WO2005042777A2

WO2005042777A2 - App/ena antisense

Info

Publication number: WO2005042777A2
Application number: PCT/GB2004/004483
Authority: WO
Inventors: Peter Estibeiro; David Page; Jenny Godfray; Eleanor Barnard; Makoto Koizumi
Original assignee: Expresson Biosystems Limited; Sankyo Company Limited
Priority date: 2003-10-24
Filing date: 2004-10-22
Publication date: 2005-05-12
Also published as: GB0324854D0; WO2005042777A3

Abstract

The present invention relates to strategies to address the deposition of APP which is associated with early etiology of disease states, such as Alzheimer's disease, by reducing the early deposition of amyloid ß peptide (Aß) in the brain. The strategies can also be used as research tools. The invention uses silencing reagents in the form of specific antisense molecules or siRNA to modulate APP.

Description

APP/ENA Antisense

The present invention relates to strategies to address the deposition of APP which is associated with early etiology of disease states, such as Alzheimer's disease, by reducing the early deposition of amyloid β peptide (Aβ) in the brain.

The deposition of amyloid β peptide (Aβ) , derived by proteolytic processing of the amyloid precursor protein is thought to be a crucial event in the etiology of Alzheimer's disease. Evidence suggests that increased production of a form of amyloid β pept±de (Aβ) known at Aβχ-₄₂ is the key etiological step in the development of the disease. Aβ_₄₂ forms fibrils at elevated concentration that can aggregate and lead directly to neuronal death.

Both Aβχ-₄₂ and its precursor APP have been considered as therapeutic targets against Alzheimer's disease. It is thought that preventing the disease-associated increase in Aβχ.₂ either directly, or by reducing the concentration of APP, will slow or even prevent the onset of Alzheimer's disease. There have been recent antisense experiments in both mice and rats to.validate the concept that reducing the levels of APP in the brain can reverse deficits in learning and memory that are often found in patients suffering from Alzheimer's disease.

Antisense technology offers a precise and specific means of knocking down expression of a target gene and is a major focus for research in both neuroscience and in a number of other areas. Antisense technology is also emerging as a therapeutic technology of immense potential, with the antisense concept being both simple and elegant . Gene expression relies on genomic DNA sequences being transcribed into messenger R As (mRNA) which in turn are themselves translated into proteins . An antisense oligonucleotide (AS-ODN) is a short nucleic acid sequence or analogue of such sequence that is able to hybridise specifically to complementary sequences within its mRNA target. This prevents its translation by either or both of the two postulated mechanisms. Either the transcript is degraded by an antisense oligonucleotide mediated recruitment of endogenous RNase H, or the presence of the antisense oligonucleotide interferes with assembly of the translation initiation complex, leading to translational arrest. Any existing protein encoded by the target gene depletes as a function of its half-life, and thus a rapid and highly specific knockdown is achieved.

Similarly siRNA (or small interfering RNA) can also be used for gene silencing. Throughout this document, the term silencing reagents can be taken to cover both antisense oligonucleotides and siRNAs .

Current treatment for Alzheimer' s disease relies on the prevention or alleviation of symptoms and/or the slowing down of the progression of the disease. Anti-Alzheimer drugs, such as Aricept™ and Cognex™ cause a net increase in the amount of acetylcholine available in the brain, and thus slow down the loss of cognitive ability. Other strategies that have been put forward rely on antioxidant compounds to minimise free radical damage, for example Eldepryl, and Estrogen therapy may also confer protection.

Thus far, none of the existing or available strategies address the early etiology of the disease and/or attempt to alleviate late stage symptoms. Therefore, there exists considerable unmet need for therapeutic strategies that prevents the early deposition of A ι-₄₂ in the brain. US Patent Application US2003/0092003 describes the use of antisense to modulate expression of the APP gene transcript. However, the document does not describe any sequences of the APP gene that are accessible to bind silencing reagents such as antisense reagents, and the antisense molecules described in the earlier document are not of particularly high affinity or in certain cases will not work.

It can be seen that it would be beneficial to provide sequences of the APP gene that are accessible to bind silencing reagents. It is an object of this invention to provide specific silencing reagents for binding to and modulating APP.

It can also be seen that it would be beneficial to provide improved affinity silencing reagents such as antisense molecules and siRNAs .

According to a first aspect of the present invention, there are provided silencing reagents that are able to bind to the accessible region of APP, for use in the modulation of APP, selected from the following list of antisense sequences of APP; CATTCTGGACATTCATGTGCATGTTCAGTCTGCCACAGAACATGG AACATGGCAATCTGGGGTTCAGCCAGCAGGCCA GTGGGGATGGGTCTTGCACTGCTTGCGGCCC GATCTGCAGTTCAGGGTAGACTTCTTGGCAA TTCCACCTCAGCCACTTCTTCCTCCTCTGCTACTTCTACTACTTT GACATCCGAGTCATCCTCCTCCGCATCAGCAGAAT TGCTCGGCACGGCCCCGTCTCGGCTTGTTCAGA GCAATGCTGGTGGTTCTCTCTGTGGCTTCTTCGTAGGGTTC CCTCATCACCATCCTCATCGTCCTCGTCATC CATGCAGTACTCTTCTGTGTC AAAGTTGTTCCGGTTGCCGCCACA GTTGCCGCCACATCCGCCGTAAAA AAAGAATGGGGCACACTTCCCTTCAGTCACATCAAA CAAGTTCTTTGCTTGACGTTCTGCCTCTTCCCATTCTCT ATAAATCACACGGAGGTGTGTCATAACCTGGGACCGGATCTG AAAATGCATAGTGATCAGGAA GCAGCTGAACTCCCACGTTCACAT AAAGTAGGACTTAATTGGGTCACAAACCACAAGAAT AATATACAACTGGCTAAGGGGCTATGTGAT GGAGAGAATCTATTCATGCACTAGTTT AACAAACGTGTGTATCCTCTTAAT ACAGGTGGCGCTCCTCTGG TCTGGGGTGACAGCGGCGT CAAACATCCATCCTCTCCT CCTCTCCTGGTGTAAGAAT GTTCCGGTTGCCGCCACAT TGCCGCCACATCCGCCGTA TCCTTCTGTTCTGCGCGGA CGCGGACATACTTCTTTAG GACGTTCTGCCTCTTCCCA CCTCTTCCCATTCTCTCAT GGATCCACCAGCGCACATG TCGGAACTTGTCAATTCCG GATGGGTAGTGAAGCAATG CATGATTGTGATCGTGGTG

Optionally the silencing reagents are fragments of sequences from the abovementioned list.

A further option is that the silencing reagents show >90% homology to the antisense sequences from the abovementioned list.

Optionally the antisense sequences are combined with sense strands to form siRNA.

Preferably in the siRNA antisense strands the T bases are replaced with U bases.

Preferably silencing reagents that are able to bind to accessible parts of an APP gene, wherein the antisense reagents are modified by the incorporation of ethylene bridged nucleic acids (ENAs) . The silencing reagents are antisense reagents or small interfering RNA.

Preferably the silencing reagents comprise a mixture of ethylene bridged nucleic acids (ENAs) , and unmodified nucleic acids, such that the unmodified nucleotides promote enzymatic cleavage of the RNA strand of a hetero duplex formed between the antisense reagent and a target RNA transcript by means of recruiting RNase H or a similar endogenous or ectopic enzyme.

Alternatively, silencing reagents comprise a mixture of ethylene bridged nucleic acids and any type of modified nucleotide that is able mediate cleavage of a target transcript by RNase H.

Preferably the antisense reagents are chosen from the following sequences: CATTCTGGACATTCATGTGCATGTTCAGTCTGCCACAGAACATGG AACATGGCAATCTGGGGTTCAGCCAGCAGGCCA GTGGGGATGGGTCTTGCACTGCTTGCGGCCC GATCTGCAGTTCAGGGTAGACTTCTTGGCAA TTCCACCTCAGCCACTTCTTCCTCCTCTGCTACTTCTACTACTTT GACATCCGAGTCATCCTCCTCCGCATCAGCAGAAT TGCTCGGCACGGCCCCGTCTCGGCTTGTTCAGA GCAATGCTGGTGGTTCTCTCTGTGGCTTCTTCGTAGGGTTC CCTCATCACCATCCTCATCGTCCTCGTCATC CATGCAGTACTCTTCTGTGTC AAAGTTGTTCCGGTTGCCGCCACA GTTGCCGCCACATCCGCCGTAAAA AAAGAATGGGGCACACTTCCCTTCAGTCACATCAAA CAAGTTCTTTGCTTGACGTTCTGCCTCTTCCCATTCTCT ATAAATCACACGGAGGTGTGTCATAACCTGGGACCGGATCTG AAAATGCATAGTGATCAGGAA GCAGCTGAACTCCCACGTTCACAT AAΆGTAGGACTTAATTGGGTCACAAACCACAAGAΆT AATATACAACTGGCTAAGGGGCTATGTGAT GGAGAGAATCTATTCATGCACTAGTTT AACAAACGTGTGTATCCTCTTAAT

Preferably the siRNA are chosen from the following antisense strands combined with corresponding sense strands; ACAGGUGGCGCUCCUCUGG UCUGGGGUGACAGCGGCGU CAAACAUCCAUCCUCUCCU CCUCUCCUGGUGUAAGAAU GUUCCGGUUGCCGCCACAU UGCCGCCACAUCCGCCGUA UCCUUCUGUUCUGCGCGGA CGCGGACAUACUUCUUUAG GACGUUCUGCCUCUUCCCA CCUCUUCCCAUUCUCUCAU GGAUCCACCAGCGCACAUG UCGGAACUUGUCAAUUCCG GAUGGGUAGUGAAGCAAUG CAUGAUUGUGAUCGUGGUG

Preferably the siRNA are prepared such that the sense and antisense strands are formed with an overhang.

Most preferably the antisense sequences are flanked by between one and ten modified synthetic nucleotides that may themselves form part of the antisense sequence, or may not . Most preferably the modified synthetic nucleotides are ethylene bridged nucleic acids .

In order to provide a better understanding of the present invention, we will now describe embodiments by way of example only, and with reference to the following Figures, in which:

Figures 1 to 5 show the results of a series of structure mapping experiments to determine accessible regions on the APP gene;

Figure 6 shows the relative level of knockdown of the human APP gene transcript achieved by the indicated antisense oligonucleotide;

Figure 7 shows the comparison between selected antisense reagents comprising either ENA, LNA or phosphorothioate chemistries;

Figure 8 shows the structure of A^p;

Figure 9 shows the structure of G^p;

Figure 10 shows the structure of C^p;

Figure 11 shows the structure of T^p;

Figure 12 shows the structure of A^e2t;

Figure 13 shows the structure of A^e2p; Figure 14 shows the structure of G^e2t;

Figure 15 shows the structure of G^e2p;

Figure 16 shows the structure of C^e2t;

Figure 17 shows the structure of C^e2p;

Figure 18 shows the structure of T^e2t;

Figure 19 shows the structure of τ^e2p;

Figure 20 is a bar graph showing the results of experiments to determine the ability of siRNA sequences to knockdown APP mRNA;

The present invention is based around using a method for empirically mapping the structure of the APP gene transcript using an ACCESSarray^® . An ACCESSarray^® is a microarray based on a structure mapping system, as described in O02/072886. The microarray may be fully degenerate or may be molecule specific. RNA structures are mapped empirically as opposed to by algorithm, which confers both time and cost benefits. A human, or any other species, APP transcript can be reacted with the ACCESSarray^® and the interaction pattern can then be interpreted into an access map of the target transcript, which in this case is APP. Figure 1 shows an example of an APP access map. Once the accessible region is determined, the antisense reagents or siRNAs can be designed based on this and, in the case of siRNA, other factors for choosing appropriate sequences can be taken into account as has been described in the art. Antisense reagents designed to be complementary to accessible regions as determined by interpreting the ACCESSarray^® map will be effective modulators of gene expression, and one embodiment of the present invention features ACCESSarray^® facilitated design of antisense reagents effective at modulating the expression of APP.

Oligonucleotides containing novel 2'-0, 4' -C-methylene nucleosides (LNA) whose sugar puckering is fixed in the N conformation have a higher level of affinity towards their complementary RNA and other modified oligonucleotides. The synthesis of novel 2'-0, 4'-C- ethylene nucleosides (ENAs) is reported and described in OOO/47599. In this case it has been found that oligonucleotides containing these ENA residues exhibit equivalent binding affinity to the corresponding oligonucleotides that contain LNA residues. However, they also exhibit much greater nuclease resistance than the corresponding oligonucleotides that contained LNA residues. In one embodiment of the present invention, ENAs are incorporated into the antisense reagents in order to provide improved binding affinity, along with greater nuclease resistance.

In another embodiment the invention features the ACCESSarray^®-facilitated design of small interfering RNA (siRNA) that are effective at modulating expression of APP.

An example relating to antisense is that an APP cDNA clone was transcribed in vitro and was applied to a molecule specific array. A molecule specific array comprises overlapping oligonucleotide elements each complementary to the APP transcript . Each oligonucleotide on the array has between 12 and 15 bases of complementarity to APP and each overlaps the next by 2 nucleotides . Each molecule specific array has a set of oligonucleotide probes that cover either a portion of the full APP transcript or the full APP transcript. The position of each oligonucleotide on the array is known.

An example relating to siRNA is that an APP cDNA clone was transcribed in vitro and was applied to a fully degenerate array. A fully degenerate array of this type comprises 4096 elements, the final six nucleotides on each element being one of every combination of bases for a 6-base sequence. Thus every possible 6-base sequence is represented on the array. The specific individual 6- base sequence at each of the 4096 positions on the array is known.

In both cases software package such as ACCESSmapper™ interprets the array and builds up an access map by interpreting each element with reference to the known target. It is possible to determine which of the elements on the array are binding to the APP. Antisense reagents can then be built up on the basis of the access map that is generated for the target.

Antisense reagents may be chemically synthesised nucleic acids modified by the incorporation of ethylene bridged nucleic acids (ENA) . Antisense reagents may also comprise a mixture of ENA and unmodified nucleotides such that the unmodified nucleotides promote cleavage of the RNA strand of a heteroduplex formed between the antisense reagent and the target RNA transcript .

Antisense reagents may also comprise a mixture of ENA and any other modified nucleotide that is able to mediate cleavage of a target transcript by RNase H.

Antisense reagents comprising an ENA component confer advantages over the prior art because they confer very high affinity interactions between the antisense reagent and the target transcript with minimal toxicity. These properties confer therapeutic advantage over the prior art . A combination of ENA based antisense reagents comprising a mixture of several individual oligonucleotides directed against different accessible regions on APP target transcript is also envisaged here. Mixtures of oligonucleotides may interact with multiple accessible regions on the same transcript or may interact with the same or different accessible regions on multiple transcripts.

To clarify possible structures and sequences of ENA oligonucleotides there is provided below a number of examples of ENA synthesis work that has been carried out. Structures of A^p, G^p, C^p, T^p, A^e2p , G^e2p, C^e2p' T^e2p, A^e2 , G^e2 , C^e2t and T^e2t in Examples are illustrated in Figures 8 to 19 .

Example 1 ; APP1- 666 ; HO-G^{e p}-T^e2p-G^e2p-C^e2p-A^e2p-T^e2p-G^p-T^p-T^p-C^p-A^p-G^p-T^e2p- Synthesis of an oligonucleotide derivative was carried out using a DNA/RNA synthesiser (ABI model 394: a product of Perkin-Elmer Corporation) on 1.0 μmole program. The solvents, reagents and concentrations of phosphoramidite in every synthetic cycle are the same as those in the synthesis of natural oligonucleotides. Solvents, reagents and phosphoramidites of the natural type nucleosides are products of PE Biosystems Corporation. Every modified oligonucleotide derivative sequence was synthesised by condensation of the ENA phosphoramidites obtained in Examples 9, 14, 22 and 27 described in O0107455. Universal-Q 500 (1.2 μmol, Glen Research) was used as the CPG.

The synthetic cycle is as follows : 1) detritylation trichloroacetic acid/dichloromethane; 35sec 2) coupling phosphoramidite (about 20eq) , 1H- tetrazole/acetonitrile; 25sec or 15min 3) capping 1-methylimidazole/tetrahydrofuran, acetic anhydride/pyridine/tetrahydrofuran; 15sec 4) oxidation iodine/water/pyridine/tetrahydrofuran; 15sec

In the above cycle 2, when the ENA phosphoramidites were used the reaction time was 15 min and when natural DNA phosphoramidites were used the reaction time was 25 sec.

After synthesis of a desired oligonucleotide on the DNA synthesiser, the carrier containing the desired product was conventionally treated with concentrated aqueous ammonia solution in order to detach the oligomer from the carrier and to deprotect the cyanoethyl group that is protecting the phosphate. In this step, the amino protecting groups in adenine, guanine and cytosine were also removed from the oligomer. The crude oligonucleotide was purified by reverse-phase HPLC (HPLC: LC-VP: a product of Shimazu Corp.; column : Wakopak WS-DNA (10 x 250 mm): a product of ako Pure Chemical Industry Ltd.; solvent A: 5% acetonitrile, 0.1 M triethylammonium acetate (TEAA, pH 7.0); solvent B: acetonitrile; B% : 10%- 50% (linear gradient, 10 min) , 50% (10 min) , and then 50%-70% (linear gradient, 5 min), temperature : 60°C ; flow rate: 2 mL/min; detection: 254 nm) . The collected fraction was co-evaporated with H₂0 to remove TEAA. The residues were treated with 80% acetic acid for 20 min to detach dimethoxytrityl group from the oligonucleotide, and then the mixture was concentrated in vacuo . The oligonucleotide was purified by reverse-phase HPLC (HPLC: LC-VP: a product of Shimazu Corp.; column : Wakopak WS- DNA (10 x 250 mm) : a product of Wako Pure Chemical Industry Ltd.; solvent A: 5% acetonitrile, 0.1 M TEAA (pH 7.0); solvent B: acetonitrile; B% : 0%-10% (linear gradient, 15 min), 10% (5 min), and then 10%-15% (linear gradient, 5 min), temperature: 60°C ; flow rate: 2 mL/min; detection: 254 nm) . According to this synthetic method, the oligonucleotide, APP1-666, was obtained (14.7 A₂₆o units) . This sequences is complementary to the nucleotide number 262-279 of APP cDNA (GenBank accession No. NM_000484) .

Ultraviolet Absorption Spectrum (H₂0) : λmax = 261 nm Retention time: 8.70 min (reverse-phase HPLC: LC-VP: a product of Shimazu Corp.; column : Chromolith Performance RP-18e (4.6 x 100 mm, Merck); solvent A: 5% acetonitrile, 0.1 M TEAA (pH 7.0); solvent B: acetonitrile; B% : 0%-10% (linear gradient, 10 min); temperature : 60°C ; flow rate: 2 mL/min; detection: 254 nm) .

Negative ion ESI mass spectroscopy: calcd: 6042.15, found: 6042.98.

Example 2 ;

APP2 - 666 ; HO-T^e2p-C^e2p-A^e2p-T^e2p-G^e2p-T^e2p-G^p-C^p-A^p-T^p-G^p-T^p-T^e2p- e2p _ a e2p _ Qβ2 _ ,j,e2p _ ^,e2 _ „

ENA oligonucleotide, APP2-666, was synthesised according to the similar method of Example 1, APP1-666. According to this synthetic method, the oligonucleotide, APP2-666, was obtained (32.3 A₂₆₀ units). This sequences is complementary to the nucleotide number 266-283 of APP cDNA (GenBank accession No. NM_000484) .

Ultraviolet Absorption Spectrum (H₂0) : λmax = 255 nm Retention time: 9.04 min (reverse-phase HPLC: LC-VP: a product of Shimazu Corp.; column : Chromolith Performance RP-18e (4.6 x 100 mm, Merck); solvent A: 5% acetonitrile, 0.1 M TEAA (pH 7.0); solvent B: acetonitrile; B% : 0%-10% (linear gradient, 10 min); temperature: 60°C ; flow rate: 2 mL/min; detection: 254 nm) .

Negative ion ESI mass spectroscopy: calcd: 6027.14, found: 6026.94.

Example 3 :

APP3/4-666: HO-G^e2p-G^e2p-T^e2p-C^e2p-T^e2p-T^e2p-G^p-C^p-A^p-C^p-T^p-G^p- β2p _ η,e2p _ _mβ2p _ Qβ2 _ „e2p _ „e2 _ -, ENA oligonucleotide, APP3/4-666, was synthesised according to the similar method of Example 1, APPl-666. According to this synthetic method, the oligonucleotide, APP3/4-666, was obtained (19.1 A₂₆₀ units). This sequences is complementary to the nucleotide number 451-468 of APP cDNA (GenBank accession No. NM_000484) .

Ultraviolet Absorption Spectrum (H₂0) : λmax = 259 nm Retention time: 8.77 min (reverse-phase HPLC: LC-VP: a product of Shimazu Corp.; column : Chromolith Performance RP-18e (4.6 x 100 mm, Merck); solvent A: 5% acetonitrile, 0.1 M TEAA (pH 7.0); solvent B: acetonitrile; B% : 0%-10% (linear gradient, 10 min); temperature: 60°C ; flow rate: 2 mL/min; detection: 254 nm) .

Negative ion ESI mass spectroscopy: calcd: 6044.13, found: 6044.04.

Example 4; APPll - 666 : HO-G^e2p-C^e2p-C^e2p-A^e2p-C^e2p-A^e2p-T^p-C^p-C^p-G^p-C^p-C^p- G^e2P_ ^{e p}- A^e2p-A^e2p-A^{e p}-A^{e t}-H

ENA oligonucleotide, APPll-666, was synthesised according to the similar method of Example 1, APPl-666. According to this synthetic method, the oligonucleotide, APPll-666, was obtained (34.9 A_26o units). This sequences is complementary to the nucleotide number 1105-1122 of APP cDNA (GenBank accession No. NM_000484) .

Ultraviolet Absorption Spectrum (H₂0) : λmax = 259 nm Retention time: 8.02 min (reverse-phase HPLC: LC-VP: a product of Shimazu Corp.; column : Chromolith Performance RP-18e (4.6 x 100 mm, Merck); solvent A: 5% acetonitrile, 0.1 M TEAA (pH 7.0); solvent B: acetonitrile; B% : 0%-10% (linear gradient, 10 min); temperature: 60°C ; flow rate: 2 mL/min; detection: 254 nm) .

Negative ion ESI mass spectroscopy: calcd: 5984.13, found: 5984.43.

Example 5 :

APP13-666: HO-A^e2p-C^e2p-A^e2p-C^e2p-T^e2p-T^e2p-C^p-C^p-C^p-T^p-T^p-C^p-

, e2p _ β2p _ r e2p _ β2p _ ■. e2p _ «e2 _ -.

ENA oligonucleotide, APP13-666, was synthesised according to the similar method of Example 1, APPl-666. According to this synthetic method, the oligonucleotide, APP13-666, was obtained (21.8 A₂₆o units). This sequences is complementary to the nucleotide number 1078-1094 of APP cDNA (GenBank accession No. NM_000484) .

Ultraviolet Absorption Spectrum (H₂0) : λmax = 266 nm Retention time: 8.05 min (reverse-phase HPLC: LC-VP: a product of Shimazu Corp.; column : Chromolith Performance RP-18e (4.6 x 100 mm, Merck); solvent A: 5% acetonitrile, 0.1 M TEAA (pH 7.0); solvent B: acetonitrile; B% : 0%-10% (linear gradient, 10 min); temperature : 60°C ; flow rate: 2 mL/min; detection:254 nm) .

Negative ion ESI mass spectroscopy: calcd: 5915.09, found: 5915.00.

Example 6 ;

Control APPAS2-666; HO-C^e2p-C^e2p-A^e2p-G^e2p-T^e2p-G^e2p-A^p-A^p-G^p-A^p-

T^p-G^p-A^e2p-G^e2p-T^e2p-T^θ2p-T^e2p-C^e2t-H ENA oligonucleotide, Control APPAS2-666, was synthesised according to the similar method of Example 1, APPl-666. According to this synthetic method, the oligonucleotide, Control APPAS2-666, was obtained (22.9 A₂₆o units). This sequences is complementary to the nucleotide number 580- 597 of APP cDNA (GenBank accession No. NM_000484) .

Ultraviolet Absorption Spectrum (H₂0) : λmax = 255 nm Retention time: 7.44 min (reverse-phase HPLC: LC-VP: a product of Shimazu Corp.; column : Chromolith Performance RP-18e (4.6 x 100 mm, Merck); solvent A: 5% acetonitrile, 0.1 M TEAA (pH 7.0); solvent B: acetonitrile; B% : 0%-10% (linear gradient, 10 min); temperature: 60°C ; flow rate: 2 mL/min; detection: 254 nm) .

Negative ion ESI mass spectroscopy: calcd: 6085.19, found: 6085.09.

Example 7 : Scrambled APPAS2-666: HO-A^e2 -T^e2p-G^e2p-A^e2p-T^e2p-T^e2p-G^p-T^p-G^p- A^p-T^p-G^p-C^e2p-T^e2p-C^e2p-C^e2p-T^e2p-C^e2t-H

ENA oligonucleotide, Scrambled APPAS2-666, was synthesised according to the similar method of Example 1, APPl-666. According to this synthetic method, the oligonucleotide, Scrambled APPAS2-666, was obtained (42.5 A₂₆₀ units) .

Ultraviolet Absorption Spectrum (H₂0) : λmax = 262 nm Retention time: 8.76 min (reverse-phase HPLC: LC-VP: a product of Shimazu Corp.; column : Chromolith Performance RP-18e (4.6 x 100 mm, Merck); solvent A: 5% acetonitrile, 0.1 M TEAA (pH 7.0); solvent B: acetonitrile; B% : 0%-10% (linear gradient, 10 min); temperature: 60°C ; flow rate: 2 mL/min; detection: 254 nm) .

Negative ion ESI mass spectroscopy: calcd: 6041.17, found: 6041.18.

Example 8 :

APPl-585 : HO-G^e2p-T^e2p-G^e2p-C^e2p-A^e2p-T^p-G^p-T^p-T^p-C^p-A^p-G^p-T^p- pe2p _ _™e2p _ e2p _ pβ2p _ «e2t _ J_J

ENA oligonucleotide, APPl-585, was synthesised according to the similar method of Example 1, APPl-666. According to this synthetic method, the oligonucleotide, APPl-585, was obtained (30.2 A₂₆₀ units). This sequences is complementary to the nucleotide number 262-279 of APP cDNA (GenBank accession No. NM_000484) .

Ultraviolet Absorption Spectrum (H₂0) : λmax = 261 nm Retention time: 8.87 min (reverse-phase HPLC: LC-VP: a product of Shimazu Corp . ; column : Chromolith Performance RP-18e (4.6 x 100 mm, Merck); solvent A: 5% acetonitrile, 0.1 M TEAA (pH 7.0); solvent B: acetonitrile; B% : 0%-10% (linear gradient, 10 min); temperature: 60°C ; flow rate: 2 mL/min; detection:254 nm) .

Negative ion ESI mass spectroscopy: calcd: 5958.08, found: 5958.05.

Example 9 :

APP2-585; HO-T^e2p-C^e2p-A^β2p-T^e2p-G^e2p-T-G^p-C^p-A^p-T^p-G^p-T^p-T^p- e2p _ _j. β2 _ Qβ2p _ β2p _ β2t _ r ENA oligonucleotide, APP2-585, was synthesised according to the similar method of Example 1, APPl-666. According to this synthetic method, the oligonucleotide, APP2-585, was obtained (69.5 A₂₆o units). This sequences is complementary to the nucleotide number 266-283 of APP cDNA (GenBank accession No. NM_000484) .

Ultraviolet Absorption Spectrum (H₂0) : λmax = 260 nm Retention time: 9.41 min (reverse-phase HPLC: LC-VP: a product of Shimazu Corp.; column : Chromolith Performance RP-18e (4.6 x 100 mm, Merck); solvent A: 5% acetonitrile, 0.1 M TEAA (pH 7.0); solvent B: acetonitrile; B% : 0%-10% (linear gradient, 10 min); temperature: 60°C ; flow rate: 2 mL/min; detection: 254 nm) .

Negative ion ESI mass spectroscopy: calcd: 5943.06, found: 5942.93.

Example 10; APP3/4-585; HO-G^e2p-G^e2p-T^e2p-C^e2p-T^e2p-T^p-G^p-C^p-A^p-C^p-T^p-G^p-C^p- ^e2p-T^e2p-G^{e p}-C^e2 -G^e2t-H

ENA oligonucleotide, APP3/4-585, was synthesised according to the similar method of Example 1, APPl-666. According to this synthetic method, the oligonucleotide, APP3/4-585, was obtained (63.8 A_2S0 units). This sequences is complementary to the nucleotide number 451-468 of APP cDNA (GenBank accession No. NM_000484) .

Ultraviolet Absorption Spectrum (H₂0) : λmax = 261 nm

Retention time: 8.71 min (reverse-phase HPLC: LC-VP: a product of Shimazu Corp.; column : Chromolith Performance RP-18e (4.6 x 100 mm, Merck); solvent A: 5% acetonitrile, 0.1 M TEAA (pH 7.0); solvent B: acetonitrile; B% : 0%-10% (linear gradient, 10 min); temperature: 60°C ; flow rate: 2 mL/min; detection: 254 nm) .

Negative ion ESI mass spectroscopy: calcd: 5946.02, found: 5945.92.

Example 11; APP5-585; HO-G^e2p-T^{e p}-T^e2p-G^e2p-G^e2p-T^p-A^p-C^p-T^p-C^p-T^p-T^p-C^p-j,e2p_^e2p_js_Le2p_^e2 _^j,e2t_jj

ENA oligonucleotide, APP5-585, was synthesised according to the similar method of Example 1, APPl-666. According to this synthetic method, the oligonucleotide, APP5-585, was obtained (39.8 A₂₆₀ units). This sequences is complementary to the nucleotide number 622-639 of APP cDNA (GenBank accession No. NM_000484) .

Ultraviolet Absorption Spectrum (H₂0) : λmax = 263 nm Retention time: 8.21 min (reverse-phase HPLC: LC-VP: a product of Shimazu Corp.; column : Chromolith Performance RP-18e (4.6 x 100 mm, Merck); solvent A: 5% acetonitrile, 0.1 M TEAA (pH 7.0); solvent B: acetonitrile; B% : 0%-10% (linear gradient, 10 min); temperature: 60°C ; flow rate: 2 mL/min; detection: 254 nm) .

Negative ion ESI mass spectroscopy: calcd: 5880.00, found: 5879.59.

Example 12; APP6-585 ; HO-G^e2p-C^e2p-A^e2p-A^e2p-G^e2p-T^p-T^p-G^p-G^p-T^p-A^p-C^p-T^p- C^{e p}-T^{e p}-T^e2p-C^o2p-T^e'"-H ENA oligonucleotide, APP6-585, was synthesised according to the similar method of Example 1, APPl-666. According to this synthetic method, the oligonucleotide, APP6-585, was obtained (27.6 A₂6o units). This sequences is complementary to the nucleotide number 626-643 of APP cDNA (GenBank accession No. NM_000484) .

Ultraviolet Absorption Spectrum (H₂0) : λmax = 259 nm Retention time: 8.08 min (reverse-phase HPLC: LC-VP: a product of Shimazu Corp.; column : Chromolith Performance RP-18e (4.6 x 100 mm, Merck); solvent A: 5% acetonitrile, 0.1 M TEAA (pH 7.0); solvent B: acetonitrile; B% : 0%-10% (linear gradient, 10 min); temperature: 60°C ; flow rate: 2 mL/min; detection:254 nm) .

Negative ion ESI mass spectroscopy: calcd: 5943.06, found: 5943.13.

Example 13 ; APP7-585: HO-C^e2p-A^e2p-C^e2p-T^e2p-T^e2p-C^p-T^p-T^p-C^p-C^p-T^p-C^p-C^p- rr^e2p-C^e2p-T^e2p-G^e2p-C^e2t-H

ENA oligonucleotide, APP7-585, was synthesised according to the similar method of Example 1, APPl-666. According to this synthetic method, the oligonucleotide, APP7-585, was obtained (43.9 A₂₆o units). This sequences is complementary to the nucleotide number 832-849 of APP cDNA (GenBank accession No. NM_000484) .

Ultraviolet Absorption Spectrum (H₂0) : λmax = 266 nm Retention time: 8.56 min (reverse-phase HPLC: LC-VP: a product of Shimazu Corp.; column : Chromolith Performance RP-18e (4.6 x 100 mm, Merck); solvent A: 5% acetonitrile, 0.1 M TEAA (pH 7.0); solvent B: acetonitrile; B% : 0%-10% (linear gradient, 10 min); temperature: 60°C ; flow rate: 2 mL/min; detection: 254 nm) .

Negative ion ESI mass spectroscopy: calcd: 5788.97, found: 5788.80.

Example 14 ; APP8-585; HO-C^e2p-A^e2p-G^e2p-C^e2p-C^e2p-A^p-C^p-T^p-T^p-C^p-T^p-T^p-C^p- j^e2P _ ^e2 _ pe2 _ e2p _ ^β2t _ τι

ENA oligonucleotide, APP8-585, was synthesised according to the similar method of Example 1, APPl-666. According to this synthetic method, the oligonucleotide, APP8-585, was obtained (56.6 A₂₆₀ units). This sequences is complementary to the nucleotide number 836-853 of APP cDNA (GenBank accession No. NM_000484) .

Ultraviolet Absorption Spectrum (H₂0) : λmax = 266 nm Retention time: 7.94 min (reverse-phase HPLC: LC-VP: a product of Shimazu Corp.; column : Chromolith Performance RP-18e (4.6 x 100 mm, Merck); solvent A: 5% acetonitrile, 0.1 M TEAA (pH 7.0); solvent B: acetonitrile; B% : 0%-10% (linear gradient, 10 min); temperature: 60°C ; flow rate: 2 mL/min; detection: 254 nm) .

Negative ion ESI mass spectroscopy: calcd: 5826.04, found: 5825.96.

Example 15 ; APP11-585; HO-G^e2p-C^e2p-C^e2p-A^e2p-C^e2p-A^p-T^p-C^p-C^p-G^p-C^p-C^p-G^p- τ^e2p-A^e2p-A^e2p-A^e2p-A^e2t-H ENA oligonucleotide, APP11-585, was synthesised according to the similar method of Example 1, APPl-666. According to this synthetic method, the oligonucleotide, APP11-585, was obtained (48.9 A₂₆₀ units). This sequences is complementary to the nucleotide number 1105-1122 of APP cDNA (GenBank accession No. NM_000484) .

Ultraviolet Absorption Spectrum (H₂0) : λmax = 258 nm Retention time: 8.97 min (reverse-phase HPLC: LC-VP: a product of Shimazu Corp.; column : Chromolith Performance RP-18e (4.6 x 100 mm, Merck); solvent A: 5% acetonitrile, 0.1 M TEAA (pH 7.0); solvent B: acetonitrile; B% : 0%-10% (linear gradient, 10 min); temperature: 60°C ; flow rate: 2 mL/min; detection: 254 nm) .

Negative ion ESI mass spectroscopy: calcd: 5900.06, found: 5899.95.

Example 16; APP12-585; HO-G^e2p-T^e2p-T^e2p-G^e2p-C^e2p-C^p-G^p-C^p-C^p-A^p-C^p-A^p-T^p- C^e2p-C^e2p-G^e2p-C^e2p-C^e2t-H

ENA oligonucleotide, APP12-585, was synthesised according to the similar method of Example 1, APPl-666. According to this synthetic method, the oligonucleotide, APP12-585, was obtained (49.4 A₂₆₀ units). This sequences is complementary to the nucleotide number 1111-1128 of APP cDNA (GenBank accession No. NM_000484) .

Ultraviolet Absorption Spectrum (H₂0) : λmax = 261 nm Retention time: 8.66 min (reverse-phase HPLC: LC-VP: a product of Shimazu Corp.; column : Chromolith Performance RP-18e (4.6 x 100 mm, Merck); solvent A: 5% acetonitrile, 0.1 M TEAA (pH 7.0); solvent B: acetonitrile; B% : 0%-10% (linear gradient, 10 min); temperature: 60°C ; flow rate: 2 mL/min; detection:254 nm) .

Negative ion ESI mass spectroscopy: calcd: 5887.05, found: 5886.51.

Example 17 ;

APP13-585; HO-A^e2p-C^e2p-A^{e p}-C^e2p-T^{e p}-T^p-C^p-C^p-C^p-T^p-T^p-C^p-A^p-

ENA oligonucleotide, APP13-585, was synthesised according to the similar method of Example 1, APPl-666. According to this synthetic method, the oligonucleotide, APP13-585, was obtained (32.4 A₂₆o units). This sequences is complementary to the nucleotide number 1078-1094 of APP cDNA (GenBank accession No. NM_000484) .

Ultraviolet Absorption Spectrum (H₂0) : λmax = 264 nm Retention time: 9.34 min (reverse-phase HPLC: LC-VP: a product of Shimazu Corp.; column : Chromolith Performance RP-18e (4.6 x 100 mm, Merck); solvent A: 5% acetonitrile, 0.1 M TEAA (pH 7.0); solvent B: acetonitrile; B% : 0%-10% (linear gradient, 10 min); temperature: 60°C ; flow rate: 2 mL/min; detection: 254 nm) .

Negative ion ESI mass spectroscopy: calcd: 5831.02, found: 5830.69.

Example 18 ;

APP14-585; HO-G^e2 -G^{e p}-C^e2p-A^e2p-C^e2p-A^p-C^p-T^p-T^p-C^p-C^p-C^p-T^p-

,j,e2p __ ζje2p _ja^p_ ^e2P_ ^^β2t _|j ENA oligonucleotide, APP14-585, was synthesised according to the similar method of Example 1, APPl-666. According to this synthetic method, the oligonucleotide, APP14-585, was obtained (34.1 A₂₆o units). This sequences is complementary to the nucleotide number 1081-1098 of APP cDNA (GenBank accession No. NM_000484) .

Ultraviolet Absorption Spectrum (H₂0) : λmax = 262 nm Retention time: 8.47 min (reverse-phase HPLC: LC-VP: a product of Shimazu Corp.; column : Chromolith Performance RP-18e (4.6 x 100 mm, Merck); solvent A: 5% acetonitrile, 0.1 M TEAA (pH 7.0); solvent B: acetonitrile; B% : 0%-10% (linear gradient, 10 min); temperature: 60°C ; flow rate: 2 mL/min; detection: 254 nm) .

Negative ion ESI mass spectroscopy: calcd: 5873.02, found: 5874.01.

Example 19 ; APP15-585; HO-C^e2p-T^o2p-C^e2p-T^e2p-T^e2p-C^p-T^p-G^p-T^p-G^p-T^p-C^p-A^p- Λ^e2P_a^β2P_(3^e2P_τ^e2P_'P^e2t_t|

ENA oligonucleotide, APP15-585, was synthesised according to the similar method of Example 1, APPl-666. According to this synthetic method, the oligonucleotide, APP15-585, was obtained (35.7 A₂₆o units). This sequences is complementary to the nucleotide number 1135-1152 of APP cDNA (GenBank accession No. NM_000484) .

Ultraviolet Absorption Spectrum (H₂0) : λmax = 261 nm Retention time: 9.25 min (reverse-phase HPLC: LC-VP: a product of Shimazu Corp.; column : Chromolith Performance RP-18e (4.6 x 100 mm, Merck); solvent A: 5% acetonitrile, 0.1 M TEAA (pH 7.0); solvent B: acetonitrile; B% : 0%-10% (linear gradient, 10 min); temperature: 60°C ; flow rate: 2 mL/min; detection: 254 nm) .

Negative ion ESI mass spectroscopy: calcd: 5904.02, found: 5904.28.

Example 20;

Control APPAS2-585; HO-C^e2p-C^e2p-A^e2p-G^e2p-T^e2p-G^p-A^p-A^p-G^p-A^p-

T^p-G^p-A^p-G^e2p-T^e2p-T^e2p-T^o2p-C^{e t}-H

ENA oligonucleotide, Control APPAS2-585, was synthesised according to the similar method of Example 1, APPl-666. According to this synthetic method, the oligonucleotide, Control APPAS2-585, was obtained (39.4 A₂₆₀ units). This sequences is complementary to the nucleotide number 580- 597 of APP cDNA (GenBank accession No. NM_000484) .

Ultraviolet Absorption Spectrum (H₂0) : λmax = 258 nm Retention time: 6.65 min (reverse-phase HPLC: LC-VP: a product of Shimazu Corp . ; column : Chromolith Performance RP-18e (4.6 x 100 mm, Merck); solvent A: 5% acetonitrile, 0.1 M TEAA (pH 7.0); solvent B: acetonitrile; B% : 0%-10% (linear gradient, 10 min); temperature: 60°C ; flow rate: 2 mL/min; detection:254 nm) .

Negative ion ESI mass spectroscopy: calcd: 6001.12, found: 6000.81.

Example 21;

Scrambled APPl-585; HO-C^e2p-G^e2p-T^β2p-C^e2p-C^e2p-A^p-G^p-T^p-G^p-G^p-

T^p-G^p-C^p-A^e2p-C^e2p-T^e2p-T^e2p-T^e2t-H ENA oligonucleotide, Scrambled APPl-585, was synthesised according to the similar method of Example 1, APPl-666. According to this synthetic method, the oligonucleotide, Scrambled APPl-585, was obtained (20.2 A₂₆o units).

Ultraviolet Absorption Spectrum (H₂0) : λmax = 260 nm Retention time: 8.30 min (reverse-phase HPLC: LC-VP: a product of Shimazu Corp.; column : Chromolith Performance RP-18e (4.6 x 100 mm, Merck); solvent A: 5% acetonitrile, 0.1 M TEAA (pH 7.0); solvent B: acetonitrile; B% : 0%-10% (linear gradient, 10 min); temperature: 60°C ; flow rate: 2 mL/min; detection:254 nm) .

Negative ion ESI mass spectroscopy: calcd: 5858.08, found: 5858.61.

Example 22; Scrambled APP2-585; HO-A^e2p-T^{e p}-G^e2p-A^e2p-T^e2p-T^p-G^p-T^p-G^p-A^p- T^p - G^p - C^p - T^e2p - C^e2p - C^o2p - T^e2p - C^e21 - H

ENA oligonucleotide, Scrambled APP2-585, was synthesised according to the similar method of Example 1, APPl-666. According to this synthetic method, the oligonucleotide, Scrambled APP2-585, was obtained (36.7 A₂₆o units).

Ultraviolet Absorption Spectrum (H₂0) : λmax = 260 nm Retention time: 8.48 min (reverse-phase HPLC: LC-VP: a product of Shimazu Corp.; column : Chromolith Performance RP-18e (4.6 x 100 mm, Merck); solvent A: 5% acetonitrile, 0.1 M TEAA (pH 7.0); solvent B: acetonitrile; B% : 0%-10% (linear gradient, 10 min); temperature: 60°C ; flow rate: 2 mL/min; detection: 254 nm) . Negative ion ESI mass spectroscopy: calcd: 5943.06 found: 5942.75.

Delivery Methods

There are a large number of delivery mechanisms that can be used depending on how the silencing reagents are intended to be used. For example, the following methods are useful when using reagents as a research tool into cells in culture Transfection by liposome Transfection by polymer By scrape-loading By electroportation By expression cassette By conjugant-mediatated transport e.g. penetratin^® (given here only as an example) .

However when being used as a therapeutic into animals or humans the silencing reagent must be delivered across the blood brain barrier either by trans-BBB transport or by direct injection. Use of conjugated oligonucleotides to facilitate transport is envisaged. Also the following methods can be used: - Use of osmotic pumps, mechanical pumps, electric pumps direct into brain - Use of liposomes or polymers to facilitate transport either or both across the blood brain barrier or across the plasma membrane - Use of conjugants that target the antisense reagent to specific intracellular compartments or to specific tissues within the body of the organism to which the compounds are administered. 1 2 Accessible Sequences 3 4 The accessible sequence on the human APP transcript 5 (Genbank accession number [XM_047790] ) has been determined 6 by the inventors . 7 8 The table 1 below shows the positions on the APPsequence 9 that have been shown by the inventors to be accessible by 0 mapping using a fully degenerate microarray such as 1 ACCESSarray^®. The table also shows the corresponding 2 antisense sequences that could be used. Any antisense, 3 ribozyme, or siRNA sequence including any part of any of 4 the sequences outlined below is anticipated as having the 5 potential to knockdown expression of the human APP gene 6 mRNA and thus the protein. 7 8 Table 1

2 Furthermore the table 2 below shows siRNA sequences that 3 are suitable. Again, it is anticipated that siRNA 4 reagents incorporating all or part of the sequences would 5 also be appropriate. 6 7 Table 2 8 siRNA Sense Sequence of Antisense sequence of % remaining (start siRNA (all synthesised siRNA (in siRNA U is APP position) and annealed as used in place of T) expression double-stranded RNA adj for 90% with TT overhangs on transfection each end) efficiency 2291P CCAGAGGAGCGCCACCTGT ACAGGUGGCGCUCCUCUGG 64.4477 2277D ACGCCGCTGTCACCCCAGA UCUGGGGUGACAGCGGCGU 43.5368 531P AGGAGAGGATGGATGTTTG CAAACAUCCAUCCUCUCCU 52.0878 520D ATTCTTACACCAGGAGAGG CCUCUCCUGGUGUAAGAAU 5.39431 1087P ATGTGGCGGCAACCGGAAC GUUCCGGUUGCCGCCACAU 21.7069 1079D TACGGCGGATGTGGCGGCA UGCCGCCACAUCCGCCGUA 45.6235 1554P TCCGCGCAGAACAGAAGGA UCCUUCUGUUCUGCGCGGA 3.46786 1541D CTAAAGAAGTATGTCCGCG CGCGGACAUACUUCUUUAG 32.0045 1298P TGGGAAGAGGCAGAACGTC GACGUUCUGCCUCUUCCCA 15.019 1289D ATGAGAGAATGGGAAGAGG CCUCUUCCCAUUCUCUCAU 95.7599 1602-neg CATGTGCGCTGGTGGATCC GGAUCCACCAGCGCACAUG 116.892 control 640-neg CGGAATTGACAAGTTCCGA UCGGAACUUGUCAAUUCCG 71.1371 control 2415-neg CATTGCTTCACTACCCATC GAUGGGUAGUGAAGCAAUG 20.0242 control scrambled GUGGUGCAUCACAAUCAUG CAUGAUUGUGAUCGUGGUG 100 siRNA control

Knockdown of human APP in cells in culture

Oligonucleotides can be transfected into HeLa cells by any available method including but not limited to liposome-mediated (e.g. lipofectamine^®, Oligofectamine^® from Life-Technologies and similar reagents from various commercial sources) or polymer-mediated (e.g. PEI, EPEI from various suppliers) or any other transfection method known to the art.

Antisense oligonucleotides are either Phosphorothioate, or comprise flanks of ENA of between 1 and 10 modified synthetic nucleotides at either end of a central "gap" or "window" of un-modified nucleotide or of a nucleotide chemistry that supports RNase H activity. Examples of ENA gapmer conformations are: 5 ' -EEEEEENNNNNNEEEEEE-3' 5'-EEEEENNNNNNNNEEEEE-3' 5 ' -EEEENNNNNNNNNNEEEE-3 ' 5'-EEENNNNNNNNNNNNEEE-3' Where E is an ENA and N is an unmodified nucleotide or other nucleotide that can support RNase H activity. Total oligo length is normally between 15 and 25 bases in length but it is anticipated that this may vary.

Data is shown in figure 2 for both the abovementioned ENA oligonucleotides and oligonucleotides where the ENA component is substituted by a locked nucleic acid (LNA) . LNA are described in WO 09914226 incorporated by reference herein. RNA is harvested from cells by any method known to the art and is quantitated by fluorescence-linked quantitative polymerase chain reaction (QPCR) standardised against a similar QPCR reaction against a house-keeping gene such as HPRT or GAP-DH.

This disclosure describes for the first time the use of ENA and ENA/DNA antisense reagents against the amyloid precursor protein APP and for the first time the use of siRNA reagents against APP. For the first time it uses a fully-degenerate microarray-based tool to map accessible regions on a transcript and design silencing reagents effective against them. Antisense sequences revealed by this method are not anticipated in the prior art .

This invention has commercial application as a research tool and has potential in the development of a therapeutic agent against Alzheimer's disease.

Figures 1,2,3,4 and 5 show the result of a series of structure mapping experiments to determine accessible regions on the APP gene.

Figure 6 shows the relative level of knockdown of the human APP gene transcript achieved by the indicated antisense oligonucleotide. Oligonucleotides in these examples are either ENA gapmers with a generic composition of (ENA) ₅- (DNA) ₈- (ENA) ₅ indicated as ENA585, or (ENA) ₆- (DNA) ₆- (ENA) ₆, indicated as ENA666, or complete phosphorothioate oligonucleotides. Although not all mapped peaks have been tested at this level, it is anticipated that all can be target for antisense, ribozyme or siRNA mediated knockdown in any appropriate biological system for research or therapeutic purposes, and that ENA chemistry or ENA chemistry in combination with any other compatible nucleic acid chemistry can be used as the basis for such reagents or drugs.

Figure 7 Shows a comparison between selected antisense reagents comprising either ENA, LNA or phosphorothioate chemistries and indicated that ENA based gapmers are the superior chemistry for antisense reagent design.

A number of siRNA sequences have also been tested to determine their ability to knockdown APP mRNA. The siRNAs were made up from 2X19 base strands of RNA, each with 2 DNA bases on the 3' end (both Ts) . The 19 RNA bases of the sense and antisense strands were annealed together by complementary base-pairing such that the TT on each strand acts as a 2 base overhang. This is one of a number of ways to design an siRNA - but they all contain a core double stranded section with overhangs.

Figure 20 shows the results of these experiments (with the oligonucleotides corresponding to those in table 2) .

The above descriptions are by way of example only and should not be considered as limiting but merely as a guide to teach one skilled in the art as to how the invention can be used.

Claims

1. Silencing reagents that are able to bind to the accessible region of APP, for use in the modulation of APP, selected from the following list of antisense sequences; CATTCTGGACATTCATGTGCATGTTCAGTCTGCCACAGAACATGG AACATGGCAATCTGGGGTTCAGCCAGCAGGCCA GTGGGGATGGGTCTTGCACTGCTTGCGGCCC GATCTGCAGTTCAGGGTAGACTTCTTGGCAA TTCCACCTCAGCCACTTCTTCCTCCTCTGCTACTTCTACTACTTT GACATCCGAGTCATCCTCCTCCGCATCAGCAGAAT TGCTCGGCACGGCCCCGTCTCGGCTTGTTCAGA GCAATGCTGGTGGTTCTCTCTGTGGCTTCTTCGTAGGGTTC CCTCATCACCATCCTCATCGTCCTCGTCATC CATGCAGTACTCTTCTGTGTC AAAGTTGTTCCGGTTGCCGCCACA GTTGCCGCCACATCCGCCGTAAAA AAAGAATGGGGCACACTTCCCTTCAGTCACATCAAA CAAGTTCTTTGCTTGACGTTCTGCCTCTTCCCATTCTCT ATAAATCACACGGAGGTGTGTCATAACCTGGGACCGGATCTG AAAATGCATAGTGATCAGGAA GCAGCTGAACTCCCACGTTCACAT AAAGTAGGACTTAATTGGGTCACAAACCACAAGAAT AATATACAACTGGCTAAGGGGCTATGTGAT GGAGAGAATCTATTCATGCACTAGTTT AACAAACGTGTGTATCCTCTTAAT ACAGGTGGCGCTCCTCTGG TCTGGGGTGACAGCGGCGT CAAACATCCATCCTCTCCT CCTCTCCTGGTGTAAGAAT GTTCCGGTTGCCGCCACAT TGCCGCCACATCCGCCGTA TCCTTCTGTTCTGCGCGGA CGCGGACATACTTCTTTAG GACGTTCTGCCTCTTCCCA CCTCTTCCCATTCTCTCAT GGATCCACCAGCGCACATG TCGGAACTTGTCAATTCCG GATGGGTAGTGAAGCAATG CATGATTGTGATCGTGGTG

2. Silencing reagents as in Claim 1, which contain all or part of antisense sequences from the abovementioned list.

3. Silencing reagents as in any of the previous Claims wherein the silencing reagents show >90% homology to the antisense sequences from the abovementioned list.

4. Silencing reagents as in any of the previous Claims that are able to bind to accessible parts of an APP gene, wherein the silencing reagents are modified by the incorporation of ethylene bridged nucleic acids.

5. Silencing reagents as in any of the previous Claims wherein the silencing reagents comprise a mixture of ethylene bridged nucleic acids (ENAs) , and unmodified nucleic acids, such that the unmodified nucleotides promote enzymatic cleavage of the RNA strand of a hetero duplex formed between the antisense reagent and a target RNA transcript by means of recruiting RNase H or a similar endogenous or ectopic enzyme.

6. Silencing reagents as in any of the previous Claims wherein the silencing reagents comprise a mixture of ethylene bridged nucleic acids and any type of modified nucleotide that is able mediate cleavage of a target transcript by RNaseH.

7. Silencing reagents as in any of the previous Claims wherein the silencing reagents are antisense reagents

8. Silencing reagents as in Claim 7 wherein the antisense reagents are flanked by between one and ten modified synthetic nucleotides that may themselves form part of the antisense sequence, or may not.

9. Silencing reagents Claims 7 and 8 wherein the antisense reagents are chosen from the following sequences: CATTCTGGACATTCATGTGCATGTTCAGTCTGCCACAGAACATGG AACATGGCAATCTGGGGTTCAGCCAGCAGGCCA GTGGGGATGGGTCTTGCACTGCTTGCGGCCC GATCTGCAGTTCAGGGTAGACTTCTTGGCAA TTCCACCTCAGCCACTTCTTCCTCCTCTGCTACTTCTACTACTTT GACATCCGAGTCATCCTCCTCCGCATCAGCAGAAT TGCTCGGCACGGCCCCGTCTCGGCTTGTTCAGA GCAATGCTGGTGGTTCTCTCTGTGGCTTCTTCGTAGGGTTC CCTCATCACCATCCTCATCGTCCTCGTCATC CATGCAGTACTCTTCTGTGTC AAAGTTGTTCCGGTTGCCGCCACA GTTGCCGCCACATCCGCCGTAAAA AAAGAATGGGGCACACTTCCCTTCAGTCACATCAAA CAAGTTCTTTGCTTGACGTTCTGCCTCTTCCCATTCTCT ATAAATCACACGGAGGTGTGTCATAACCTGGGACCGGATCTG AAAATGCATAGTGATCAGGAA GCAGCTGAACTCCCACGTTCACAT AAAGTAGGACTTAATTGGGTCACAAACCACAAGAAT AATATACAACTGGCTAAGGGGCTATGTGAT GGAGAGAATCTATTCATGCACTAGTTT AACAAACGTGTGTATCCTCTTAAT

10. Silencing reagents as in Claims 1 to 6 wherein the silencing reagents are small interfering RNA (siRNA) .

11. Silencing reagents as in Claim 10 wherein the siRNA reagents are chosen from the following antisense sequences combined with the corresponding sense sequences; ACAGGUGGCGCUCCUCUGG UCUGGGGUGACAGCGGCGU CAAACAUCCAUCCUCUCCU CCUCUCCUGGUGUAAGAAU GUUCCGGUUGCCGCCACAU UGCCGCCACAUCCGCCGUA UCCUUCUGUUCUGCGCGGA CGCGGACAUACUUCUUUAG GACGUUCUGCCUCUUCCCA CCUCUUCCCAUUCUCUCAU GGAUCCACCAGCGCACAUG UCGGAACUUGUCAAUUCCG GAUGGGUAGUGAAGCAAUG CAUGAUUGUGAUCGUGGUG

12. Silencing reagents as in Claims 10 and 11 wherein the siRNA reagents are flanked by between one and ten modified synthetic nucleotides.

13. Silencing reagents as in Claims 10 to 12 wherein the modified synthetic nucleotides are ethylene bridged nucleic acids.