WO2004046315A2 - Compositions and methods utilizing human gamma-hydroxybutyrate receptor - Google Patents

Abstract

The present invention concerns compositions and methods related to isolating and using human GHB receptors (hGHB receptor), as well as agents that modify the physical, chemical, and biological properties or activities of hGHB receptors. Isolation of an hGHB receptor and the polynucleotide(s) encoding an hGHB receptor allow the use of biotechnological approaches to screen for and identify compounds that affect or modulate receptor activity. Compounds identified will typically have advantageous properties such as stimulation, enhancement, or induction of SWS; biologic, chemical, and/or storage stability; less toxicity; higher potency; higher selectivity; fewer side effects and/or other beneficial physical, biological and pharmacologic characteristics.

Description

DESCRIPTION

COMPOSITIONS AND METHODS UTILIZING HUMAN GAMMA- HYDROXYBUTYRATE RECEPTOR

BACKGROUND OF THE INVENTION

This application claims priority to U.S. Provisional Patent Applications serial numbers 60/426,190 filed on November 14, 2002, which is incorporated in its entirety herein by reference.

1. Field of the Invention

The present invention relates generally to the fields of molecular biology, neurobiology and pharmacology. More particularly, it concerns methods and compositions for identifying modulators of Gamma-hydroxybutyrate (GHB) receptors.

2. Description of Related Art

GHB is a four carbon fatty acid which readily crosses the blood-brain barrier. GHB is a naturally occurring substance in the brain and is a metabolite of gamma-aminobutyric acid (GAB A). High affinity GHB receptors are typically present in the hippocampus, cortex and dopaminergic structures of the brain.

GHB was first synthesized in 1964 and was used as an adjuvant in general anesthesia because of its marked hypnotic action. Studies indicated that oral doses of 30-60 mg/kg at bedtime induce sleep and result in a robust stimulation of slow wave sleep (SWS) without suppressing rapid eye movement (REM) sleep (Lapierre et al, 1990; Mamelak et al, 1977; and Series et al, 1992). However, GHB's short duration of action limits its use for the treatment of insomnia. Typically, the subject awakens 3-4 hours after GHB intake in a state of excellent alertness. GHB has been used to treat narcolepsy (Scharf et al, 1985). Narcoleptic patients generally take 2 to 3 doses of GHB across the night to maintain sleep. Based on observations from clinical research studies published over the past 20 years, which have included a total of nearly 200 subjects (reviewed in Van Cauter et al, 1997), and on the experience accumulated in an open clinical trial, which has enrolled over 120 narcoleptic subjects treated nightly with 2-3 g doses of GHB for periods of up to 15 years (Scharf et al, 1998), treatment with GHB is generally tolerated. In contrast to the low toxicity of low doses of GHB administered in controlled conditions, a number of mild to very severe adverse reactions (ranging from drowsiness and nausea to seizures and coma) following uncontrolled uses of variable, generally high, doses of GHB, often in association with ethanol and/or other drugs, have been reported (reviewed in Tunnicliff, 1997).

Additionally, GHB lacks storage stability. GHB degrades into gamma-butyrolactone (GBL) and possibly other degradants in solution depending upon the pH and other factors. Also, the contamination of a GHB solution by microorganisms rapidly surpasses acceptable limits and preservatives can adversely affect the pH, thus, GHB's stability. Thus, there is a need for effective, stable, specific and less toxic agents that modulate the activity of GHB receptors.

GHB has demonstrated effects on the sleep cycle. Studies have shown that GHB administration restores a specific component of restorative sleep, slow wave sleep (SWS), in older adults and indicates that growth hormone (GH) secretion is simultaneously enhanced by GHB. This suggests that some of the adverse effects of reduced GH secretion in old age could be treated or corrected by restoring SWS.

There is also evidence to indicate that SWS is important for cognition, particularly memory consolidation (Buzsaki, 1998). Finally, alterations in SWS appear to play a pathophysiological role in a number of disease states, including subtypes of depression (Kupfer et al, 1990) and fibromyalgia (Lentz et al, 1999). In fibromyalgia, stimulation of SWS by GHB administration is able to reduce symptoms of pain and fatigue (Scharf et al, 1998).

The design of hypnotic or somnogenic drugs has focused on facilitating sleep onset and increasing sleep efficiency, i.e., reducing the amount and duration of intra-sleep awakenings, and has not attempted to preserve or enhance the depth of sleep. The widely used benzodiazepine hypnotics (e.g., flurazepam, flunitrazepam, triazolam, midazolam, lorazepam) actually decrease, rather than increase, SWS. The more recent non-benzodiazepine hypnotics, the imidazopyridines (zolpidem, zopiclone), also fail to increase SWS and reduce slow wave activity (SWA) (Aeschbach et al, 1994). Compounds with significant serotonin receptor antagonism which have been developed as anti-depressants such as ritanserin, seganserin, mianserin and mirtazapine increase the amount of SWS but do not have sedative properties, i.e., they do not consistently induce sleep (Sharpley and Cowen, 1995). Additionally, when the profile of SWA during SWS was examined by power spectral analysis for some of these compounds, differences with the normal distribution of SWS became apparent, suggesting that these drugs stimulated a non-physiological type of SWA (Dijk et al, 1989). Finally, melatonin, which is sold as a food additive in the USA, does not increase SWS during nocturnal sleep (Turek and Czeisler, 1999) and actually suppresses SWA during daytime sleep (Dijk et al, 1995).

Thus, improved agents that modulate GHB receptors are needed; in particular, sleep- enhancing compounds that stimulate slow-wave sleep (SWS).

SUMMARY OF THE INVENTION

In certain embodiments, methods of selecting a candidate substance that binds to a human GHB receptor polypeptide may comprise (a) obtaining one or more candidate substance(s); (b) contacting a human GHB receptor polypeptide with one or more of the candidate substance; (c) assessing the ability of the one or more candidate substance(s) to bind to the human GHB receptor polypeptide; and (d) selecting a candidate substance having desirable binding characteristics. The human GHB receptor polypeptide may expressed in a cell. In certain aspects the cell is stably transfected with a nucleic acid encoding a human GHB receptor polypeptide. The cell may be a mammalian cell, a CHO cell, a Xenopus Oocyte or the like. Binding of the candidate substance to the human GHB receptor polypeptide may be assessed by competition with GHB binding to the human GHB receptor polypeptide. In further aspects, testing the candidate substance for binding to the human GHB receptor polypeptide is assessed by activation of the human GHB receptor polypeptide. Activation of the human GHB receptor polypeptide may be assessed by detecting a current across a cell membrane of a cell expressing a human GHB receptor polypeptide.

The methods may further comprise (a) producing a pharmacologically acceptable formulation of one or more of a selected substances(s); (b) administering one or more of the formulation(s) to an animal; and (c) assessing the pharmacological activity of the formulation by monitoring the animal. Monitoring of the animal may involve monitoring behavioral activity of the animal. The methods of the invention may further comprising: (d) comparing the behavioral activity of the animal in the presence of the candidate substance to the behavioral activity of the animal in the absence of the candidate substance. Behavioral activity may be locomotor activity. In certain aspects, monitoring may include monitoring body temperature of the animal, EEG waveforms of the animal, EMG waveforms of the animal and the like. An animal may be, but is not limited to, a mammal, a rodent, a rat, or a human.

A pharmacologically acceptable formulation of the invention may have sleep enhancing activity, alcohol craving reducing activity, alcohol withdrawal reducing activity, slow wave sleep enhancing activity, growth hormone secretion enhancing activity, stage IN sleep enhancing activity, fibromyalgia palliating activity, cancer palliating activity, or chronic fatigue palliating activity.

In still further embodiments, method for screening a plurality of compounds so as to identify at least one compound exhibiting sleep enhancing activity is contemplated The methods including (a) assessing the binding of a plurality of compounds to a human GHB receptor; (b) selecting one or more compounds based on the results of (a) ; and (c) testing such compounds for sleep enhancing activity. The binding of a plurality of compounds may be assessed by a physiological response of a cell.

Further embodiments of the invention include pharmaceutical compositions for the treatment of a GHB receptor related disorder comprising a therapeutically effective amount of (a) a candidate substance selected as described herein and a pharmaceutically acceptable carrier, or (b) a pharmacologically acceptable formulation produced in accordance with the teachings descried herein or known in the art.

Embodiments of the invention include methods of treatment comprising administering to a mammal an amount of the pharmaceutical composition of the invention sufficient to reduce or alleviate symptoms of a sleep disorder, to reduce or alleviate an alcohol craving, to reduce or alleviate alcohol withdrawal, to enhance slow wave sleep, to enhance growth hormone secretion, to enhance stage IN sleep, to treat fibromyalgia, to treat cancer, or to treat chronic fatigue in mammals.

Certain embodiments include compounds identified by the methods of the invention, wherein the compound binds to the human GHB receptor polypeptide. The compound may be a GHB derivative, a gamma butyrolactone derivative, a gamma- valerolactone derivative, a 1,4 butanediol derivative or other GHB analog derivative known in the art. In certain aspects, the compound competes with GHB for binding to the human GHB receptor polypeptide and/or activates the human GHB receptor polypeptide. The activity of the human GHB receptor polypeptide may be the induction of a current across a cell membrane, hi still further aspects, the compound may have human GHB receptor agonist activity in an animal. In certain embodiments, the compound modulates behavioral activity of the animal, such as locomotor activity. The compound may also modulate EEG waveforms of the animal and/or EMG waveforms of the animal.

Embodiments of the invention also include methods of manufacturing a formulation for use in the treatment of a GHB receptor-related disease, the method comprising manufacturing a substance selected as described herein and formulating the substance in a pharmacologically acceptable formulation.

Various embodiments of the invention include methods of screening a candidate substance for its ability to bind a human GHB receptor or a GHB receptor polypeptide. In certain embodiments the methods include (a) providing a cell that expresses at least one GHB and/or a human GHB receptor polypeptide; (b) contacting the cell with the candidate substance; and (c) testing the ability of the candidate substance to bind the GHB and/or a human GHB receptor polypeptide. The methods may include a cell that is stably transfected with a nucleic acid encoding a GHB and/or a human GHB receptor receptor polypeptide. The cell can be a mammalian cell, a CHO cell, a Xenopus Oocyte or other known primary cell or cultured cell line. As used herein, a "GHB receptor polypeptide" or a "human GHB receptor polypeptide" includes a full length GHB and/or a human GHB receptor, a GHB and/or a human GHB receptor fragment or a fusion protein including all or part of the full length GHB and/or a human GHB receptor for the purposes of identifying a candidate substance that binds a GHB and/or a human GHB receptor. GHB and/or a human GHB receptor polypeptide fragments may be 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, 50, 100, 150, 200, 250, 300, 350, 400, 450, or more consecutive amino acids including the full length GHB and/or a human GHB receptor polypeptide as set for the in SEQ ID NO:3, SEQ ID NO:8, SEQ ID NO-10, SEQ ID NO-12, or SEQ ID NO: 14, including all intervening integers thereof. h certain embodiments, testing the ability of the candidate substance to bind a GHB and/or a human GHB receptor polypeptide involves determining the binding of the candidate substance to a GHB and/or a human GHB receptor polypeptide, which includes the full length a GHB and/or a human GHB receptor polypeptide or a fragment thereof. Binding of the candidate substance to a GHB and/or a human GHB receptor polypeptide may be determined by competition with GHB binding to a GHB and/or a human GHB receptor polypeptide or other known binding assays.

In various embodiments, testing of the ability of the candidate substance to bind a GHB and/or a human GHB receptor polypeptide involves determining the ability of the candidate substance to activate a GHB and/or a human GHB receptor polypeptide. Activation of a GHB and/or a human GHB receptor may be tested using a full length human GHB receptor, active fragment of a GHB and/or a human GHB receptor polypeptide, or a fusion protein of a GHB and/or a human GHB receptor polypeptide. Determining the ability of the candidate substance to activate a GHB and/or a human GHB receptor polypeptide may be by detecting a current across the cell membrane. In some embodiments, screening the candidate substances for human GHB receptor agonist activity may include (a) administering to an animal the candidate substance, wherein the candidate substance binds a GHB and/or a human GHB receptor; and (b) monitoring the animal. The animal may be a non-transgenic animal or a transgenic animal. The transgenic animal may express a human GHB receptor polypeptide, a derivative of a human GHB receptor polypeptide, or a reporter gene sensitive to activation of a human GHB receptor polypeptide in a cell, tissue, organ, or combinations thereof. Monitoring of the animal may include monitoring the behavioral activity of the animal. Certain embodiments of the invention may also include (c) comparing the behavioral activity of the animal in the presence of the candidate substance to the behavioral activity of the animal in the absence of the candidate substance. Behavioral activity may include locomotor activity or the like. Monitoring of the animal may also include monitoring the body temperature of the animal, monitoring EEG waveforms of the animal, monitoring EMG waveforms of the animal or the like. The animal may be a mammal, a rabbit, a goat, a mouse, a horse, a cow, a primate, a monkey, an ape, a rodent, a rat or any other animal for which monitoring is reasonable. In particular embodiments, the animal is a rat.

Various embodiments of the invention include methods for screening a plurality, i.e., two or more, of compounds so as to identify at least one compound exhibiting sleep enhancing activity, including a) determining in vitro efficacy and EC₅₀ values for each compound for an hGHB receptor; b) determining an in vitro efficacy value for each compound for an hGHB receptor; and c) testing a compound as exhibiting sleep enhancing activity.

In some embodiments, screening compounds for sleep enhancing activity including a) selecting compounds in vitro having a binding affinity for an hGHB receptor polypeptide; b) determining in vitro efficacy for each selected compound for activating an hGHB receptor polypeptide; and c) identifying a selected compound having in vivo sleep enhancing activity are contemplated.

Other embodiments of the invention include methods of treating a sleep disorder comprising admimstering to a mammal an amount of the pharmaceutical composition of a compound(s) identified using methods described herein sufficient to reduce or alleviate symptoms of the sleep disorder.

Still other embodiments include methods of enhancing slow wave sleep comprising admimstering to a mammal an amount of the pharmaceutical composition of a compound(s) identified using methods described herein.

Further embodiments include methods of enhancing growth hormone secretion comprising administering to a mammal an amount of the pharmaceutical composition of a compound(s) identified using methods described herein.

In still further embodiments include methods of enhancing stage IV sleep comprising admimstering to a mammal an amount of the pharmaceutical composition of a compound(s) identified using methods described herein.

Various embodiments include methods of decreasing alcohol craving comprising administering to a mammal an amount of the pharmaceutical composition of a compound(s) identified using methods described herein.

Other embodiments include methods of reducing or alleviating alcohol withdrawal symptoms comprising administering to a mammal an amount of the pharmaceutical composition of a compound(s) identified using methods described herein sufficient to reduce or alleviate symptoms of alcohol withdrawal.

Further embodiments include methods of treating fibromyalgia comprising administering to a mammal an amount of the pharmaceutical composition of a compound(s) identified using methods described herein sufficient to reduce or alleviate symptoms of fibromyalgia

Certain embodiments include methods of treating a cancer comprising administering to a mammal an amount of the pharmaceutical composition of a compound(s) identified using methods described herein sufficient to reduce or alleviate symptoms of the cancer.

Some embodiments of the invention include methods of treating chronic fatigue in mammals, comprising administering to a mammal an amount of a compound identified by a screening method described herein sufficient to reduce or alleviate symptoms of chronic fatigue.

Various embodiments include methods of providing a pharmaceutical preparation to patients in need of sleep enhancing treatment comprising obtaining at least one candidate substance identified as exhibiting human GHB receptor agonist activity and administering the pharmaceutical preparation to the patients.

Certain embodiments of the invention include compounds identified by methods described herein. For example, the methods may include (a) providing a cell that expresses at least one human GHB receptor polypeptide; (b) contacting the cell with the candidate substance; and (c) testing the ability of the candidate substance to bind a GHB and/or a human GHB receptor polypeptide.

Various embodiments of the invention include compounds or candidate substances identified by methods of screening a candidate substance for its ability to bind a human GHB receptor polypeptide. In certain embodiments the methods include (a) providing a cell that expresses at least one human GHB receptor polypeptide; (b) contacting the cell with the candidate substance; and (c) testing the ability of the candidate substance to bind a GHB and/or a human GHB receptor polypeptide. The methods may include a cell that is stably transfected with a nucleic acid encoding a human GHB receptor polypeptide. The cell can be a mammalian cell, a CHO cell, a Xenopus Oocyte or other known primary cell or cultured cell line.

In certain embodiments, the methods include testing the ability of the candidate substance to bind a GHB and/or a human GHB receptor polypeptide by determining the binding of the candidate substance to a GHB and/or a human GHB receptor polypeptide, which includes the full length GHB and/or a human GHB receptor polypeptide or a fragment thereof. Binding of the candidate substance to a GHB and/or a human GHB receptor polypeptide may be determined by competition with GHB binding to a GHB and/or a human GHB receptor polypeptide or other known binding assays.

In various embodiments, testing of the ability of the candidate substance to bind a GHB and/or a human GHB receptor polypeptide involves determining the ability of the candidate substance to activate a GHB and/or a human GHB receptor polypeptide. Activation of a GHB and/or a human GHB receptor may be tested using a full length GHB and/or a human GHB receptor, active fragment of a GHB and/or a human GHB receptor polypeptide, or a fusion protein of a GHB and/or a human GHB receptor polypeptide. Determining the ability of the candidate substance to activate a GHB and/or a human GHB receptor polypeptide may be by detecting a current across the cell membrane.

In some embodiments, screening the candidate substances for human GHB receptor agonist activity may include (a) administering to an animal the candidate substance, wherein the candidate substance binds a GHB and/or a human GHB receptor; and (b) monitoring the animal. The animal may be a non-transgenic animal or a transgenic animal. The transgenic animal may express a human GHB receptor polypeptide, a derivative of a human GHB receptor polypeptide, or a reporter gene sensitive to activation of a human GHB receptor polypeptide in a cell, tissue, organ, or combinations thereof. Monitoring of the animal may include monitoring the behavioral activity of the animal. Certain embodiments of the invention may also include (c) comparing the behavioral activity of the animal in the presence of the candidate substance to the behavioral activity of the animal in the absence of the candidate substance. Behavioral activity may include locomotor activity or the like. Monitoring of the animal may also include monitoring the body temperature of the animal, monitoring EEG waveforms of the animal, monitoring EMG waveforms of the animal or the like. The animal may be a mammal, a rabbit, a goat, a mouse, a horse, a cow, a primate, a monkey, an ape, a rodent, a rat or any other animal for which monitoring is reasonable. In particular embodiments, the animal is a rat.

Various embodiments include a pharmaceutical composition for the treatment of sleep disorders comprising a therapeutically effective amount of a candidate substance identified according to the screening methods described herein and a pharmaceutically acceptable carrier.

The use of the word "a" or "an" when used in conjunction with the term "comprising" in the claims and/or the specification may mean "one," but it is also consistent with the meaning of "one or more," "at least one," and "one or more than one."

Other objects, features and advantages of the present invention will become apparent from the following detailed description. It should be understood, however, that the detailed description and the specific examples, while indicating specific embodiments of the invention, are given by way of illustration only, since various changes and modifications within the spirit and scope of the invention will become apparent to those skilled in the art from this detailed description.

BRIEF DESCRIPTION OF THE DRAWINGS

The following drawings form part of the present specification and are included to further demonstrate certain aspects of the present invention. The invention may be better understood by reference to one or more of these drawings in combination with the detailed description of specific embodiments presented herein.

FIG. 1. An exemplary alignment of rat and human GHB receptors.

FIG. 2. An example of GHB binding assays to the newly identified hGHB receptor.

FIG. 3. An example of an electrophysiologic recording of a cell expressing hGHB receptor exposed to GHB.

FIG. 4. An exemplary alignment of the identified hGHB receptor with other similar proteins.

FIG. 5. An example of GHB effects on GH secretion.

FIG. 6. An example of the effects of GHB on the amount of slow wave sleep (SWS) and on slow wave activity (SWA; EEG power in 1 - 5 Hz band) during SWS, as measured during the first 4 hours for SWS and the first 2 hours for SWA after the treatment. Values of SWS and SWA for 4 animals are represented as a percentage change over baseline mean values (vehicle injection under the same conditions). FIG. 7. An example of GHB administration consistently and markedly enhancing SWA. By visual examination, the EEG patterns in SWS were indistinguishable from those observed in younger adults.

FIG. 8. An example of restoration of SWS in early sleep associated with a significant (p<0.005) increase in GH secretion. Peak GH levels in older adults treated with GHB approach those normally measured with the same assay in young subjects. There were no adverse reactions or undesirable side effects and the treatment was well tolerated.

FIG. 9. Effects of GHB (200 mg/kg) injected at different time points of the light-dark cycle (ZTO=onset of light phase; ZT12=onset of dark phase) on vigilance states for each of the 6 hours following the treatment. Mean (±SEM) values of wake, NREM and REM sleep are expressed as percentage of recording time. *p<0.05, **p<0.01, ***p<0.001 (within subjects ANOVA followed by least significant difference (LSD) post hoc tests) compared to control values (vehicle injection under the same conditions).

FIG. 10. Dose-response effects of GHB (150 mg/kg, left panel; 200 mg/kg, right panel) injected at the onset of the dark phase (ZT12) on vigilance states, locomotor activity and body temperature for each of the 6 hours following the treatment. Mean (±SEM) values of wake, NREM and REM sleep are expressed as percentage of recording time. Mean activity counts represent the mean total counts per hour while body temperature is measured at 10-sec intervals and then mean temperature is determined per hour. *p<0.05, **p<0.01, ***p<0.001 (within subjects ANOVA followed by least significant difference (LSD) post hoc tests) compared to control values (vehicle injection under the same conditions).

FIG. 11. Effects of GHB (200 mg/kg) injected at the beginning of the dark phase on behavioral states evaluated on a 5 -point scale score (see text for definition). Mean (±SEM) values for behavioral score are determined per 5-min intervals during a 90-min period after the treatment in 4 animals receiving injections of vehicle or GHB one week later.

FIG. 12. Effects of NCS-467 (100 mg/kg) injected at four different time points of the light-dark cycle (ZTO=onset of light phase; ZT12=onset of dark phase) on vigilance states for each of the 6 hours following the treatment. Mean (±SEM) values of wake, NREM and REM sleep are expressed as percentage of recording time. *p<0.05. **p<0.01, ***ρ<0.001 (within subjects ANOVA followed by least significant difference (LSD) post hoc tests) compared to control values (vehicle injection under the same conditions).

FIG. 13. Effects of NCS-467 (100 mg/kg i.p.) injected either at light onset (ZTO) or at dark onset (ZT 12) on relative delta power activity during NREM sleep (N = 5 - 7 animals per dose). Mean (±SEM) values of delta power are determined in the 1 - 5 Hz frequency band, and are expressed as percentage of absolute values of the total power. **p<0.01, *** pO.OOl (within subjects ANOVA followed by least significant difference (LSD) post hoc tests) compared to values obtained after vehicle injection in the same conditions.

FIG. 14. Dose-response effects of NCS-467 (50 mg/kg, left panel; 100 mg/kg, right panel) injected at the onset of the dark phase (ZT12) on vigilance states, locomotor activity and body temperature for each of the 6 hours following the treatment. Mean (±SEM) values of wake, NREM and REM sleep are expressed as percentage of recording time. Mean activity counts represent the mean total counts per hour while body temperature is measured at 10-sec intervals and then mean temperature is determined per hour. *p<0.05, **p<0.01, ***p<0.001 (within subjects ANOVA followed by least significant difference (LSD) post hoc tests) compared to control values (vehicle injection under the same conditions).

FIG. 15. Saturation [³H]-GHB binding experiments (non-linear regression line) with membranes of hGHBRl transfected CHO cells. Kd value is 114 ± 12 nM. Means ± SD of three independent values, non-linear fitting by the GraphPad-Prism program (San Diego, CA).

FIG. 16A-16B. Northern Blot analysis. The probe "A" (190 bp), which is more specific for hGHBRl than hGHBR2 (70 % identity) would have a higher specificity to hGHBRl than hGHBR2 (FIG. 16A). The probe "B", a mix of two PCR amplified cDNA segments from the clone B6H9(19) would hybridize with equivalent specificity the two isoforms of GHB receptors (89 and 85 % identity for hGHBR2) but not hGHBR3 (FIG. 16B. FIG. 16B shows Northern blot analysis.

FIG. 17A-17C. Schematic representation of hGHBRl (B6H9(19)). One structure is an 11 transmembrane domains (TMD) protein (FIG. 17A) with an extracellular Carboxy-terminal tail while the other is a 10 TMD protein (FIG. 17B) with an intracellular Carboxy-terminal tail. Based on the inventors studies, this latter model is more likely because a deletion of a Cι₃₇₄ (clone C12K32) leads to a change in the ORF and disappearance of a PKC consensus site (FIG. 17C).

FIG. 18. Northern blot analysis for lιGHBR3 on human tissues. PCR amplified cDNA from hGHBR3 was used in Northern blot studies. The amplified DNA probe did not have a significant homology to hGHBRl or hGHBR2. The major band (2 kb) revealed is present in all tissues but with a more intense labelling in the case of placenta, skeletal muscle, liver and heart.

FIG. 19. Human tissue studies, membranes were prepared from frozen human pancreas and thyroid. FIG. 20. Multiple alignment analysis was performed with "MULTALIN" algorithm (prodes.toulouse.inra.fr/multalin.html)

FIG. 21A-21C. The differences between hGHBR2 (FIG. 21B) or hGHBR3 (FIG. 21C) and hGHBRl (FIG. 21A) in terms of sequence identities or homologies are shown in a scaled representation.

FIG. 22A - 22C An example of an electrophysiologic recording of a cell expressing mGHBR2 (A) or hGHBR3 (B and C) receptor exposed to various concentrations of GHB and to the antagonist NCS-382.

DESCRIPTION OF ILLUSTRATIVE EMBODIMENTS

The invention provides compositions and methods related to isolating and using GHB and/or a human GHB receptors (GHB or hGHB receptor), as well as agents that modify the physical, chemical, and biological properties or activities of GHB or hGHB receptors. Isolation of a GHB or hGHB receptor and the polynucleotide(s) encoding a GHB or hGHB receptor allow the use of biotechnological approaches to screen for and identify compounds that affect or modulate receptor activity. Compounds identified will typically have advantageous properties such as stimulation, enhancement, or induction of SWS; biologic, chemical, and/or storage stability; less toxicity; higher potency; higher selectivity; fewer side effects and/or other beneficial physical, biological and pharmacologic characteristics.

The recent progress in the understanding of the GHB signaling system in the brain and, in particular, the identification of GHB receptors and the nucleic acids encoding them, in particular the hGHB receptor described herein, offers an opportunity to develop novel agents, compounds, molecules, pharmaceutical preparations and the like that bind to and modulate the activity of GHB receptors. GHB receptor binding agents, identified using the methods described herein, may have the sedative, SWS-stimulating and other beneficial properties of GHB with a greater biologic, chemical, or storage stability; less toxicity; a greater potency; a higher selectivity; and/or a minimized potential for abuse and/or illegal use.

In vitro, ex vivo, and in vivo screening or combinations thereof may be used to develop a novel class of sleep-enhancing and/or sleep disorder treating compounds that act through the GHB system. These compounds may have a pharmacokinetic profile consistent with the maintenance of sleep throughout the night and a heightened level of alertness upon morning awakening. I. GHB RECEPTOR

Generally, GHB receptors, which include human GHB receptors, are selectively expressed in certain regions of the brain. Their specific stimulation participates in the regulation of some important aspects of brain function, including the wake/sleep cycle, modulation of some neurohormonal influences, mood and addiction to some drugs. The cloning and expression of specific members of the GHB receptor family will assist in the design and selection of drugs or agents with human GHB receptor modulating properties, as well as other beneficial characteristics. Analysis and searches of nucleic acid databases indicate that there is a family of GHB receptors. The GHB receptor family, i.e., GHB receptors, includes at least GHBR1 (B6H9(19)), GHBR2 (accession numbers AK008081; partial sequences CB782916, CA340251 and BU759348), and GHBR3 (accession numbers BC009750, A 009850 and XM_230720).

Pharmacologic and other evidence favors the existence of various classes of GHB receptor, so there may be a number of divergent, convergent or similar proteins that function as GHB receptors. A GHB receptor as described herein is a protein that when in contact with GHB, GHB analogues and/or mimetics provide a functional response, be it a positive or negative . response, activating or inhibiting type of response. Examples of such responses include, but are not limited to specific binding to a receptor, induction of a current (ion flux), activation/inhibition of a second messenger or signal transduction pathway(s), association or dissociation of the receptor with other proteins or molecules, phosphorylation or other modification of the receptor, and other such functions known for a variety of receptors, such as G-protein coupled receptors, tyrosine kinase receptors, and the like.

A GHB receptor has recently been cloned from a rat brain hippocampus cDNA library, SEQ ID NO:l and SEQ ID NO:2 (WO 00/78948, incorporated herein by reference). Interestingly, Southern blotting of genomic DNA from different species, using a rat GHB receptor probe, revealed the presence of DNA sequences that are similar or homologous to the rat GHB receptor sequence (SEQ ID NO:l). Screening of a human frontal cortex cDNA library using PCR assays and probes derived from the rat GHB receptor has led to the identification a human protein that demonstrates specific binding to GHB, see below (SEQ ID NO:3). An alignment of the rat and human GHB receptors showing a 42% similarity and a 20.4% identity is shown in FIG. 1. The limited similarity between the rat and human receptor may indicate that, even though both proteins are GHB receptors they may not perform the same function in the respective species, in other words the rat and human receptors described herein may not be homologous. Thus, the gene encoding the rat protein that performs the same function as the hGHB receptor (SEQ ID NO:4) is yet to be identified, however the rat and human respond similarly to GHB. Thus, the binding characteristics and biologic activity of a GHB-like compound identified by an initial screen in a in vitro type assay using a GHB receptor may be further characterized in an in vivo rat model, which is known to conelate with GHB activity in humans.

The newly cloned hGHB receptor has been shown by the inventors to specifically bind GHB in a cell based binding assay (see below and FIG. 2). h addition to the binding properties of hGHB receptor, cells expressing the hGHB receptor in vitro responded to GHB exposure by inducing a cunent, as detected by electrophysiological recording by patch-clamp techniques (FIG. 3). A search of available DNA and protein sequence databases identified a similar polynucleotide/protein with an unknown function, GenBank accession number AK021918 (FIG. 4), which is incorporated herein by reference.

Various embodiments of the invention include compositions and methods comprising and using the hGHB receptor polynucleotide (SEQ ID NO:3) and polypeptide (SEQ LO NO:4) as well as variants of thereof, as described below. In certain embodiments, a cell stably or transiently expressing an hGHB polynucleotide and/or a polypeptide may be used in a screening method to identify agents, compounds or molecules that regulate hGHB receptor function. In other embodiments, various members of the GHB receptor family may be used in place of or with hGHB, i.e., GHB receptors, including at least GHBR2 (accession numbers AK008081; partial sequences CB782916, CA340251 and BU759348), and GHBR3 (accession numbers BC009750, AK009850 and XM_230720).

II. GHB PATHWAYS AND SLEEP.

Some of the various reasons for developing GHB derivatives, analogs, mimetics and related compounds for sleep and sleep disorders, as well as other CNS functions and disorders, are 1) GHB is naturally processed in the brain and has specific receptors and transduction mechanisms, and 2) GHB interacts with two of the major neurotransmitter systems in the brain known to be involved in sleep, alertness and a variety of mood disorders: the dopaminergic and GABAergic systems. Furthermore, it is known that GHB affects sleep in humans and animals (see below).

GHB is an endogenous compound with hypnotic properties that is found in many human body tissues. GHB is present, for example, in the mammalian brain and other tissues. In brain the highest GHB concentration is found in the hypothalamus and basal ganglia and GHB is postulated to function as a neurotransmitter (Snead and Morley, 1981). The neuropharmacologic effects of GHB include increases in brain acetylcholine, increases in brain dopamine, inhibition of GABA-ketoglutarate transaminase and depression of glucose utilization but not oxygen consumption in the brain. GHB is converted to succinate and then metabolized via the Krebs cycle. Clinical trials have shown that GHB increases delta sleep and improves the continuity of sleep (Ladinsky et al, 1983; Anden and Stock, 1973; Stock et al, 1973; Laborit, 1973; Lapiene et al, 1988; Lapiene et al, 1990; Yamda et al, 1967; Grove- White and Kelman, 1971; Scharf, 1985).

GHB has typically been administered in clinical trials as an oral solution (Mamelak, 1977; Hoes, 1980; Scharf, 1985; Scrima, 1990; Gallimberti, 1992; Series, 1992; Lammers, 1993). GHB treatment substantially reduces the signs and symptoms of narcolepsy, i.e. daytime sleepiness, cataplexy, sleep paralysis and hypnagogic hallucinations. In addition, GHB increases total sleep time and REM sleep, and it decreases REM latency (Mamelak et al, 1973; Yamada et al, 1967; Bedard et al, 1989), reduces sleep apnea (Series et al, 1992; Scrima et al, 1987), and improves general anesthesia (Hasenbos and Gielen, 1985).

GHB has also been shown to affect the sleep/wake cycle, in particular SWS. Slow-wave sleep is an essential component of restorative sleep. Sleep is generally divided into two fundamentally different states, refened to as REM (rapid-eye-movement) and non-REM sleep that alternate with a periodicity of 90-100 min throughout the sleep period (Zee and Turek, 1999). REM sleep is characterized by EEG activation, muscle atonia, bursts of eye movements and vivid dreaming. Non-REM sleep is divided into four stages, according to the depth of sleep and is described in more detail below.

In normal young adults, SWS and REM sleep each occupies 20-25% of the night, whereas roughly 50% is spent in stages I and II. Awakenings interrupting sleep are rare and brief. Sleep quality is markedly affected by aging. The first alteration is a sharp decline in SWS, which is already apparent by 40 years of age, particularly in men (Van Cauter et al, 2000). Adults >50 years have typically less than 20 min of SWS per night as compared to >100 min in young adults. Many elderly subjects have no SWS at all. The loss of SWS occurs at an earlier age than the age- related increase in awakenings that is observed in many elderly humans (Van Cauter et al, 2000). REM sleep appears to be better preserved than SWS during aging (Van Cauter et al, 2000). The normal age-related changes in sleep quality are compounded by pathological conditions and it is estimated that chronic sleep disturbance affects more than half of the U.S. population over the age of 65 years. Restoring or increasing SWS may have beneficial central as well as peripheral effects in a wide variety of conditions affecting millions of individuals.

The design of hypnotic or somnogenic drugs has focused on facilitating sleep onset and increasing sleep efficiency, (i.e. reducing the amount and duration of intra-sleep awakenings), and have not attempted to preserve or enhance the depth of sleep or to provide a good level of alertness upon awakening. The widely used hypnotics typically decrease, rather than increase, SWS and are often associated with drowsiness and grogginess on awakening.

Certain embodiments of the invention describe methods and compositions for the development of novel sedative drugs that enhance physiological SWS and provide a high level of alertness upon awakening. Compounds such as these are needed for the treatment of sleep disorders and related disease states, h various embodiments, sleep disorders that are directly or indirectly related to a disease state may be treated with the compounds of the invention.

III. SLEEP DISORDERS

There are a number of ways to subjectively or objectively determine whether the onset, duration or quality of sleep (e.g. non-restorative or restorative sleep) is impaired or improved. One method is a subjective determination of the subject or patient, e.g., do they feel drowsy or rested upon waking. Other methods involve the observation of the patient or subject by another during sleep, e.g., how long it takes the patient to fall asleep, how many times does the patient wake up during the night, how restless is the patient during sleep, etc.

Another method is to objectively measure the stages of sleep. Polysomnography is the monitoring of multiple electrophysiological parameters during sleep and generally includes measurement of electroencephalographic (EEG) activity, electroculographic (ECG) activity and electromyographic (EMG) activity, as well as other measurements. These results, along with observations, can measure not only sleep latency (the amount of time required to fall asleep), but also sleep continuity (overall balance of sleep and wakefulness), which may be an indication of the quality of sleep.

There are five distinct sleep stages that can be measured by polysomnography: rapid eye movement (REM) sleep and four stages of no-rapid eye movement or non-REM (NREM) sleep (stages I, II, III and IV). Stage I NREM sleep is a transition from wakefulness to sleep and occupies about 5% of time spent asleep in healthy adults. Stage II NREM sleep, which is characterized by specific EEG waveforms (sleep spindles and K complexes), occupies about 50% of time spent asleep. Stages III and IV NREM sleep (also known collectively as slow-wave sleep) are the deepest levels of sleep and occupy about 10-20% of sleep time.

These sleep stages have a characteristic temporal organization across the night. NREM stages III and IV tend to occur in the first one-third to one-half of the night and increase in duration in response to sleep deprivation. Stages III and IV conespond to deep sleep, with higher arousal thresholds, and are characterized by the appearance of high amplitude low frequency (0.5-4 Hz) waves in the EEG, slow wave sleep. In humans as well as in rats, SWS appears to be primarily controlled by a recovery process dependent on the duration of prior wakefulness, often refened to as the "homeostatic component" (Borbely, 1998). The level of this component rises during waking and decays during sleep.

In humans, GHB significantly reduced sleep latency as compared to placebo (from 19.2 ± 2.8 min under placebo to 9.8 ± 1.2 min under GHB, p<0.005). Despite the fact that, at baseline, these older adults had minimal amounts of SWA, GHB administration consistently enhanced SWA. By visual examination, the EEG patterns in SWS were indistinguishable from those observed in younger adults. As illustrated in FIG. 5, the restoration of SWS in early sleep was associated with a significant (p<0.005) increase in GH secretion (P = 0.01). The levels of SWA and GH secretion in GHB-treated 55 to 81 years old adults were intennediate between those seen in young (26 ± 2 years) men and those seen at baseline before treatment.

There were no adverse reactions or undesirable side effects and the treatment was well tolerated. However, in the majority of subjects, GHB treatment resulted in an early morning awakening (3 to 4 hours post GHB) and some of the subjects were unable to reinitiate sleep for more than one hour. These early awakenings are thought to be related to a delayed elevation of dopaminergic activity by GHB.

In various animal models, GHB may induce a "sleep-like" state (Sharpley and Cowen, 1995; Godschalk et al, 1977; Mamelak, 1989; and Tunniclif, 1992). In rodents, at high doses, GHB was also found to induce a sequence of EEG phenomena characterized by a high amplitude and a low frequency EEG activity during the waking state, a condition reminiscent of absence epilepsy (Godschalk et al, 1977). Such epileptic-like activity has not been observed in humans.

The reported effects of GHB on the "sleep-like" state of laboratory animals, whether monitored behaviorally or via the EEG, are highly variable, depending on the species, the dose and the time of administration. Early studies indicated that GHB at doses of 50 and lOOmg/kg could induce a selective increase in REM sleep in the cat (Jouvet et al, 1961 and Matsuzaki et al, 1964) but not in the rat (Marcus et al, 1967) or in man (Yamada et α/.,1967). Two subsequent studies in the rat did find that doses as low as 25-100 mg/kg i.p. could induce an increase in NREM sleep while REM sleep was not affected (Godschalk et al, 1977 and Monti et al, 1979). A series of pilot studies in a limited number of rats (n=6 or n=2) have indicated that the latency to REM sleep was reduced by i.p. administration of a low dose (lOmg/kg) of GHB at the beginning of the usual rest period, but not later or at a high dose (160mg/kg) (Girodas et al, 1996 and Girodas et al, 1995). While these preliminary reports were the first to indicate that the effects of GHB may be dependent on time of day, in these studies, similar to all previous reports, GHB was only administered during the light, a time of inactivity in these nocturnal animals. The inventors have found that the effects of GHB on sleep are much more pronounced during the night than during the day, which indicates that the impact of GHB on sleep is typically dependent upon the time of day of administration. This dependence of sleep-inducing effects on time of day is not unique to GHB and has been previously observed for other compounds. For example, GHRH promotes NREM sleep in rats when injected at the onset of the dark period (Obal et al, 1988), but has no effect on these parameters when administered at the onset of the light period (Obal et al, 1996).

In addition to its effects on sleep, GHB affects locomotor activity and body temperature in rats. Previous studies have shown that administration of GHB was associated with a reduction of locomotor activity (Wachtel et al, 1978) and a decrease of body temperature (Lin et al, 1979). More recently, GHB has been reported to have a biphasic effect on body temperature depending on the dose, with hyperthermia after low doses (5-10 mg/kg) and hypothermia after high doses (300-500 mg/kg) in rats (Kaufman et al, 1990).

The rat is the animal model of choice for the development of hypnotic drugs and also appears to be a good animal model to screen GHB-related compounds, including analogs, derivatives, and/or mimetics, for sleep-enhancing properties. The rat may be used as an in vivo animal model to screen for novel compounds that enhance SWS and EEG-SWA in non-REM sleep in humans.

IV. METHODS OF SCREENING

Screening assays of the present invention generally involve determining the ability of a candidate substance to bind to the receptor and to affect the activity of the receptor, such as the screening of candidate substances to identify those that activate, inhibit or otherwise modify the receptor's function. Typically, this method includes preparing recombinant receptor polypeptide, followed by testing the recombinant polypeptide or cells expressing the polypeptide with a candidate substance to determine the ability of the substance to affect a physical or physiological function. In prefened embodiments, the invention relates to the screening of candidate substances to identify those that affect the activity of the human receptor, and thus identifying candidate substances that may be suitable for use in humans, h various embodiments, screening assays are designed to identify agents useful in mimicking the desirable aspects of GHB while eliminating the undesirable aspects, prefened assays employ GHB as the normal agonist or ligand. Particularly prefened compounds will be those useful in inhibiting or promoting the functions of hGHB receptors in the brain of a patient or subject. However, assays are not limited to the use of a functional receptor polypeptide. For example, polypeptide and peptide fragments may be used in assays for identifying antibody or other candidate substance's interaction with a portion of the receptor polypeptide. In various embodiments of the screening assays of the present invention, the candidate substance may first be screened for basic biochemical activity - e.g., binding to hGHB receptor or a fragment thereof. Subsequently the candidate substance may then be tested for its ability to modulate activity at the cellular, tissue or whole animal level. For certain candidate substances only the ability to bind an hGHB receptor or a fragment thereof is needed.

Candidate substance binding may be identified through binding assays, affinity chromatography, dihybrid screening assays, BIAcore assays, gel overlay assays, or other methods described herein or known in the art. Suitable assays for receptor activity include, but are not limited to those described in: Enna et al, 2002; Coligan et al, 1999; Takai et al, 1987; Bierer et al, 1988; Rosenstein et al, 1989; Stoltenberg et al, 1994; and Stitt et al, 1995; each of which is incorporated herein by reference in its entirety.

In other embodiments, screening assays may be used to determine the ability of a candidate substance to bind to an hGHB receptor polypeptide, not necessarily inducing or stimulating any activity of the receptor. In some embodiments an hGHB receptor polypeptide may or may not be functional or full length. Thus, a screening assay may encompass the determination of the ability of a candidate substance to bind a peptide or polypeptide fragment either alone or in the context of a fusion protein or other non-GHB context.

There are believed to be a wide variety of embodiments that can be employed to determine the effect of the candidate substance on an hGHB receptor polypeptide of the invention, and the invention is not intended to be limited to any one such method. However, it is generally desirable to employ a system wherein one can measure the ability of the receptor polypeptide to bind to and/or be modified by a substance. Accordingly, it is proposed that this aspect of the present invention provides those of skill in the art with methodology that allows for the identification of candidate substances having the ability to bind to and/or to modify the action of GHB receptor polypeptides in one or more ways.

In a typical screening assay for identifying candidate substances, one may employ the same recombinant expression host as the starting source for obtaining the receptor polypeptide, generally prepared in the form of a crude homogenate. Recombinant cells expressing the receptor are washed and homogemzed to prepare a crude polypeptide homogenate in a desirable buffer such as disclosed herein. In a typical assay, an amount of polypeptide from the cell homogenate is placed into a small volume of an appropriate assay buffer at an appropriate pH. Candidate substances, such as agonists and antagonists, are added to the admixture in convenient concentrations and the interaction between the candidate substance and the receptor polypeptide is monitored.

Where one uses an appropriate known substrate for the receptor, one can, in the foregoing manner, obtain a baseline activity for the recombinantly produced receptor. Then, to test for activators, inhibitors or modifiers of the receptor function, one can incorporate into the admixture a candidate substance whose effect on the receptor is unknown. By comparing reactions that are carried out in the presence or absence of the candidate substance, one can then obtain information regarding the effect of the candidate substance on the normal function of the receptor.

In one embodiment, such an assay is designed to be capable of discriminating those candidate substances with desirable activating or stimulating properties of GHB, but lack undesirable or secondary properties of GHB. Desirable properties include the specific or preferential activation of a particular GHB receptor or group of GHB receptors, as well as other described herein. In another embodiment, screening assays for testing candidate substances such as agonists and antagonists of GHB receptors are used to identify such candidate substances having selective ability to interact with one or more of the GHB receptor polypeptides, but which polypeptides are without a substantially overlapping activity with other GHB receptors and, thus, selectively activating a subset of GHB receptors.

Additionally, screening assays for the testing of candidate substances are designed to allow the investigation of structure activity relationships of GHB with the GHB receptors, e.g., study of binding of naturally occurring molecules or other substances capable of interacting or otherwise modulating the GHB receptor versus studies of the activity caused by the binding of such molecules to the GHB receptor. A. Assay Formats

In certain embodiments, the present invention provides methods of screening for modulators of hGHB receptor. In one embodiment, the present invention is directed to a method of:

(i) providing an hGHB receptor polypeptide or fragment thereof;

(ii) contacting the hGHB receptor polypeptide with a candidate substance; and

(iii) determining the binding of the candidate substance to the hGHB receptor polypeptide.

In yet another embodiment, the assay looks not at binding, but at the activity of an hGHB receptor, or variant thereof. Such methods would comprise, for example:

(i) providing a cell that expresses hGHB receptor or variant polypeptide;

(ii) contacting the cell with a candidate substance; and

(iii) determining the effect of the candidate substance on the activity of an hGHB receptor or variant thereof.

As described below, screening assays may be carried out in vitro, in cyto or in cells, in vivo and/or a combination thereof. Cells useful in the methods of the present invention include eukaryotic and prokaryotic cells including, but not limited to bacterial cells, yeast cells, fungal cells, insect cells, nematode cells, plant or animal cells. Suitable animal cells include, but are not limited to CHO, HEK, HeLa, COS, and various primary mammalian cells or cell lines. For example, receptors have been expressed in E. coli (Bertin et al, 1992), in yeast (King et al, (1990) and in mammalian cells (Bouvier et. al. 1988). The cell will typically be engineered to express one or more hGHB receptor polypeptide(s) and may also express other proteins that aid in or are necessary for detection of hGHB receptor activity, including, but not limited to a reporter construct, a kinase, a kinase substrate, a green fluorescent protein (GFP) or a GFP fusion protein, as well as other known molecules for signaling, reporting or detecting receptor activity. In particular embodiments, signaling molecules known to associate or are activated directly or indirectly by G-protein coupled receptors may be expressed, detected or monitored for activation, inhibition, translocation, modification or the like.

Cells useful in the present methods include those that express an hGHB receptor. As used herein, a cell that expresses hGHB receptor is one that contains a functional hGHB receptor localized in an appropriate compartment within the cell, such as its membrane(s); the cells may naturally express the hGHB receptor of interest, or may be genetically engineered to express the hGHB receptor. The hGHB may also be constitutively expressed or under the control of an inducible promoter. Cells of the invention may also express an hGHB receptor peptide, polypeptide, variant thereof that may or may not be a functional hGHB receptor.

In general, such screening procedures involve providing appropriate cells that express an hGHB receptor on the cell surface. In particular, a polynucleotide encoding the receptor of the present invention may be employed to transfect cells and provide for expression of the receptor. Alternatively, a cell line that expresses the hGHB receptor may be obtained. Generally, screening may identify agonist or antagonist of the hGHB receptor. Agonist may be identified by contacting the receptor with a candidate agonist and detecting activation of the receptor. Antagonist may be identified by contacting the receptor with a know agonist in combination with a candidate antagonist and observing an inhibition or reduction in the activity of the agonist

One such screening procedure involves the use of the melanophores which are transfected to express the receptor of the present invention. Such a screening technique is described in WO 92/01810, incorporated herein by reference. Thus, for example, such an assay may be employed for screening for a receptor antagonist by contacting cells expressing the receptor with the receptor ligand and/or a compound to be screened. Inhibition of the signal generated by the ligand indicates that a compound is a potential antagonist for the receptor, i.e., inhibits activation of the receptor.

The screen may be employed for determining an agonist by contacting such cells with compounds to be screened and determining whether such compound generates a signal, i.e., activates the receptor. Screening techniques include the use of cells that express the receptor (for example, transfected CHO cells) in a system in which a signal may be measured, for example an electrical signal, detected by patch-clamp techniques or the like, caused by receptor activation. For example, potential agonists or antagonists may be contacted with a cell which expresses the receptor and provides for a second messenger response, e.g. signal transduction mechanisms that may be measured to determine whether the potential agonist or antagonist is effective.

Another screening technique involves introducing RNA encoding the receptor into xenopus oocytes to transiently express the receptor. The receptor oocytes may then be contacted in the case of agonist screening with a compound to be screened, followed by detection of activation of a calcium signal.

An additional screening technique involves expressing the receptor in which the receptor is linked or operatively coupled to a phospholipase C or D. As representative examples of such cells, there may be mentioned endothelial cells, smooth muscle cells, embryonic kidney cells, etc. The screening for an agonist or antagonist may be accomplished as described by detecting activation of the receptor or inhibition of activation of the receptor by using the phospholipase activity as a secondary signal.

Another method involves screening for compounds which bind to the receptor polypeptide of the present invention by determining inhibition or displacement of binding of a labeled ligand to cells that have the receptor on the surface thereof. Such a method involves transfecting a eukaryotic cell with DNA encoding the receptor such that the cell expresses the receptor on its surface and contacting the cell with a potential agonist or antagonist in the presence of a labeled form of a known ligand. The ligand can be labeled, e.g., by radioactivity. The amount of labeled ligand bound to the receptors is measured, e.g., by measuring radioactivity of the receptors. If the candidate substance binds to the receptor as determined by a reduction of labeled ligand that binds to the receptors, then the candidate substance binds to the receptor. Further study may be initiated as described herein to determine if the candidate substance is an agonist or antagonist of the receptor.

Examples of receptor agonist or antagonists include antibodies, or in some cases, oligonucleotides, which bind to the receptor, may or may not elicit a second messenger response such that the activity of the receptor is stimulated or prevented. Antibodies include anti-idiotypic antibodies, which recognize unique determinants generally associated with the antigen-binding site of an antibody. Potential agonist or antagonists also include proteins that are closely related to the ligand of the receptor, i.e. a fragment or mimetic of the ligand.

Another potential receptor agonist or antagonist is a small molecule that binds to the receptor, activating or making it inaccessible to ligands such that normal biological activity is prevented, respectively. Examples of small molecules include but are not limited to GHB analogs, derivatives, and mimetics; small peptides or peptide-like molecules.

Potential antagonists also include a soluble form of a receptor, e.g. a fragment of the receptor, which binds to the ligand and prevents the ligand from interacting with membrane bound receptors.

Recombinant receptor expression systems of the present invention possess definite advantages over tissue-based systems. The methods of the present invention make it possible to produce large quantities of hGHB receptors for use in screening assays. More important, however, is the relative purity of the receptor polypeptides provided by the present invention. A relatively pure polypeptide preparation for assaying a protein-protein interaction makes it possible to use elutive methods without invoking competing and unwanted side-reactions. Expression systems such as those described herein are also useful when there is difficulty in obtaining tissue that satisfactorily expresses a particular receptor or multiple receptors are expressed in the same or sunounding tissue. For agonist or antagonists in a primary screen, microorganism expression systems may be used and are inexpensive compared to tissue- screening and other methods.

Traditionally, screening assays employed the use of crude receptor preparations. Typically, animal tissue slices thought to be rich in the receptor of interest. Alternatively, tissues may be homogenized and the crude homogenate used as a receptor source. A major difficulty with this approach is that there is rarely a tissue type where only one receptor type is expressed. The data obtained therefore may not be definitively conelated with a particular receptor. A second fundamental difficulty with the tissue homogenate approach is the limited availability or unavailability of human tissue for drug screening. The traditional approach almost invariably utilized animal receptors. With the cloning of human receptors, there is an additional advantage of utilizing human receptors in at least some steps of the screening procedure.

A major advantage of recombinant receptor screening systems over tissue-based systems is that the investigator can now control the type of receptor that is utilized in a screening assay. Specific receptor types and sub-types can be preferentially expressed and its interaction with a ligand or candidate substance may be identified. Other advantages include the availability of large amounts of receptor, the availability of rare receptors previously unavailable in tissue samples, and the reduction or lack of expenses associated with the maintenance of live animals. Other advantages include the ability to co-express other molecules such that detection of a natural or artificial second messenger system may be used to enhance, simplify, and/or improve the detection of receptor activation.

The detection of an interaction between an agent and a receptor can be accomplished through techniques well known in the art. These techniques include but are not limited to centrifugation, chromatography, electrophoresis and spectroscopy. The use of isotopically labeled reagents in conjunction with these techniques, other techniques described herein or alone is also contemplated. Candidate substances of the invention may be associated or coupled to radioisotopes, colorimetric molecules, or other detectable molecules or substances. Commonly used radioactive isotopes include ³H, ¹⁴C, ²²Na, ³²P, ³⁵S, ⁴⁵Ca, ⁶⁰Co, ¹²⁵I, and ¹³¹I. Commonly used stable isotopes include ²H, ¹³C, ¹⁵N, ¹⁸O. Commonly used colorimetric molecules include, but are not limited to fluorescent molecules such as fluorescamine, rhodamine or other fluormetric molecules. For example, if an agent can bind to the receptor of the present invention, the binding can be detected by using radiolabeled agent or radiolabeled receptor. Briefly, if radiolabeled agent or radiolabeled receptor is utilized, the agent receptor complex can be detected by liquid scintillation or by exposure to X-Ray film.

When an agent modifies or stimulates/induces a modification of the receptor, the modified receptor can also be detected by differences in mobility between the modified receptor and the unmodified receptor through the use of chromatography, electrophoresis or centrifugation. When the technique utilized is centrifugation, differences in mobility are known as the sedimentation coefficient. The modification can also be detected by differences between the spectroscopic properties of the modified and unmodified receptor. As a specific example, if an agent covalently modifies a receptor, the difference in retention times between modified and unmodified receptor or peptide fragments of a receptor on a high pressure liquid chromatography (HPLC) column can easily be detected.

As a specific example, where an agent covalently modifies a receptor, the spectroscopic differences between modified and unmodified receptor in the nuclear magnetic resonance (NMR) spectra can be detected. Alternatively, one can focus on the candidate substance and detect the differences in the spectroscopic properties or the difference in mobility between the free candidate substance and the candidate substance after modification of the receptor.

Where a secondary polypeptide is provided, the agent receptor-secondary polypeptide complex or the receptor-secondary polypeptide complex can be detected. Differences in mobility or differences in spectroscopic properties as described above can be detected.

It is further contemplated that where a secondary polypeptide is provided the enzymatic activity of the secondary or effector polypeptide can be detected. For example, many receptors exert physiological effects through the stimulation or inhibition of adenylyl cyclase. The enzymatic activity of adenylyl cyclase in the presence of a candidate substance can be detected.

The interaction of an agent and a receptor can be detected by providing a reporter gene that is activated or inhibited by modulation of the receptor. Well known reporter genes include β-galactosidase (β-Gal), chloramphenicol transferase (CAT) and luciferase. A host cell may express a reporter gene and the reporter gene's enzymatic activity may be detected directly or indirectly.

In certain assays, an admixture containing the polypeptide, effector and candidate substance is allowed to incubate for a selected amount of time, and the resultant incubated mixture subjected to a separation process to separate the unbound effector remaining in the admixture from any effector/receptor complex so produced. Then, one simply measures the amount of each (e.g., versus a control to which no candidate substance has been added). This measurement can be made at various time points where velocity data is desired. From this, one can determine the ability of the candidate substance to alter or modify the function of the receptor.

Numerous techniques are known for separating the effector from effector/receptor complex, and all such methods are intended to fall within the scope of the invention. Use of immunoprecipitation (IP), thin layer chromatographic methods (TLC), HPLC, spectrophotometric, gas chromatographic/mass spectrophotometric, NMR analyses or the like. It is contemplated that any such technique can be employed so long as it is capable of differentiating between the effector and complex, and can be used to determine enzymatic function such as by identifying or quantifying the substrate and product.

The effector/receptor complex itself can also be the subject of techniques such as x-ray crystallography. Where a candidate substance replaces the GHB molecule, studies designed to monitor the replacement and its effect on the receptor will be of particular benefit.

Various cell lines that express hGHB receptor can be utilized for screening of candidate substances. For example, cells containing an hGHB receptor with native and/or engineered indicators can be used to study various functional attributes of candidate compounds. In such assays, the compound would be formulated appropriately, given its biochemical nature, and contacted with a target cell.

Depending on the assay, culture may be required. As discussed above, the cell may then be examined by virtue of a number of different physiologic assays (growth, size, Ca* ^" effects, cAMP production, kinase activity, phosphorylation state, localization of detectable fusion proteins, fluorescence activated cell sorting (FACS), etc.). Alternatively, molecular analysis may be performed in which the function of an hGHB receptor and related pathways may be explored. This involves assays such as those for protein expression, enzyme function, substrate utilization, mRNA expression (including differential display of whole cell or polyA RNA) and others.

B. Assay Conditions

As is well known in the art, a screening assay provides a receptor under conditions suitable for the binding of an agent to the receptor. These conditions include, but are not limited to pH, temperature, tonicity, the presence of relevant co-factors, and relevant modifications to the polypeptide such as glycosylation or prenylation. It is contemplated that the receptor can be expressed and utilized in a prokaryotic or eukaryotic cell. The host cell expressing the receptor can be used whole or the receptor can be isolated or partially isolated from the host cell. The receptor can be membrane bound in the membrane of the host cell or it can be free in the cytosol of the host cell. The host cell can also be fractionated into sub-cellular fractions where the receptor can be found. For example, cells expressing the receptor can be fractionated into the nuclei, the endoplasmic reticulum, vesicles, or the membrane surfaces of a cell.

Assay conditions are typically provided so that physical, chemical or biological activity of the receptor is maintained. pH is preferably from about a value of 6.0 to a value of about 8.0, more preferably from about a value of about 6.8 to a value of about 7.8 and, most preferably about 7.4. In certain embodiments, temperature may be from about 20°C to about 50°C, more preferably from about 30°C to about 40°C and, even more preferably about 37°C. Osmolality is preferably from about 5 milliosmols per liter (mosm/L) to about 400 mosm/L and, more preferably from about 200 milliosmols per liter to about 400 mosm/L and, even more preferably from about 290 mosm/L to about 310 mosm/L. The presence of co-factors may be required for the proper functioning of the receptor. Typical co-factors include sodium, potassium, calcium, magnesium, and chloride. In addition, small, non-peptide molecules, known as prosthetic groups can be required. Other biological conditions needed for receptor function are well known in the art.

It is well known in the art that proteins can be reconstituted in artificial membranes, vesicles or liposomes (Danbolt et al, 1990). The present invention contemplates that the receptor can be incorporated into artificial membranes, vesicles or liposomes. The reconstituted receptor may then be utilized in screening assays.

It is further contemplated that the receptor of the present invention can be coupled to a solid support. The solid support can be agarose beads, polyacrylamide beads, polyacrylic beads or other solid matrices capable of being coupled to proteins. Well known coupling agents include cyanogen bromide, carbonyidiimidazole, tosyl chloride, and glutaraldebyde.

It is further contemplated that secondary polypeptides which can function in conjunction with the receptor of the present invention can be provided. For example, the receptor of the present invention may exert its physiological effects in conjunction with a G-protein and an effector polypeptide.

1. In vitro Assays

A quick, inexpensive and easy assay to run is a binding assay. Binding of a molecule to a receptor may, in and of itself, be inhibitory, due to steric, allosteric or charge-charge interactions. This can be performed in solution or on a solid phase and can be utilized as a first round screen to rapidly eliminate certain compounds before moving into more sophisticated screening assays. In one embodiment of this kind, the screening of candidate substances that bind to an hGHB receptor molecule or fragment thereof is provided.

The receptor may be either free in solution, fixed to a support, expressed in or on the surface of a cell or a membrane preparation. Either the target or the candidate compound may be labeled, thereby permitting the determination of binding. In another embodiment, the assay may measure the inhibition of binding of a candidate to a natural or artificial substrate or binding partner (such as GHB or NCS-382 a known antagonist of GHB response). Competitive binding assays can be performed in which one of the agents (GHB or GHB analog for example) is labeled. One may measure the amount of free label versus bound label to determine binding or inhibition of binding. The receptor, candidate substance, or competitive agent may be labeled, depending on the assay.

A technique for high throughput screening of compounds is described in WO 94/03564, which is incorporated herein by reference. Large numbers of small peptide test compounds are synthesized on a solid substrate, such as plastic pins or some other surface. The peptide test compounds are reacted with, for example, an hGHB receptor and washed. Bound polypeptide is detected by various methods.

Purified or partially purified target, such as an hGHB receptor, can be coated directly onto plates for use in the aforementioned drug screening techniques. However, non-neutralizing antibodies to the polypeptide can be used to immobilize the polypeptide to a solid phase. 2. In cyto Assays

A cell expressing a receptor can be used whole to screen agents or candidate substances. For example, cells expressing the receptor of the present invention can be exposed to radiolabelled agent or candidate substance and the amount of binding of the radiolabelled agent or candidate substance to the cell can be determined.

The cell expressing the receptor may be fractionated into sub-cellular components that contain the receptor of the present invention. Methods for purifying sub-cellular fractions are well known in the art (Bonifacino et al, 1999, which is incorporated herein by reference). Sub- cellular fractions include but are not limited to the cytoplasm, cellular membrane, other membranous fractions such as the endoplasmic reticulum, golgi bodies, vesicles and the nucleus. Receptors isolated as sub-cellular fractions can be associated with cellular membranes. For example, if cellular membrane vesicles are isolated from the cell expressing the receptor, the receptor molecule can be membrane bound. It is further contemplated that the receptor of the present invention can be purified from a cell that expresses the receptor. Methods of purification are well known in the art. The purified receptor can be used in screening assays. 3. In vivo Assays

The present invention particularly contemplates the use of various animal models, particularly the rat. Animals may be used that permit evaluation of hGHB receptor activity and/or function. A description of the materials, methods and techniques for use of these animals is described herein.

Treatment of animals with test compounds (candidate substances) will involve the administration of the compound, in an appropriate form, to the animal. Administration will be by any route the could be utilized for clinical or non-clinical purposes, including but not limited to oral, nasal, buccal, even topical, bronchial instillation, intradermal, subcutaneous, intramuscular, intraperitoneal or intravenous injection.

In alternative embodiments, an animal model expressing an accessory molecule such as an effector-fusion protein (e.g., beta anestin-GFP) throughout its tissues, or within a particular organ or tissue type, may be used in studying cellular targets of known or unknown hGHB receptor ligands. These detectable second messenger fusions may be used to detect GHB receptor activation within the whole animal or tissue context.

The animals, subjects, or patients may be monitored by observation, polygraphic and electrophysiologic recording, tissue and/or fluid sampling, necropsy, and the like.

C. Candidate Substances

As used herein, the term "candidate substance" refers to any molecule or agent that may potentially bind to or modulate hGHB receptor activity or function. The candidate substance may be a protein or fragment thereof, a small molecule, or even a nucleic acid molecule. It may prove to be the case that the most useful pharmacological compounds will be compounds that are structurally related to compounds which interact naturally with hGHB receptor, such as analogs, derivatives, or mimetics of GHB. Creating and examining the action of such molecules is known as "rational drug design," and include making predictions relating to the structure of target molecules. For exemplary methods see: Moneale et al, 2002; Matter et al, 2001; each of which is incorporated herein by reference. Also, an inhibitor according to the present invention may be one which exerts an inhibitory effect on the function activity of hGHB receptor. By the same token, an activator according to the present invention may be one which exerts a stimulatory effect on the expression or function/activity of hGHB receptor. Rational drug design may be used to produce structural analogs of biologically active polypeptides or target compounds. By creating such analogs, it is possible to fashion drugs which are more active or stable than the natural molecules, which have different susceptibility to alteration or which may affect the function of various other molecules, hi one approach, one may generate or predict a three-dimensional structure for a molecule like a GHB receptor or GHB itself, and then design a molecule for its ability to interact with GHB and/or hGHB receptor or mimic GHB. Alternatively, one could design a partially functional fragment of a GHB and/or hGHB receptor (binding but no activity), thereby creating a competitive inhibitor. This could be accomplished by x-ray crystallography, computer modeling or by a combination of both approaches.

It also is possible to use antibodies to ascertain the structure of a target compound or inhibitor, hi principle, this approach yields a pharmacore upon which subsequent drug design can be based. It is possible to bypass protein crystallography altogether by generating anti- idiotypic antibodies to a functional, pharmacologically active antibody. As a minor image of a minor image, the binding site of anti-idiotype would be expected to be an analog of the original antigen. The anti-idiotype could then be used to identify and isolate peptides from banks of chemically- or biologically-produced peptides. Selected peptides would then serve as the pharmacore. Anti-idiotypes may be generated using the methods described herein for producing antibodies, using an antibody as the antigen.

On the other hand, one may simply acquire, from various commercial sources, small molecule libraries that are believed to meet the basic criteria for useful drugs in an effort to "brute force" the identification of useful compounds. Screening of such libraries, including combinatorially generated libraries (e.g., peptide libraries), is a rapid and efficient way to screen large number of related (and unrelated) compounds for activity. Combinatorial approaches also lend themselves to rapid evolution of potential drugs by the creation of second, third and fourth generation compounds modeled on active, but otherwise undesirable compounds. In certain embodiments, combinatorial libraries based on the structure of various GHB analogs, such as GBL (gamma butyrolactone, 2(3H)-Furanone di-hydro), BD (1,4 butanediol or tetramethylene glycol, 1,4-Dihydroxybutane, 1,4-Butyleneglycol, SUCOL-B), GVL (gamma- valerolactone, 4- pentanolide) or NCS-382 may be used.

Candidate compounds may include fragments or parts of natαirally-occurring compounds or may be found as active combinations of known compounds which are otherwise inactive. It is proposed that compounds isolated from natural sources, such as animals, bacteria, fungi, plant sources, including leaves and bark, and marine samples may be assayed as candidates for the presence of potentially useful pharmaceutical agents. It will be understood that the pharmaceutical agents to be screened could also be derived or synthesized from chemical compositions or man-made compounds. Thus, it is understood that the candidate substance identified by the present invention may be polypeptide, polynucleotide, small molecule(s) or any other compounds that may be designed through rational drug design starting from known modulators of a SWS, sedative or hypnotic response.

It will, of course, be understood that all the screening methods of the present invention are useful in themselves notwithstanding the fact that effective candidates may not be found. The invention provides methods for screening for such candidates, not solely methods of finding them.

Furthermore, exemplary methods of manufacture for GHB analogs or derivatives related to GHB and candidate substances are known in the art. Exemplary methods can be found or derived from Zink et al. (2003); Advanced Organic Chemistry, March (1977); Sterile Pharmaceutical Products: Process Engineering Applications (Drug Manufacturing Technology Series, V. 1) by Kenneth E. Avis (Editor) (1995); and Biotechnology and Biopharmaceutical Manufacturing, Processing, and Preservation (Drug Manufacturing Technology Series, Vol 2) by Kenneth E. Avis (Editor), Vincent L. Wu (Editor) (1996), as examples. In particular slight modifications of known methods will, typically result in manufacturing methods for derivative of known substances.

D. Screening Assays for GHB Receptor Polypeptides

The present invention provides a process of screening a biological sample for the presence of a GHB receptor polypeptide. A biological sample to be screened can be a biological fluid such as extracellular, e.g., cerebrospinal fluid, or intracellular fluid or a cell or tissue extract or homogenate. A biological sample can also be an isolated cell (e.g., in culture) or a collection of cells such as in a tissue sample or histology sample. A tissue sample can be suspended in a liquid medium or fixed onto a solid support such as a microscope slide.

In accordance with a screening assay process, a biological sample is exposed to an antibody immunoreactive with a GHB, e.g., hGHB, receptor polypeptide whose presence is being assayed. Typically, exposure is accomplished by forming an admixture in a liquid medium that contains both the antibody and the candidate receptor polypeptide. Either the antibody or the sample with the hGHB receptor polypeptide can be affixed to a solid support (e.g., a column or a microliter plate). The biological sample is exposed to the antibody under biological reaction conditions and for a period of time sufficient for antibody-polypeptide conjugate formation. Biological reaction conditions include ionic composition and concentration, temperature, pH and the like.

Ionic composition and concentration can range from that of distilled water to a 2 molal solution of NaCl. Preferably, osmolality is from about 100 mosmols/1 to about 400 mosmols/1 and, more preferably from about 200 mosmols/1 to about 300 mosmols/1. Temperature preferably is from about 4°C to about 100°C, more preferably from about 15°C to about 50°C and, even more preferably from about 25°C to about 40°C pH is preferably from about a value of 4.0 to a value of about 9.0, more preferably from about a value of 6.5 to a value of about 8.5 and, even more preferably from about a value of 7.0 to a value of about 7.5. The only limit on biological reaction conditions is that the conditions selected allow for antibody-polypeptide conjugate formation and that the conditions do not adversely affect either the antibody or the hGHB receptor polypeptide.

Exposure time will vary inter alia with the biological conditions used, the concentration of antibody and polypeptide and the nature of the sample (e.g., fluid or tissue sample). Means for determining exposure time are well known to one of ordinary skill in the art. Typically, where the sample is fluid and the concentration of polypeptide in that sample is about 10^"10 M, exposure time is from about 10 minutes to about 200 minutes.

The presence of hGHB receptor polypeptide in the sample is detected by detecting the formation and presence of antibody-hGHB receptor polypeptide conjugates. Means for detecting such antibody-antigen (e.g., receptor polypeptide) conjugates or complexes are well known in the art and include such procedures as centrifugation, affinity chromatography and the like, binding of a secondary antibody to the antibody-candidate receptor complex.

In one embodiment, detection is accomplished by detecting an indicator affixed to the antibody. Exemplary and well known, such indicators include radioactive labels (e.g., ³²P, ¹²⁵I, ¹⁴C), a second antibody or an enzyme such as horse radish peroxidase (HRP). Means for affixing indicators to antibodies are well known in the art. Commercial kits are available.

E. Screening Assay for a Polynucleotide that Encodes a GHB or hGHB Receptor Polypeptide

A DNA molecule and, particularly a probe molecule, can be used for hybridizing as oligonucleotide probes to a DNA source suspected of possessing an hGHB receptor polypeptide encoding polynucleotide or gene. The probing is usually accomplished by hybridizing the oligonucleotide to a DNA source suspected of possessing such a receptor gene, hi some cases, the probes constitute only a single probe, and in others, the probes constitute a collection of probes based on a certain amino acid sequence or sequences of the hGHB receptor polypeptide and account in their diversity for the redundancy inherent in the genetic code.

A suitable source of DNA for probing in this manner is capable of expressing hGHB receptor polypeptides and can be a genomic library of a cell line of interest. Alternatively, a source of DNA can include total DNA from the cell line of interest. Once the hybridization process of the invention has identified a candidate DNA segment, one confirms that a positive clone has been obtained by further hybridization, restriction enzyme mapping, sequencing and/or expression and testing.

Alternatively, such DNA molecules can be used in a number of techniques including their use as: (1), diagnostic tools to detect nonnal and abnormal DNA sequences in DNA derived from patient's cells or tissue samples, e.g., in situ hybridization; (2) means for detecting and isolating other members of the hGHB receptor family and related polypeptides from a DNA library potentially containing such sequences; (3) primers for hybridizing to related sequences for the purpose of amplifying those sequences; (4) primers for altering the native hGHB receptor DNA sequences; as well as other techniques which rely on the similarity of the DNA sequences to those of the hGHB receptor DNA segments herein disclosed.

As set forth above, in certain aspects, DNA sequence information provided by the invention allows for the preparation of relatively short DNA (or RNA) sequences (e.g., probes) that specifically hybridize to encoding sequences of the selected hGHB receptor gene, hi these aspects, nucleic acid probes of an appropriate length are prepared based on a consideration of the selected hGHB receptor sequence (e.g., a sequence such as that shown in SEQ ID NO:3. The ability of such nucleic acid probes to specifically hybridize to hGHB receptor encoding sequences lend them particular utility in a variety of embodiments. Most importantly, the probes can be used in a variety of assays for detecting the presence of complementary sequences in a given sample. However, uses are envisioned, including the use of the sequence information for the preparation of mutant species primers or primers for use in preparing other genetic constructions.

V. DISORDERS RELATED TO SLEEP DISTURBANCE

Screening of candidate substances would enable the development of improved compounds or pharmaceuticals for the treatment of altered GHB physiology as well as other diseases or disorders that are indirectly related to GHB physiology , such as chronic fatigue syndromes or trauma.

One of the clinical uses of GHB and the modulation of its receptor is the treatment of narcolepsy (Mamelak et al, 1986; Scharf et al, 1985; Scrima et al, 1990; and Lammers et al, 1993). GHB given repeatedly during the night to narcoleptic patients facilitates sleep consolidation and reduces the number of daytime sleep attacks. Narcoleptic patients generally take 2 to 3 doses of GHB across the night to maintain sleep. By consolidating nocturnal REM sleep, GHB decreases daytime pressure for REM sleep.

In normal subjects, oral doses of 30-50 mg/kg GHB at bedtime induce sleep and result in a robust stimulation of SWS and/or SW activity (Lapiene et al, 1990; Mamelak et al, 1977; Series et al, 1992; and Van Cauter et al, 1997). Preliminary reports suggest significant improvement after GHB administration in patients suffering from fibromyalgia (Scharf et al, 1998), a disorder thought to involve a disturbance of SWS. GHB administration is also associated with enhance SWS and SWS-associated GH secretion (Van Cauter et al, 1997 and U.S. Patent 5,840,331, each of which is incorporated herein by reference). GHB also reduces sleep latency, indicating that, in the human GHB has sleep-inducing properties, in addition to SWS-enhancing properties. The effects on SWS and GH were mainly observed during the first 2 hours after sleep onset. There was a doubling of GH secretion, resulting from an increase of the amplitude and the duration of the first GH pulse following sleep onset. This stimulation of GH secretion was significantly conelated to a simultaneous increase in the amount of stage IN sleep. Abrupt but transient elevations of prolactin and cortisol were also observed, but did not appear to be associated with the concomitant stimulation of SWS. Thyrotropin and melatonin profiles were not altered by GHB administration. These data confirm the SWS-enhancing properties of GHB, and demonstrate that GHB is a potent GH secretagogue. It was hypothesized that the effects of GHB may involve a stimulation of central growth hormone releasing hormone (GHRH) release, resulting in both increased SWS (a robust effect following GHRH injections in laboratory rodents as well as humans) and increased GH release.

Both SWS and nocturnal GH secretion are markedly decreased in midlife and late life. A second series of studies was conducted to determine whether pharmacological restoration of SWS is possible in older adults and whether the restoration of SWS and SWA would result in the restoration of nocturnal GH release. The protocol is a 28-day placebo-controlled study with an assessment of sleep and hormonal profiles at baseline, after 7 days of treatment and after 28 days of treatment with a 3 g (± 43 mg/kg) GHB dose. GHB is ingested when the subjects are in bed, 15 min before lights off. hi order to evaluate possible side effects in this older population, the subjects slept in the CRC during the first 7 days of treatment and sleep was recorded during at least 5 of these 7 days. A total of 26 older men and women (55-81 yrs) have been studied.

GHB has several clinical applications other than narcolepsy and sleep disorders. GHB has been reported to reduce alcohol craving, the number of daily drinks consumed, and the symptoms of alcohol withdrawal in patients (Gallimberti et al, 1989; Gallimberti et al, 1992; Gessa et al, 1992). GHB has been used to decrease the symptoms of opiate withdrawal, including both heroin and methadone withdrawal (Gallimberti et al, 1994; Gallimberti et al, 1993). It has analgesic effects that make it suitable as a pain reliever (U.S. Patent 4,393,236). Intravenous administration of GHB has been reported to reduce intracranial pressure in patients (Strong, 1984). Also, administration of GHB was reported to increase growth hormone levels in patients (Gena et al, 1994; Oyama et al, 1970).

A good safety profile for GHB consumption, when used long term for treatment of narcolepsy, has been reported. Patients have been safely treated for many years with GHB without development of tolerance (Scharf, 1985). Clinical laboratory tests carried out periodically on many patients have not indicated organ or other toxicities (Lammers, 1993; Scrima, 1990; Scharf, 1985; Mamelack, 1977; Mamelak, 1979; Gallimberti, 1989; Gallimberti, 1992; Gessa, 1992). The side effects of GHB treatment have been minimal in incidence and degree of severity, though they include sleepwalking, enuresis, headache, nausea and dizziness (Broughton and Mamelak, 1979; Mamelak et al, 1981; Mamelak et al, 1977; Scrima et al, 1989; Scrima et al, 1990; Scharf et al, 1985).

An agent or substance that modulates GHB receptor(s) may be used to treat the above described conditions and a variety of other conditions either directly or indirectly. In particular embodiments, modulators of hGHB may be used as a palliative therapy. Application of sleep therapy is one treatment that may enhance the quality of life of patients suffering from a variety of disease states, including cancer and other chronic illnesses as well as providing palliative therapy for subjects or patients suffering traumatic injuries. Cancer-related fatigue syndrome (CRFS) is a syndrome experience by cancer patients, regardless of their diagnosis, stage of disease, treatment regimen, or age. CRFS may aggravate other symptoms such as pain, nausea, and dyspnea. Thus, hGHB receptor modulators may be used in combination with other standard therapies to enhance the quality of sleep and in the least the quality of life for some patients.

A preparation of a medicament from a composition comprising a compound having a pharmacological activity for an hGHB receptor to treat or prevent at least one disorder or condition including, but not limited to sleep disturbance, insomnia, narcolepsy, cancer, an addictive disorder and/or withdrawal syndrome, an adjustment disorder, an age-associated learning and/or mental disorder, anorexia nervosa, apathy, an attention-deficit disorder, attention-deficit hyperactivity disorder, bipolar disorder, epilepsy, schizophrenia, muscle wasting, growth retardation, obesity, bulimia nervosa, chronic fatigue syndrome, chronic or acute stress, chronic pain, conduct disorder, cyclothymic disorder, depression, dysthymic disorder, fibromyalgia and other somatoform disorders, generalized anxiety disorder, incontinence, an inhalation disorder, an intoxication disorder, mania, migraine headaches, obesity, obsessive compulsive disorders and related spectrum disorders, oppositional defiant disorder, panic disorder, peripheral neuropathy, post-traumatic stress disorder, premenstrual dysphoric disorder, a psychotic disorder, seasonal affective disorder, a sleep disorder, social phobia, a specific developmental disorder, selective serotonin reuptake inhibition (SSRJ) "poop out" syndrome, and TIC disorders. In addition, other disorders may also be treated by compounds that activate, bind, inhibit or otherwise modulate an hGHB receptor including , but not limited to at least one nervous system disorder. Diagnostic criteria for these disorders generally are provided by the American Psychiatric Association, 1994), and in International Publication Nos. WO 99/15177, WO 99/15176, and WO 99/15163, the disclosures of which are hereby incorporated by reference. Furthermore, patients suffering from addictive disorders and withdrawal syndromes may benefit from the administration of a modulator of hGHB receptor(s). These disorders display similar patterns in children, adolescents, and adults. Hence, methods of the present invention are effective in the treatment of child, adolescent, and adult patients. For purposes of the present invention, a child is considered to be a person below the age of puberty, an adolescent is considered to be a person between the age of puberty and up to about 18 years of age, and an adult generally is a person of at least about 18 years of age. The optimum daily dosage for each patient must be determined by a treating physician taking into account each patient's size, other medications which the patient is taking, identity and severity of the disorder, and all of the other circumstances of the patient.

VI. GHB RECEPTOR PEPTIDES AND POLYPEPTIDES hGHB receptor is a designation assigned to a human nucleic acid or protein (SEQ ID NO:3 and SEQ ID NO:4, respectively) that binds and is activated by GHB. As used herein the term GHB receptor includes the hGHB receptor and its related sequences (e.g., SEQ ID NO:9, SEQ ID NO:ll, SEQ ID NO:13, and SEQ ID NO: 15. In addition to an entire GHB receptor molecule, the present invention also relates to fragments of the polypeptide(s) that may or may not retain various functions described below. Fragments, including the N-terminus of the molecule may be generated by genetic engineering of translation stop sites within the coding region (discussed below). Alternatively, treatment of the GHB receptor with proteolytic enzymes, known as proteases, can produce a variety of N-terminal, C-terminal and internal fragments. Examples of fragments may include contiguous residues of SEQ ID NO:4, SEQ ID NO:9, SEQ ID NO:ll, SEQ ID NO:13, or SEQ ID NO:15 of 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 30, 35, 40, 45, 50, 55, 60, 65, 75, 80, 85, 90, 95, 100, 200, 300, 400 or more amino acids in length. These fragments may be purified according to known methods, such as precipitation (e.g., ammonium sulfate), HPLC, ion exchange chromatography, affinity chromatography (including immunoaffinity chromatography) or various size separations (sedimentation, gel electrophoresis, gel filtration). A. Variants of GHB receptor

Amino acid sequence variants of the polypeptide can be substitutional, insertional or deletion variants. Deletion variants lack one or more residues of the native protein which are not essential for function and/or immunogenic activity. Another common type of deletion variant is one lacking secretory signal sequences or signal sequences directing a protein to bind to a particular part of a cell. Insertional mutants typically involve the addition of material at a nonterminal point in the polypeptide. This may include the insertion of an immunoreactive epitope or simply a single residue. Terminal additions, called fusion proteins, are discussed below.

Substitutional variants typically contain the exchange of one amino acid for another at one or more sites within the protein, and may be designed to modulate one or more properties of the polypeptide, such as stability against proteolytic cleavage, without the loss of other functions or properties. Substitutions of this kind preferably are conservative, that is, one amino acid is replaced with one of similar shape and charge. Conservative substitutions are well known in the art and include, for example, the changes of: alanine to serine; arginine to lysine; asparagine to glutamine or histidine; aspartate to glutamate; cysteine to serine; glutamine to asparagine; glutamate to aspartate; glycine to proline; histidine to asparagine or glutamine; isoleucine to leucine or valine; leucine to valine or isoleucine; lysine to arginine; methionine to leucine or isoleucine; phenylalanine to tyrosine, leucine or methionine; serine to threonine; threonine to serine; tryptophan to tyrosine; tyrosine to tryptophan or phenylalanine; and valine to isoleucine or leucine. The following is a discussion based upon changing of the amino acids of a protein to create an equivalent, or even an improved, second-generation molecule. For example, certain amino acids may be substituted for other amino acids in a protein structure without appreciable loss of interactive binding capacity with structures such as, for example, antigen-binding regions of antibodies, binding sites for ligands, binding sites on substrate molecules, binding sites for signal transducing molecules (e.g., trimeric G-proteins, small G-proteins, kinases, adaptor proteins, etc.). Since it is the interactive capacity and nature of a protein that defines that protein's biological functional activity, certain amino acid substitutions can be made in a protein sequence, and its underlying DNA coding sequence, and nevertheless obtain a protein with like properties. It is thus contemplated by the inventors that various changes may be made in the DNA sequences of genes without appreciable loss of their biological utility or activity, as discussed below. Table 1 shows the codons that encode particular amino acids.

TABLE 1: Codons for particular amino acids.

Amino Acids Codons i

Alanine Ala A GCA GCC GCG GCU

Cysteine Cys C UGC UGU

Aspartic acid Asp D GAC GAU

Glutamic acid Glu E GAA GAG

Phenylalanine Phe F UUC uuu

Glycine Gly G GGA GGC GGG GGU

Histidine His H CAC CAU

Isoleucine He I AUA AUC AUU

Lysine Lys K AAA AAG

Leucine Leu L UUA UUG CUA CUC CUG CUU

Methionine Met M AUG

Asparagine Asn N AAC AAU

Proline Pro P CCA CCC CCG CCU

Glutamine Gin Q CAA CAG

Arginine Arg R AGA AGG CGA CGC CGG CGU

Serine Ser S AGC AGU UCA UCC UCG UCU

Threonine Thr T ACA ACC ACG ACU

Valine Val V GUA GUC GUG GUU

Tryptophan Tip w UGG

Tyrosine Tyr Y UAC UAU In making such changes, the hydropathic index of amino acids may be considered. The importance of the hydropathic amino acid index in conferring interactive biologic function on a protein is generally understood in the art (Kyte and Doolittle, 1982). It is accepted that the relative hydropathic character of the amino acid contributes to the secondary structure of the resultant protein, which in turn defines the interaction of the protein with other molecules, for example, enzymes, substrates, receptors, DNA, antibodies, antigens, and the like.

Each amino acid has been assigned a hydropathic index on the basis of their hydrophobicity and charge characteristics (Kyte and Doolittle, 1982), these are: isoleucine (+4.5); valine (+4.2); leucine (+3.8); phenylalanine (+2.8); cysteine/cystine (+2.5); methionine (+1.9); alanine (+1.8); glycine (-0.4); threonine (-0.7); serine (-0.8); tryptophan (-0.9); tyrosine (- 1.3); proline (-1.6); histidine (-3.2); glutamate (-3.5); glutamine (-3.5); aspartate (-3.5); asparagine (-3.5); lysine (-3.9); and arginine (-4.5).

It is known in the art that certain amino acids may be substituted by other amino acids having a similar hydropathic index or score and still result in a protein with similar biological activity, i.e., still obtain a biological functionally equivalent protein. In making such changes, the substitution of amino acids whose hydropathic indices are within ±2 is prefened, those which are within ±1 are particularly preferred, and those within ±0.5 are even more particularly prefened.

It is also understood in the art that the substitution of like amino acids can be made effectively on the basis of hydrophilicity. U.S. Patent 4,554,101, incorporated herein by reference, states that the greatest local average hydrophilicity of a protein, as governed by the hydrophilicity of its adjacent amino acids, conelates with a biological property of the protein. As detailed in U.S. Patent 4,554,101, the following hydrophilicity values have been assigned to amino acid residues: arginine (+3.0); lysine (+3.0); aspartate (+3.0 ± 1); glutamate (+3.0 ± 1); serine (+0.3); asparagine (+0.2); glutamine (+0.2); glycine (0); threonine (-0.4); proline (-0.5 ± 1); alanine (-0.5); histidine *-0.5); cysteine (-1.0); methionine (-1.3); valine (-1.5); leucine (-1.8); isoleucine (-1.8); tyrosine (-2.3); phenylalanine (-2.5); tryptophan (-3.4).

It is understood that an amino acid can be substituted for another having a similar hydrophilicity value and still obtain a biologically equivalent and immunologically equivalent protein. In such changes, the substitution of amino acids whose hydrophilicity values are within ±2 is prefened, those that are within ±1 are particularly preferred, and those within ±0.5 are even more particularly prefened. As outlined above, amino acid substitutions are generally based on the relative similarity of the amino acid side-chain substituents, for example, their hydrophobicity, hydrophilicity, charge, size, and the like. Exemplary substitutions that take various of the foregoing characteristics into consideration are well known to those of skill in the art.

B. Domain Switching

Domain switching involves the generation of chimeric molecules using different polypeptide(s). Chimeric, as used herein, defines an organism, molecule or other entity that contains a distinct portion, genotype or characteristic of another organism, molecule or entity, e.g., a chimeric protein may contain a distinct domain or portion of another protein. These molecules may have additional value in that these "chimeras" can be distinguished from natural molecules, while possibly providing the same function. For example, the C-termini of receptors with known signaling mechanisms may provide suitable candidates for domain switching experiments to improve the ability to detect activation or inhibition of hGHB receptor.

C. Fusion Proteins

A specialized kind of insertional variant is the fusion protein. This molecule generally has all or a substantial portion of the native molecule, linked at the N- or C-terminus, to all or a portion of a second polypeptide. For example, fusions typically employ leader sequences from other species to permit the recombinant expression of a protein in a heterologous host. Another useful fusion includes the addition of a immunologically active domain, such as an antibody epitope, to facilitate purification of the fusion protein. Inclusion of a cleavage site at or near the fusion junction will facilitate removal of the extraneous polypeptide after purification. Other useful fusions include linking of functional domains, such as active sites from enzymes, glycosylation domains, cellular targeting signals or transmembrane regions.

D. Purification of Proteins

It will be desirable to purify hGHB receptor(s) or variants thereof. Protein purification techniques are well known to those of skill in the art. These techniques involve, at one level, the crude fractionation of the cellular milieu to polypeptide and non-polypeptide fractions. Having separated the polypeptide from other proteins, the polypeptide of interest may be further purified using chromatographic and electrophoretic techniques to achieve partial or complete purification (or purification to homogeneity). Analytical methods particularly suited to the preparation of a pure peptide are ion-exchange chromatography, exclusion chromatography; polyacrylamide gel electrophoresis; isoelectric focusing. A particularly efficient method of purifying peptides is fast protein liquid chromatography or even HPLC. As is generally known in the art, it is believed that the order of conducting the various purification steps may be changed, or that certain steps may be omitted, and still result in a suitable method for the preparation of a substantially purified protein or peptide.

Certain aspects of the present invention concern the purification, and in particular embodiments, the substantial purification of an encoded protein or peptide. The term "purified protein or peptide" as used herein, is intended to refer to a composition, isolatable from other components, wherein the protein or peptide is purified to any degree relative to its naturally- obtainable state. A purified protein or peptide therefore also refers to a protein or peptide, free from the environment in which it may naturally occur.

Generally, "purified" will refer to a protein or peptide composition that has been subjected to fractionation to remove various other components, and which composition substantially retains its expressed biological activity. Where the term "substantially purified" is used, this designation will refer to a composition in which the protein or peptide forms the major component of the composition, such as constituting about 50%, about 60%, about 70%, about 80%, about 90%, about 95% or more of the proteins in the composition.

Various methods for quantifying the degree of purification of the protein or peptide will be known to those of skill in the art in light of the present disclosure. These include, for example, determining the specific activity of an active fraction, or assessing the amount of polypeptides within a fraction by SDS/PAGE analysis. A prefened method for assessing the purity of a fraction is to calculate the specific activity of the fraction, to compare it to the specific activity of the initial extract, and to thus calculate the degree of purity, herein assessed by a "- fold purification number." The actual units used to represent the amount of activity will, of course, be dependent upon the particular assay technique chosen to follow the purification and whether or not the expressed protein or peptide exhibits a detectable activity.

There is no general requirement that the protein or peptide always be provided in their most purified state. Indeed, it is contemplated that less substantially purified products will have utility in certain embodiments. Partial purification may be accomplished by using fewer purification steps in combination, or by utilizing different forms of the same general purification scheme. For example, it is appreciated that a cation-exchange column chromatography performed utilizing an HPLC apparatus will generally result in a greater "-fold" purification than the same technique utilizing a low pressure chromatography system. Methods exhibiting a lower degree of relative purification may have advantages in total recovery of protein product, or in maintaining the activity of an expressed protein.

It is known that the migration of a polypeptide can vary, sometimes significantly, with different conditions of SDS/PAGE (Capaldi et al, 1977). It will therefore be appreciated that under differing electrophoresis conditions, the apparent molecular weights of purified or partially purified expression products may vary.

E. Synthetic Peptides

The present invention also describes smaller hGHB receptor-related peptides for use in various embodiments of the present invention. Because of their relatively small size, the peptides of the invention can also be synthesized in solution or on a solid support in accordance with conventional techniques. Various automatic synthesizers are commercially available and can be used in accordance with known protocols. See, for example, Stewart and Young (1984); Tarn et al. (1983); Merrifield (1986); and Barany and Merrifield (1979), each incorporated herein by reference. Short peptide sequences, or libraries of overlapping peptides, usually from about 6 up to about 35 to 50 amino acids, which conespond to the selected regions described herein, can be readily synthesized and then screened in screening assays designed to identify reactive peptides. Alternatively, recombinant DNA technology may be employed wherein a nucleotide sequence which encodes a peptide of the invention is inserted into an expression vector, transformed or transfected into an appropriate host cell and cultivated under conditions suitable for expression.

F. Antigen Compositions

The present invention also provides for the use of hGHB receptor proteins or peptides as antigens for the immunization of animals relating to the production of antibodies. It is envisioned that hGHB receptor, or portions thereof, will be coupled, bonded, bound, conjugated or chemically-linked to one or more agents via linkers, polylinkers or derivatized amino acids. This may be performed such that a bispecific or multivalent composition or vaccine is produced. It is further envisioned that the methods used in the preparation of these compositions will be familiar to those of skill in the art and should be suitable for administration to animals, i.e., pharmaceutically acceptable. Prefened agents are the carriers are keyhole limpet hemocyannin (KLH) or bovine serum albumin (BSA). Preparation of antibodies is well known, for examples see Harlow and Lane, 1988. VII. NUCLEIC ACIDS

The present invention also provides, in another embodiment, genes encoding hGHB receptor (see, for example, SEQ ID NO: 3). Various embodiments also include genes encoding hGHB related seqeunces such as SEQ ID NO:8, SEQ ID NO-10, SEQ ID NO:12 or SEQ ID NO: 14. The present invention is not limited in scope to this nucleic acid sequence, however, as one of ordinary skill in the could, using these nucleic acids, readily identify related homologues or family members in these and various other species (e.g., rat, rabbit, dog, monkey, gibbon, human, chimp, ape, baboon, cow, pig, horse, sheep, cat and other species). h addition, it should be clear that the present invention is not limited to the specific nucleic acids disclosed herein. As discussed below, an "hGHB receptor polynucleotide" may contain a variety of different bases and yet still produce a conesponding polypeptide that is functionally indistinguishable, and in some cases structurally indistinguishable, from the human polynucleotide disclosed herein.

Similarly, any reference to a nucleic acid should be read as encompassing a host cell containing that nucleic acid and, in some cases, capable of expressing the product of that nucleic acid. In addition to therapeutic considerations, cells expressing nucleic acids of the present invention may prove useful in the context of screening for agents that induce, repress, inhibit, augment, interfere with, block, abrogate, stimulate or enhance the activity of hGHB receptor.

A. Nucleic Acids encoding hGHB receptor

Nucleic acids according to the present invention may encode an entire hGHB receptor polynucleotide, a domain(s) of hGHB receptor, or any other fragment of hGHB receptor as set forth herein. The nucleic acid may be derived from genomic DNA, i.e., cloned directly from the genome of a particular organism. In prefened embodiments, however, the nucleic acid would comprise complementary DNA (cDNA). Also contemplated is a cDNA plus a natural intron or an intron derived from another gene; such engineered molecules are sometime refened to as "mini-genes."

The term "cDNA" is intended to refer to DNA prepared using messenger RNA (mRNA) as template. The advantage of using a cDNA, as opposed to genomic DNA or DNA polymerized from a genomic, non- or partially-processed RNA template, is that the cDNA primarily contains coding sequences of the conesponding protein. There may be times when the full or partial genomic sequence is prefened, such as where the non-coding regions are required for optimal expression or where non-coding regions such as introns are to be targeted in an antisense strategy. It also is contemplated that a given hGHB receptor from a given species may be represented by natural variants that have slightly different nucleic acid sequences but, nonetheless, encode the same protein (see Table 1 above).

As used in this application, the term "a nucleic acid encoding an hGHB receptor" refers to a nucleic acid molecule that has been isolated free of total cellular nucleic acid. In prefened embodiments, the invention concerns a nucleic acid sequence essentially as set forth in SEQ ID NO:3. The term "as set forth in SEQ ID NO:3" means that the nucleic acid sequence substantially corresponds to a portion of SEQ ID NO:3. The term "functionally equivalent codon" is used herein to refer to codons that encode the same amino acid, such as the six codons for arginine or serine (Table 1, above), and also refers to codons that encode biologically equivalent amino acids, as discussed herein.

Allowing for the degeneracy of the genetic code, sequences that have at least about 50%, usually at least about 60%, more usually about 70%, most usually about 80%, preferably at least about 90% and most preferably about 95% of nucleotides that are identical to the nucleotides of SEQ ID NO:3 are contemplated. Sequences that are essentially the same as those set forth in SEQ ID NO: 3 may also be functionally defined as sequences that are capable of hybridizing to a nucleic acid segment containing the complement of SEQ ID NO:3 under standard conditions.

The DNA segments of the present invention include those encoding biologically functional equivalent hGHB receptor proteins and peptides, as described above. Such sequences may arise as a consequence of codon redundancy and amino acid functional equivalency that are known to occur naturally within nucleic acid sequences and the proteins thus encoded. Alternatively, functionally equivalent proteins or peptides may be created via the application of recombinant DNA technology, in which changes in the protein structure may be engineered, based on considerations of the properties of the amino acids being exchanged. Changes designed by man may be introduced through the application of site-directed mutagenesis techniques or may be introduced randomly and screened later for the desired function, as described below.

B. Oligonucleotide Probes and Primers

Naturally, the present invention also encompasses DNA segments that are complementary, or essentially complementary, to the sequence set forth in SEQ ID NO:3. Nucleic acid sequences that are "complementary" are those that are capable of base-pairing according to the standard Watson-Crick complementary rules. As used herein, the term "complementary sequences" means nucleic acid sequences that are substantially complementary, as may be assessed by the same nucleotide comparison set forth above, or as defined as being capable of hybridizing to the nucleic acid segment of SEQ ID NO:3 under relatively stringent conditions such as those described herein. Such sequences may encode entire hGHB receptor proteins or functional or non-functional fragments thereof.

Alternatively, the hybridizing segments may be shorter oligonucleotides. Sequences of 17 bases long should occur only once in the human genome and, therefore, suffice to specify a unique target sequence. Although shorter oligomers are easier to make and increase in vivo accessibility, numerous other factors are involved in determining the specificity of hybridization. Both binding affinity and sequence specificity of an oligonucleotide to its complementary target increases with increasing length. It is contemplated that exemplary oligonucleotides of 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100 or more base pairs of SEQ ID NO:3 or variants thereof may be used, although others are contemplated. Longer polynucleotides encoding 250, 500, 1000, 1212, 1500, 2000, 2500, 3000 or 5000 bases and longer are contemplated as well. Such oligonucleotides will find use, for example, as probes in Southern and Northern blots and as primers in amplification reactions.

Suitable hybridization conditions will be well known to those of skill in the art. In certain applications, for example, substitution of amino acids by site-directed mutagenesis, it is appreciated that lower stringency conditions are required. Under these conditions, hybridization may occur even though the sequences of probe and target strand are not perfectly complementary, but are mismatched at one or more positions. Conditions may be rendered less stringent by increasing salt concentration and decreasing temperature. For example, a medium stringency condition could be provided by about 0.1 to 0.25 M NaCl at temperatures of about 37°C to about 55°C, while a low stringency condition could be provided by about 0.15 M to about 0.9 M salt, at temperatures ranging from about 20°C to about 55°C. Thus, hybridization conditions can be readily manipulated, and thus will generally be a method of choice depending on the desired results.

In other embodiments, hybridization may be achieved under conditions of, for example, 50 mM Tris-HCl (pH 8.3), 75 mM KC1, 3 mM MgCl₂, 10 mM dithiothreitol, at temperatures between approximately 20°C to about 37°C. Other hybridization conditions utilized could include approximately 10 mM Tris-HCl (pH 8.3), 50 mM KC1, 1.5 μM MgCl₂, at temperatures ranging from approximately 40°C to about 72°C. Formamide and SDS also may be used to alter the hybridization conditions.

One method of using probes and primers of the present invention is in the search for genes related to hGHB receptor or, more particularly, homologues of hGHB receptor from other species. Normally, the target DNA will be a genomic or cDNA library, although screening may involve analysis of RNA molecules. By varying the stringency of hybridization, and the region of the probe, different degrees of homology may be discovered.

Another way of exploiting probes and primers of the present invention is in site-directed, or site-specific mutagenesis. Site-specific mutagenesis is a technique useful in the preparation of individual peptides, or biologically functional equivalent proteins or peptides, through specific mutagenesis of the underlying DNA. The technique further provides a ready ability to prepare and test sequence variants, incorporating one or more of the foregoing considerations, by introducing one or more nucleotide sequence changes into the DNA. Site-specific mutagenesis allows the production of mutants through the use of specific oligonucleotide sequences which encode the DNA sequence of the desired mutation, as well as a sufficient number of adjacent nucleotides, to provide a primer sequence of sufficient size and sequence complexity to form a stable duplex on both sides of the deletion junction being traversed. Typically, a primer of about 17 to 25 nucleotides in length is prefened, with about 5 to 10 residues on both sides of the junction of the sequence being altered.

The technique typically employs a bacteriophage vector that exists in both a single- stranded and double-stranded form. Typical vectors useful in site-directed mutagenesis include vectors such as the Ml 3 phage. These phage vectors are commercially available and their use is generally well known to those skilled in the art. Double stranded plasmids are also routinely employed in site directed mutagenesis, which eliminates the step of transferring the gene of interest from a phage to a plasmid. These and other known techniques for mutagenesis can be found in Sambrook et al, 2001.

The preparation of sequence variants of the selected gene using site-directed mutagenesis is provided as a means of producing potentially useful species and is not meant to be limiting, as there are other ways in which sequence variants of genes may be obtained. For example, recombinant vectors encoding the desired gene may be treated with mutagenic agents, such as hydroxylamine, to obtain sequence variants.

C. Vectors for Cloning, Gene Transfer and Expression

Within certain embodiments expression vectors are employed to express an hGHB receptor polypeptide product in a cell, tissue or animal. In certain embodiments the polypeptide may then be purified and, for example, be used to vaccinate animals to generate antisera or monoclonal antibody with which further studies may be conducted. Expression requires that appropriate signals be provided in the vectors, and which include various regulatory elements, such as enhancers/promoters from both viral and mammalian sources that drive expression of the genes of interest in host cells. Elements designed to optimize messenger RNA stability and translatability in host cells also are defined. The conditions for the use of a number of dominant drug selection markers for establishing permanent, stable cell clones expressing the products are also provided, as is an element that links expression of the drug selection markers to expression of the polypeptide.

1. Regulatory Elements

Throughout this application, the term "expression construct" is meant to include any type of genetic construct containing a nucleic acid coding for a gene product in which part or all of the nucleic acid encoding sequence is capable of being transcribed. The transcript may be translated into a protein, but it need not be. In certain embodiments, expression includes both transcription of a gene and translation of mRNA into a gene product. In other embodiments, expression only includes transcription of the nucleic acid encoding a gene of interest.

In prefened embodiments, the nucleic acid encoding a gene product is under transcriptional control of a promoter. A "promoter" refers to a DNA sequence recognized by the synthetic machinery of the cell, or introduced synthetic machinery, required to initiate the specific transcription of a gene. The phrase "under transcriptional control" means that the promoter is in the conect location and orientation in relation to the nucleic acid (positioned) to control RNA polymerase initiation and expression of the gene.

The term promoter will be used here to refer to a group of transcriptional control modules that are clustered around the initiation site for RNA polymerase II. Much of the thinking about how promoters are organized derives from analyses of several viral promoters, including those for the HSV thymidine kinase (tk) and SV40 early transcription units. These studies, augmented by more recent work, have shown that promoters are composed of discrete functional modules, each consisting of approximately 7-20 bp of DNA, and containing one or more recognition sites for transcriptional activator or repressor proteins.

At least one module in each promoter functions to position the start site for RNA synthesis. The best known example of this is the TATA box, but in some promoters lacking a TATA box, such as the promoter for the mammalian terminal deoxynucleotidyl transferase gene and the promoter for the SV40 late genes, a discrete element overlying the start site itself helps to fix the place of initiation.

Additional promoter elements regulate the frequency of transcriptional initiation. Typically, these are located in the region 30-110 bp upstream of the start site, although a number of promoters have recently been shown to contain functional elements downstream of the start site as well. The spacing between promoter elements frequently is flexible, so that promoter function is preserved when elements are inverted or moved relative to one another. In the tk promoter, the spacing between promoter elements can be increased to 50 bp apart before activity begins to decline. Depending on the promoter, it appears that individual elements can function either co-operatively or independently to activate transcription.

In various embodiments, the human cytomegalovirus (CMV) immediate early gene promoter, the SV40 early promoter, the Rous sarcoma virus long terminal repeat, rat insulin promoter and glyceraldehyde-3 -phosphate dehydrogenase can be used to obtain high-level expression of the coding sequence of interest. The use of other viral or mammalian cellular or bacterial phage promoters which are well-known in the art to achieve expression of a coding sequence of interest is contemplated as well, provided that the levels of expression are sufficient for a given purpose.

By employing a promoter with well-known properties, the level and pattern of expression of the protein of interest following transfection or transformation can be optimized. Further, selection of a promoter that is regulated in response to specific physiologic signals can permit inducible expression of the gene product. Table 2 and 3 list several regulatory elements that may be employed, in the context of the present invention, to regulate the expression of the gene of interest. This list is not intended to be exhaustive of all the possible elements involved in the promotion of gene expression but, merely, to be exemplary thereof.

Enhancers are genetic elements that increase transcription from a promoter located at a distant position on the same molecule of DNA. Enhancers are organized much like promoters. That is, they are composed of many individual elements, each of which binds to one or more transcriptional proteins.

The basic distinction between enhancers and promoters is operational. An enhancer region as a whole must be able to stimulate transcription at a distance; this need not be true of a promoter region or its component elements. On the other hand, a promoter must have one or more elements that direct initiation of RNA synthesis at a particular site and in a particular orientation, whereas enhancers lack these specificities. Promoters and enhancers are often overlapping and contiguous, often seeming to have a very similar modular organization.

Below is a list of viral promoters, cellular promoters/enhancers and inducible promoters/enhancers that could be used in combination with the nucleic acid encoding a gene of interest in an expression construct (Table 2 and Table 3). Additionally, any other promoter/enhancer combination (for example, as per the Eukaryotic Promoter Data Base EPDB) could also be used to drive expression of the gene. Eukaryotic cells can support cytoplasmic transcription from certain bacterial promoters if the appropriate bacterial polymerase is provided, either as part of the delivery complex or as an additional genetic expression construct.

Table 2: Promoter and/or Enhancer

Table 3: Inducible Elements

Where a cDNA insert is employed, one will typically desire to include a polyadenylation signal to effect proper polyadenylation of the gene transcript. The nature of the polyadenylation signal is not believed to be crucial to the successful practice of the invention, and any such sequence may be employed such as human growth hormone and SV40 polyadenylation signals. Also contemplated as an element of the expression cassette is a terminator. These elements can serve to enhance message levels and to minimize read through from the cassette into other sequences.

2. Selectable Markers

In certain embodiments of the invention, the cells contain nucleic acid constructs of the present invention, a cell may be identified in vitro or in vivo by including a marker in the expression construct. Such markers would confer an identifiable change to the cell permitting easy identification of cells containing the expression construct. Usually the inclusion of a drug selection marker aids in cloning and in the selection of transformants, for example, genes that confer resistance to neomycin, puromycin, hygromycin, DHFR, GPT, zeocin and histidinol are useful selectable markers. Alternatively, enzymes such as herpes simplex virus thymidine kinase (tk) or chloramphenicol acetyltransferase (CAT) may be employed. Immunologic markers also can be employed. The selectable marker employed is not believed to be important, so long as it is capable of being expressed simultaneously with the nucleic acid encoding a gene product. Further examples of selectable markers are well known to one of skill in the art.

3. Multigene Constructs and IRES

In certain embodiments of the invention, the use of internal ribosome binding sites (IRES) elements are used to create multigene, or polycistronic, messages. IRES elements are able to bypass the ribosome scanning model of 5' methylated Cap dependent translation and begin translation at internal sites (Pelletier and Sonenberg, 1988). IRES elements from two members of the picanovirus family (polio and encephalomyocarditis) have been described (Pelletier and Sonenberg, 1988), as well an IRES from a mammalian message (Macejak and Sarnow, 1991). IRES elements can be linked to heterologous open reading frames. Multiple open reading frames can be transcribed together, each separated by an IRES, creating polycistronic messages. By virtue of the IRES element, each open reading frame is accessible to ribosomes for efficient translation. Multiple genes can be efficiently expressed using a single promoter/enhancer to transcribe a single message.

Any heterologous open reading frame can be linked to IRES elements. This includes genes for secreted proteins, multi-subunit proteins, encoded by independent genes, intracellular or membrane-bound proteins and selectable markers. In this way, expression of several proteins can be simultaneously engineered into a cell with a single construct and a single selectable marker.

4. Delivery of Expression Constructs

There are a number of ways in which expression constructs may be introduced into cells. In certain embodiments of the invention, a vector (also refened to herein as a gene delivery vector) is employed to deliver the expression construct. By way of illustration, in some embodiments, the vector comprises a virus or engineered construct derived from a viral genome. The ability of certain viruses to enter cells via receptor-mediated endocytosis, to integrate into host cell genome and express viral genes stably and efficiently have made them attractive candidates for the transfer of foreign genes into mammalian cells (Ridgeway, 1988; Nicolas and Rubenstein, 1988; Baichwal and Sugden, 1986; Temin, 1986). Where viral vectors are employed to deliver the gene or genes of interest, it is generally prefened that they be replication-defective, for example as known to those of skill in the art and as described further herein below.

One of the prefened methods for in vivo delivery of expression constructs involves the use of an adenovirus expression vector. "Adenovirus expression vector" is meant to include those constructs containing adenovirus sequences sufficient to (a) support packaging of the construct and (b) to express a polynucleotide that has been cloned therein. In this context, expression does not require that the gene product be synthesized. h prefened embodiments, the expression vector comprises a genetically engineered form of adenovirus. Knowledge of the genetic organization of adenovirus, a 36 kb, linear, double- stranded DNA virus, allows substitution of large pieces of adenoviral DNA with foreign sequences at least up to 7 kb (Grunhaus and Horwitz, 1992). Adenovirus is particularly suitable for use as a gene delivery vector because of its mid-sized genome, ease of manipulation, high titer, wide target cell range and high infectivity. (Renan, 1990). For exemplary methods and a brief review of adenovirus see Graham et al, 1977; Jones and Shenk, 1978; Graham and Prevec, 1991; Ghosh-Choudhury et al, 1987; Racher et al, 1995; and the like each of which is incorporated by reference.

Other than the requirement that the adenovirus vector be replication defective, or at least conditionally defective, the nature of the adenovirus vector is not believed to be crucial to the successful practice of the invention. The adenovirus may be selected from any of the 42 different known serotypes or subgroups A-F. Adenovirus type 5 of subgroup C is a prefened starting material for obtaining a replication-defective adenovirus vector for use in the present invention. This is, in part, because Adenovirus type 5 is a human adenovirus about which a great deal of biochemical and genetic information is known, and it has historically been used for most constructions employing adenovirus as a vector. Various modifications of adenovirus are known to those of skill in the art and are likewise contemplated herein.

The retroviruses are a group of single-stranded RNA viruses characterized by an ability to convert their RNA to double-stranded DNA in infected cells by a process of reverse- transcription (Coffin, 1990). The resulting DNA then stably integrates into cellular chromosomes as a provirus and directs synthesis of viral proteins. The integration results in the retention of the viral gene sequences in the recipient cell and its descendants. In order to construct a retroviral vector, a nucleic acid encoding a gene of interest is inserted into the viral genome in the place of certain viral sequences to produce a virus that is replication-defective. In order to produce virions, a packaging cell line containing the gag, pol, and env genes but without the LTR and packaging components is constructed (Mann et al, 1983). When a recombinant plasmid containing a cDNA, together with the retroviral LTR and packaging sequences is introduced into this cell line (by calcium phosphate precipitation for example), the packaging sequence allows the RNA transcript of the recombinant plasmid to be packaged into viral particles, which are then secreted into the culture media (Nicolas and Rubenstein, 1988; Temin, 1986; Mann et al, 1983). The media containing the recombinant retroviruses is then collected, optionally concentrated, and used for gene transfer. Retroviral vectors are able to infect a broad variety of cell types. However, integration and stable expression require the division of host cells (Paskind et al, 1975).

Other viral vectors may be employed as expression constructs in the present invention. Vectors derived from viruses such as vaccinia virus (Ridgeway, 1988; Baichwal and Sugden, 1986; Coupar et al, 1988) adeno-associated virus (AAV) (Ridgeway, 1988; Baichwal and Sugden, 1986; Hermonat and Muzycska, 1984) and herpesviruses may be employed. They offer several attractive features for various mammalian cells (Friedmann, 1989; Ridgeway, 1988; Baichwal and Sugden, 1986; Coupar et al, 1988; Horwich et al, 1990).

In order to effect expression of sense or antisense gene constructs, the expression construct must be delivered into a cell. This delivery may be accomplished in vitro, as in laboratory procedures for transforming cells lines, or in vivo or ex vivo, as in the treatment of certain disease states. In general, viral vectors accomplish delivery of the expression construct by infecting the target cells of interest. Alternatively to incorporating the expression construct into the genome of a viral vector, the expression construct may be encapsidated in the infectious viral particle.

Several non-viral gene delivery vectors for the transfer of expression constructs into mammalian cells also are contemplated by the present invention. These include calcium phosphate precipitation (Graham and Van Der Eb, 1973; Chen and Okayama, 1987; Rippe et al, 1990) DEAE-dextran (Gopal, 1985), electroporation (Tur-Kaspa et al, 1986; Potter et al, 1984), direct microinjection (Harland and Weintraub, 1985), DNA-loaded liposomes (Nicolau and Sene, 1982; Fraley et al, 1979) and lipofectamine-DNA complexes, cell sonication (Fechheimer et al, 1987), gene bombardment using high velocity microprojectiles (Yang et al, 1990), and receptor-mediated transfection (Wu and Wu, 1987; Wu and Wu, 1988). Some of these techniques may be successfully adapted for in vivo or ex vivo use.

Once the expression construct has been delivered into the cell the nucleic acid encoding the gene of interest may be positioned and expressed at different sites, hi certain embodiments, the nucleic acid encoding the gene may be stably integrated into the genome of the cell. This integration may be in the cognate location and orientation via homologous recombination (gene replacement) or it may be integrated in a random, non-specific location (gene augmentation), hi yet further embodiments, the nucleic acid may be stably maintained in the cell as a separate, episomal segment of DNA. Such nucleic acid segments or "episomes" encode sequences sufficient to permit maintenance and replication independent of or in synchronization with the host cell cycle. How the expression construct is delivered to a cell and where in the cell the nucleic acid remains is dependent on the type of expression construct employed.

In yet another embodiment of the invention, the expression vector may simply consist of naked recombinant DNA or plasmids comprising the expression construct. Transfer of the construct may be performed by any of the methods mentioned above which physically or chemically permeabilize the cell membrane. This is particularly applicable for transfer in vitro but it may be applied to in vivo use as well.

In still another embodiment of the invention, transferring of a naked DNA expression construct into cells may involve particle bombardment. This method depends on the ability to accelerate DNA-coated microprojectiles to a high velocity allowing them to pierce cell membranes and enter cells without killing them (Klein et al, 1987).

In a further embodiment of the invention, the expression construct may be entrapped in a liposome, another non-viral gene delivery vector. Liposomes are vesicular structures characterized by a phospholipid bilayer membrane and an inner aqueous medium. Multilamellar liposomes have multiple lipid layers separated by aqueous medium. They form spontaneously when phospholipids are suspended in an excess of aqueous solution. The lipid components undergo self-reanangement before the formation of closed structures and entrap water and dissolved solutes between the lipid bilayers (Ghosh and Bachhawat, 1991). Also contemplated are lipofectamine-DNA complexes.

Liposome-mediated nucleic acid delivery and expression of foreign DNA in vitro has been very successful. Wong et al, (1980) demonstrated the feasibility of liposome-mediated delivery and expression of foreign DNA in cultured chick embryo, HeLa and hepatoma cells. Nicolau et al, (1987) accomplished successful liposome-mediated gene transfer in rats after intravenous injection.

In certain embodiments of the invention, the liposome may be complexed with a hemagglutinating virus (HVJ). This has been shown to facilitate fusion with the cell membrane and promote cell entry of liposome-encapsulated DNA (Kaneda et al, 1989). In other embodiments, the liposome may be complexed or employed in conjunction with nuclear non- histone chromosomal proteins (HMG-1) (Kato et al, 1991). In yet further embodiments, the liposome may be complexed or employed in conjunction with both HVJ and HMG-1. In that such expression constructs have been successfully employed in transfer and expression of nucleic acid in vitro and in vivo, then they are applicable for the present invention. Where a bacterial promoter is employed in the DNA construct, it also will be desirable to include within the liposome an appropriate bacterial polymerase.

Other expression constructs which can be employed to deliver a nucleic acid encoding a particular gene into cells are receptor-mediated delivery vehicles. These take advantage of the selective uptake of macromolecules by receptor-mediated endocytosis in almost all eukaryotic cells. Because of the cell type-specific distribution of various receptors, the delivery can be highly specific (Wu and Wu, 1993). For exemplary methods see Wu and Wu, 1987; Wagner et al, 1990; Ferkol et al, 1993; Perales et al, 1994; Myers, EPO 0273085 and the like.

VIII. GENERATING ANTIBODIES REACTIVE WITH GHB RECEPTORS hi another aspect, the present invention contemplates an antibody or antibodies that is/are immunoreactive with a GHB receptor molecule of the present invention, or any portion thereof. An antibody can be a polyclonal or a monoclonal antibody. In a prefened embodiment, an antibody is a monoclonal antibody. Means for preparing and characterizing antibodies are well known in the art (see, e.g., Harlow and Lane, 1988).

Briefly, a polyclonal antibody is prepared by immunizing an animal with an immunogen comprising a polypeptide of the present invention and collecting antisera from that immunized animal. A wide range of animal species can be used for the production of antisera. Typically an animal used for production of anti-antisera is a non-human animal including rabbits, mice, rats, hamsters, pigs or horses. Because of the relatively large blood volume of rabbits, a rabbit is a prefened choice for production of polyclonal antibodies.

Antibodies, both polyclonal and monoclonal, specific for antigen(s) may be prepared using conventional immunization techniques, as will be generally known to those of skill in the art. A composition containing antigenic epitopes of the compounds of the present invention can be used to immunize one or more experimental animals, such as a rabbit or mouse, which will then proceed to produce specific antibodies against the compounds of the present invention. Polyclonal antisera may be obtained, after allowing time for antibody generation, simply by bleeding the animal and preparing serum samples from the whole blood.

In general, both polyclonal and monoclonal antibodies against an hGHB receptor may be used in a variety of embodiments. For example, they may be employed in antibody cloning protocols to obtain cDNAs or genes encoding other GHB receptors. They may also be used in inhibition studies to analyze the effects of hGHB receptor related peptides in cells or animals. hGHB receptor antibodies will also be useful in immunolocalization studies to analyze the distribution of hGHB receptor during various cellular events, for example, to determine the cellular or tissue-specific distribution of hGHB receptor polypeptides under different points in the cell cycle. A particularly useful application of such antibodies is in purifying native or recombinant hGHB receptor, for example, using an antibody affinity column. The operation of all such immunological techniques will be known to those of skill in the art in light of the present disclosure. As is well known in the art, a given composition may vary in its immunogenicity. It is often necessary therefore to boost the host immune system, as may be achieved by coupling a peptide or polypeptide immunogen to a carrier. Exemplary and prefened carriers are keyhole limpet hemocyanin (KLH) and bovine serum albumin (BSA). Other albumins such as ovalbumin, mouse serum albumin or rabbit serum albumin can also be used as carriers. Means for conjugating a polypeptide to a carrier protein are well known in the art and include glutaraldehyde, m-maleimidobencoyl-N-hydroxysuccinimide ester, carbodiimide and bis- biazotized benzidine, for example.

MAbs may be readily prepared through use of well-known techniques, such as those exemplified in U.S. Patent 4,196,265, incorporated herein by reference. Typically, this technique involves immunizing a suitable animal with a selected immunogen composition, e.g., a purified or partially purified hGHB receptor protein, polypeptide or peptide or cell expressing high levels of hGHB receptor. The immunizing composition is administered in a manner effective to stimulate antibody producing cells. The use of rats may provide certain advantages (Goding, 1986), but mice are prefened, with the BALB/c mouse being most prefened as this is most routinely used and generally gives a higher percentage of stable fusions. Following immunization, somatic cells with the potential for producing antibodies, specifically B- lymphocytes (B-cells), are selected for use in the mAb generating protocol. Typically, a spleen

7 R from an immunized mouse contains approximately 5 x 10 to 2 x l0 lymphocytes. The antibody-producing B lymphocytes from the immunized animal are then fused with cells of an immortal myeloma cell, generally one of the same species as the animal that was immunized.

Any one of a number of myeloma cells may be used, as are known to those of skill in the art (Goding, 1986; Campbell, 1984). For example, where the immunized animal is a mouse, one may use P3-X63/Ag8, P3-X63-Ag8.653, NSl/l.Ag 4 1, Sp210-Agl4, FO, NSO/U, MPC-11, MPC11-X45-GTG 1.7 and S194/5XX0 Bui; for rats, one may use R210.RCY3, Y3-Ag 1.2.3, IR983F and 4B210; and U-266, GM1500-GRG2, LICR-LON-HMy2 and UC729-6 are all useful in connection with cell fusions. Hybridomas are screen for expression of an appropriate antibody and antibodies are typically produced by injecting a selected hybridoma interperitoneally and purifying antibodies from the ascites. IX. PHARMACEUTICALS PREPARATIONS AND METHODS FOR THE TREATMENT OF DISEASE

Aqueous pharmaceutical compositions of the present invention will have an effective amount of a GHB analog, derivative, or mimetic. Alternatively, an effective amount of a GHB analog, derivative, or mimetic may also be formulated in a pharmaceutical composition. Such compositions generally will be dissolved or dispersed in a pharmaceutically acceptable carrier or aqueous medium. An "effective amount," for the purposes of therapy or treatment, is defined as that amount that causes a measurable or clinically measurable difference in the condition of the subject or patient. This amount will vary depending on the substance, the condition of the patient, the type of treatment, the type and severity of disorder, etc.

The phrases "pharmaceutically or pharmacologically acceptable" refer to molecular entities and compositions that do not produce an adverse, allergic or other untoward reaction when administered to an animal, or human, as appropriate. As used herein, "pharmaceutically acceptable carrier" includes any and all solvents, dispersion media, coatings, antibacterial and antifungal agents, isotonic and absorption delaying agents and the like. The use of such media and agents for pharmaceutical active substances is well known in the art. Except insofar as any conventional media or agent is incompatible with the active ingredients, its use in the therapeutic or pharmaceutical compositions is contemplated. Supplementary active ingredients, such as other anti-cancer or therapeutic agents, can also be incorporated into the compositions. Formulation of one or more of the candidate substances identified can be accomplished using methods know in the art, examples of such may be found in "Remington's Pharmaceutical Sciences" 15th Edition, pages 1035-1038 and 1570-1580)

In addition to the compounds formulated for parenteral administration, such as those for intravenous or intramuscular injection, other pharmaceutically acceptable forms include, e.g., tablets or other solids for oral administration; time release capsules; and any other form cunently used, including inhalants and the like.

The active compounds of the present invention will often be formulated for parenteral administration, e.g., formulated for injection via the intravenous, intramuscular, subcutaneous, or even intraperitoneal routes. The preparation of an aqueous composition that contains human GHB receptor agonist or antagonist as active ingredients will be known to those of skill in the art in light of the present disclosure. Typically, such compositions can be prepared as injectables or oral doses, either as liquid solutions or suspensions; solid forms suitable for using to prepare solutions or suspensions upon the addition of a liquid prior to injection or ingestion can also be prepared; and the preparations can also be emulsified.

Solutions of the active compounds as free base or pharmacologically acceptable salts can be prepared in water suitably. In some embodiments, the compounds may be mixed with a surfactant, such as hydroxypropylcellulose. Dispersions can also be prepared in glycerol, liquid polyethylene glycols, and mixtures thereof and in oils. Under ordinary conditions of storage and use, these preparations contain a preservative to prevent the growth of microorganisms.

The pharmaceutical forms suitable for injectable use include sterile aqueous solutions or dispersions; formulations including sesame oil, peanut oil or aqueous propylene glycol; and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersions, h many cases, the form must be sterile and must be fluid to the extent that easy syringability exists. It must be stable under the conditions of manufacture and storage and must be preserved against the contaminating action of microorganisms, such as bacteria and fungi.

The active compounds may be formulated into a composition in a neutral or salt form. Pharmaceutically acceptable salts, include the acid addition salts (formed with the free amino groups of a protein) and which are formed with inorganic acids such as, for example, hydrochloric or phosphoric acids, or such organic acids as acetic, oxalic, tartaric, mandelic, and the like. Salts formed with the free carboxyl groups can also be derived from inorganic bases such as, for example, sodium, potassium, ammonium, calcium, or ferric hydroxides, and such organic bases as isopropylamine, trimethylamine, histidine, procaine and the like.

The carrier also can be a solvent or dispersion medium containing, for example, water, ethanol, polyol (for example, glycerol, propylene glycol, and liquid polyethylene glycol, and the like), suitable mixtures thereof, and vegetable oils. The proper fluidity can be maintained, for example, by the use of a coating, such as lecithin, by the maintenance of the required particle size in the case of dispersion and by the use of surfactants. The prevention of the action of microorganisms can be brought about by various antibacterial and antifungal agents, for example, parabens, chlorobutanol, phenol, sorbic acid, thimerosal, and the like. In many cases, it will be preferable to include isotonic agents, for example, sugars or sodium chloride. Prolonged absorption of the injectable compositions can be brought about by the use in the compositions of agents delaying absorption, for example, aluminum monostearate and gelatin.

Sterile injectable solutions are prepared by incorporating the active compounds in the required amount in the appropriate solvent with various other ingredients enumerated above, as required, followed by filtered sterilization. Generally, dispersions are prepared by incorporating the various sterilized active ingredients into a sterile vehicle which contains the basic dispersion medium and the required other ingredients from those enumerated above. In the case of sterile powders for the preparation of sterile injectable solutions, the prefened methods of preparation are vacuum-drying and freeze-drying techniques which yield a powder of the active ingredient plus any additional desired ingredient from a previously sterile-filtered solution thereof.

In certain other case, the formulation will be geared for administration to the central nervous system, e.g., the brain.

Upon formulation, solutions will be administered in a manner compatible with the dosage formulation and in such amount as is therapeutically effective. The formulations are easily administered in a variety of dosage forms, such as the type of injectable solutions described above, with even drug release capsules and the like being employable.

For parenteral administration in an aqueous solution, for example, the solution should be suitably buffered if necessary and the liquid diluent first rendered isotonic with sufficient saline or glucose. These particular aqueous solutions are especially suitable for intravenous, intramuscular, subcutaneous and intraperitoneal administration. In this connection, sterile aqueous media that can be employed will be known to those of skill in the art in light of the present disclosure. For example, one dosage could be dissolved in 1 mL of isotonic NaCl solution and either added to 1000 mL of hypodermoclysis fluid or injected at the proposed site of infusion, (see for example, "Remington's Pharmaceutical Sciences" 15th Edition, pages 1035- 1038 and 1570-1580). Some variation in dosage will necessarily occur depending on the condition of the subject being treated. The person responsible for administration will, in any event, determine the appropriate dose for the individual subject.

X. ASSAY KITS

In another aspect, the present invention contemplates diagnostic assay kits for detecting the presence of hGHB receptor polypeptides in biological samples, where the kits comprise a first container containing a first antibody capable of immunoreacting with hGHB receptor polypeptides, with the first antibody present in an amount sufficient to perform at least one assay. Preferably, assay kits of the invention further comprise a second container containing a second antibody that immunoreacts with the first antibody. Preferably the antibodies used in the assay kits of the present invention are monoclonal antibodies. Even more preferably, the first antibody is affixed to a solid support. More preferably still, the first and second antibodies comprise an indicator, and, preferably, the indicator is a radioactive label or an enzyme. The present invention also contemplates a diagnostic kit for screening agents. Such a kit comprises an hGHB receptor of the present invention. The kit can further contain reagents for detecting an interaction between an agent and a receptor of the present invention. The provided reagent can be radiolabeled. The kit can contain a known radiolabeled agent capable of binding or interacting with a receptor of the present invention.

It is further contemplated that the kit can contain a secondary polypeptide. The secondary polypeptide can be a G-protein. The secondary polypeptide can also be an effector protein. When a secondary polypeptide is included in a kit, reagents for detecting an interaction between the receptor and the secondary polypeptide can be provided. As a specific example, an antibody capable of detecting a receptor/G-protein complex can be provided. As another specific example, an antibody capable of detecting a G-protein/effector complex can be provided. Reagents for the detection of the effector can be provided. For example, if the effector provided is adenylyl cyclase, reagents for detecting the activity of adenylyl cyclase can be provided. The identity of such agents is within the knowledge of those skilled in the relevant art.

EXAMPLES

The following examples are included to demonstrate prefened embodiments of the invention. It should be appreciated by those of skill in the art that the techniques disclosed in the examples which follow represent techniques discovered by the inventor to function well in the practice of the invention, and thus can be considered to constitute prefened modes for its practice. However, those of skill in the art should, in light of the present disclosure, appreciate that many changes can be made in the specific embodiments which are disclosed and still obtain a like or similar result without departing from the spirit and scope of the invention.

EXAMPLE 1

CLONING HUMAN GHB RECEPTOR

Generally, GHB receptors are selectively expressed in some regions of the rat brain. Their specific stimulation participates in the regulation of some important aspects of brain functions, including the wake/sleep cycle, modulation of some neurohormonal influences, mood and addiction to some drugs. The cloning and expression of specific members of the GHB receptor family may assist in the designing and selection of drugs with specific GHB receptor modulating properties. In addition, this may provide the basis for a molecular and pharmacological classification of brain GHB receptors.

A receptor has recently been cloned from a rat brain hippocampus cDNA library with pharmacological and functional characteristics of a GHB receptor (WO 00/78948, incorporated herein by reference). Interestingly, Southern blot analysis of genomic DNA from different species, including human, revealed the presence of similar or homologous DNA sequences. This result prompted screening of a human frontal cortex cDNA library PCR using primers derived from the rat GHB receptor polynucleotide and polypeptide sequences.

A. Library Preparation

The library was anayed so that each well on the master plate contains cDNAs from approximately 250 clones, with a total of 1 x 10⁶. Two hundred fifty phages were plated in 0.1 ml NZY low-melt top agarose overlays in each well of 24-well culture dishes containing 1 ml of NZY-agar, for a total of 192 dishes. Following incubation, phage suspensions are prepared from each individual well by the addition of 1 ml SM buffer and transfened to a unique well within a 96-well microtiter dish.

PCR screening was initiated with the complete collection of individual plate pools. The row and column pools relevant to each positive plate pool are then screened to reveal the unique address of the positive well within each plate. Forty-eight plate pools were constituted from each 96-well plate. Forty-eight PCRs were performed to reveal positive plates by the mean of 1 % agarose gel. On every positive plate, 12 PCR were run on column pools and 8 PCR on row pools. The positive column and row pools were finally subjected to cross PCR to reveal positive wells.

B. Primers Design

The success of the PCR-based screening procedure lies on the quality of the information contained into the sequences of the chosen primers (conserved regions, location of the sequence on the cDNA, size of the messenger to be amplified, etc) and two strategies were carried out:

1. Degenerate oligonucleotides were designed from the sequences of peptides obtained by partial hydrolysis of the purified rat GHB receptor protein. The aim is to generate specific cDNA fragments from the sequences of interest and use them as probes to screen the cDNA library and isolate a full length cDNA. These degenerated primers were localized to the cDNA sequence of the cloned rat GHB receptor by homology searches. 2. Use of a combination of couples of specific primers chosen from the already cloned GHB receptor nucleotide sequence. The nucleotide sequence of the cloned rat GHB receptor shows some similarity with human tetraspanin-5, particularly, in the 5' region. Tefraspanins (or TM4SF) are expressed in a wide variety of species and regulate cell adhesion, migration, proliferation and differentiation. The majority of additional specific primers were selected to be to the 3' region of the rat GHB receptor cDNA.

C. PCR screening

Use of degenerated oligonucleotide primers

The exemplary methods for the characterization of cDNA fragments that served as a starting point in the screen for hGHB receptors are as follows. Once the amplified sequences were cloned, they were used to screen a cDNA library. PCR conditions 95°C 10 min (HotGoldStar Polymerase) 4 cycles with: 94°C 30 sec

40°C 30 sec

72°C 1 min

30 cycles with: 92°C 30 sec

55°C 30 sec 72°C 1 min 72°C 7 min

Subcloning into pBK-CMV (TA cloning) T-tailing vectors: First, pBK-CMV is cut with Smal. T-tailing is performed in the presence of Taq DNA polymerase and dTTP (2mM final) in a standard PCR buffer at 70°C for 2h. Under these conditions Taq is forced to add a T instead of the usual A at the 3' ends (Marchuk et al, 1991). Ligation This reaction inserts the PCR product between the two arms of the digested vector and performed at 12°C overnight in the presence of T4 DNA ligase. DH5 a transformation (competent cells) The above construction is introduced into DH5α competent cells and plated on LB- kanamycin supplemented with IPTG/X-Gal White colonies were selected and grown in LB- kanamycin medium. Plasmid cDNA preparation for sequencing

Plasmid cDNA is purified by the GenElute mini-prep Kit (SIGMA). The sequencing was performed using T3/T7 as primers.

Use of specific primers

The nucleotide sequences of two of the primers used to screen the library were:

GGCTGTGACACTGAGGCCAAGGTGA (as downstream primer; SEQ ID NO:5) and

CATGGTACTCAGGAAGCCACTGAGG (as upstream primer; SEQ ID NO:6).

Table 5: Clone identification.

D. Screening of cDNA library by hybridization probes.

Plating the human cDNA library:

One million plaque-forming units (pfu) from the cDNA library were plated on NZY-agar plates at 40,000 per plate with 600 μl XLl-Blue MRF' and 8 ml NZY top agarose and incubated overnight at 37°C. The plates were chilled at 4°C for 1 hour and phage plaques were transfened to Biodyne A nylon membranes for 5 min. The membranes were then successively incubated in denaturing solution (1.5 M NaCl, 0.5 M NaOH) for 5 min, neutralizing buffer (1.5 M NaCl, 0.5 M tris-HCl, pH 8.0) and washing buffer (0.2 M tris-HCl, pH 7.5, 2X SSC). The membranes were heated at 80°C for at least 2 hours before prehybridization in 5X SSC buffer containing 20 mM NaH₂PO₄, 0.4 % SDS, 5X PAF (polyvinylpynolidone/BSA/Ficoll) and 100 μg/ml denatured salmon sperm DNA for 6 h at 60°C. The hybridization step was performed at 60°C overnight in the presence of the [³²P]-labeled PCR-amplified probe, amplified using ADU34 (SEQ ID NO:5) and ADO228 (SEQ ID NO:6) as primers, with gentle shaking. Putative positive plaques were isolated and screened again at lower densities until homogeneity was reached. The purified clones were stored as bacteriophage suspensions in SM buffer at 4°C until further use. Automatic excision of the recombinant plasmid:

Two E.coli strains (XLl-Blue MRF' and SOLR) were grown separately overnight in NZY medium containing 0.2 % maltose. In a sterile tube, 200 μl of the XLl-Blue MRF' culture were inoculated with 250 μl of a positive phage suspension in the presence of ExAssist phage helper for 15 min at 37°C. Three milliliters of NZY were added and incubation was performed at 37°C for 3 h. The tube was then heated at 70°C for 20 min and centrifuged at 1,000 g for 15 min. An aliquot of the supernatant (10 μl) was added to 200 μl of the SOLR culture and incubated at 37°C for 15 min. After addition of 300 μl of NZY, incubation was continued for 45 min at 37°C. Two-hundred microliters of the mixture were plated on LB-agar plates containing 50 μg/ml of Ampicillin and incubated overnight at 37°C. A distinct colony was picked up and grown overnight in LB-Ampicillin medium to prepare plasmid DNA for further analysis. This preparation was made according to GenElute miniprep kit (SIGMA) protocol.

Table 6: Clone identification.

EXAMPLE 2

CLONE B6H9(19) (hGHB RECEPTOR) CHARACTERIZATION

A. PCR amplification of the hybridization probe

PCR amplification was performed on the cloned rat GHB receptor cDNA using the oligonucleotides ADU34 (SEQ ID NO:5) and ADO228 (SEQ ID NO:6) as primers and led to the amplification of a 411 bp fragment. This fragment was labelled with [ P] and used as probe for screening.

B. Search for similar sequences.

The DNA sequence derived the cloned fragments was used to search for similar human sequences in the Genbank nucleic acid database. Genbank accession number AK021918 was identified as being similar to clone B6H9(19) (hGHB receptor). hGHB receptor was aligned with the cloned rat GHB receptor for comparison purposes, see FIG.l.

C. Chromosomal location of hGHB receptor. hGHB receptor gene, by virtue of its similarity with AK021918, is located on chromosome 8 of the human genome and has 5 exons. AK021918 and hGHB receptor cDNAs contain different splice sites and a number of point mutations in exon 1, 2 and 4. The presence of DNA fragment between exon 2 and 3, in the coding sequences of AK021819 and hGHB receptor and the lack of consensus splice acceptor/donor sites, suggests an alternative splicing mechanism. The 3' end of hGHB receptor shows a 600 bp non coding sequence, downstream to the stop codon followed by poly(A).

D. hGHB receptor is a putative G protein coupled receptor.

Clone B6H9(19) (hGHB receptor) has 11 putative transmembrane domains. The fourth intracellular loop contains a GPCR motif with 75% homology with a consensus sequence (PDPKAYQLLSARSA; SEQ ID NO:7).

E. hGHB receptor binds GHB.

B6H9(19) was shown to be expressed in transiently transfected CHO cells and expression of B6H9(19) led to the synthesis of a membranous protein which is able to bind GHB. As shown in FIG. 2, more than 50% of [³H]-GHB (100 nM) binding is displaced by 1 mM GHB.

F. Electrophysiological recording.

Furthermore, patch-clamp experiments on B6H9(19) transfected cells also generate a signal following 0.1 or 1 μM GHB application. This signal is antagonized by 50 μM NCS-382 (FIG. 3A and 3B). GHB application on control cells (vector alone) did not induce any current. In various embodiments, electrophysiological recording or patch-clamp experiments may be used to detect a current across the cell membrane, particularly when the hGHB receptor is activated.

EXAMPLE 3

EFFECTS OF GHB ON THE SLEEP EEG DURING LIGHT CYCLE

Eight male Wistar rats were chronically implanted with electrodes for the recording of EEG sleep. After a 10-day recovery period from surgery, habituation to the recording conditions was performed over another 10-day period. The animals were then injected with vehicle and 48 hrs later were injected i.p. with varying doses of GHB. A period of at least one week separated treatment for each animal with different doses of GHB. The doses tested were 25, 50, 100, 200 or 300 mg/kg (n=4 animals per dose) with animals being injected with increasing doses of GHB. EEG and EMG activity were recorded for 4 hrs following treatment with either vehicle or GHB. All animals were injected with vehicle or GHB two hrs after the onset of the light phase.

No effects on EEG sleep were observed at doses of 25, 50 or 100 mg/kg of GHB. While no effects on the amount of SWS were observed in animals treated with 200 mg/kg of GHB, there was a moderate increase in EEG SWA during SWS in animals treated with this dose of GHB (Table 7 and Fig. 6). hi animals treated with 300 mg/kg GHB, abnormal spindles in the EEG appeared, followed by a continuous hypersynchrony (previously reported in rats, cats, rabbits) of the EEG. This hypersynchrony of the EEG occuned while the rat was fully awake, immobile but standing on its feet with eyes open. After about two hrs post injection the rats started to adopt a sleeping position with eyes closed and the EEG signal became progressively normalized. During this period of normalized SWS, the EEG SWA in SWS was increased by 16% compared to vehicle injection. No effects on REM sleep were observed in response to GHB administration at any doses tested.

TABLE 7: Effects on GHB sleep states.

EXAMPLE 4

EFFECTS OF GHB ON EEG SLEEP DURING THE DARK CYCLE

A sleep EEG was recorded from four male Wistar rats. The animals were injected i.p. with vehicle and 24 hrs later were injected with a 100 mg/kg dose of GHB. A week later, the animals were again injected with vehicle followed 24 hrs later with an injection of 200 mg/kg of GHB. While a dose of 100 mg/kg of GHB had no effect on the time spent in SWS or on EEG SWA in SWS, at 200 mg/kg GHB induced a 27 % increase in SWS and a 37 % increase in EEG SWA during SWS (Table 7 and Fig. 6) compared to vehicle injections. No major changes were observed in either EEG power during wake or on REM sleep. Interestingly, while inducing a clear increase in SWS and EEG SWA during SWS, GHB did not reduce the time to sleep onset (Table 8). On the contrary, SWS latency was delayed in animals treated with GHB compared to vehicle (Table 8). In the rat, GHB is not acting as a sleep-inducing substance per se, but is instead facilitating SWS and EEG SWA during SWS when this sleep state occurs.

TABLE 8: Effects of GHB during the dark phase on SWS latency.

EXAMPLE 5

DATA ON THE EFFECTS OF GHB IN HUMANS

Two series of clinical studies have been conducted. The first series of studies involved only nonnal young men and examined whether gamma-hydroxybutyrate (GHB) would simultaneously enhance SWS and SWS-associated GH secretion (Mamelak et al, 1977). Eight healthy young men participated each in four studies involving bedtime oral administration of placebo, 2.5 g, 3.0 g, and 3.5 g of GHB.

Polygraphic sleep recordings were performed every night and blood samples were obtained at 15-min intervals from 2000 to 0800 hours. Irrespective of the dose, GHB reduced sleep latency, indicating that, in the human GHB has sleep-inducing properties, in addition to SWS-enhancing properties. The effects on SWS and GH were mainly observed during the first 2 hours after sleep onset. There was a doubling of GH secretion, resulting from an increase of the amplitude and the duration of the first GH pulse following sleep onset. This stimulation of GH secretion was significantly conelated to a simultaneous increase in the amount of sleep stage IV. Abrupt, but transient elevations of prolactin and cortisol were also observed, but did not appear to be associated with the concomitant stimulation of SWS. Thyrotropin and melatonin profiles were not altered by GHB administration. These data indicate that GHB is SWS-enhancing and that GHB is a potent GH secretagogue. The effects of GHB may involve a stimulation of central GHRH release, resulting in both increased SWS (a robust effect following GHRH injections in laboratory rodents as well as humans) and increased GH release. The second series of studies were a placebo-controlled 28-day protocol with GHB administration in older adults. The protocol involves a baseline study, a study after 7 days of treatment and a study after 28 days of treatment with a low dose of GHB (3g). The subject sleeps in the Clinical Research Center during the first 7 days of treatment and sleep is recorded during at least 5 of these 7 days. A total of 26 older men and women (55-81 yrs) have been studied. The available data already provide highly significant results. Sleep latency was reduced with GHB as compared to placebo (from 19.2 ± 2.8 min under placebo to 9.8 ±1.2 min under GHB, p<0.005). FIG. 7 shows exemplary profiles of SWA at baseline and after 7 and 28 days of treatment for both conditions. GHB administration consistently enhanced SWA. By visual examination, the EEG patterns in SWS were indistinguishable from those observed in younger adults.

EXAMPLE 6

ANIMAL MODEL

The rat may be used as a rapid and cost effective animal model for screening GHB- related compounds or candidate substances that enhance SWS and SWA, i.e., EEC power density in the delta frequency range (1-4 Hz) during SWS. To reach this objective three sets of studies are carried out in rats a) characterize the effects of GHB on EEG sleep, b) stepwise behavioral assay to rapidly screen candidate substances, and c) behavioral/physiological screen and.

A. Materials and Methods

Animals:

All rats will be of the Wistar strain, one of the most widely used rat strains for pharmacological studies of sleep (Kales, 1995). The animals will be allowed ad libitum access to food and water and maintained under a LD 12:12 cycle and constant temperature (22 ± 2 C) throughout all of the studies.

Surgical procedures for EEG and EMG sleep recording:

The surgical area is washed with a disinfectant (Roccal-D) and alcohol prior to surgery. Instruments are autoclaved and allowed to soak in alcohol during the procedure. For implantation of the recording electrodes, rats will be anesthetized by an injection of sodium pentobarbital (60 mg/kg, i.p.) and placed in a stereotaxic apparatus. The hair is clipped from the animal's scalp and iodine antiseptic solution applied to the skin. An incision measuring 4-5 cm in length is then made laterally in the scalp, and the underlying skull surface exposed. For monitoring of EEG signals, stainless steel recording screws (Small Parts Inc. Miami Lakes/ FL #000-120) are positioned at two locations contralateral to each other on the skull surface.

The first is 1 mm anterior to Bregma and 1 mm right of the central suture while the second is located 1 mm posterior to Lambda and 1 mm left of the central suture. This positioning is chosen in order to maximize the amount of delta activity recorded from the cortex while still being able to detect clear hippocampal theta activity necessary for the classification of REM sleep. Once the screws are in place the pre-fabricated head implant, containing a 1 x 4 pin grid anay (PGA) and the two EMG electrodes, is attached to the skull between the screws using cyanoacrylimide (super-glue) adhesive. Bare wire leads from the PGA are manually wrapped around the screws in a manner that ensures a solid electrical connection. The screws are then further tightened to take up the slack of the wire and solidify this connection. To check the connection is secure, a continuity test is made between the top pin on the PGA and the conesponding screw to which the connector wire is fastened. Only in the case of a solid electrical connection is the operation allowed to proceed. After the EEG wires are secure, the screws and exposed wire are coated using liquid dental acrylic. This procedure serves to 1) insulate and protect the electrical connections from other interference and 2) attach the PGA to the screws in skull in order to form a more permanent and solid attachment. EMG activity is monitored using stainless steel, teflon-coated wires which have been worked into a small, blunt loop and insulated using silicon. These electrodes are inserted bilaterally into the trapezius muscles on either side of the neck. The back of the PGA implant is then also covered in dental acrylic in order to hold the wires of the EMG electrodes into place. After allowing several minutes for the newly applied acrylic to dry the skin around the implant is checked to ensure that it is free of excess debris and the area is irrigated using saline. The skin at the back of the implant typically required 1-2 stitches to close up around the implant, leaving the top PGA exposed. In order to control for pain and itching over the next 12-24 hours rats are given Buprenex (Bupreno hine, 2 mg/kg s.c. every 12hrs). Typically, the entire procedure takes less than 45 minutes. During the recovery period animals are momtored every day for signs of infection or physical distress. In the event of either condition the animal will be removed from the experiment and sacrificed. Recovery from surgery is considered satisfactory after 7 days. Typically, a return to baseline levels of activity and re-entrainment to the light-dark cycle are apparent by this point. Recording of EEC sleep:

Studies typically involve the monitoring of EEC and EMG waveforms for a continuous period of up to two months. Any animal to be momtored will be surgically implanted with electrodes (see procedure above). After a 7-day recovery from surgery rats are placed in a sleep recording chamber and connected to a lightweight rotating tether system which enabled complete freedom of movement throughout the cage. Except for the recording tether, conditions in the recording chamber are identical to those in the home cage. Rats are allowed a minimum of 48 hours to acclimate to the tether. Once the animal has adapted to the chamber EEC and EMG waveforms are then collected for each animal. EEC signals are amplified approximately 25,000 times with a -6dB/oct high pass and low pass filter settings at 0.1 Hz and 50Hz (3dB), respectively. EMG signals are amplified 50,000 X and low-pass filtered at 100 Hz. Both signals may then be digitized at 100 Hz by an analog to digital converter (Data Translation model DT- 01EZ) and stored on an IBM AT computer system. Waveforms are typically collected using ACQ, a soft-ware system designed specifically for gathering and analyzing rodent sleep data.

EEC sleep analysis:

Sleep-wake parameters: After collection, all waveforms are classified by two independent sleep scorers into 10 sec. epochs of either wake (low voltage, high frequency EEC; high amplitude EMG)/slow wave sleep (SWS -high voltage, mixed frequency EEC; low amplitude EMG) or REM sleep (mixed frequency EEG with a predominance of theta activity (5- 9 Hz); very low amplitude EMG. Unscorable epochs, i.e. from movement or electrical recording interference, are marked as artifact and excluded from further analysis. Individual scorers typically achieve 95% agreement on sleep/wake epochs and 85% agreement on SWS/REM sleep. Results from both scorers are then averaged to produce a final result for each animal.

Power spectral analysis: Preamplifiers (GRASS Model 12 Neurodata Data Acquisition System) are used to amplify and pre-filter the EEG (gain 10,000x, bandpass 1-30 Hz (6dB) ) and the EMG (gain 50,000x, bandpass 3 - 100 Hz). Both signals are sampled at 100 Hz , digitized and stored, together with a time code on disk. For manual scoring, the EEG and EMG signals are reconstituted on the screen of a PC in 10-sec epochs and assigned a score of wake, SWS, REM sleep, or (rarely) artifact. For power spectral analysis, each epoch is divided into five 2-sec subepochs whose EEG are subjected to Fast Fourier Transform. The results are converted to power density in three -wavebands Delta (1-4 Hz), theta (5 - 9 Hz), and Sigma (10 - 15 Hz). Following the sleep Scoring, the mean SWS power density and the total SWS energy density is calculated for the three wavebands. EEG power density in the delta band is designated as slow wave activity (SWA). SWA is an indicator of slow wave sleep intensity (Borbely and Neuhaus, 1979). A 50 μH, 5 Hz signal recorded immediately preceding the rat EEG is used to calibrate the system.

Recording of total locomotor activity and body temperature: hnplantable transducers (PDT-4000 E-Mitter by Mini-Mitter) that record body temperature and activity will be Inserted through a small (>1 cm) incision off midline in the peritoneal cavity. To prevent migration of the probe, they will be anchored by nylon suture to the muscle layers. The muscle layer is first closed with gut sutures, then the skin layer is separately closed using woundclips. The woundclips are removed after 1 week when sleep recording is to begin. The implantation surgery will be accomplished at the same time as the implantation of electrodes for EEG and EMG. These transducers are ideal; rather than using a battery, the E- mitters are powered though an induction-coil base that is placed under the cage. The body temperature (accurate to 0.1 degree) and activity (number of movements per 10-secohd time period) signals are sent via radio frequency to the receiver base; the data acquisition computer then collects these data concunently with EEG and EMG waveforms

EXAMPLE 7

CHARACTERIZATION OF EFFECTS OF GHB ON SLEEP IN THE RAT.

All studies were carried out on adult male Wistar rats maintained under a 12L:12D light- dark cycle, at a temperature of 22 ± 2° C, and with free access to food and water. The animals were implanted under deep anesthesia (ketamine 100 mg/kg and xylazine 10 mg/kg i.p.) with chronic EEG and EMG electrodes for sleep recording. At the same time, a transducer was implanted in the peritoneal cavity for the recording of locomotor activity and body temperature. Two weeks after surgery, habituation to the recording conditions was performed over a 10-day period before pharmacological treatments were started.

Typically, these studies were to determine the time of day when GHB had the most hypnotic effects and to determine more precisely the time course of the response to GHB. In an initial study, different doses of GHB (25, 50, 100, 200 and 300 mg/kg i.p.; n = 4 animals per dose) were tested either during the light phase or the dark phase. When injected at the beginning of the light phase, no effects of GHB on EEG sleep were observed at doses up to 200 mg/kg. At the dose of 300 mg/kg abnormal spindles in the EEG appeared followed by a continuous EEG hypersynchrony. In contrast, 200 mg/kg GHB injected at the onset of the dark phase induced an increase in NREM sleep. In a second study, sleep EEG was recorded in rats injected with vehicle and 24 hours later treated with 200 mg/kg of GHB at one of four time points: at lights on (Zeitgeber time, ZT 0), 6 hours after lights on (ZT 6), at the onset of dark (ZT 12) and 6 hours after the onset of dark (ZT 18). However, due to technical problems, there were too few animals in the ZT 6 group, and data from this group were not included in the analysis. Sleep-wake patterns, locomotor activity and body temperature were analyzed per 1 hour periods during 6 hours after treatment and were compared to those obtained after vehicle injection. As shown in FIG. 9, GHB was only effective in inducing an increase in sleep (both NREM and REM) when administered at lights off. In an initial study the inventors also found GHB to be more effective when delivered at lights off rather than lights on. In these original studies, it is noted that administration of GHB seemed to increase sleep latency. Indeed, when injected at dark onset, GHB had a biphasic effect on sleep; an initial reduction of NREM and REM sleep during the first hour followed by a pronounced increase in both NREM and REM sleep for 2 h. This increase in wake during the 1st hour was also reflected in an increase in sleep latency in the animals injected at ZT 12, while there were no effects on sleep latency in animals treated at the other times of day (Table 9). These results suggest that, in the rat, GHB is not acting as a sleep- inducing substance per se, but is facilitating NREM sleep when this sleep state occurs. Derailed analysis of the sleep-wake states each hour after GHB treatment at ZT 12 revealed that the decrease in NREM sleep during the 1st hour was associated with a decrease in the number of bouts of NREM sleep, but not their duration (Table 10). Similarly, the increase in NREM sleep during hours 2 and 3 post injection were due to a near doubling in the number of bouts of NREM (and to some extent REM) while there were no significant effects on the number of NREM or REM episodes during this time period (Table 10). In a separate study, the inventors found that a dose of 150 mg/kg of GHB administered at ZT 12 was not as effective as the 200mg dose in promoting sleep, but still had qualitatively similar effects on sleep, body, temperature and locomotor activity (see below and FIG. 10). Therefore, there is a clear dose-dependent effect of GHB on sleep- wake parameters.

TABLE: 9

Mean (±SEM) values of NREM and REM sleep latencies (min) following injections of vehicle and GHB (200mg/kg) in rats (N = 4-7 animals per group) at different ZT times (ZTO = onset of light phase; ZT12 = onset of dark phase). **p < .01 (paired two-tailed Student t-test).

Table 10:

Mean (±SEM) values for the numbers and durations (min) of wake, NREM and REM bouts for each consecutive recording hour following injections vehicle and GHB (200mg/kg) in 7 rats at the onset of the dark phase. *p < .05; **p < .01; ***p < .001 (paired two-tailed Student t-test). V = vehicle.

One hypothesis to explain the increase in NREM and REM sleep after the initial increase in wake during the first hour after GHB treatment at ZT 12 is that this represents rebound sleep after an initial sleep decrease. This is unlikely. First, the amount of NREM and REM sleep during hours 2 and 3 is greater than the amount of sleep lost during the first hour. Second, a similar sleep enhancing effect was observed with a GHB agonists (see below) without an associated initial increase in wake. An alternative, is that the initial increase in wake is due to a dopaminergic effect of GHB while the delayed increase in sleep is due to the GABAergic effects of GHB. It is noteworthy that the wake-promoting effects of GHB were also observed during the first hour when animals were treated at ZT 6 and 18.

Lead compounds and/or candidate substances will typically be tested for their effects on wake and sleep near the time of lights off. Also, a series of studies involving dopaminergic and GABAergic antagonists may be performed to develop a more detailed understanding of the wake and sleep promoting mechanisms by which GHB induces an initial increase in wake then a delayed increase in NREM and REM sleep.

EXAMPLE 8

BEHAVIORAL ASSAY FOR COMPOUNDS WITH GHB-LIKE ACTIVITY.

A 5-point scale was typically used to determine if the overall behavior of the animal could be used as a marker of the effects of GHB. Such an assay could then be used to rapidly screen many compounds in order to select those that have the most "GHB-like" activity at the lowest doses. The 5-point scale used was as follows:

1. animal active and moving around the cage (walking, running, foraging)

2. animal active in a standing position, but not moving around the cage

3. animal immobile in a standing position with eyes open

4. animal supine with eyes open

5. animal "asleep", i.e. supine, immobile with eyes closed

However, as shown in FIG. 11, this behavioral screen may not be adequate for detecting GHB induced changes in behavior.

In addition to using a visual behavioral screen, the total activity and/or body temperature as measured via biotelemetry to detect GHB-induced changes in behavior may be used. GHB (200 mg/kg) induced an increase in locomotor activity and body temperature during the first hour after treatment at ZT 12 that was followed by a decrease in both parameters 1-3 hours post- treatment (FIG. 10). These GHB-induced changes in total activity and body temperature matched those changes in wake and sleep states for the first three hours after treatment at ZT 12 (FIG. 10). Importantly, the changes in body temperature and to a lesser extent locomotor activity reflected the effects of a GHB agonist on sleep and wake states (see below).

Taken together, the results on both GHB-and GHB agonist-induced changes in body temperature and locomotor activity suggest that these are markers for both the wake-promoting (perhaps due to dopaminergic stimulation) and the sleep-inducing (perhaps due to GABAergic stimulation) effects of GHB and related compounds. Thus, body temperature and locomotor activity will be used to screen for GHB-like activity compounds that have high binding affinity for hGHB receptor. This screen will allow the selection of the most promising compounds for further analysis, (e.g., full sleep EEG/EMG analysis).

Testing of GHB receptor agonists

In order to verify the rat as a model to screen for compounds with GHB-like activity, three compounds have been tested from the NCS series. Two of the compounds had previously been identified as having moderate affimty to the rat GHB receptor based on displacement of [³H]-GHB binding from striatal membranes (Kaufman et al, 1990). NCS-356 and NCS-399 were delivered at ZT 12 at a dose of 250 mg/kg. Both compounds induced an increase in wakefulness for about 4 hours after treatment. Indeed, following treatment with NCS-399, there was no REM or NREM sleep for the first four and two hours, respectively, and NREM sleep was still decreased by 65 and 30% during hours 3 and 4 after treatment. Because these compounds did not induce sleep in a manner similar to GHB, and because another NCS series compounds were available that had a much higher affinity for rat GHB, more complete studies were carried out with this compound, NCS-467.

Sleep EEG was recorded in rats injected with vehicle and 24 hours later with 100 mg/kg of the GHB agonist NCS-467 at each of four time points: ZT 0, 6, 12 and 18. As shown in FIG. 12, like GHB, NCS-467 was only effective in inducing an increase in NREM sleep when it was delivered at ZT 12. However, in contrast to GHB, which induced an initial decrease in REM followed by an increase, treatment with NCS-467 at ZT 12 induced a clear decrease in REM sleep that lasted for three hours. Power spectral analysis of the EEG in NREM sleep revealed that NCS-467 induced an increase in delta power (i.e., power spectral values in the 1-5 Hz frequency band; refened to as SWA, an index of sleep intensity). Interestingly, the delta power enhancing effect was observed when NCS-467 was administered either at ZT 0 or at ZT 12 (FIG. 13). These results indicate that the ability of the rat GHB agonist NCS-467 to promote delta power (i.e., sleep intensity) is evident even when the duration of NREM sleep is not substantially increased. Detailed analysis of the sleep-wake state each hour after treatment with NCS-467 at ZT 12 revealed a very interesting difference from the effects of GHB. Whereas the GHB- induced increase in NREM sleep was due to an increase in the number of NREM bouts, but not the duration of the bouts, NCS-467 had the opposite effect. It increased the mean duration of the bouts, but had no effect on the number of bouts (Table 11). This suggests that NCS-467 may induce a more consolidated sleep pattern than GHB. In a separate study, the effects of a lower dose of NCS-467 delivered at ZT 12. A 50 mg/kg dose were studied and had no measurable effect on sleep EEG (FIG. 14).

The effects of NCS-467 on body temperature and locomotor activity when delivered at ZT 12 were examined. FIG. 14 shows a clear decrease in both activity and body temperature at a dose of 100 mg/kg that was more pronounced than that observed after a 200 mg/kg dose of GHB.

The studies with NCS-467 support the other GHB studies in that the best time to test compounds for GHB-like activity is at ZT 12. Furthermore, they also support the use of body temperature and locomotor activity as a marker of GHB-like activity in further studies where other compounds with high hGHB receptor binding affinity will be tested. There is one other interesting similarity between the findings with GHB and NCS-467. Both compounds appear to have biphasic effects in which the initial effects were an increase in wake and/or a decrease in REM; both effects which may be due to an increase in dopaminergic activity. After this initial effect, both compounds induce an increase in sleep time; an effect which may be due to an increase in GABAergic activity. In further studies, both dopaminergic and GABAergic antagonists will be used to elucidate the mechanisms by which both GHB and at least one GHB agonist exert their effects on sleep-wake states.

EXAMPLE 9

FUNCTIONAL, PHARMACOLOGIC AND STRUCTURAL STUDIES OF GHBR

A. Materials and Methods:

Cells membranes preparation

CHO cells were transiently transfected as described above. Cells were harvested and resuspended in cold phosphate buffer (100 mM KH₂PO₄; pH 6.0) containing 5 mM EDTA and centrifuged at 18,000g for 10 min at 4°C. The pellet was resuspended in EDTA-free phosphate buffer and centrifuged at 30,000g for 20 min. The membrane preparation was resuspended in phosphate buffer and used immediately for binding experiments.

Tissue membrane preparation

Tissue was homogenized in Tris-HCl (5mM; pH 7.4), sucrose 0.32 M, EDTA 3 mM and protease inhibitors cocktail. The resulting homogenate was centrifuged at lOOOg for 5 min. The supernatant was collected and centrifuged at 30,000g for 20 min. The pellet was resuspended in KH₂PO₄ buffer (50mM, pH 6.0).

PCR experimental conditions:

95°C 10 min

30 cycles with: 92°C 30 sec

55°C 30 sec 72°C 1 min

72°C 7 min

Primers used for hGHBR3 amplification and isolation were 5'- CCATGGCCTTCCTGATGCACCTGCTGGTCT-3' (SEQ ID NO:16) and 5'- CTAGGCTGGACAGTGCAGATTGCAGAAGTC-3' (SEQ ID NO:17). Primers used for rGHBR2 amplification and isolation were 5'-ACCTTTGACCTAATGGCAG CACCTCCACTG-3' (SEQ ID NO: 18) and 5'-GTGAAGTAACTCCTACGCGA CCCGGTTCAA-3' (SEQ ID NO:19). The primers used for mGHBR2 amplification and isolation were 5'-ACCTTTGACCTAATGGCAGCACCTCCGCTG-3' (SEQ ID NO:20) and 5'- CCTACACGTCTGGGTTCAGAGGCCACACTG-3' (SEQ ID NO:21).

Northern Blot analysis on human total RNA

Norhtern Blot studies were performed using the methods provided in the Clontech Multiple Tissue Northern (MTN^®) Blot User Manual. Briefly, MTN^® Blots were prehybridized for 30 min in ExpressHyb buffer at 68°C, hybridized with ³²P-labelled cDNA probes for 1 hour at the same temperature, washed with appropriate buffers and exposed to X-ray film for two weeks.

Probes design for Northern Blot analysis

Probes used for hGHBRl and hGHBR2 Northern Blot included probe A and probe B. Probe A was an hGHBRl specific probe was obtained by enzymatic digestion of the clone B6H9(19) with Pst I (cut at position C₁₅₁₄) and EcoR I (site of insertion for B6H9(19) into Blue Script vector). Probe B was a mix of two probes that were obtained by PCR amplification of the clone B6H9(19) with primers 5'-TCAAAGAGCTTCCAGAGGGTTGGAGCCTCC-3' (SEQ ID NO:22) and 5'-CCCAGGAAGAATGACCGTAAGAAGCGAGGT-3' (SEQ ID NO:23) (amplification of nucleotides 215 to 551) and primers 5'-TTCCTTGAGCGTTTTCCCGCCAGC ACCTT-3' (SEQ ID NO:24) and 5'-ACTGCGGGCTGATAGAAGCTGATAGGCCTT-3' (SEQ ID NO:25) (amplification of nucleotides 661 to 930)

The probe used for hGHBR3 Northern Blot studies was obtained by PCR amplification of hGHBR3 with primers 5'-GTCTCACTACCTGCGTCAATGT-3' (SEQ ID NO:26) and 5'- AGGCCACCAGGGTATAGACGAA-3' (SEQ ID NO:27) (amplification of nucleotides 736 to 1176)

B. Results

Characterization and confirmation of functional and pharmacologic data related to GHBR family. Analyses and searches in gene databases led the inventors to propose the existence of a family of human GHB receptors with at least three members (hGHBRl, hGHBR2 and l GHBR3). hGHBRl seems to be human specific while hGHBR2 and hGHBR3 are expressed in many species including mouse and rat. (See Table 12; h: human, m: mouse, r: rat).

Based on this information, coding sequences have been isolated from human, mouse- derived neuroblastoma and rat cDNA libraries. Each receptor, with the exception of rGHBR2, is expressed in all tissues studied. Partial or complete coding sequences were identified from peripheral and central tissues. The full length coding sequence for rGHBR2 is identical to exonic chromosome 3 sequence and is not described in any gene database.

Table 13 summarizes the species and the origin for clones and constructions (GFP for "green fluorescent protein"). CHO cells transfected with GFP-GHBR showed that the fluorescence was principally localized at the plasma membrane.

TABLE 13

The peripheral expression for all these receptors were confirmed by Northern-Blot analysis on human RNA and binding experiments on rat and human tissues were performed, hi addition, preliminary structural studies for the three proteins are suggested as well as a mechanism of action in terms of signal transduction. hGHBRl (B6H9(19T)

FIG. 15. shows saturation [³H]-GHB binding experiments (non-linear regression line) with membranes of hGHBRl transfected CHO cells. I j value is 114 + 12 nM. Means ± SD of three independent values, non-linear fitting by the GraphPad-Prism program (San Diego, CA).

Northern blot analysis for hGHBRl and hGHBR2 on human tissues

Because of the high homology between hGHBRl and hGHBR2 nucleotide sequences, the inventors have used two different ³²P labelled probes to evaluate the expression in human tissues by Northern Blot analysis (FIG. 16). The probe "A" (190 bp), which is more specific for hGHBRl than hGHBR2 (70 % identity) would have a higher specificity to hGHBRl than hGHBR2. The probe "B", a mix of two PCR amplified cDNA segments from the clone B6H9(19) would hybridize with equivalent specificity the two isoforms of GHB receptors (89 and 85 % identity for hGHBR2) but not hGHBR3. In the two cases identical autoradiograms were observed. The major band (3 kb) is present in all tissues but placenta. Skeletal muscle and heart tissues higher level of label than other tissues. The presence of other bands suggests an alternative splicing or the existence of yet unknown isoforms.

Schematic representation of hGHBRl (B6H9(19

Two two-dimensional (2D) structures were suggested when using structural modeling algorithms, such as Residue-based Diagram editor (icb.med.cornell.edu/crt/RbDe/RbDe.html), TMpred (www.ch.embnet.org/software/ TMPRED_form.html), The PredictProtein Server (cubic.bioc.columbia.edu /predictprotein/) and TMHMM Server

(www.cbs.dtu.dk/services/TMHMM-2.01). One structure is an 11 transmembrane domains (TMD) protein (FIG. 17 A) with an extracellular Carboxy-terminal tail while the other is a 10 TMD protein (FIG. 17B) with an intracellular Carboxy-terminal tail. Based on the inventors studies, this latter model is more likely because a deletion of a Cι₃₇₄ (clone C12K32) leads to a change in the ORF and disappearance of a PKC consensus site (FIG. 17C). This site may play a role in the desensitization of the receptor. Indeed, it was observed that following GHB application to CHO transfected cells, desensitization was observed with clone B6H9(19) but not with C12K32. Possible G protein coupling sequence is indicated in FIG. 16A. A putative PKC phosphorylation site is also present in the GPCR domain.

Electrophysiological studies on CHO transfected cells with GHB receptors

Electrophysiological results obtained by patch clamp experiments on CHO transfected cells with GHB receptors. FIG. 22A-22C shows an exemplary electrophysiologic recording of the studies described in Table 14.

TABLE 14

Northern blot analysis for hGHBR3 on human tissues

PCR amplified cDNA from hGHBR3 was used in Northern blot studies. The amplified DNA probe did not have a significant homology to hGHBRl or hGHBR2. The major band (2 kb) revealed is present in all tissues but with a more intense labelling in the case of placenta, skeletal muscle, liver and heart (FIG. 18).

Binding studies on peripheral human and rat tissues

For Human tissue studies membranes were prepared from frozen human pancreas and thyroid (FIG. 19). Binding experiments were performed with 300 nM of [ H]GHB and 100 μg of protein/assay. Non specific binding was determined in the presence of 5mM GHB.

For Rat tissue studies membranes were prepared from the various fresh tissues. Binding experiments were performed with 300 nM of [³H]GHB and 100 μg of protein/assay. Table 15 shows IC₅₀ of GHB in various tissues, estimated in the presence of lnM to 5 mM GHB. Table 16 shows IC₅o in rat liver, estimated in the presence of lnM to 5 mM of various competitors.

TABLE 15

TABLE 16

Structural studies of hGHBR family

Multiple alignment analysis was performed with "MULTALIN" algorithm (prodes.toulouse.ima.fr/multalin.html) (FIG. 20). The homologies and identities in reference to hGHBRl sequence are symbolized in single amino acid code. hGHBRl and hGHBR2 are very closely related (92 % homology). hGHBR3 shows 64 % homology when compared to hGHBRl or hGHBR2.

Comparison between human GHB receptors structure

The differences between hGHBR2 or hGHBR3 and hGHBRl in terms of sequence identities or homologies are shown in a scaled representation (FIG. 21). The three proteins are presented in their 11 TMD models. The major differences observed between the three proteins reside in the third extracellular and intracellular loops (percentage of homologies/identities are indicated; the hGHBR3 extracellular loop is longer). Putative G protein coupled sequence is indicated as is PKC phosphorylation sites.

* * *

All of the compositions and/or methods disclosed and claimed herein can be made and executed without undue experimentation in light of the present disclosure. While the compositions and methods of this invention have been described in terms of prefened embodiments, it will be apparent to those of skill in the art that variations may be applied to the compositions and/or methods and in the steps or in the sequence of steps of the method described herein without departing from the concept, spirit and scope of the invention. More specifically, it will be apparent that certain agents that are both chemically and physiologically related may be substituted for the agents described herein while the same or similar results would be achieved. All such similar substitutes and modifications apparent to those skilled in the art are deemed to be within the spirit, scope and concept of the invention as defined by the appended claims.

REFERENCES

The following references, to the extent that they provide exemplary procedural or other details supplementary to those set forth herein, are specifically incorporated herein by reference.

U.S. Patent 4,196,265 U.S. Patent 4,393,236 U.S. Patent 4,554,101 U.S. Patent 5,840,331

Advanced Organic Chemistry, Magraw Hill, 1977.

Aeschbach et al, Neuropsychopharmacology, 11: 237-244, 1994.

American Psychiatric Association In: Diagnostic and Statistical Manual of Mental Disorders,

4th ed. rev., Washington D.C., 1994. Anden and Stock, Naunyn. Schmiedebergs Arch. Pharmacol, 279(l):89-92, 1973. Angel et al, Mol. Cell. Biol, 7:2256, 1987. Angel et al, Cell, 49:729, 1987b. Angel et al, Mol. Cell. Biol, 7:2256, 1987a. Atchison and Perry, Cell, 46:253, 1986. Atchison and Peny, Cell, 48:121, 1987. Avis and Wu, In: Biotechnology and Biopharmaceutical Manufacturing, Processing, and

Preservation, Drug Manufacturing Technology Series, V:2, 1996. Avis, hi: Sterile Pharmaceutical Products: Process Engineering Applications, Drug

Manufacturing Technology Series, V:l, 1995. Baichwal and Sugden, In: Gene Transfer, Kucherlapati (Ed.), NY, Plenum Press, 117-148,

1986. Banerji et al, Cell, 27(2 Pt l):299-308, 1981. Banerji et al, Cell, 33(3):729-740, 1983. Barany and Merrifield, In: The Peptides, Gross and Meienhofer (Eds.), Academic Press, NY,

1-284, 1979. Bedard et α/., Clin. Neuropharmacol, 12(l):29-36, 1989. Berkhout et al, Cell, 59:273-282, 1989. Bertin et al, J. Biol. Chem., 267(12):8200-82006, 1992.

Bierer et al, J. Exp. Med., 168(3):1145-1156, 1988.

Blanar et «/., E ROJ, 8:1139, 1989.

Bodine and Ley, EMBOJ, 6:2997, 1987.

Bonifacino et al, In: Current Protocols in Cell Biology, John Wiley & Sons, Inc., 1999.

Borbely and Neuhaus, Comp Physiol, 133:71-87, 1979.

Borbely, Horm. Res., 49:114-117,1998.

Boshart et al, Cell, 41:521, 1985.

Bosze et al, EMBO J, 5(7):1615-1623, 1986.

Bouiver et al, Nature, 333(6171):370-373, 1988.

Braddock et al, Cell, 58:269, 1989.

Broughton and Mamelak, Can. J. Neurol. Sci., 6(l):l-6, 1979.

Bulla and Siddiqui, J. Virol, 62:1437, 1986.

Buzsaki, J. Sleep Res., 7(Suppl l):17-23, 1998.

Campbell and Nillaneal, Mol. Cell. Biol, 8:1993, 1988.

Campbell et al, J. Mol. Biol, 180:1-19, 1984.

Campere and Tilghman, Genes andDev., 3:537, 1989.

Campo et al, Nature, 303:77, 1983.

Capaldi et al, Biochem. Biophys. Res. Comm., 74(2):425-433, 1977.

Celander and Ηaseltine, J. Virology, 61:269, 1987.

Celander et α/., J. Virology, 62:1314, 1988.

Chandler et al, Cell, 33:489, 1983.

Chang et al, Mol. Cell. Biol, 9:2153, 1989.

Chatterjee et al, Proc. Natl. Acad. Sci. USA, 86:9114, 1989.

Chen and Okayama, Mol. Cell Biol, 7(8):2745-2752, 1987.

Choi et al, Cell, 53:519, 1988.

Coffin, In: Virology, Fields et al. (Eds.), Raven Press, ΝY, 1437-1500, 1990.

Cohen et al, J. Cell. Physiol, 5:75, 1987.

Coligan et al, In: Current Protocols in Immunology, John Wiley & Sons, 1999

Costa et al, Mol. Cell. Biol, 8:81, 1988.

Coupar et al, Gene, 68:1-10, 1988.

Cripe et al, EMBO J, 6:3745, 1987.

Culotta and Ηamer, Mol. Cell. Biol, 9:1376, 1989. Danbolt et al, Biochemistry, 29(28):6734-6740, 1990.

Dandolo et al, J. Virology, 47:55-64, 1983.

De Nilliers et α/., Nature, 312(5991):242-246, 1984.

Deschamps et al, Science, 230:1174-1177, 1985.

Dijk et al, Eur. J. Pharmacol, 21:207-218, 1989.

Dijk et al, Neurosci. Lett., 201:13-26, 1995.

Edbrooke et al, Mol. Cell. Biol, 9:1908, 1989.

Edlund et al, Science, 230:912-916, 1985.

Enna et al, hi: Current Protocols in Pharmacology, John Wiley & Sons, Inc., 2002.

European Pat. Appl. EPO 0273085

Fechheimer et α/., Proc. Natl. Acad. Sci. USA, 84:8463-8467, 1987.

Feng and Holland, Nature, 334:6178, 1988.

Fe ol et al., FASEB J, 7:1081-1091, 1993.

Firak and Subramanian, Mol. Cell. Biol, 6:3667, 1986.

Foecking and Hofstetter, Gene, 45(1):101-105, 1986.

Fraley et al, Proc. Natl. Acad. Sci. USA, 76:3348-3352, 1979.

Friedmann, Science, 244:1275-1281, 1989.

Fujita et al, Cell, 49:357, 1987.

Gallimberti et al, Alcohol Clin. Exp. Res., 16(4):673-676, 1992.

Gallimberti et al, Eur. Arch. Psychiatry Clin. Neurosci., 244(3):113-114, 1994.

Gallimberti et al, Lancet., 2(8666):787-789, 1989.

Gallimberti et al, Neuropsychopharmacology, 9(1):77-81, 1993.

Gena et al, Int. Clin. Psychopharmacol, 9(3):211-215., 1994.

Gessa et al, Clin. Neuropharmacol, 15Suppl 1 Pt A:303A-304A, 1992.

Ghosh and Bachhawat, hi: Liver Diseases, Targeted Diagnosis and Therapy Using Specific

Receptors and Ligands, Wu et al. (Eds.), Marcel Dekker, ΝY, 87-104, 1991. Ghosh-Choudhury et al, EMBO J, 6:1733-1739, 1987. Gilles et al, Cell, 33:717, 1983. Girodas et al, Sleep Res., 24A:24, 1995. Girodas et al, Sleep Res., 25, 1996. Gloss et al, EMBOJ, 6:3735, 1987. Godbout et -./., ?/. Cell. Biol, 8:1169, 1988. Goding, In: Monoclonal Antibodies: Principles and Practice, 2d ed., Academic Press, FL., 60-66, and 71-74, 1986. Godschalk et al, Eur. J. Pharmacol, 44:105-111,1977. Goodbourn and Maniatis, Proc. Natl. Acad. Sci. USA, 85:1447, 1988. Goodbourn et al, Cell, 45:601, 1986. Gopal, Mol. CellBiol, 5:1188-1190, 1985. Graham and Prevec, In: Methods in Molecular Biology: Gene Transfer and Expression

Protocol, Murray (Ed.), Humana Press, Clifton, NJ, 7:109-128, 1991. Graham and Van Der Eb, Virology, 52:456-467, 1973. Graham et al, J. General Virology, 36:59-74, 1977. Greene et a/., Immunology Today, 10:272, 1989 Grosschedl and Baltimore, Cell, 41:885, 1985. Grove- White and Kelma, Rr. J. Anaesth., 43(2):ll3-U6, 1971. Grunhaus et al, Seminar in Virology, 200(2):535-546, 1992. Harland and Weintraub, J CellBiol, 101:1094-1099, 1985. Harlow, and Lane, In: Antibodies: A Laboratory Manual, Cold Spring Harbor Laboratory,

Cold Spring Harbor, N.Y., 346-348, 1988. Hasenbos and Gielen, Anaesthesia, 40(10):977-980, 1985. Haslinger and Karin, Proc. Natl. Acad. Sci. USA, 82:8572, 1985. Hauber and Cullen, J. Virology, 62:673, 1988. Hen et al, Nature, 321:249, 1986. Hensel et al, Lymphokine Res., 8:347, 1989.

Hennonat and Muzycska, Proc. Natl. Acad. Sci. USA, 81:6466-6470, 1984. Hen and Clarke, Cell, 45:461, 1986. Hirochika et α/., J Virol, 61:2599, 1987. Hirsch et α/., o/. Cell. Biol, 10:1959, 1990. Hoes, Ned Tijdschr Geneeskd., 124(17):647-653, 1980. Holbrook et α/., Virology, 157:211, 1987. Horlick and Benfield, Mol. Cell. Biol, 9:2396, 1989. Horwich et al. J. Virol, 64:642-650, 1990. Huang et al, Cell, 27:245, 1981. Hug et al, Mol. Cell. Biol, 8:3065, 1988. Hwang et al, Mol. Cell. Biol, 10:585, 1990. frnagawa t α/., Cell, 51:251, 1987. hnbra and Karin, Nature, 323:555, 1986.

Imler et al, Mol. Cell. Biol, 7:2558, 1987.

Imperiale and Nevins, Mol. Cell. Biol, 4:875, 1984.

Jakobovits et al, Mol. Cell. Biol, 8:2555, 1988.

Jameel and Siddiqui, Mol. Cell. Biol, 6:710, 1986.

Jaynes et al, Mol. Cell. Biol, 8:62, 1988.

Johnson et al, Mol. Cell. Biol, 9:3393, 1989.

Jones and Shenk, Cell, 13:181-188, 1978.

Jouvet et /., C.R. Soc. Biol, 155:1313, 1961.

Kadesch and Berg, Mol. Cell. Biol, 6:2593, 1986.

Kales, In: The pharmacology of sleep, Handbook of Experimental Pharmacology, Kales (Ed.),

Berlin: Springer- Verlag, 1995. Kaneda et al, Science, 243:375-378, 1989. Karin et al, Mol Cell. Biol, 7:606, 1987. Karin et al, Mol. Cell. Biol, 7:606, 1987. Katinka et al, Cell, 20:393, 1980. Kato et al, J. Biol. Chem., 266:3361-3364, 1991. Kaufinan et al, Biochem. Pharmacol, 40(12):2637-40, 1990. Kawamoto et al, Mol. Cell. Biol, 8:267, 1988. Kiledjian et al, Mol. Cell. Biol, 8:145, 1988. King et al, Science, 250(4977):121-123, 1990. Klam t et al, Mol. Cell Biol, 10:193, 1990. Klein et al, Nature, 327:70-73, 1987. Koch et al, Mol. Cell. Biol, 9:303, 1989. Kriegler and Botchan, In: Eukaryotic Viral Vectors, Gluzman (Ed.), Cold Spring Harbor:

Cold Spring Harbor Laboratory, NY, 1982. Kriegler and Botchan, Mol. Cell. Biol, 3:325, 1983. Kriegler et al, Cell, 38:483, 1984. Kriegler et al, Cell, 53:45, 1988. Kuhl et al, Cell, 50:1057, 1987. Kunz et al, Nucl Acids Res., 17:1121, 1989. Kupfer et al, Arch. Gen. Psychiatry, 47:1100-1105, 1990. Kyte and Doolittle, J. Mol. Biol, 57(l):105-32, 1982. Ladinsky et al, Naunyn. Schmiedebergs Arch. Pharmacol, 322(l):42-48, 1983.

Lammers et al, Sleep, 16(3):216-20, 1993.

Lapiene et al, J. Exp. Med., 167(3):794-804, 1988.

Lapiene et al, Sleep, 15:24-30,1990.

Larson et al, Proc Natl. Acad. Sci. USA., 83:8283, 1986.

Laspia et α/., Cell, 59:283, 1989.

Laximer et al, Mol. Cell. Biol, 10:760, 1990.

Lee et al, Nature, 294:228, 1981.

Lee et al, Nucleic Acids Res., 12:4191-206, 1984.

Lentz et al, Rheumatol, 26:1586-92, 1999.

Levinson et al, Nature, 295:79, 1982.

Lin et al, Mol. Cell. Biol, 10:850, 1990.

Luria et al, EMBO J, 6:3307, 1987.

Lusky and Botchan, Proc. Natl Acad. Sci. USA, 83:3609, 1986.

Lusky et al, Mol. Cell. Biol, 3:1108, 1983.

Macejak and Sarnow, Nature, 353:90-94, 1991.

Majors and Narmus, Proc. Natl. Acad. Sci. USA, 80:5866, 1983.

Mamelak and Webster, Sleep, 4(1):105-111, 1981.

Mamelak et al, Biol Psychiatry, 14(5):821-834, 1979.

Mamelak et al, Biol. Psychiatry, 12:273-288, 1977.

Mamelak et al, Lancet, 2(7 '824):328-329, 1973.

Mamelak et al, Sleep, 9(1):285-9,1986.

Mamelak, Neurosc Biobehav. Rev., 13:187-198, 1989.

Mann et al, Cell, 33:153-159, 1983.

Marchuk et al, Nucleic Acids Res., 9(5)1154, 1991.

Marcus et al, Int. J. Neuropharmacol, 6:175-185, 1967.

Matsuzaki et al, Science, 146:1328, 1964.

Matter et al, Comb. Chem. High. Throughput Screen, 4(6):453-75, 2001.

McΝeall et /., Gene, 76:81, 1989.

Merrifield, Science, 232(4748):341-347, 1986.

Miksicek et al, Cell, 46:203, 1986.

Monti et al, J. Neural. Transm., 45:177-183, 1979.

Mordacq and Linzer, Genes andDev., 3:760, 1989. Moreau et al, Nucl Acids Res., 9:6047, 1981.

Moneale et al, Curr. Med. Chem., 9(1):99-125, 2002.

Muesing et al, Cell, 48:691, 1987.

Ng et al, Nuc Acids Res., 17:601, 1989.

Nicolas and Rubenstein, In: Vectors: A survey of molecular cloning vectors and their uses,

Rodriguez and Denhardt (Eds.), Stoneham: Butterworth, 494-513, 1988. Nicolau and Sene, Biochim. Biophys. Ada, 721:185-190, 1982. Nicolau et al, Methods Enzymol, 149:157-176, 1987. Obal et al, Am. J. Physiol. (Endocrinol Metab.), 270:E230-E237, 1996. Obal et al, Am. J. Physiol, 255:R310-R316,1988. Ondek et al, EMBO J., 6:1017, 1987. Ornitz et al, Mol. Cell. Biol, 7:3466, 1987. Oyama et al, Jap. Masui., 19(6):645-652, 1970. Palmiter et al, Nature, 300:611, 1982. Paskind et al, Virology, 67:242-248, 1975. PCT Appln. WO 00/78948 PCT Appln. WO 00/78948 PCT Appln. WO 92/01810 PCT Appln. WO 94/03564 PCT Appln. WO 99/15163 PCT Appln. WO 99/15176 PCT Appln. WO 99/15177 Pech et al, Mol. Cell. Biol, 9:396, 1989. Pelletier and Sonenberg, Nature, 334(6180):320-325, 1988. Perales et al, Proc. Natl. Acad. Sci. USA, 91:4086-4090, 1994. Perez-Stable and Constantini, Mol. Cell. Biol, 10:1116, 1990. Picard and Schaffher, Nature, 307:83, 1984. Pinkert et al, Genes and Dev., 1:268, 1987. Ponta et al, Proc. Natl. Acad. Sci. USA, 82:1020, 1985. Porton et al, Mol. Cell. Biol, 10:1076, 1990. Potter et al, Proc. Natl. Acad. Sci. USA, 81:7161-7165, 1984. Queen and Baltimore, Cell, 35:741, 1983. Quinn et al, Mol. Cell. Biol, 9:4713, 1989. Racher et al, Biotechnology Techniques, 9:169-174, 1995.

Redondo et al, Science, 247:1225, 1990.

Reisman and Rotter, Mol. Cell. Biol, 9:3571, 1989.

Remington's Pharmaceutical Sciences, 15^th ed., pages 1035-1038 and 1570-1580, Mack

Publishing Company, Easton, PA, 1980. Renan, Radiother. Oncol, 19:197-218, 1990. Resendez Jr. et al, Mol. Cell. Biol, 8:4579, 1988. Ridgeway, In: Vectors: A survey of molecular cloning vectors and their uses, Rodriguez and

Denhardt (Eds.), Stoneham:Butterworth, 467-492, 1988. Ripe et al, Mol. Cell. Biol, 9:2224, 1989. Rippe et ., o/. CellBiol, 10:689-695, 1990. Rittling et al, Nuc Acids Res., 17:1619, 1989. Rosen et al, Cell, 41:813, 1988. Rosenstein et al, J. Exp. Med., 169:149-160, 1989. Sakai et al, Genes andDev., 2:1144, 1988. Sambrook et al, In: Molecular cloning, Cold Spring Harbor Laboratory Press, Cold Spring

Harbor, NY, 2001. Satake et α/., J. Virology, 62:970, 1988. Schaffner et al, J. Mol. Biol, 201:81, 1988. Scharf et al, J. Clin. Psychiatry, 46:222-5, 1985. Scharf et al, J. Rheumatol, 25:1896-1990, 1998. Scrima et al, Biol. Psychiatry, 26(4):331-343, 1989. Scrima et al, Sleep, 13(6):479-90, 1990. Scrima, Crit. Care Nurse, 7(2):47-56, 1987. Searle et al, Mol. Cell. Biol, 5:1480, 1985. Series et al, Am. Rev. Respir. Dis., 145:1378-1383, 1992. Shapley and Cowen, Biol. Psychiatry, 37:85-98, 1995. Sharp and Marciniak, Cell, 59:229, 1989. Shaul and Ben-Levy, EMBOJ, 6:1913, 1987. Sherman et al, Mol. Cell. Biol, 9:50, 1989. Sleigh and Lockett, J. EMBO, 4:3831, 1985. Snead and Morley, Brain Res., 227(4):579-589, 1981. Spalholz et al, Cell, 42:183, 1985. Spandau and Lee, J. Virology, 62:427, 1988.

Spandidos and Wilkie, EMBOJ, 2:1193, 1983.

Stephens and Hentschel, Biochem. J, 248:1, 1987.

Stewart and Young, In: Solid Phase Peptide Synthesis, 2d. ed., Pierce Chemical Co., 1984.

Stitt et al, Cell, 80(4):661-670, 1995.

Stock et al, Naunyn. Schmiedebergs Arch. Pharmacol, 278(4):347-361, 1973.

Sxolteriborg et al, J. Immunol. Methods, 175:59-68, 1994.

Strong, Lancet., 1(8389):1304, 1984.

Stuart et al, Nature, 317:828, 1985.

Sullivan and Peterlin, Mol. Cell. Biol, 7:3315, 1987.

Swartzendruber and Lehman, J. Cell. Physiology, 85:179, 1975.

Takai et al, Proc. Natl. Acad. Sci. USA, 84:6864-6868, 1987.

Takebe et al, Mol. Cell. Biol, 8:466, 1988.

Tarn et al, J. Am. Chem. Soc, 105:6442, 1983.

Tavernier et al, Nature, 301:634, 1983.

Taylor and Kingston, Mol. Cell. Biol, 10:165, 1990a.

Taylor and Kingston, Mol. Cell. Biol, 10:176, 1990b.

Taylor et al, J. Biol. Chem., 264:15160, 1989.

Temin, In: Gene Transfer, Kucherlapati (Ed.), NY, Plenum Press, 149-188, 1986.

Thiesen et al, J Virology, 62:614, 1988.

Treisman, Cell, 42:889, 1985.

Tranche et al, Mol. Biol. Med., 7:173, 1990.

Trudel and Constantini, Genes andDev. 6:954, 1987.

Tunnicliff, Clin. Toxicol, 35:581-590, 1997.

Tunnicliff, Gen. Pharmac, 23:1027-34, 1992.

Turek and Czeisler, In: Regulation of sleep and circadian rhythms, Turek and Zee (Eds.), NY,

Marcel Dekker, 181-196, 1999. Tur-Kaspa et α/., ./. Cell Biol, 6:716-718, 1986. Tyndell et al, Nuc Acids. Res., 9:6231, 1981. Van Cauter et al, J. Clin. Invest, 100:745-753,1997. Nan Cauter et al, JAMA, 284(21):2717-8, 2000. Nannice and Levinson, J. Virology, 62:1305, 1988. Nasseur et al, Proc Natl. Acad. Sci. U.S.A., 77:1068, 1980. Wachtel et al, Naunyn. Schmiedebergs Arch. Pharmacol, 302(2):133-139, 1978. Wagner et al, Proc. Natl. Acad. Sci. USA 87(9):3410-3414, 1990. Wang and Calame, Cell, 47:241, 1986. Weber et al, Cell, 36:983, 1984. Weinberger et al. Mol. Cell. Biol, 8:988, 1984. Winoto and Baltimore, Cell 59:649, 1989. Wong et al, Gene, 10:87-94, 1980. Ψu d Wλx, Adv. Drug Delivery Rev., 12:159-167, 1993. Wu and Wu, Biochemistry, 27:887-892, 1988. Wu and Wu, J. Biol. Chem., 262:4429-4432, 1987. Wu et al, J. Pharmacol. Exp. Then, 305(2):675-679, 2003. Yamada et al, Electroenceph Clin. Neurophysiol, 22:558-562, 1967. Yang et al, Proc. Natl. Acad. Sci. USA, 87:9568-9572, 1990. Yutzey et al. Mol. Cell. Biol, 9:1397, 1989.

Zee and Turek, In: Regulation of sleep and circadian rhythms, NY, Marcel Dekker, 1-18, 1999.

Claims

1. A method of selecting a candidate substance that binds to a human GHB receptor polypeptide comprising:

(a) obtaining one or more candidate substance;

(b) contacting a human GHB receptor polypeptide with one or more of the candidate substance;

(c) assessing the ability of the one or more candidate substance(s) to bind to the human GHB receptor polypeptide; and

(d) selecting a candidate substance having desirable binding characteristics.

2. The method ofclaim 1, wherein the human GHB receptor polypeptide is expressed in a cell.

3. The method of claim 2, wherein in the cell is stably transfected with a nucleic acid encoding a human GHB receptor polypeptide.

4. The method of claim 2, wherein the cell is a mammalian cell.

5. The method of claim 4, wherein the cell is a CHO cell.

6. The method of claim 2, wherein the cell is a Xenopus Oocyte.

7. The method ofclaim 1, wherein binding of the candidate substance to the human GHB receptor polypeptide is assessed by competition with GHB binding to the human GHB receptor polypeptide.

8. The method ofclaim 1, wherein testing the candidate substance for binding to the human GHB receptor polypeptide is assessed by activation of the human GHB receptor polypeptide.

9. The method of claim 8, wherein activation of the human GHB receptor polypeptide is assessed by detecting a cunent across a cell membrane of a cell expressing a human GHB receptor polypeptide.

10. The method ofclaim 1, further comprising:

(a) producing a pharmacologically acceptable formulation of one or more of the selected substances(s);

(b) administering one or more of the formulation(s) to an animal; and

(c) assessing the pharmacological activity of the formulation by monitoring the animal.

11. The method of claim 10, wherein monitoring of the animal involves monitoring behavioral activity of the animal.

12. The method ofclaim 11, further comprising: (d) comparing the behavioral activity of the animal in the presence of the candidate substance to the behavioral activity of the animal in the absence of the candidate substance.

13. The method of claim 11 , wherein the behavioral activity is locomotor activity.

14. The method ofclaim 10, further comprising monitoring body temperature of the animal.

15. The method of claim 10, further comprising monitoring EEG waveforms of the animal.

16. The method ofclaim 10, further comprising monitoring EMG waveforms of the animal.

17. The method ofclaim 10, wherein the animal is a rodent.

18. The method of claim 10, wherein the animal is a rat.

19. The method ofclaim 10, wherein the animal is a human.

20. The method ofclaim 10, wherein the pharmacologically acceptable formulation has sleep enhancing activity.

21. The method of claim 10, wherein the pharmacologically acceptable formulation has alcohol craving reducing activity.

22. The method of claim 10, wherein the pharmacologically acceptable formulation has alcohol withdrawal reducing activity.

23. The method ofclaim 10, wherein the pharmacologically acceptable formulation has slow wave sleep enhancing activity.

24. The method of claim 10, wherein the pharmacologically acceptable formulation has growth hormone secretion enhancing activity.

25. The method ofclaim 10, wherein the pharmacologically acceptable formulation has stage IN sleep enhancing activity.

26. The method of claim 10, wherein the pharmacologically acceptable formulation has fibromyalgia palliating activity.

27. The method of claim 10, wherein the pharmacologically acceptable formulation has cancer palliating activity.

28. The method ofclaim 10, wherein the pharmacologically acceptable formulation has chronic fatigue palliating activity.

29. A method for screening a plurality of compounds so as to identify at least one compound exhibiting sleep enhancing activity, comprising:

(a) assessing the binding of a plurality of compounds to a human GHB receptor;

(b) selecting one or more compounds based on the results of (a) ; and

(c) testing such compounds for sleep enhancing activity.

30. The method of claim 29, wherein the binding of a plurality of compounds is assessed by a physiological response of a cell.

31. A pharmaceutical composition for the treatment of a GHB receptor related disorder comprising a therapeutically effective amount of (a) a candidate substance selected according to claim 1 and a pharmaceutically acceptable carrier, or (b) a pharmacologically acceptable formulation produced in accordance with claim 10.

32. A method of treatment comprising administering to a mammal an amount of the pharmaceutical composition ofclaim 31 sufficient to reduce or alleviate symptoms of a sleep disorder, to reduce or alleviate an alcohol craving, to reduce or alleviate alcohol withdrawal, to enhance slow wave sleep, to enhance growth hormone secretion, to enhance stage IN sleep, to treat fibromyalgia, to treat cancer, or to treat chronic fatigue in mammals.

33. A compound identified by the methods ofclaim 1, wherein the compound binds to the human GHB receptor polypeptide.

34. The compound ofclaim 33, wherein the compound is a GHB derivative.

35. The compound ofclaim 33, wherein the compound is a gamma butyrolactone derivative.

36. The compound ofclaim 33, wherein the compound is a gamma-valerolactone derivative.

37. The compound ofclaim 33, wherein the compound is a 1,4 butanediol derivative

38. The compound ofclaim 33, wherein the compound competes with GHB for binding to the human GHB receptor polypeptide.

39. The compound ofclaim 33, wherein the compound activates the human GHB receptor polypeptide.

40. The compound ofclaim 39, wherein the activity of the human GHB receptor polypeptide is the induction of a current across a cell membrane.

41. The compound of claim 33, wherein compound has human GHB receptor agonist activity in an animal.

42. The compound ofclaim 41, wherein the compound modulates behavioral activity of the animal.

43. The compound of claim 42, wherein the behavioral activity is locomotor activity.

44. The compound ofclaim 33, wherein the compound modulates EEG waveforms of the animal.

45. The compound of claim 33 , wherein the compound modulates EMG waveforms of the animal.

46. A method of manufacturing a formulation for use in the treatment of a GHB receptor- related disease, the method comprising manufacturing a substance selected according to claim 1 or claim 10 and formulating said substance in a pharmacologically acceptable formulation.