37 (Pt 2): 119-145, 2000.

9. Watson JD and Crick FH. Nature 171: 737-738, 1953.

10. Whitlow M, et al. 1.85 Protein Eng 8: 749-761, 1995.

While the above is a complete description of the preferred embodiments of the invention, various alternatives, modifications, and equivalents may be used. Therefore, the above description should not be taken as limiting the scope of the invention which is defined by the appended claims.

Claims

What is claimed is:

1. A method for detecting the presence of a pathogen in a specimen, the method comprising:

lysing a specimen of interest to produce a lysate of the specimen, wherein the lysing releases nucleic acid molecules from the pathogen;

contacting the lysate of the specimen with a capture probe immobilized on a substrate, wherein the capture probe comprises an oligonucleotide that specifically hybridizes with a first target nucleic acid sequence region of the pathogen;

wherein the lysate is in contact with a detector probe that comprises a detectably labeled oligonucleotide that specifically hybridizes with a second target nucleic acid sequence region of the pathogen,

whereby detection of the detectable label complexed with the substrate is indicative of the presence of the corresponding pathogen.

2. The method of claim 1, wherein the first and second nucleic acid sequences of the pathogen are adjacent to each other.

3. The method of claim 1, wherein the lysate is brought into contact with the detector probe prior to the contacting of the lysate with the capture probe.

4. The method of claim 1, wherein the lysate is brought into contact with the detector probe after the contacting of the lysate with the capture probe.

5. The method of claim 1, wherein the lysing comprises contacting the specimen with a first lysis buffer comprising a non-denaturing detergent and lysozyme;

6. The method of claim 5, wherein the lysing comprises further contacting the specimen with a second lysis buffer comprising NaOH.

7. The method of claim 5, wherein the further contacting of the specimen with the second lysis buffer occurs prior to the contacting of the specimen with the first lysis buffer.

8. The method of claim 5, wherein the further contacting of the specimen with second lysis buffer occurs after the contacting of the specimen with the first lysis buffer.

9. The method of claim 5, wherein the contacting of the specimen with the first and/ or second lysis buffers occurs at room temperature.

10. The method of claim 5, wherein the contacting of the specimen with the first and/ or second lysis buffers occurs for about 5 minutes per lysis buffer.

11, The method of claim 1, wherein the detectable label is at the 3' end of the detector probe.

12. The method of claim 1, wherein the detectable label is at the 5' end of the detector probe.

13. The method of claim 1, wherein the oligonucleotide probes are 10-50 base pairs in length.

14. The method of claim 1, wherein the oligonucleotide probes are 20-40 base pairs in length.

15. The method of claim 1, wherein the pathogen is a uropathogen.

16. The method of claim 1, wherein the pathogen is selected from the group consisting of E. coli, P. mirabitis, P. aeruginosa, Enterococcus spp., Klebsiella spp. and

Enterobactersp^.

17. The method of claim 1, wherein the specimen is a bodily fluid.

18. The method of claim 17, wherein the specimen is urine.

19. An assay kit for detecting a plurality of pathogens comprising:

(a) an electrochemical sensor array comprising a plurality of electrodes;

(b) a plurality of paired oligonucleotide probes that specifically hybridize to nucleic acid sequences of corresponding pathogens, wherein each pair of probes comprises:

(i) a capture probe bound to one of the electrodes, the capture probe having a first detectable label; and

(ii) a detector probe having a second detectable label;

wherein the capture probe and detector probe of each pair of probes specifically hybridize to adjacent nucleic acid sequences of a corresponding pathogen.

20. The assay kit of claim 19, wherein the second detectable label is at the 3' end of the detector probe.

21. The assay kit of claim 19, wherein the second detectable label is at the 5' end of the detector probe.

22. The assay kit of claim 19, wherein the oligonucleotide probes are 10-50 base pairs in length.

23. The assay kit of claim 19, wherein the oligonucleotide probes are 20-40 base pairs in length.

24. The assay kit of claim 19, wherein the pathogen is a uropathogen.

25. The assay kit of claim 19, wherein the pathogen is selected from the group consisting of E. coli, P. mirabilis, P. aeruginosa, Enterococcus spp., Klebsiella spp. and Εnterobacter spp.