WO2004005442A1

WO2004005442A1 - Method for the production of conjugated polyunsaturated fatty acids comprising at least two double bonds in plants

Info

Publication number: WO2004005442A1
Application number: PCT/EP2003/006833
Authority: WO
Inventors: Andreas Renz; Martijn Gipmans; Ivo Feussner; Claudia Krüger; Ellen Hornung; Andrea Porzel
Original assignee: Basf Plant Science Gmbh
Priority date: 2002-07-03
Filing date: 2003-06-27
Publication date: 2004-01-15
Also published as: AU2003258496A1

Abstract

The invention relates to a method for producing conjugated polyunsaturated fatty acids comprising at least two, preferably three, double bonds in eukaryotes, especially plants, and a method for producing oils and/or triglycerides having an increased content of conjugated and/or unconjugated polyunsaturated fatty acids comprising at least two, preferably three, double bonds. The invention also relates to a method for producing conjugated linoleic acid in eukaryotes, especially plants, and a method for producing oils and/or triglycerides having an increased content of conjugated linoleic acid. Further disclosed are nucleic acid sequences, nucleic acid constructs, vectors, and organisms containing said nucleic acid sequences, nucleic acid constructs, and/or vectors. The invention finally relates to fatty acid mixtures and triglycerides having an increased content of conjugated and/or unconjugated polyunsaturated fatty acids comprising at least two, preferably three, double bonds, especially conjugated linoleic acid, and the use thereof.

Description

METHOD FOR THE PRODUCTION OF CONJUGATED MULTIPLE UNSATURATED FATTY ACIDS WITH AT LEAST TWO DOUBLE BINDINGS IN PLANTS

description

The present invention relates to a process for the production of conjugated polyunsaturated fatty acids with at least two advantageously three double bonds in eukaryotes, especially in plants, and a process for the production of oils and / or triglycerides with an increased content of conjugated and / or unconjugated polyunsaturated fatty acids with at least two advantageously three double bonds.

The present invention also relates to a process for the production of conjugated linoleic acid in eurkaryotes, especially in plants, and to a process for the production of oils and / or triglycerides with an increased content of conjugated linoleic acid.

The invention further relates to nucleic acid sequences; Nucleic acid constructs, vectors and organisms containing the nucleic acid sequences, nucleic acid constructs and / or vectors. In addition, the invention relates to fatty acid mixtures and triglycerides with an increased content of conjugated and / or unconjugated polyunsaturated fatty acids with at least two advantageously three double bonds, in particular conjugated linoleic acid, and their use.

Fatty acids and triglycerides have a large number of applications in the food industry, animal nutrition, cosmetics and in the pharmaceutical sector. Depending on whether it is free fatty acids or triglycerides with an increased content of saturated or unsaturated fatty acids, they are suitable for a wide variety of applications, for example polyunsaturated fatty acids are added to baby food to increase the nutritional value. The various fatty acids and triglycerides are mainly obtained from microorganisms such as Mortierella or Schizochytrium or from oil-producing plants such as soybean, rapeseed, sunflower and others, where they are generally obtained in the form of their triacylglycerides. But they are also advantageously obtained from animals such as fish. The free fatty acids are advantageously produced by saponification.

Depending on the application, oils with saturated or unsaturated fatty acids are preferred, e.g. In human nutrition, lipids with unsaturated fatty acids, especially polyunsaturated fatty acids, are preferred because they have a positive influence on the cholesterol level in the blood and thus on the possibility of heart disease. They are used in various dietary foods or medications.

The so-called conjugated unsaturated fatty acids are particularly valuable and sought-after unsaturated fatty acids. Conjugated polyunsaturated fatty acids are rare in nature compared to other polyunsaturated fatty acids. In plants, these conjugated fatty acids only come in individual species such as in the Euphorbiacease such as Aleurites fordii or in Calendula officinalis. There is no natural vegetable source for conjugated linoleic acid (CLA).

The chemical production of conjugated fatty acids, for example punicic acid or conjugated linoleic acid, is described in US 3,356,699 and US 4,164,505. CLA or other conjugated fatty acids can easily be obtained chemically via an alkaline isomerization from linoleic acid or linolenic acid or oils that contain linoleic acid or linolenic acid. Two reactions are catalyzed by the alkaline isomerization at temperatures of, for example, 180 ° C., on the one hand the hydrolysis of the fatty acid ester bond in the triglycerides and on the other hand the isomerization of the double bonds (WO 99/32604). Depending on the oil used, approx. 20 to 35% cis-9, trans-11 CLA and approximately equal amounts of trans-10, cis- 12 CLA are produced in this process. In addition to these main isomers, further isomers are formed. The various isomers can be further enriched by means of complex, expensive purification, for example by fractional crystallization. However, pure CLA isomers cannot be obtained in this way.

The production of conjugated linoleic acid by the enzymatic activity of a desaturase is described by Qiu et al., (Plant Physiology, 125, 2001, 847-855). A disadvantage of this activity, however, is that the enzymatic action produces the undesired 8,10-isomer of the conjugated linoleic acid.

Furthermore, a number of prokaryotic microorganisms have been described which occur in starter cultures or in the rumen of ruminants and which naturally produce CLA. CLA is presumably a degradation product of linoleic acid on the way to stearidonic acid. WO 99/29886 discloses bacteria for the enrichment of CLA in food and feed.

WO 99/32604 describes a linoleate isomerase from Lactobacillus reuteri. The enzyme activity leads to the conversion of linoleic acid into six different isomers of CLA [(cis, trans) -9.11-CLA, (trans, cis) -10.12-CLA, (cis, cis) -9.11-CLA, (cis.cis) - 10,12-CLA, (trans, trans) -9,11-CLA and (trans, trans) -10,12-CLA]. The disadvantage of this isomerase is that the yield in the reaction is low and the purity of the CLA is unsatisfactory. This leads to an economically unattractive process.

By Kepler et al. an isomerase from Butyrivibrio fibrisolvens (Kepler and Tovee, J. Biol. Chem., 1966, 241: 1350) and by Deng et al. one from Propionibacterium acnes (Deng et al., Ist International Conference on CLA, 2001, Alesund, Norway) was described. WO 99/29886 discloses and claims an isomerase from Bifidobacterium. The CLA isomerases described so far use free fatty acids as a substrate. The gene coding for CLA isomerase from Lactobacillus reuteri and Propionibacterium acnes was cloned and could be functionally expressed in prokaryotic microorganisms. Expression in eukaryotes has so far not been successful. The biological conversion of linoleic acid to CLA by microorganisms has qualitative advantages over the chemical conversion, but it is due to the fermentation costs economically disadvantageous and only provides free fatty acids, but no triglycerides.

Conjugated linoleic acid is an intermediate product of the linoleic acid metabolism in ruminants. CLA is a collective term for positional and structural isomers of linoleic acid, which are characterized by a conjugated double bond system on the carbon atom 8, 9, 10, 11, 12 or 13. Geometric isomers exist for each of these positional isomers, i.e. cis-cis, trans-cis, cis-trans, trans-trans. Especially C18: 2 cis-9, trans-11 and C18: 2 trans-10, cis-12 CLAs, which are the most biologically active isomers, are of particular interest because they have been shown to be cancer-preventive in animal experiments, anti-arteriosclerotic act and reduce body fat in humans and animals. Commercially, CLAs are mainly sold as free fatty acids.

For humans, the most important natural sources of CLA are primarily animal fats. As mentioned above, there are no vegetable sources. Fats from ruminant animals such as cattle (Chin, Journal of Food Composition and Ahalysis, 5, 1992: 185-197) and sheep, as well as dairy products, have very high CLA concentrations. Cattle have 2.9 to 8.9 mg / g fat. In contrast, vegetable oils, margarines and fats from non-ruminant animals have CLA concentrations of only 0.6 to 0.9 mg / g fat.

^{^} COOH (I)

Linoleic acid (18: 2, c9, c12)

OOH (II)

CLA (C18: 2, c9, t11)

^* COOH (III) CLA (C18: 2, t10, c12)

A number of positive effects have been demonstrated for CLA. For example, the administration of conjugated linoleic acid reduces body fat in humans and animals or increases the feed turnover per body weight in animals (WO 94/16690, WO 96/06605, WO 97/46230, WO 97/46118). By administering conjugated linoleic acid, allergies (WO 97/32008), diabetes (WO 99/29317) or cancer can also be positive (Banni, Carcinogenesis, Vol. 20, 1999: 1019-1024, Thompson, Cancer, Res., Vol 57, 1997: 5067-5072). Polyunsaturated fatty acids are also baby food for "increasing the nutritional value" and added as essential building blocks that ensure growth and brain development.

Few data are available on daily human CLA intake. In Germany, the daily CLA intake is approximately 0.36 g / day for women and 0.44 g / day for men [Fritsche et al., Zeitschrift Lebensmittel. Investigation Research A-Food Research & Technology 205: 415-418 (1997)].

As described above, CLA has very far-reaching positive nutritional effects. However, CLA naturally only occurs in significant quantities in ruminants and their products, such as milk, cheese, etc. There is therefore a great need for alternatives to the CLA derived from these animal sources, in particular to ensure a balanced and healthy diet in less developed regions where the supply of these animal fats is inadequate or synthetic production is too expensive. But even in developed regions, consumption of meat and dairy products has decreased to reduce the proportion of saturated fatty acids that are considered unhealthy. At the same time, this means a reduction in the intake of "healthy" CLA.

In contrast to CLA, conjugated polyenoic acids are not found in significant amounts in animal lipids, whereas in some vegetable oils they mainly occur as cis-trienes or tetraenes. Examples of such conjugated octadecatrienic acids are the eleostearic acid (= Eleostearic acid, 9c, 11t, 13t) from Aleurites fordii (Euphorbiaceae) or Prunus maheleb (= rock cherry), the punicic acid (9c, 11t, 13c) from Punica granatum, the calendulic acid (8t, 10t, 12c) from Calendula officialis (= marigold), the parinic acid (9c, 11t, 13t, 15c) from Parinarium sp. (Rosaceae) or Impatiens balsamina. Conjugated octadecatrienoic acids can also be isolated from marine algae such as the green algae Anadyomena stellata. These conjugated polyunsaturated fatty acids have great potential for use in foods, cosmetics and / or pharmaceuticals. For example, calendulic acid is already used as a component in many cosmetics.

In order to enable food and feed to be enriched with these conjugated polyenoic acids, in particular CLA, there is therefore a great need for a simple, inexpensive process for the production of these conjugated polyunsaturated fatty acids or for the production of conjugated linoleic acid.

The task was therefore to provide a corresponding method. This object was achieved by the methods described below, specifically by a method for producing conjugated polyunsaturated fatty acids with at least two double bonds in transgenic eurkaryotic organisms, characterized in that it comprises the following method steps: a) introducing at least one nucleic acid sequence selected from the group consisting of from SEQ ID NO: 1, SEQ ID NO: 3 or SEQ ID NO: 5 into an organism that produces unsaturated fatty acids; or b) introduction of at least one nucleic acid sequence which is derived by back-translation into a nucleic acid sequence from the amino acid sequence shown in SEQ ID NO: 2, SEQ ID NO: 4 or SEQ ID NO: 6 on the basis of the degenerated genetic code, or c) introduction of at least one derivative the nucleic acid sequence shown in SEQ ID NO: 1, SEQ ID NO: 3 or SEQ ID NO: 5, which code for polypeptides with the amino acid sequences shown in SEQ ID NO: 2, SEQ ID NO: 4 or SEQ ID NO: 6 and at least Have 90% identity at the amino acid level without the enzymatic action of the polypeptides being significantly changed, and d) expression of the nucleic acid in the organism produced according to (a), (b) or (c), and e) cultivation and harvesting of the according ), (b) or (c) produced organism.

The conjugated polyunsaturated fatty acids produced in the process according to the invention advantageously contain at least three double bonds. The fatty acids particularly advantageously contain two or three double bonds. In addition to the conjugated double bonds, further non-conjugated double bonds can also be contained in the fatty acid molecule. There can advantageously be two (= dienes) or three (= trienes) double bonds in conjugation. The fatty acids produced can contain up to 6 double bonds in the molecule. Fatty acids produced or reacted in the process advantageously have 18 to 22 carbon atoms in the fatty acid chain. Table 1 shows the substrates and the reaction products. C18 fatty acids are advantageously implemented. A preferred reaction product is the triene fatty acid 18: 3 (11E, 13E, 15Z), which is formed by reaction of the fatty acid 18: 3 (9Z, 12Z, 15Z). The configuration of the double bonds was determined by NMR analysis unless otherwise described. After reaction in the process according to the invention, the fatty acids advantageously contain two (= diene) or three (= triene) double bonds in conjugation. These can be contained in the reaction mixture as the only product or else in a mixture of conjugated double bonds, that is to say in the reaction mixture, conjugated triple and double bonds are simultaneously contained. In addition, further double bonds can be contained in the fatty acid molecule that are not in conjugation with the other double bonds. Two or three double bonds can advantageously be in conjugation.

An advantageous embodiment of the aforementioned method is a method for the production of conjugated linoleic acid in transgenic eurkaryotic organisms, characterized in that it comprises the following method steps: a) introduction of at least one nucleic acid sequence selected from the group consisting of SEQ ID NO: 1, SEQ ID NO : 3 or SEQ ID NO: 5 in an organism producing linoleic acid advantageously in an unsaturated fatty acid; or b) introduction of at least one nucleic acid sequence which is derived by back-translation into a nucleic acid sequence from the amino acid sequence shown in SEQ ID NO: 2, SEQ ID NO: 4 or SEQ ID NO: 6 on the basis of the degenerated genetic code, or c) introduction of at least one derivative the nucleic acid sequence shown in SEQ ID NO: 1, SEQ ID NO: 3 or SEQ ID NO: 5, which code for polypeptides with the amino acid sequences shown in SEQ ID NO: 2, SEQ ID NO: 4 or SEQ ID NO: 6 and at least Have 90% identity at the amino acid level without the enzymatic action of the polypeptides being significantly changed, or d) introduction of a nucleic acid sequence which is different from the prokaryotic codon usage of the nucleic acid sequences SEQ ID NO: 7, SEQ ID NO: 9 or SEQ ID NO: 11 by at least 0.5%, advantageously at least 1, 2, 3 or 5%, preferably at least 6, 7, 8, 9 or 10%, particularly preferably at least 20, 30, 40 or 50%, very particularly be preferably distinguishes at least 60, 70, 80 or 90% of a eukaryotic codon usage, or e) introducing a derivative of the nucleic acid sequences claimed under (d) by at least one, advantageously at least 2, preferably at least 3, particularly preferably at least 4 particularly preferably at least 5 - codon triplets advantageously at the 5 'end of the nucleic acid sequences necessary for a

Amino acid coding is extended without the enzymatic effect of the polypeptides encoded by the nucleic acids being significantly changed, and f) expression of the nucleic acid in the organism produced according to (a), (b), (c), (d) or (e) , and if applicable g) if appropriate, cultivation and harvesting of the organism produced according to (a), (b), (c), (d) or (e).

The abovementioned nucleic acids are advantageously used in the method according to the invention after their so-called codon usage for expression in eukaryotes has preferably been changed for expression in yeasts. Corresponding modifications have been made and can be seen from the examples.

Another embodiment of the invention is a process for the preparation of oils or triglycerides with an increased content of conjugated polyunsaturated fatty acids with at least two advantageously three double bonds, especially with an increased content of conjugated linoleic acid (= CLA), characterized in that the oils contained in the organism or the triglycerides contained in the organism are isolated from the organism. This can be done according to customary methods known to the person skilled in the art, which are used especially in fat chemistry. For example, by harvesting the transgenic organisms, the oils and triglycerides can be obtained either from the culture in which they grow or from the field. The further processing In the case of plants, for example, the plant seeds can preferably be pressed or extracted from the plant parts. The oils, fats, lipids and / or free fatty acids can be obtained by cold pressing or cold pressing without the addition of heat by pressing. To make it easier for the parts of the plant, especially the seeds, to be broken down, they are crushed, steamed or roasted beforehand. The seeds pretreated in this way can then be pressed or extracted with solvents such as cold or advantageously warm hexane or cyclohexane. The solvent is then removed again. In this way, more than 96% of the compounds produced in the process can be isolated. The products thus obtained are then processed further, that is to say refined. First, the plant mucilages and turbid substances. The so-called degumming can be carried out enzymatically or, for example, chemically / physically by adding acid such as phosphoric acid. The free fatty acids are then removed by treatment with a base, for example sodium hydroxide solution and / or potassium hydroxide solution. The product obtained is washed thoroughly with water to remove the lye remaining in the product and dried. In order to remove the dyes still contained in the product, the products are subjected to bleaching with, for example, bleaching earth or activated carbon. Finally, the product is deodorized with water vapor, for example. After isolation, the fatty acids contained in the oil or in the glycerides can subsequently be released by acidic or alkaline hydrolysis using methods known to those skilled in the art.

The term "glyceride" means a glycerol esterified with one, two or three carboxylic acid residues (mono-, di- or triglyceride). “Glyceride” is also understood to mean a mixture of different glycerides. The glyceride or -

Glyceride mixture may contain other additives, e.g. contain free fatty acids, antioxidants, proteins, carbohydrates, vitamins and / or other substances.

A “glyceride” in the sense of the method according to the invention is further understood to mean derivatives derived from glycerol. In addition to the fatty acid glycerides described above, these also include glycerophospholipids and glyceroglycolipids. Glycerophospholipids such as lecithin (phosphatidylcholine), cardiolipin, phosphatidylglycerol, phosphatidylserine and alkylacylglycerophospholipids may be mentioned here by way of example.

An embodiment of the invention is therefore oils, lipids or fatty acids or fractions thereof, which have been prepared by the process described above, particularly preferred are oils, lipids or fatty acid compositions which have an increased content of conjugated polyunsaturated fatty acids with at least two, advantageously three, double bonds include conjugated linoleic acid and originate from transgenic plants. The lipids advantageously consist essentially of glycerides, which in turn consist essentially of triglycerides. With increased content of conjugated and / or non-conjugated polyunsaturated fatty acids with at least two advantageously three double bonds are to be understood as meaning a content of conjugated polyunsaturated fatty acids with at least two advantageously three double bonds in the oils, lipids or fatty acid compositions (= fatty acid mixtures) which is preferably at least 10%, advantageously at least 20% at least 30%, particularly preferably of at least 40% and very particularly preferably of at least 50% is above the content of the eccaryotic starting organism which does not contain the nucleic acids used in the method according to the invention. In the case of transgenic plants, an increased content of conjugated and / or non-conjugated polyunsaturated fatty acids with at least two advantageously three double bonds advantageously means a content of conjugated and / or non-conjugated polyunsaturated fatty acids with at least two advantageously three double bonds such as calendulic acid, punicic acid, and electrostearic acid or CLA in the oils, lipids or fatty acid compositions (= fatty acid mixtures) which is at least 100%, advantageously at least 200%, preferably at least 250%, particularly preferably at least 300% and very particularly preferably at least 500% above the content of the starting plant lies that does not contain the nucleic acids used in the inventive method. The above-mentioned% data relate to the total amount of the oil, lipids or fatty acid mixtures in the starting organisms and not to other constituents in the organisms.

With the methods according to the invention conjugated polyunsaturated fatty acids with at least two advantageously three double bonds, especially CLA, can be produced in eukaryotic organisms such as yeasts, fungi or advantageously plants. In principle, production in non-human animals is also possible. In addition to these conjugated polyunsaturated fatty acids produced in the process, other unsaturated or saturated fatty acids can also be found in the oils. Lipids or fatty acid mixtures can be included.

Contents of the aforementioned conjugated polyunsaturated fatty acids or of CLA in the organisms of at least 1% by weight, advantageously at least 3% by weight, preferably at least 5% by weight, particularly preferably at least 10, are advantageous in the process % By weight, very particularly preferably of at least 20% by weight, based on the total fatty acids of the organism. The above weight percentages relate to the total amount of the oil, lipids or fatty acid mixtures and not to other constituents. In a further embodiment of the method according to the invention for the production of conjugated polyunsaturated fatty acids with at least two advantageously three double bonds with or in transgenic eurkaryotic organisms, the method is characterized in that it comprises the following method steps: a) introducing at least one nucleic acid sequence selected from the group consisting of from SEQ ID NO: 1, SEQ ID NO: 3 or SEQ ID NO: 5 into an organism producing unsaturated fatty acids; or b) introduction of at least one nucleic acid sequence which differs from the prokaryotic codon usage of the nucleic acid sequences SEQ ID NO: 7, SEQ ID NO: 9 or SEQ ID NO: 11 by at least 0.5% of a eukaryotic codon usage, or c) Introduction of at least one derivative of the nucleic acid sequences claimed under (b), which is extended by at least one codon triplet of the nucleic acid sequences which code for an amino acid, without the enzymatic action of the polypeptides coded by the nucleic acids having been significantly changed. d) expression of the nucleic acid in the organism produced according to (a), (b) or (c).

The conjugated polyunsaturated fatty acids with at least two advantageously three double bonds produced in the aforementioned process are advantageously conjugated linoleic acid.

A further embodiment according to the invention relates to a method for producing conjugated linoleic acid with or in transgenic eurkaryotic organisms, characterized in that it comprises the following method steps: a) introducing at least one nucleic acid sequence selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 3 or SEQ ID NO: 5 in a linoleic acid producing organism; or b) introducing at least one nucleic acid sequence which differs from the prokaryotic codon usage of the nucleic acid sequences SEQ ID NO: 7, SEQ ID NO: 9 or SEQ ID NO: 11 by at least 0.5% of a eukaryotic codon usage, or c ) Introduction of at least one derivative of the nucleic acid sequences claimed under (b), which is extended by at least one codon triplet of the nucleic acid sequences which code for an amino acid, without the enzymatic action of the polypeptides encoded by the nucleic acids having been significantly changed, d) expression the nucleic acid in the organism produced according to (a), (b) or (c). Advantageously, the nucleic acid sequences mentioned in each of the two aforementioned methods under point (b) have the least possible change in the codon usage, since these few changes already have the inventive effect, that is to say enable the expression of the nucleic acid sequences in the eurkaryotic organisms and there the fewer changes to the codon usage that have to be inserted into the sequences, the easier these sequences can be generated in vitro. The changes should advantageously be in a range from 0.5 to 99%, advantageously between 0.5 to 90%, preferably between 1 to 50%, particularly preferably between 1 to 40%, very particularly preferably between 1 to 20% of the entire sequence. These changes are preferably inserted at the amino terminus or 5 'end of the sequences. However, a change at another point is also possible, for example at the C terminus or within the sequence or at several points within the sequence.

The mRNA-instructed process of translation into a protein is influenced by the codon usage of each special organism. The function f (x) -> y, with x from the set of codons, the genetic code, y from the set of amino acids, is noted here, f is a function that maps each codon exactly to an amino acid. This mapping is not unambiguous in the sense of mathematics, that is, several codons code for the same amino acid. The genetic code is called degenerate because some amino acids are encoded by several (synonymous) codons. A specific tRNA does not exist for each codon, modified bases can be incorporated at position one of the anticodon and mismatches are permitted at the third position of the codon in the codon / anticodon complex (Crick's wobble rule). ^' The information content of the three base positions in the codon is not the same, the highest information content applies in position 2, followed by position 1 followed by position 3. Therefore a mutation of the third base in the codon often does not change the amino acid composition, a mutation in the first Base position often leads to the incorporation of an amino acid with similar properties, a mutation of the middle base often causes the incorporation of an amino acid with different properties. The least effects on the amino acid composition of the proteins thus have changes in the base composition in position three of the codon, followed by changes in the base composition in position one. Nevertheless, the genetic code is almost universal, but different codon assignments can be found, for example, in mitochondria, mycoplasma and some protozoa. The frequency with which codons occur in genes varies considerably between taxonomic groups. The codon preferences of E. coli and Salmonella typhimurium are relatively similar; the genus Bacillus, which is taxonomically distant from them, specifically the species B. subtilis, differ greatly from both. Within the genetic code, there are synonymous codons that code for the same amino acid. The use of these synonymous codons in the different organisms does not occur with a comparable frequency, that is, some are preferably incorporated. In addition, the codon frequencies vary within a species between different genes, depending on how strongly these genes are to be expressed. In certain genes, a subset of the codons occurs preferentially, depending on the species. As already mentioned, this distortion of the codon frequencies is positively correlated with the gene expression. Possible causes for this distortion of the codon frequencies are the different concentrations of the tRNAs, the maintenance of the maximum elongation rate, the cost of proofreading and different translation rates of the codons etc. This distortion of the codon frequencies is interpreted as a "strategy", the growth rates to optimize. Since different codon usage is used for the same amino acid in different organisms, i.e. the codons are mapped differently, there is a defined expression from an organ unpredictable surprises in another organism, that is, a sequence can suddenly be expressed significantly more or less or not at all. Despite the adaptation of the genetic code of the sequences to the host organism, the sequences are often not expressed. It was all the more unexpected that the sequences according to the invention were expressed after a change of approximately 0.5% of the codons. Since the genetic code is familiar to the person skilled in the art, as is the codon use of different genera and species, and since algorithms are available for the codon adaptation, it can adapt the sequence according to the invention to the condon usage of the host organism. Examples of such a translation can be found in the primers I and II used.

To improve the expression of the advantageous nucleic acids SEQ ID NO: 7, SEQ ID NO: 9 and SEQ ID NO: 11 used in the method in a transgenic (host) organism, the sequence is advantageously changed in such a way that the codon usage after Start codon is changed in such a way that it is optimally adapted to the codon usage of the eurkaryotic non-human organism used for expression and is thus optimally expressed. This change can advantageously be carried out with the aid of the following primers, the primers I advantageously being used for changing the bifidobacterium sequence (SEQ ID NO: 9) and the primers II advantageously being used for changing the lactobacillus sequence (SEQ ID NO: 11):

Primer I:

BBI-Kpnla: GGT ACC ATG GGT TAG TAC TCC TCC GGT AAC TAC GAA GCT

TTC GCT AGA CCA AAG AAG CCA GCT GGT GTT G (5'Primer)

BBI-Xholb: CTC GAG CAG ATC ACA TGG TAT TCG CGT AGC AG (3'Primer) Primer II:

LRI-EcoRla: GAA TTC ACC ATG GGT TAC TAC TCC AAC GGT AAC TAC GAA GCT TTC GCT AGA CCA AAG AAG CCA GCT GGT G (5'Primer)

LRI-Xholb: CTC GAG TTA TAG TAA GTG CTG TTG CTC CAT TAA TTC

(3'Primer) The primer used to change SEQ ID NO: 7 (propionibacterium sequence) can be found in the examples. The corresponding original amino acid sequences of the sequences SEQ ID NO: 7, SEQ ID NO: 9 and SEQ ID NO: 11 can be found in the sequences SEQ ID NO: 8, SEQ ID NO: 10 and SEQ ID NO: 12. With a corresponding procedure, the sequences SEQ ID NO: 1, SEQ ID NO: 3 and SEQ ID NO: 5 can also be changed further. This change in the codon usage adds an additional amino acid to the amino acid sequences (see SEQ ID NO: 4 and SEQ ID NO: 6), but the other amino acid sequence is retained. Furthermore, an interface is inserted into the nucleic acid (s) for a restriction enzyme. The change leads to the following changed nucleic acid sequences:

BBI (Bifidobacterium sequence): atgggttactactcctccggtaactacgaagctttcgctagaccaaagaagccagctggtgttg (modified)

atg - tactacagcagcggcaactatgaggcgtttgcccgtccgaagaagccagccggcgtag (Original) LRI (Lactobacillussequenz): atgggttactactccaacggtaactacgaagctttcgctagaccaaagaagccagctggtg (modified) atg - tattattcaaacgggaattatgaagcctttgctcgaccaaagaagcctgctggcg .. (original).

For a further embodiment of the invention it is advantageous for an optimal expression of heterologous genes in an organism to completely change the nucleic acid sequences in accordance with the specific "codon usage" used in the organism. This advantageously leads to a further increase in expression, in addition to the sequence change via the aforementioned primer.

The nucleic acid sequences described under point (c) advantageously have only one further codon triplet. This leads to an amino acid sequence of the isomerase being extended by one amino acid. In principle, it is also possible to change the sequence without extending the nucleic acid and amino acid sequence. In the present case, the codon GGT was introduced after the start codon ATG by the extension. The ATGG base sequence which is thereby formed is considered to be a consensus sequence which has an advantageous effect on translation, that is to say an advantageous effect on protein synthesis.

The organism produced in this way can then advantageously be grown and harvested as described above after cultivation. The oils, lipids and / or fatty acid mixtures contained in the organism can then be isolated and further treated as described.

Before cultivation and harvest or during cultivation, however, linoleic acid and / or linolenic acid and / or other polyunsaturated C ₈ -, C ₂₀ - and / or C ₂₂ fatty acids can advantageously be fed, so that the content of conjugated polyunsaturated is thereby Fatty acids with at least two advantageously three double bonds can advantageously be increased to CLA in the organism or in the culture medium of the organism. The organism produced according to (a), (b) or (c) can then be grown and harvested. In a further advantageous embodiment of the invention, however, it is also possible to harvest the organism produced according to (a), (b) or (c) directly or after cultivation and to convert linoleic acid with it either after digestion of the organism or without digestion and / or linolenic acid and / or further polyunsaturated C ₈ -, C ₂₀ - and / or C ₂₂ fatty acids to conjugated polyunsaturated fatty acids with at least two advantageously three double bonds advantageously to convert linoleic acid to CLA in vitro.

In the method according to the invention or in the methods according to the invention (the singular is intended to include the plural here), SEQ ID NO: 1 and their derivatives are preferably used.

Another embodiment of the invention is the use of the aforementioned oil, lipid or fatty acid composition in animal feed, food, cosmetics or pharmaceuticals.

In a further embodiment, the present invention therefore relates to a method for producing a food, dietary supplement, animal feed or pharmaceutical preparation, comprising the addition of a conjugated and / or non-conjugated trans / cis octadecadienoic acid, octadecatrienoic acid, octadecatetraenoic acid, eicosatrienoic acid , Eicosatetraenoic acid, eicosapentaenoic acid, docosatrienoic acid, docosatetraenoic acid, docosapentaenoic acid and / or docosahexaenoic acid for preparation. Preferably said trans / cis octadecatrienoic acid has a c9, t11, t10, c12 or 11E, 13E, 15Z configuration.

Furthermore, the present invention relates to a process for the production of individual biologically active isomers of the aforementioned fatty acids in advantageous plants. Individual biologically active CLA isomers can preferably be produced. The isomerase gene is advantageous either in unchanged form or in fusion with others

Gene fragments expressed so that the protein is either present in the cytosol, in the chloroplast or associated with membranes or is bound to oleosomes. The expression of the isomerases used can advantageously take place in all parts of the plant, such as roots, stems, leaves, flowers, buds or seeds, advantageously in the seeds of these plants.

The enzymatic activity of the heterologously expressed isomerases used in the process according to the invention converts the fatty acids used as the substrate (= educt) into the corresponding conjugated fatty acids. Two or more of the double bonds in the fatty acid molecules can be conjugated by the enzymatic reaction, two or three double bonds are advantageously conjugated to one another. Linoleic acid is advantageously converted into the c9, t11 or t10, c12-CLA isomer. In addition to these conjugated double bonds, other double bonds which are not in conjugation can also be present in the fatty acid molecule. In principle, however, all double bonds of a converted fatty acid molecule can also be in conjugation. The conjugated and / or non-conjugated fatty acids thus produced can enter the membranes of the plant cells and / or in various lipids, for example, be incorporated into the triglycerides and stored in the seed oil.

The present invention therefore also relates to a food, dietary supplement, animal feed or pharmaceutical preparation containing conjugated polyunsaturated fatty acids with at least two advantageously three double bonds specifically containing conjugated linoleic acid.

Preparations according to the invention are outstandingly suitable as a food or feed additive, e.g. in diets or on animal fattening. They can be used in combination or alone with a reduced calorie intake to support a diet, e.g. to reduce body weight in humans, which also has an advantageous effect on eating habits. The improved utilization of the increased food leads to a reduction in food consumption, which can be particularly advantageous in less developed regions with food shortages or in extreme situations (illnesses, competitive sports). Preparations according to the invention can also be used economically and ecologically advantageously in animal nutrition, in particular for reducing the amount of feed.

In addition to the conjugated polyunsaturated fatty acids with at least two advantageously three double bonds, especially the conjugated linoleic acid, various other saturated or unsaturated fatty acids e.g. Linoleic acid, linolenic acid, palmitic acid may be included. In particular, the proportion of the different fatty acids in the oils, lipids or fatty acid mixtures can vary depending on the production process. Every fatty acid pattern is encompassed by the preparation according to the invention, in particular fatty acid patterns which arise in the production of oil from vegetable material. It is preferred that the oils, lipids or fatty acid mixtures contain as little scatter as possible of different fatty acids or that the number of different fatty acids is small. In a further embodiment, the preparation mentioned contains further additives.

The term "additives" is understood to mean further additives which are advantageous for nutrition or health, e.g. "Nutrients" or "active ingredients". The preparation can contain one or more additives for animal or human nutrition or treatment and can be diluted or mixed therewith. Additives can be administered together with or separately from the feed, food, dietary supplement or pharmaceutical. A food, dietary supplement, animal feed or pharmaceutical preparation contains no additives or no amounts of additives which can be considered harmful to animal or human nutrition.

“Nutrients” are understood to mean additives which are advantageous for the nutrition of humans or animals. The accessory according to the invention preferably contains Therefore vitamins, for example vitamins A, B1, B2, B6, B12, C, D3, and / or E, folic acid, nicotinic acid, pantothenic acid, taurine, carboxylic acids, eg tricarboxylic acids, citrate, isocitrate, trans / cis aconitate , and / or homo-citrate, enzymes, eg phytases, carotenoids, minerals, eg P, Ca, Mg, Mn and / or Fe, proteins, carbohydrates, fats, amino acids and / or trace elements Sn. The preparation can also

Pyruvic acid, L-carnitine, lipoic acid, Coenzyme Q10, aminocarboxylic acids, e.g. Creatine.

"Active ingredients" are understood to mean those substances which support the use of the inventive preparation as a pharmaceutical or whose effect is used to treat diseases, in particular the treatment of cancer, diabetes, AIDS, allergies and cardiovascular diseases (see also below).

Consequently, the preparation according to the invention can also comprise preservatives, antibiotics, antimicrobial additives, antioxidants, chelating agents, inert gases, physiologically acceptable salts, etc. The person skilled in the art knows how to add the additives suitable for the particular use as a pharmaceutical, animal feed, food supplement or food additive to the preparation or to determine them by simple tests known in the prior art.

"Additives" are also understood to mean antioxidants. Antioxidants are e.g. advantageous to protect the double bonds of the fatty acids from oxidation. However, the general health-promoting effects of antioxidants are also known. For example, ethoxyquin is used as an antioxidant in animal nutrition, otherwise gamma and alpha tocopherols, tocotrienol, rosemary extract, naturally occurring polyphenols, e.g. Flavonoids, isoflavones and carotenoids are used. In a further embodiment, the preparation mentioned contains further polyunsaturated fatty acids (PUFAs). The term “fatty acid” is understood to mean an unbranched carboxylic acid with an even number of carbon atoms and 12 to 22 advantageously 16 to 22 carbon atoms. According to the invention, “unsaturated fatty acid” means a fatty acid with at least two double bonds. “Conjugated unsaturated fatty acid” is understood here to mean an unsaturated fatty acid with at least two advantageously three double bonds which are conjugated to one another. Preferably the preparation contains omega-3 fatty acids, e.g. Alphalinolenic acid, docosatrienic acid, docosatetraenoic acid, docosahexaenoic acid, docosapentaenoic acid, and / or eicosatrienoic acid, eicosatetraenoic acid, eicosapentaenoic acid, dimorphencolic acid, parinaric acid, and / or preferably conjugated linolenic acid.

Flavorings can also be added to the preparations mentioned.

In food, the preparation can be combined with common food components. These include vegetable but also animal products, in particular sugar, optionally in the form of syrups, fruit preparations, such as fruit juices, nectar, fruit pulps, purees or dried fruits; Cereal products and starches of the mentioned cereals; Dairy products such as milk protein, whey, yogurt, lecithin and milk sugar.

In one embodiment, the preparation according to the invention is suitable for use in animal nutrition and contains e.g. Aggregates. "Aggregates" are understood to mean substances which serve to improve the product properties, such as dust behavior, flow properties, water absorption and storage stability. Examples of such additives and / or mixtures thereof can be based on sugars e.g. Lactose or maltodextrin, based on cereal or legume products e.g. Corn spindle flour, wheat bran and soybean meal, based on mineral salts, etc. Calcium, magnesium, sodium, potassium salts or based on silicas such as silica gel.

The term "oil" or "fat" is understood to mean a fatty acid mixture which contains unsaturated, saturated, preferably esterified fatty acid (s). It is preferred that the oil or fat has a high proportion of unsaturated, conjugated and / or non-conjugated esterified fatty acid (s), in particular conjugated linoleic acid but also other unsaturated fatty acids such as γ-linolenic acid, dihomo-γ-linolenic acid, arachidonic acid, α - Has linolenic acid, stearidonic acid, eicosatetraenoic acid or eicosapentaenoic acid. The proportion of unsaturated conjugated and / or non-conjugated polyunsaturated esterified fatty acids with at least two advantageously three double bonds is approximately 30% by weight, more preferred is a proportion of 50% by weight, even more preferred is a proportion of 60 % By weight, 70% by weight, 80% by weight or more. For the determination e.g. the proportion of fatty acid after conversion of the fatty acids into the methyl esters can be determined by gas chromatography by transesterification. The oil or fat can also contain various other saturated or unsaturated fatty acids, e.g. CLA, palmitic, stearic, linoleic, linolenic, oleic acid etc. included. In particular, depending on the starting organism, especially the starting plant, the proportion of the different fatty acids in the oil or fat can fluctuate.

The conjugated and / or non-conjugated polyunsaturated fatty acids with at least two advantageously three double bonds produced in the process can be found in the eurkaryotic transgenic organisms in the form of their sphingolipids, phosphoglycerides, lipids, glycolipids, phospholipids, monoacylglycerol, diacylglycerol, triacylglycerol or other fatty acid glycerol or in the form of the free fatty acid. The conjugated and / or non-conjugated polyunsaturated fatty acids containing at least two advantageously three double bonds and / or further fatty acids, for example via an alkali treatment, for example aqueous KOH or NaOH or acid hydrolysis, can advantageously be obtained from the compounds prepared in the process according to the invention in the presence of an alcohol such as Release and isolate methanol or ethanol or via an enzymatic cleavage, for example by phase separation and subsequent acidification using, for example, H ₂ SO ₄ . The The fatty acids can also be released directly without the workup described above.

If the conjugated and / or non-conjugated polyunsaturated fatty acids produced in the process according to the invention are administered with at least two advantageously three double bonds in feed, they can be administered individually or in combination with other substances in the feed, the active compounds e.g. the above-mentioned fatty acids can be administered as pure substance or substance mixtures or liquid or solid extracts together with customary further feed ingredients or other active compounds such as vitamins, carotenoids etc. Examples of common feed ingredients are: maize, barley, wheat, oats, rye, tritale, sorghum, rice and bran, semolina as well as flours of these cereals, soybeans, soy products such as soybean meal, rapeseed, rapeseed meal, cottonseed and extraction meal, sunflower, sunflower extract, sunflower extract , Oilseed expeller, field beans, peas, gluten, gelatin, tapioca, yeast, single cell protein, fish meal, salts, minerals, trace elements, vitamins, amino acids, oils / fats and the like. Advantageous compositions are e.g. in Jeroch, H. et al. Nutrition of farm animals, UTB described.

The preparation according to the invention can be provided as a powder, granulate, pellet, extrudate with a coating ("coated") and / or as combinations thereof. The preparation of the animal feed according to the invention, for example by enveloping compounds, is used e.g. to improve product properties such as dust behavior, flow properties, water absorption and storage stability. Such preparations are widely known in the prior art. For example, in animal nutrition Blocks of a solid, cohesive, shape-retaining mass of several kilos are used.

Animal nutrition is composed in such a way that the corresponding nutrient requirements for the respective animal species are optimally covered. In general, vegetable feed components such as corn, wheat or barley meal, soybean bean meal, soy extraction meal, linseed meal, rapeseed meal, green meal or pea meal are chosen as raw protein sources. Soybean oil or other animal or vegetable fats are added to ensure an appropriate energy content of the feed. Since the vegetable protein sources only contain an insufficient amount of some essential amino acids, feed is often enriched with amino acids. This is mainly lysine,

Methionine and / or threonine. In order to ensure the mineral and vitamin supply to farm animals, minerals and vitamins are also added. The type and amount of minerals and vitamins added depends on the animal species and is known to the person skilled in the art (see, for example, Jerosch et al., Nutrition of Agricultural Animals, Ulmer, UTB). To cover the nutrient and energy requirements, complete feed can be used that contains all nutrients in a ratio that meets the needs of each other. It is the only animal feed. Alternatively, to one Grain feed from cereals can be given a supplementary feed. These are protein, mineral and vitamin-rich feed mixes that complement the grain feed in a meaningful way.

The invention further relates to a preparation according to the invention which is a medicament.

Improved food conversion, as has been observed for CLA, for example, and which can also be assumed for conjugated polyunsaturated fatty acids such as calendulic acid, can lead to a faster recovery, for example, in people or animals weakened by an illness. The medicament produced using the preparation according to the invention can therefore also be used to treat cancer, cardiovascular diseases, e.g. Atherosclerosis (MacDonald, J.J. American College of Nutrition, (2000) 19, 111S-118S), diabetes (WO99 / 29317), allergies and disease-accompanying diets can be used. It is therefore advantageous e.g. the use of the preparation mentioned for accelerated body building, e.g. after an extended illness associated with weight loss, e.g. chemotherapy, and to support or accelerate the recovery process.

The drug may also contain other active ingredients, e.g. the above or others. The active ingredients can be used to treat cancer, cardiovascular diseases, e.g. Atherosclerosis, diabetes, allergies and the support of diets serve or improve the effect of the preparation according to the invention. A drug for the treatment of diabetes can e.g. Contain insulin, sulfonylureas, sulfonamides, lipoic acid, γ-glucosidase inhibitors, thiazolidinediones, metformin and / or acetylsalicylic acid. Cancer diseases are e.g. by adding cytostatics such as vinca alkaloids, alkylating agents such as e.g. Chlorambucil, melphalan, thio-TEPA, C c-lophospamid, etc., by folic acid analogues such as aminopterin or methotrexate, or by the addition of immunosuppressants, e.g. Cyclophophosphamide and azathioprine, glucocorticoids, such as prednisolone, or cyclosporin treated. HIV infections or AIDS can e.g. can be treated by the administration of reverse transcriptase inhibitors and / or protease inhibitors. Allergies are e.g. treated by stabilizing the mast cells, e.g. by cromoglyxate, by blocking the histamine receptors, e.g. by H1 anithistamines, or by functional antagonists of the allergy mediators, e.g. with alpha-sympathomimetics, adrenaline, beta2-sympathomimetics, theophylline, ipratropium or glucocorticoids. Cardiovascular diseases are treated with the aid of anticoagulants, ACE inhibitors, cholesterol-lowering agents such as steatins and fibrates, niacin and cholestyramine.

The drug may comprise a pharmaceutically acceptable carrier. Examples of suitable pharmaceutically acceptable carriers are known in the prior art and include physiologically acceptable salts, for example phosphate-buffered salt solutions. solutions, water, emulsions such as oil / water emulsions, sterile solutions etc. Sterile solutions can be, for example, aqueous or non-aqueous solutions. Aqueous solutions are, for example, water, alcohol / water solutions, emulsions or suspensions and include sodium chloride solutions, Ringer's dextrose, dextrose and sodium chloride etc. Examples of non-aqueous solutions are propylene, glycol, polyethylene glycol, vegetable oils, organic esters, for example ethyl oleate. Furthermore, the medicament can comprise one of the suitable additives mentioned above.

Drugs can be administered orally or parenterally (subcutaneously, intravenously, intramuscularly, intraperotoneally) in the usual way. It can also be applied with steam or sprays through the nasopharynx.

The dosage depends on the age, condition and weight of the patient as well as the type of application. As a rule, the daily dose of active substance is between approximately 0.05 and 100 mg / kg body weight when administered orally and between approximately 0.01 and 20 mg / kg body weight when administered parenterally. 0.5 to 50 mg / kg are particularly preferred. The new preparations can be used in the customary pharmaceutical application forms, solid or liquid, e.g. as tablets, film-coated tablets, capsules, powders, granules, dragees, suppositories, solutions, ointments, creams or sprays. These are manufactured in the usual way. The active ingredients can be processed with the usual pharmaceutical auxiliaries such as tablet binders, fillers, preservatives, tablet disintegrants, flow regulators, plasticizers, wetting agents, dispersants, emulsifiers, solvents, retardants, antioxidants and / or propellants (see H. Sucker et al .: Pharmaceuticals Technology, Thieme-Verlag, Stuttgart, 1991). The administration forms obtained in this way contain active substances, including CLA or oil, normally in an amount of 0.1 to 90% by weight.

A medicament according to the invention can e.g. are produced by obtaining and formulating raw extracts from plants which contain conjugated polyunsaturated fatty acids such as CLA. Standard manufacturing processes for drugs are well known to those skilled in the art. Depending on the purpose, the amount of conjugated polyunsaturated fatty acids used with at least two advantageously three double bonds, such as trans / cis conjugated linoleic acid, must be adjusted. The amount of the aforementioned fatty acids used can e.g. Represent 0.01% or 0.1% of the amount of fat added to the diet. Also preferred are 0.5%, 1%, 2% or 3%, 5% or 10% of the conjugated and / or non-conjugated polyunsaturated fatty acids with at least two advantageously three double bonds. These quantities can also include other fatty acids.

In principle, all eukaryotic non-human organisms can be considered as the transgenic organism for the method according to the invention. Microorganisms such as fungi or yeasts or plants such as algae, moss, se, monocotyledons or dicotyledons used, these are advantageously oil-producing organisms. If plants are used in the process, they are advantageously so-called oil fruit plants, fruit plants, useful plants or other plants. The introduction of the nucleic acid (s) used in the method according to the invention [the plural is intended to include the singular for the invention described here and vice versa], the nucleic acid according to the invention, the nucleic acid construct or the vector in a eukaryotic transgenic organism, for example of a plant, can in principle be applied to all methods known to the person skilled in the art. For microorganisms, the person skilled in the art can use the corresponding textbooks from Sambrook, J. et al. (1989) Molecular cloning: A laboratory manual, Cold Spring Harbor Laboratory Press, by FM Ausubel et al. (1994) Current protocols in molecular biology, John Wiley and Sons, by DM Glover et al., DNA Cloning Vol. 1, (1995), IRL Press (ISBN 019-963476-9), by Kaiser et al. (1994) Methods in Yeast Genetics, Cold Spring Habor Laboratory Press or Guthrie et al. See Guide to Yeast Genetics and Molecular Biology, Methods in Enzymology, 1994, Academic Press.

The transfer of foreign genes into the genome of a plant is called transformation. The methods described for the transformation and regeneration of plants from plant tissues or plant cells for transient or stable transformation are used. Suitable methods are protoplast transformation by polyethylene glycol-induced DNA uptake, the use of a gene cannon, electroporation, the incubation of dry embryos in DNA-containing solution, microinjection and the gene transfer mediated by Agrobacterium. The methods mentioned are described, for example, in B. Jenes et al., Techniques for Gene Transfer, in: Transgenic Plants, Vol. 1, Engineering and Utilization, published by S.D. Kung and R. Wu, Academic Press (1993) 128-143 and in Potrykus Annu. Rev. Plant Physiol. Plant Molec. Biol. 42 (1991) 205-225). The construct to be expressed or the nucleic acid to be expressed is preferably cloned into a vector which is suitable for transforming Agrobacterium tumefaciens, for example pBin19 (Bevan et al., Nucl. Acids Res. 12 (1984) 8711). The transformation of plants with Agrobacterium tumefaciens is described, for example, by Höfgen and Willmitzer in Nucl. Acid Res. (1988) 16, 9877.

Agrobacteria transformed with an expression vector according to the invention can likewise be used in a known manner to transform plants such as test plants such as Arabidopsis and tobacco or crop plants, in particular oil-containing crop plants such as soybean, peanut, castor bean, sunflower, corn, cotton, flax, rapeseed, co coconut, oil palm, safflower (Carthamus tinctorius), canola, poppy seeds, mustard, hemp, olive, sesame, calendula, punica, evening primrose, mullein, thistle, wild roses, hazelnut, almond, macadamia, avocado, bay leaves, pumpkin, pistachios, borage, Walnut, wheat, rye, oats, triticale, rice, barley, cassava, pepper, tagetes, potato, tobacco, eggplant, tomato, pea, alfalfa, coffee, tea or cocoa bean are used, For example, by bathing wounded leaves or leaf pieces in an agrobacterial solution and then cultivating them in suitable media.

The genetically modified plant cells can be regenerated using all methods known to the person skilled in the art. Appropriate methods can be found in the above-mentioned writings by S.D. Kung and R. Wu, Potrykus or Höfgen and Willmitzer can be found.

In principle, all eukaryotic organisms which are able to synthesize fatty acids, especially unsaturated fatty acids or are suitable for the expression of recombinant genes are suitable as organisms or host organisms for the nucleic acid according to the invention, the nucleic acid construct or the vector. Examples include plants such as Arabidopsis, Asteraceae such as Calendula or crops such as soybean, peanut, castor oil, sunflower, corn, cotton, flax, rapeseed, coconut, oil palm, safflower (Carthamus tinctorius) or cocoa bean, microorganisms such as fungi, for example the genus Mortierella, Saprolegnia or Pythium, yeasts such as the genus Saccharomyces, algae or protozoa such as dinoflagellates such as crypthecodinium. Organisms which can naturally synthesize oils in large amounts, such as fungi such as Mortierella alpina, Pythium insidiosum or plants such as soybean, rapeseed, coconut, oil palm, safflower, castor bean, calendula, peanut, cocoa bean or sunflower or yeasts such as Saccharomyces cerevisiae, are particularly preferred soy, rapeseed, linseed, sunflower, calendula or Saccharomyces cerevisiae. In principle, transgenic non-human animals, for example C. elegans, are also suitable as host organisms.

After introduction into a plant cell or plant, the nucleic acids used in the method can either lie on a separate plasmid or be integrated into the genome of the host cell. When integrated into the genome, the integration can be random or by recombination such that the native gene or another native gene contained in the nucleic acid construct (see below) is replaced by the inserted copy, whereby the production of the desired compound by the cell is modulated, or by using a gene in trans, so that the gene is functionally linked to a functional expression unit which contains at least one sequence ensuring the expression of a gene and at least one sequence ensuring the polyadenylation of a functionally transcribed gene. The nucleic acids are advantageously introduced into the transgenic organisms such as plants via multi-expression cassettes or constructs for the multiparallel expression of genes. In the case of plants, seed-specific expression is advantageous.

Using cloning vectors in plants and in plant transformation, such as those published or cited in the following documents: Plant Molecular Biology and Biotechnology (CRC Press, Boca Raton, Florida), Chapter 6/7, Pp. 71-119 (1993); FF White, Vectors for Gene Transfer in Higher Plants; in: Transgenic Plants, Vol. 1, Engineering and Utilization, ed .: Kung and R. Wu, Academic Press, 1993, 15-38; B. Jenes et al., Techniques for Gene Transfer, in: Transgenic Plants, Vol. 1, Engineering and Utilization, ed .: Kung and R. Wu, Academic Press (1993), 128-143; Potrykus, Annu. Rev. Plant Physiol. Plant Molec. Biol. 42 (1991), 205-225)), the nucleic acids can be used for the genetic engineering modification of a broad spectrum of plants, so that this becomes a better or more efficient producer of one or more products derived from lipids, such as PUFAs specially conjugated and / or non-conjugated polyunsaturated fatty acids with at least two advantageously three double bonds. This improved production or efficiency of the production of a product derived from lipids, such as the aforementioned PUFAs, can be brought about by the direct effect of the manipulation or an indirect effect of this manipulation.

There are a number of mechanisms by which the modification of an isomerase protein can directly affect the yield, production and / or efficiency of the production of a fine chemical from an oil crop or a microorganism due to a modified protein. The number or activity of the isomerase protein or gene and of gene combinations of different isomerases can be increased, so that larger amounts of these compounds are produced de novo because the organisms lack this activity and ability to biosynthesize before the introduction of the corresponding gene. The same applies to the combination with other enzymes from the lipid metabolism. The use of different divergent, ie different sequences at the DNA sequence level, can also be advantageous, or the use of promoters for gene expression, which enables a different temporal gene expression, for example depending on the maturity level of a seed or oil-storing tissue. For the method according to the invention described, it is advantageous to additionally introduce at least one further nucleic acid into the organism in method step (a), which codes for a polypeptide with desaturase activity, selected from the group consisting of a Δ-5-desaturase, a Δ-6-desaturase, a Δ-8 desaturase or Δ-12 desaturase. For the process described for the production of oils and / or triglycerides with an increased content of conjugated polyunsaturated fatty acids with at least two advantageously three double bonds, for example from linoleic acid or linolenic acid, the isomerases mentioned (= SEQ ID NO: 2, SEQ ID NO: 4 , SEQ ID NO: 6) a further Δ-12-desaturase is advantageous, by means of which the amount of starting product of the isomerization reaction can be increased. In order to make a wide range of polyunsaturated fatty acids accessible, other genes for enzymes such as desaturase such as for a Δ-4-desaturase, a Δ-5-desaturase, a Δ-6-desaturase and / or a Δ-8-desaturase can advantageously be used or elongases such as a Δ-5 elongase, a Δ-6 elongase and / or Δ-9 elongase are introduced into the host organisms. The formation of conjudia and / or conjutrien fatty acids, for example from linoleic acid, linolenic acid and / or dihomo-γ-uenolenic acid, is particularly advantageously possible from oil seeds such as soya, sunflower, safflower or advantageously linseed, which provide inexpensive and easy access to conjudia and / or allow Konutrien due to their high content of linoleic acid and / or linolenic acid. In order to be able to use rapeseed, which has a high oleic acid content, advantageously for the process according to the invention, a further enzymatic activity (Δ-12-desaturase) must be introduced into the plant in addition to the isomerase.

Another aspect of the invention is an isolated nucleic acid sequence which codes for a polypeptide with isomerase activity, selected from the group: h) a nucleic acid sequence with the one in SEQ ID NO: 1, SEQ ID NO: 3 or

SEQ ID NO: 5 sequence, or i) a nucleic acid sequence which is derived by back-translation into a nucleic acid sequence from the amino acid sequence shown in SEQ ID NO: 2, SEQ ID NO: 4 or SEQ ID NO: 6 on the basis of the degenerated genetic code, or j) derivatives of the nucleic acid sequence shown in SEQ ID NO: 1, SEQ ID NO: 3 or SEQ ID NO: 5, for polypeptides with that shown in SEQ ID NO: 2, SEQ ID NO: 4 or SEQ ID NO: 6 Encode amino acid sequences and have at least 90% identity at the amino acid level, or k) a nucleic acid sequence which differs from the prokaryotic codon usage of the nucleic acid sequences SEQ ID NO: 7, SEQ ID NO: 9 or SEQ ID NO: 11 by at least 0.5%, advantageously at least 1, 2, 3 or 5%, preferably at least 6, 7, 8, 9 or 10%, particularly preferably at least 20, 30, 40 or 50%, very particularly preferably at least 60, 70, 80 or 90% of a eukaryotic codon usage differs, or

I) Derivatives of the nucleic acid sequences claimed under (d), which by at least one, advantageously at least 2, preferably at least 3, particularly preferably at least 4, very particularly preferably at least 5-

Codon triplets are advantageously extended at the 5 'end of the nucleic acid sequences which code for an amino acid, without the enzymatic action of the polypeptides encoded by the nucleic acids having been significantly changed. As described above, derivatives or functional derivatives of the sequence mentioned in SEQ ID NO: 1, SEQ ID NO: 3 or SEQ ID NO: 5 are to be understood, for example, as allelic variants which have at least 90% homology at the derived amino acid level, preferably at least 95% homology, particularly preferably at least 96, 97 or 98% homology, very particularly preferably 99; 99.5; 99.6; 99.7; 99.8; 99.9 or have 99.95% homology. The homology was calculated over the entire amino acid or nucleic acid sequence range. The PileUp program was used for sequence comparisons (J. Mol. Evolution., 25, 351-360, 1987, Higgins et al., CABIOS, 5 1989: 151-153) or the programs Gap and BestFit [Needleman and Wunsch (J. Mol. Biol. 48; 443-453 (1970) and Smith and Waterman (Adv. Appl. Math. 2; 482-489 (1981)], which are contained in the GCG software package [Genetics Computer Group, 575 Science Drive, Madison, Wisconsin, USA 53711 (1991)] The sequence homology values given above in percent were determined with the program BestFit over the entire sequence range with the following settings: gap weight: 8, length weight: 2. Under homology, identity is too for the present invention Both terms are synonymous. The amino acid sequences derived from the nucleic acids mentioned can be found in sequence SEQ ID NO: 2, SEQ ID NO: 4 or SEQ ID NO: 6. Allelic variants include, in particular, functional variants which can be deleted, inserted or substituted by Nucleotides from the in SEQ ID NO: 1, SEQ ID NO: 3 or SEQ ID NO: 5 can be obtained, the enzymatic activity of the derived synthesized proteins and the eukaryotic codon usage being retained.

Such DNA sequences can be derived from the DNA sequences described in SEQ ID NO: 1, SEQ ID NO: 3 or SEQ ID NO: 5 or parts of these sequences, for example using conventional hybridization methods or the PCR technique from other organisms isolate as mentioned above. These DNA sequences hybridize to the sequences mentioned under standard conditions. For the hybridization, short oligonucleotides, for example of the conserved regions, which can be determined by comparison with other isomerase genes known to the person skilled in the art, are advantageously used. However, longer fragments of the nucleic acids according to the invention or the complete sequences can also be used for the hybridization. These standard conditions vary depending on the nucleic acid used: oligonucleotide, longer fragment or complete sequence or depending on the type of nucleic acid DNA or RNA used for hybridization. For example, the melting temperatures for DNA: DNA hybrids are approx. 10 ° C lower than that of DNA: RNA hybrids of equal length. Standard conditions are understood to mean conditions as disclosed in this description above.

The nucleic acid sequences mentioned under point (b) advantageously have the least possible change in the codon usage, since these few changes already have the inventive effect, that is to say the expression of the nucleic acid sequences in the eurkaryotic organisms and the fewer changes in the codon -usage must be inserted into the sequences, the easier it is to generate these sequences in vitro. The changes should advantageously be in a range from 0.5 to 99%, advantageously between 0.5 to 90%, preferably between 1 to 50%, particularly preferably between 1 to 40%, very particularly preferably between 1 to 20% of the entire sequence lie. These changes are preferably inserted at the amino terminal end or 5 'end of the sequences. It is also a change is possible elsewhere, for example at the C-terminus or within the sequence or at several locations within the sequence.

The mRNA-instructed process of translation into a protein is influenced by the codon usage of each special organism. The function f (x) -> y, with x from the set of codons, the genetic code, y from the set of amino acids, is noted here, f is a function that maps each codon exactly to one amino acid. This mapping is not unambiguous in the sense of mathematics, that is, several codons code for the same amino acid. The genetic code is called degenerate because some amino acids are encoded by several (synonymous) codons. A specific tRNA does not exist for each codon, modified bases can be incorporated at position one of the anticodon and mismatches are permitted at the third position of the codon in the codon / anticodon complex (Crick's wobble rule). The information content of the three base positions in the codon is not the same, the highest information content applies in position 2, followed by position 1 followed by position 3. Therefore a mutation of the third base in the codon often does not change the amino acid composition, a mutation in the first base position often leads to the incorporation of an amino acid with similar properties, a mutation of the middle base often causes the incorporation of an amino acid with different properties. The least effects on the amino acid composition of the proteins thus have changes in the base composition in position three of the codon, followed by changes in the base composition in position one. Nevertheless, the genetic code is almost universal, but different codon assignments can be found, for example, in mitochondria, mycoplasma and some protozoa. The frequency with which codons occur in genes varies considerably between taxonomic groups. The codon preferences of E. coli and Salmonella typhimurium are relatively similar; the genus Bacillus, which is taxonomically distant from them, specifically the species B. subtilis, differ greatly from both. Within the genetic code, there are synonymous codons that code for the same amino acid. The use of these synonymous codons in the different organisms does not occur with a comparable frequency, that is, some are preferably incorporated. In addition, the codon frequencies vary within a species between different genes, depending on how strongly these genes are to be expressed. In certain genes, a subset of the codons occurs preferentially, depending on the species. As already mentioned, this distortion of the codon frequencies is positively correlated with the gene expression. Possible causes for this distortion of the codon frequencies are the different concentrations of the tRNAs, the maintenance of the maximum elongation rate, the costs for proofreading as well as different translation rates of the codons etc. This distortion of the codon frequencies is interpreted as a "strategy" which Optimize growth rates. Since different codon usage for the same amino acid is used in different organisms, i.e. the codons are shown differently, there are always unpredictable surprises when expressing a defined sequence originating from one organism in another organism, i.e. a sequence can suddenly become clear expressed more or less or not at all. Often takes place despite adjustment the genetic code of the sequences on the host organism no expression of the sequences. It was all the more unexpected that the sequences according to the invention were expressed after a change of approximately 0.5% of the codons. Since the genetic code is familiar to the person skilled in the art, as is the codon use of different genera and species, and since algorithms are available for adapting the codon, it can adapt the sequence according to the invention to the condon usage of the host organism. Examples of such a translation can be found in the primers I and II used.

To improve the expression of the nucleic acids SEQ ID NO: 7, SEQ ID NO: 9 and SEQ ID NO: 11 used in the method, the sequence is advantageously changed in a transgenic (host) organism in such a way that the codon usage changes the start codon is changed in such a way that it is optimally adapted to the codon usage of the eurkaryotic non-human organism used for expression and is thereby optimally expressed. This change can advantageously be carried out with the aid of the following primers, the primer I advantageously being used for changing the bifidobacterium sequence (SEQ ID NO: 9) and the primer II advantageously for changing the lactobacillus sequence (SEQ ID NO: 11) become:

Primer I:

BBI-Kpnla: GGT ACC ATG GGT TAC TAC TCC TCC GGT AAC TAC GAA GCT TTC GCT AGA CCA AAG AAG CCA GCT GGT GTT G (5'Primer)

BBI-Xholb: CTC GAG CAG ATC ACA TGG TAT TCG CGT AGC AG (3'Primer)

Primer II:

LRI-EcoRla: GAA TTC ACC ATG GGT TAC TAC TCC AAC GGT AAC TAC GAA GCT TTC GCT AGA CCA AAG AAG CCA GCT GGT G (5'Primer) LRI-Xholb: CTC GAG TTA TAG TAA GTG CTG TTG CTC CAT TAA TTC ( 3 'primer)

The primer used to change SEQ ID NO: 7 (propionibacterium sequence) can be found in the examples. The corresponding amino acid sequences of the sequences SEQ ID NO: 7, SEQ ID NO: 9 and SEQ ID NO: 11 can be found in the sequences SEQ ID NO: 8, SEQ ID NO: 10 and SEQ ID NO: 12. This change in codon usage inserts an additional amino acid into the amino acid sequences (see SEQ ID NO: 2, SEQ ID NO: 4 and SEQ ID NO: 6), but the other amino acid sequence is retained. Furthermore, an interface is inserted into the nucleic acid (s) for a restriction enzyme. The change leads to the following changed nucleic acid sequences: BBI (Bifidobacterium sequence): atgggttactactcctccggtaactacgaagctttcgctagaccaaagaagccagctggtgttg (modified) atg - tactacagcagcggcaactatgaggcgtttgcccgtccgaagaagccagccggcgtag (original)

LRI (Lactobacillus sequence): atgggttactactccaacggtaactacgaagctttcgctagaccaaagaagccagctggtg (modified) atg - tattattcaaacgggaattatgaagcctttgctcgaccaaagaagcctgctggcg .. (original). For a further embodiment of the invention, it is advantageous for an optimal expression of heterologous genes in an organism to completely change the nucleic acid sequences according to the specific "codon usage" used in the organism. This advantageously leads to a further increase in expression, in addition to the sequence change via the aforementioned primer. The nucleic acid sequences described under point (c) advantageously have only one further codon triplet. This leads to an amino acid sequence of the isomerase which is extended by one amino acid. In principle, it is also possible to change the sequence without extending the nucleic acid and amino acid sequence. In the present case, an extension for a restriction enzyme was inserted into the sequence. However, this interface can also be inserted outside the coding sequence.

Another embodiment of the invention is an amino acid sequence encoded by the aforementioned nucleic acid sequences SEQ ID NO: 1, SEQ ID NO: 3, or SEQ ID NO: 5 or their aforementioned derivatives. These amino acid sequences can be found in SEQ ID NO: 2, SEQ ID NO: 4 or.

Derivatives in the process according to the invention or to the nucleic acid according to the invention include, for example, functional homologs of the enzymes encoded by SEQ ID NO: 2, SEQ ID NO: 4 or SEQ ID NO: 6 or their enzymatic activity, i.e. To understand enzymes which catalyze the same enzymatic reactions as the enzyme encoded by SEQ ID NO: 1, SEQ ID NO: 3 or SEQ ID NO: 5. These genes also enable advantageous production of unsaturated conjugated fatty acids.

The nucleic acid sequences or fragments thereof used in the method according to the invention can advantageously be used to isolate further genomic sequences via homology screening. The derivatives mentioned can be isolated, for example, from other organisms such as rumen rumen microorganisms, the intestines of other animals or from starter cultures of dairy products or silages. Advantageous derivatives or homologs can be microorganisms such as fungi, yeasts, protozoa or bacteria such as gram-negative or gram-positive bacteria, preferably from gram-positive bacteria such as, for example, from the genera Propionibacterium, Lactococcus, Bifidobacterium or Lactobacillus, particularly preferably from the genera Isolate Lactobacillus or Bifidobacterium. Furthermore, derivatives or functional derivatives of the sequence mentioned in SEQ ID NO: 1, SEQ ID NO: 3 or SEQ ID NO: 5 mean, for example, allelic variants which have at least 90% homology at the derived amino acid level, preferably at least 95% homology, particularly preferably at least 96, 97 or 98% homology, very particularly preferably 99; 99.5; 99.6; 99.7; 99.8; 99.9 or 99.95% homology. The homology was calculated over the entire amino acid or nucleic acid sequence range. The PileUp program was used for sequence comparisons (J. Mol. Evolution., 25, 351-360, 1987, Higgins et al., CABIOS, 5 1989: 151-153) or the programs Gap and BestFit [Needleman and Wunsch (J. Mol. Biol. 48; 443-453 (1970) and Smith and Waterman (Adv. Appl. Math. 2; 482-489 (1981)], which are contained in the GCG software package [Genetics Computer Group, 575 Science Drive, Madison, Wisconsin, USA 53711 (1991)] The sequence homology values given above in percent were determined with the program BestFit over the entire sequence range with the following settings: gap weight: 8, length weight: 2. The homology comparison was carried out with the program under homology for the present invention to understand identity. Both terms are synonymous. The amino acid sequences derived from the nucleic acids mentioned can be found in sequence SEQ ID NO: 2, SEQ ID NO: 4 or SEQ ID NO: 6. Allelic variants include in particular functional variants which are characterized by Deletion, insertion or S Substitution of nucleotides from the sequence shown in SEQ ID NO: 1, SEQ ID NO: 3 or SEQ ID NO: 5 can be obtained, the enzymatic activity of the derived synthesized proteins and the eukaryotic codon usage being retained.

Such DNA sequences can be derived from the DNA sequences described in SEQ ID NO: 1, SEQ ID NO: 3 or SEQ ID NO: 5 or parts of these sequences, for example using conventional hybridization methods or the PCR technique from other organisms isolate as mentioned above. These DNA sequences hybridize to the sequences mentioned under standard conditions. For the hybridization, short oligonucleotides, for example of the conserved regions, which can be determined by comparison with other isomerase genes known to the person skilled in the art, are advantageously used. However, longer fragments of the nucleic acids according to the invention or the complete sequences can also be used for the hybridization. These standard conditions vary depending on the nucleic acid used: oligonucleotide, longer fragment or complete sequence or depending on the type of nucleic acid DNA or RNA used for hybridization. For example, the melting temperatures for DNA: DNA hybrids are approx. 10 ° C lower than that of DNA: RNA hybrids of equal length.

Under standard conditions, for example, depending on the nucleic acid, temperatures between 42 and 58 ° C in an aqueous buffer solution with a concentration between 0.1 to 5 x SSC (1 X SSC = 0.15 M NaCl, 15 mM sodium citrate, pH 7.2) or additionally in the presence of 50% formamide such as 42 ° C in 5 x SSC, 50% formamide. The hybridization conditions for DNA: DNA hybrids are advantageously 0.1 × SSC and temperatures between approximately 20 to 45 ° C., preferably between approximately 30 to 45 ° C. For DNA: RNA hybrids, the hybridization Conditions advantageous at 0.1 x SSC and temperatures between about 30 to 55 ° C, preferably between about 45 to 55 ° C. These specified temperatures for the hybridization are, for example, calculated melting temperature values for a nucleic acid with a length of approx. 100 nucleotides and a G + C content of 50% in the absence of formamide. The experimental conditions for DNA hybridization are described in relevant textbooks of genetics such as Sambrook et al., "Molecular Cloning", Cold Spring Harbor Laboratory, 1989, and can be made according to formulas known to the person skilled in the art, for example depending on the length of the nucleic acids, the type of hybrid or the G + C content. The person skilled in the art can obtain further information on hybridization from the following textbooks: Ausubel et al. (eds), 1985, Current Protocols in Molecular Biology, John Wiley & Sons, New York; Harnes and Higgins (eds), 1985, Nucleic Acids Hybridization: A Practical Approach, IRL Press at Oxford University Press, Oxford; Brown (ed), 1991, Essential Molecular Biology: A Practical Approach, IRL Press at Oxford University Press, Oxford.

Furthermore, derivatives include homologs of the sequences SEQ ID NO: 1, SEQ ID NO: 3 or SEQ ID NO: 5, for example advantageously prokaryotic homologs, shortened sequences, single-stranded DNA of the coding and non-coding DNA sequence or RNA of the coding and non-coding DNA Understand sequence. In addition, homologs of the sequences SEQ ID NO: 1, SEQ ID NO: 3 or SEQ ID NO: 5 are to be understood as derivatives such as promoter variants. These variants can be changed by one or more nucleotide exchanges, by insertion (s) and / or deletion (s), but without the functionality or effectiveness of the promoters being impaired. Furthermore, the effectiveness of the promoters can be increased by changing their sequence, or completely replaced by more effective promoters, including organisms of other species.

Derivatives are also advantageously to be understood as variants whose nucleotide sequence in the range from -1 to -2000 before the start codon has been changed such that the gene expression and / or the protein expression is changed, preferably increased. Derivatives are also to be understood as variants that have been changed at the 3 'end.

The isomerase gene can advantageously be combined in the process according to the invention with other genes of fatty acid biosynthesis. The combination with a Δ-12 desaturase is particularly advantageous. Derivatives of the amino acid sequences according to the invention are to be understood as proteins which have an amino acid sequence shown in SEQ ID NO: 2, SEQ ID NO: 4 or SEQ ID NO: 6 or a substitution, inversion, insertion or deletion of one or more amino acid residues Available sequence contain, wherein the enzymatic activity of the proteins shown in SEQ ID NO: 2, SEQ ID NO: 4 or SEQ ID NO: 6 is retained or is not changed significantly. These not significantly modified proteins are therefore still enzymatically active, that is, functional nell. Not significantly changed means all enzymes which still have at least 10%, preferably 20%, particularly preferably 30% of the enzymatic activity of the starting enzyme. Or their enzymatic activity is increased by at least 10%, preferably by 50%, particularly preferably by at least 100%, compared to the starting enzyme or the starting amino acid sequence. For example, certain amino acids can be replaced by those with similar physicochemical properties (space filling, basicity, hydrophobicity, etc.). For example, arginine residues are exchanged for lysine residues, valine residues for isoleucine residues or aspartic acid residues for glutamic acid residues. However, one or more amino acids can also be interchanged, added or removed in their order, or several of these measures can be combined with one another.

The nucleic acid constructs or fragments used in the method according to the invention are to be understood as sequences which contain at least one of the nucleic acid sequences SEQ ID NO: 1, SEQ ID NO: 3 or SEQ ID NO: 5 or which are the result of the genetic code by back-translation can be derived from SEQ ID NO: 2, SEQ ID NO: 4 or SEQ ID NO: 6 or contain derivatives of the sequences SEQ ID NO: 1, SEQ ID NO: 3 or SEQ ID NO: 5 and which advantageously with one or more regulation signals were functionally linked to increase gene expression. For example, these regulatory sequences are sequences to which inducers or repressors bind and thus regulate the expression of the nucleic acid. In addition to these new regulatory sequences or instead of these sequences, the natural regulation of these sequences may still be present before the actual structural genes and may have been genetically modified so that the natural regulation has been switched off and the expression of the genes increased. However, the gene construct (= nucleic acid construct) can also have a simpler structure, i.e. no additional regulatory signals have been inserted in front of the sequence or its derivatives and the natural promoter with its regulation has not been removed. Instead, the natural regulatory sequence was mutated so that regulation no longer takes place and gene expression is increased. These modified promoters can also be placed in front of the natural gene to increase activity. The gene construct can also advantageously contain one or more so-called "enhancer sequences" functionally linked to the promoter, which enable increased expression of the nucleic acid sequence. Additional advantageous sequences, such as further regulatory elements or terminators, can also be inserted at the 3 'end of the DNA sequences. The isomerase gene or the isomerase genes can be contained in one or more copies in the gene construct.

Advantageous regulatory sequences for the method according to the invention are, for example, in promoters such as cos, tac, trp, tet, trp-tet, Ipp, lac, Ipp-lac, lacl ^{q "} 'T7, T5- , T3-, gal-, trc-, ara-, SP6-, λ-P _R - or in the λ -P _L promoter, which are advantageously used in gram-negative bacteria and advantageously for the multiplication of nucleic acid in these organisms can be used. Partial regulatory sequences are, for example, in the gram-positive promoters amy and SPO2, in the yeast or fungal promoters ADC1, MFα, AC, P-60, CYC1, GAPDH, TEF, rp28, ADH or in the plant promoters such as CaMV / 35S [Franck et al., 1980, Cell 21: 285-294], PRP1 [Ward et al., Plant. Mol. Biol. 22 (1993)], SSU, OCS, Iib4, STLS1, B33, nos or in the ubiquitin promoter. Further advantageous plant promoters are, for example, one that can be induced by benzenesulfonamide (EP 388186), one that can be induced by tetracycline (Gatz et al., (1992) Plant J. 2, 397-404), one that can be induced by abscisic acid (EP335528) or one by ethanol or cyclohexanone inducible (WO9321334) promoter. Further plant promoters are, for example, the promoter of the cytosolic FBPase from potato, the ST-LSI promoter from potato (Stockhaus et al., EMBO J. 8 (1989) 2445-245), the promoter of the phosphoribosyl pyrophosphate amidotransferase from Glycine max (see also Genbank Accession Number U87999) or a node-specific promoter as in EP 249676 can advantageously be used. Plant promoters which ensure expression in tissues or parts of plants in which fat biosynthesis or its precursors take place are particularly advantageous. Promoters which ensure seed-specific expression, such as the usp promoter, the LEB4 promoter, the phaseolin promoter or the napin promoter, should be mentioned in particular. In principle, all natural promoters with their regulatory sequences such as those mentioned above can be used for the method according to the invention. In addition, synthetic promoters can also be used advantageously.

In addition to SEQ ID NO: 1, SEQ ID NO: 3, and / or SEQ ID NO: 5, other genes that can be found in the organisms can be found in the nucleic acid fragment (s) [= gene construct (s), nucleic acid construct (s)] as described above should be included. These genes can be under separate regulation or under the same regulatory region as the isomerase genes used in the method according to the invention. These genes are, for example, further biosynthesis genes advantageously in fatty acid biosynthesis. Advantageous fatty acid biosynthesis genes are selected from the group of nucleic acid sequences which are suitable for an acyl-CoA dehydrogenase, an acyl-ACP [= acyl carrier protein] desaturase, an acyl-ACP thioesterase, a fatty acid acyl transferase, a fatty acid synthase , a fatty acid hydroxylase, an acetyl-coenzyme A carboxylase, an acyl-coenzyme A oxidase, a fatty acid desaturase, a fatty acid acetylenase, a lipoxygenase, a triacylglycerol lipase, an alloxide synthase, a hydroperoxide lyase, encode a fatty acid transporter or a fatty acid elongase. The isomerase genes are advantageously used in the same nucleic acid construct as the other genes. A Δ-12 desaturase gene is preferably used as the further gene.

For expression in a host organism, for example a microorganism such as a fungus or a plant, the nucleic acid constructs according to the invention are advantageously inserted into a vector such as, for example, a plasmid, a phage or other DNA, which optimally expresses the genes in the host allows. Suitable plasmids are, for example, in E. coli pLG338, pACYC184, pBR322, pUC18, pUC19, pKC30, pRep4, pHS1, pHS2, pPLc236, pMBL24, pLG200, pUR290, plN-III ¹¹³ -B1, λgt11 or pBdCIJ36, in Streptomy , plJ702 or plJ361, in Bacillus pUB110, pC194 or pBD214, in Corynebacterium pSA77 or pAJ667, in mushrooms pALSI, plL2 or pBB116, in yeasts 2DM, pAG-1, YEp6, YEp13 or pEMBLYI23, or in plants pGBHGI23 ⁺ , pGBHGI23 ⁺ , pGBHGI23, pAK2004, pVKH or pDH51 or derivatives of the plasmids mentioned above. The plasmids mentioned represent a small selection of the possible plasmids. Further plasmids are well known to the person skilled in the art and can be found, for example, in the book Cloning Vectors (Eds. Pouwels PH et al. Elsevier, Amsterdam-New York-Oxford, 1985,

ISBN 0444 904018). Suitable plant vectors are described in "Methods in Plant Molecular Biology and Biotechnology" (CRC Press), Chap. 6/7, p.71-119.

In addition to plasmids, vectors are also understood to mean all other vectors known to the person skilled in the art, such as phages, viruses such as SV40, CMV, baculovirus, adenovirus, transposons, IS elements, phasmids, phagemids, cosmids, linear or circular DNA. These vectors can be replicated autonomously in the host organism or can be replicated chromosomally. Chromosomal replication is preferred.

Another aspect of the invention relates to vectors, e.g. recombinant expression vectors which contain at least one nucleic acid molecule used in the method according to the invention, and host cells into which these vectors have been introduced, in particular eukaryotic microorganisms, plant cells, plant tissues, plant organs or whole plants. In one embodiment, such a host cell can store the conjugated and non-conjugated polyunsaturated fatty acids produced with at least two advantageously three double bonds; the cells are harvested to isolate the desired compound. The compound (oils, lipids, triacylglycerides, fatty acids) can then be isolated from the medium or the host cell which contain or store the abovementioned polyunsaturated fatty acids, most preferably cells from storage tissues, such as in plants from cells of seed shells, tubers , Epidermal and sperm cells.

Yet another aspect of the invention relates to a genetically modified plant, preferably an oil fruit plant, as mentioned above, particularly preferably a linseed, sunflower, cotton or safflower body, into which an isomerase gene has been introduced. In one embodiment, the genome of linseed, rapeseed, soybean, sunflower, cotton or safflower has been changed as a transgene by introducing an isomerase gene which codes for a wild-type or mutated isomerase sequence. In a preferred embodiment, flax, sunflower, soybean or safflower is also used to produce a desired compound, such as lipids and fatty acids, with triene and / or dienes being particularly preferred and CLA being particularly preferred. The vector advantageously contains at least one copy of the nucleic acid sequence used in the method according to the invention and / or the nucleic acid construct according to the invention.

To increase the number of gene copies, the nucleic acid sequences or homologous genes can be incorporated, for example, into a nucleic acid fragment or into a vector which preferably contains the regulatory gene sequences assigned to the respective genes or promoter activity acting in an analogous manner. In particular, those regulatory sequences are used which increase gene expression.

Advantageously, the nucleic acid fragments for the expression of the further genes contained additionally contain 3 'and / or 5' terminaie regulatory sequences for increasing the expression, which are selected depending on the selected host organism and gene or genes for optimal expression.

These regulatory sequences are intended to enable targeted expression of the genes and protein expression. Depending on the host organism (= transgenic organism), this can mean, for example, ^" that the gene is only expressed and / or overexpressed after induction, or that it is immediately expressed and / or overexpressed.

The regulatory sequences or factors can preferably have a positive influence on the gene expression of the introduced genes and thereby increase it. Thus, the regulatory elements can advantageously be strengthened at the transcription level by using strong transcription signals such as promoters and / or "enhancers". In addition, an increase in translation is also possible, for example, by improving the stability of the mRNA.

In a further embodiment of the vector, the gene construct (= nucleic acid construct; the singular should also include the plural for the present description) can also advantageously be introduced into the organisms in the form of a linear DNA and integrated into the genome of the host organism via heterologous or homologous recombination become. This linear DNA can consist of a linearized plasmid or only of the nucleic acid fragment as a vector or the nucleic acid sequence used in the method according to the invention.

The nucleic acid sequence (the singular should also include the plural for the present description) is advantageously cloned together with at least one reporter gene into a nucleic acid construct which is introduced into the genome. This reporter gene should enable easy detection via a growth, fluorescence, chemo, bioluminescence or resistance assay or via a photometric measurement. Examples include reporter genes, antibiotic or herbicide resistance genes, hydrolase genes, fluorescence protein genes, bioluminescence genes, sugar or nucleotide metabolism genes or biosynthesis genes such as the Ura3 gene, the Ilv2 gene, the luciferase gene, the ß-galactosidase gene, the 2-desp-gene, the gfp gene, the gfp gene, 6-phosphate-phosphatase gene, the ß-glucuronidase gene, ß-lactamase gene, called the neomycin phosphotransferase gene, the hygromycin phosphotransferase gene or the BASTA (= gluphosinate resistance) gene. These genes enable the transcription activity and thus the expression of the genes to be measured and quantified easily. This enables genome sites to be identified that show different productivity. Furthermore, successful transformations can advantageously be identified with these reporter genes.

A nucleic acid construct for plants preferably contains regulatory sequences which can control the gene expression in plant cells and are operably linked so that each sequence can fulfill its function, such as termination of the transcription, for example polyadenylation signals. Preferred polyadenylation signals are those derived from Agrobacterium tumefaciens-t-DNA, such as gene 3 of the Ti plasmid pTiACHδ (Gielen et al., EMBO J. 3 (1984) 835ff.) Known as octopine synthase or functional equivalents thereof, but all other terminators that are functionally active in plants are also suitable. Since plant gene expression is often not restricted to transcriptional levels, a plant expression cassette preferably contains other functionally linked sequences, such as translation enhancers, for example the overdrive sequence, which is the 5'-untranslated leader sequence from tobacco mosaic virus which contains the protein / RNA Ratio increased (Gallie et al., 1987, Nucl. Acids Research 15: 8693-8711).

Plant gene expression, as described above, must be operably linked to a suitable promoter that performs gene expression in a timely, cell or tissue specific manner. Useful promoters are constitutive promoters (Benfey et al., EMBO J. 8 (1989) 2195-2202), such as those derived from plant viruses, such as 35S CAMV (Franck et al., Cell 21 (1980) 285-294), 19S CaMV (see also US 5352605 and WO 84/02913) or plant promoters, such as that of the small subunit of the Rubisco described in US 4,962,028.

Other preferred sequences for use for the functional connection in plant gene expression cassettes are targeting sequences which are necessary for the control of the gene product into its corresponding cell compartment (see an overview in Kermode, Grit. Rev. Plant Sei. 15, 4 (1996) 285 -423 and references cited therein), for example in the vacuole, the cell nucleus, all types of plastids, such as amyloplasts, chloroplasts, chromoplasts, the extracellular space, the mitochondria, the endoplasmic reticulum, oil bodies, peroxisomes and other compartments of plant cells.

Plant gene expression can also be facilitated as described above using a chemically inducible promoter (see an overview in Gatz 1997, Annu. Rev. Plant Physiol. Plant Mol. Bio!., 48: 89-108). Chemically inducible promoters are particularly suitable if it is desired that the gene expression be carried out in a time-specific manner. Examples of such promoters are a salicylic acid-inducible one Promoter (WO 95/19443), a tetracycline-inducible promoter (Gatz et al. (1992) Plant J. 2, 397-404) and an ethanol-inducible promoter.

Promoters that react to biotic or abiotic stress conditions are also suitable promoters, for example the pathogen-induced PRP1 gene promoter (Ward et al., Plant. Mol. Biol. 22 (1993) 361-366), the heat-inducible hsp80-

Promoter from tomato (US 5,187,267), the cold-inducible alpha amylase promoter from potato (WO 96/12814) or the wound-inducible pin III promoter (EP-A-0 375 091).

Those promoters which bring about gene expression in tissues and organs in which lipid and olbiosynthesis takes place, in sperm cells, such as the cells of the endosperm and the developing embryo, are particularly preferred. Suitable promoters are the Napingen promoter from rapeseed (US 5,608,152), the USP promoter from Vicia faba (Baeumlein et al., Mol Gen Genet, 1991, 225 (3): 459-67), the oleosin promoter from Arabidopsis ( WO 98/45461), the phaeolin promoter from Phaseolus vulgaris (US 5,504,200), the Bce4 promoter from Brassica (WO

91/13980) or the legumin B4 promoter (LeB4; Baeumlein et al., 1992, Plant Journal, 2 (2): 233-9) and promoters which promote seed-specific expression in monocot plants, such as maize, Bring barley, wheat, rye, rice, etc. Suitable noteworthy promoters are the barley lpt2 or lpt1 gene promoter (WO 95/15389 and WO 95/23230) or those described in WO 99/16890

(Promoters from the barley-hordein gene, the rice-glutelin gene, the rice-oryzin gene, the rice-prolamin gene, the wheat-gliadin gene, wheat-glutelin gene, the maize-zein gene , the oat-glutelin gene, the sorghum-kasirin gene, the rye-secalin gene). In particular, the multiparallel expression of the isomers used in the method alone or in combination with desaturases such as the Δ-12 desaturase may be desired. Such expression cassettes can be introduced via a simultaneous transformation of several individual expression constructs or preferably by combining several expression cassettes on one construct. Several vectors, each with a plurality of expression cassettes, can also be transformed and transferred to the host cell.

Promoters which bring about plastid-specific expression are also particularly suitable, since plastids are the compartment in which the precursors and some end products of lipid biosynthesis are synthesized. Suitable promoters, such as the viral RNA polymerase promoter, are described in WO 95/16783 and

WO 97/06250, and the Arabidopsis clpP promoter, described in WO 99/46394.

In a further advantageous embodiment, nucleic acid sequences used in the methods according to the invention can also be introduced into an organism alone. If, in addition to the nucleic acid sequence according to the invention, further genes are to be introduced into the organism, they can all be introduced into the organism together with a reporter gene in a single vector or each individual gene with a reporter gene in one vector, the different vectors being carried out simultaneously or successively can be introduced.

The host organism advantageously contains at least one copy of the nucleic acid sequence and / or the nucleic acid construct.

The introduction of the nucleic acids according to the invention, the nucleic acid construct or the vector into organisms, for example plants, can in principle be carried out by all methods known to the person skilled in the art.

For microorganisms, the person skilled in the art can use the corresponding textbooks from Sambrook, J. et al. (1989) Molecular cloning: A laboratory manual, Cold Spring Harbor Laboratory Press, by F.M. Ausubel et al. (1994) Current protocols in molecular biology, John Wiley and Sons, by D.M. Glover et al., DNA Cloning Vol.1, (1995), IRL Press (ISBN 019-963476-9), by Kaiser et al. (1994) Methods in Yeast Genetics, Cold Spring Habor Laboratory Press or Guthrie et al. See Guide to Yeast Genetics and Molecular Biology, Methods in Enzymology, 1994, Academic Press.

The transfer of foreign genes into the genome of a plant is called transformation. The methods described for the transformation and regeneration of plants from plant tissues or plant cells for transient or stable transformation are used. Suitable methods are protoplast transformation by polyethylene glycol-induced DNA uptake, the use of a gene cannon, electroporation, the incubation of dry embryos in DNA-containing solution, microinjection and the gene transfer mediated by Agrobacterium. The methods mentioned are described, for example, in B. Jenes et al., Techniques for Gene

Transfer, in: Transgenic Plants, Vol. 1, Engineering and Utilization, edited by S.D. Kung and R. Wu, Academic Press (1993) 128-143 and in Potrykus Annu. Rev. Plant Physiol. Plant. Molec. Biol. 42 (1991) 205-225). The construct to be expressed is preferably cloned into a vector which is suitable for transforming Agrobacterium tumefaciens, for example pBin19 (Bevan et al., Nucl. Acids Res. 12 (1984) 8711). The transformation of plants with Agrobacterium tumefaciens is described, for example, by Höfgen and Willmitzer in Nucl. Acid Res. (1988) 16, 9877.

Agrobacteria transformed with an expression vector according to the invention can also be used in a known manner to transform plants such as test plants such as Arabidopsis or crop plants, in particular oil-containing crop plants such as soybean, peanut, castor bean, sunflower, corn, cotton, flax, rapeseed, coconut, oil palm, Dyer safflower (Carthamus tinctorius) or cocoa bean can be used, for example by bathing wounded leaves, leaf pieces, hypocotyl pieces or roots in an agrobacterial solution and then cultivating them in suitable media. Using the Invitrogen GATE-WAY system for cloning, no more suitable interfaces in the vector are necessary.

In order to ensure stable integration of the isomerase genes into the transgenic plant over several generations, each of the nucleic acids used in the method, which code for the isomerase and / or the advantageous Δ-12-desaturase, should be expressed under the control of its own, preferably a different promoter , since repeating sequence motifs can lead to instability of the T-DNA or to recombination events earlier. The expression cassette is advantageously constructed in such a way that a promoter is followed by a suitable interface for inserting the nucleic acid to be expressed, advantageously in a polylinker, and then optionally a terminator behind the polylinker. This sequence is repeated several times, preferably three, four or five times, so that up to five genes are brought together in one construct and can thus be introduced into the transgenic plant for expression. The sequence is advantageously repeated up to two or three times. The nucleic acid sequences are inserted for expression via the suitable interface, for example in the polylinker behind the promoter. Each nucleic acid sequence advantageously has its own promoter and possibly its own terminator. However, it is also possible to insert several nucleic acid sequences behind a promoter and possibly in front of a terminator. The insertion point or the sequence of the inserted nucleic acids in the expression cassette is not of crucial importance, i.e. a nucleic acid sequence can be inserted at the first or last position in the cassette without the expression being significantly influenced thereby. Different promoters such as the USP, LegB4, DC3 or the ubiquitin promoter and different terminators can advantageously be used in the expression cassette. However, it is also possible to use only one type of promoter in the cassette. However, this can lead to undesirable recombination events.

As described above, the transcription of the introduced genes should advantageously be terminated by suitable terminators at the 3 'end of the introduced biosynthesis genes (behind the stop codon). Can be used e.g. the OCS1 terminator. As for the promoters, different terminator sequences should be used for each gene.

Suitable organisms or host organisms for the nucleic acids, nucleic acid constructs or vectors used in the method according to the invention are, in principle, all eukaryotic organisms, as have already been mentioned, which are able to synthesize fatty acids, especially unsaturated fatty acids or are suitable for the expression of recombinant genes. Examples include plants such as Arabidopsis, branches raceae such as Calendula, Punicaceae such as Punica granatum or crops such as soybean, peanut, castor oil, sunflower, corn, cotton, flax, rapeseed, coconut, oil palm, safflower (Carthamus tinctorius) or cocoa bean, microorganisms such as fungi, for example the genus Mortierella, Saprolegnia or Pythium Yeasts such as the genus Saccharomyces, algae or protozoa such as dinoflagellates such as Crypthecodinium. Organisms which can naturally synthesize oils in large quantities, such as fungi such as Mortierella alpina, Pythium insidiosum, or plants such as soybean, rapeseed, coconut, oil palm, safflower, castor bean, flax, calendula, peanut, cocoa bean or sunflower or yeasts such as Saccharomyces cerevisiae are preferred. Soybeans, rapeseed, sunflower, safflower, flax, calendula or Saccharomyces cerevisiae are particularly preferred. In principle, transgenic animals, for example C. elegans, can also be used as host organisms.

Transgenic in the sense of the invention means that the nucleic acids or nucleic acid constructs used in the method are not in their natural position in the genome of an organism, and the nucleic acids can be expressed homologously or heterologously. However, transgene also means that the nucleic acids or expression cassettes are in their natural place in the genome of an organism, but that the sequence has been changed compared to the natural sequence and / or that the regulatory sequences, the natural sequences, have been changed. Transgenic is preferably understood to mean the expression of the nucleic acids according to the invention at a non-natural location in the genome, i.e. homologous or preferably heterologous expression of the nucleic acids is present. Preferred transgenic organisms are the above-mentioned transgenic plants, preferably oil crop plants which contain large amounts of lipid compounds, such as oilseed rape, evening primrose, hemp, diesel, peanut, canola, flax, soybean, safflower, sunflower, borage, or plants such as

Corn, wheat, rye, oats, triticale, rice, barley, cotton, cassava, pepper, tagetes, solanaceae plants such as potatoes, tobacco, eggplant and tomato, Vicia species, peas, alfalfa, bush plants (coffee, cocoa, tea ), Salix species, trees (oil plant, coconut) as well as perennial grasses and fodder crops. Particularly preferred plants according to the invention are oil fruit plants such as soybean, peanut, rapeseed, canola, flax, hemp, evening primrose, sunflower, safflower, trees (oil palm, coconut).

The use of the nucleic acid sequences used in the process according to the invention or the nucleic acid construct for the production of transgenic eukaryotic organisms or transgenic plants is therefore also part of the subject matter of the invention.

A nucleic acid sequence selected from the group is advantageously used for the production of transgenic eukaryotic organisms or transgenic plants: a) nucleic acid sequence selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 3 or SEQ ID NO: 5, or b) nucleic acid sequence which is derived by back-translation into a nucleic acid sequence from the amino acid sequence shown in SEQ ID NO: 2, SEQ ID NO: 4 or SEQ ID NO: 6 on the basis of the degenerate genetic code, or c) derivatives of those in SEQ ID NO: 1, SEQ ID NO: 3 or SEQ ID NO: 5, which encode polypeptides with the amino acid sequences shown in SEQ ID NO: 2, SEQ ID NO: 4 or SEQ ID NO: 6 and have at least 90% identity at the amino acid level , without the enzymatic action of the polypeptides being significantly changed, or d) a nucleic acid sequence which differs from the prokaryotic codon usage of the nucleic acid sequences SEQ ID NO: 7, SEQ ID NO: 9 or SEQ ID NO: 11 by at least 0.5 %, advantageously at least 1, 2, 3 or 5%, preferably at least 6, 7, 8, 9 or 10%, particularly preferably at least 20, 30, 40 or 50%, very particularly preferably at least 60, 70, 80 or 90% of one eukaryotic codon -usage distinguishes, or e) derivatives of the nucleic acid sequences claimed under (d), which by at least one, advantageously at least 2, preferably at least 3, particularly preferably at least 4, very particularly preferably at least 5 codon triplets advantageously at the 5 'end of the nucleic acid sequences which are for encoding an amino acid is extended without the enzymatic effect of the polypeptides encoded by the nucleic acids being significantly changed.

Another object of the invention, as described above, is a process for the production of fatty acid mixtures with an increased unsaturated fatty acid content, characterized in that at least one nucleic acid sequence described above or at least one nucleic acid construct or vector is brought into a preferably oil-producing organism, attracts this organism and isolates the oil and / or triglyceride contained in the organism and releases the fatty acids contained in the oil and / or triglyceride.

A process for the preparation of oils and / or triglycerides with an increased content of conjugated and / or non-conjugated polyunsaturated fatty acids with at least two advantageously three double bonds, characterized in that at least one nucleic acid sequence described above or at least one nucleic acid construct or brings a vector into an oil producing organism, attracts this organism and isolates the oil contained in the organism is one of the objects of the invention.

Both methods advantageously enable the synthesis of fatty acid mixtures or triglycerides with an increased content of conjugated and / or non-conjugated polyunsaturated fatty acids with at least two advantageously three double bonds. Since this does not occur naturally in plants, they are from the Plants resulting oils, lipids and / or fatty acid mixtures new. The same applies to other eukaryotic organisms.

Examples of organisms for the processes mentioned are plants such as arabidopsis, soybean, peanut, castor bean, sunflower, maize, cotton, flax, rapeseed, coconut, oil palm, dyed savannah (Carthamus tinctorius) or cocoa bean, microorganisms such as fungi Mortierella, Saprolegnia or Pythium Yeasts such as the genus Saccharomyces, algae or protozoa such as dinoflagellates such as Crypthecodinium. Preference is given to organisms which can naturally synthesize oils in large amounts, such as fungi such as Mortierella alpina, Pythium insidiosum or plants such as soybean, rapeseed, coconut, oil palm, savory, castor bean, calendula, punica, peanut, cocoa bean or sunflower or yeasts such as Saccharomyces cerevisiae, soya, rape, sunflower, calendula, punica or Saccharomyces cerevisiae are particularly preferred.

Depending on the host organism, the organisms used in the processes are grown or cultivated in a manner known to those skilled in the art. Microorganisms are usually in a liquid medium that contains a carbon source mostly in the form of sugars, a nitrogen source mostly in the form of organic nitrogen sources such as yeast extract or salts such as ammonium sulfate, trace elements such as iron, manganese, magnesium salts and possibly vitamins, at temperatures between 0 and 100 ° C, preferably between 10 to 60 ° C attracted with oxygen. The pH of the nutrient liquid can be kept at a fixed value, i.e. regulated or not during cultivation. The cultivation can take place batchwise, semi batchwise or continuously. Nutrients can be introduced at the beginning of the fermentation or fed in semi-continuously or continuously. After transformation, plants are first regenerated as described above and then grown or cultivated as usual.

After culturing, the lipids are usually obtained from the organisms. For this purpose, the organisms can first be digested after harvesting or used directly. The lipids are advantageously extracted with suitable solvents such as apolar solvents such as hexane or ethanol, isopropanol or mixtures such as hexane / isopropanol, phenol / chloroform / isoamyl alcohol at temperatures between 0 to 80 ° C., preferably between 20 to 50 ° C. The biomass is usually extracted with an excess of solvent, for example an excess of solvent to biomass of 1: 4. The solvent is then removed, for example by distillation. The extraction can also be carried out with supercritical CO ₂ . After extraction, the remaining biomass can be removed, for example, by filtration.

The crude oil obtained in this way can then be further purified, for example by removing turbidity by adding polar solvents such as acetone or chloroform and then filtering or centrifuging. Further cleaning via columns is also possible. To obtain the free fatty acids from the triglycerides, they are usually saponified.

The invention is explained below using examples:

Examples Example 1: Cloning and expression of the CLA isomerase from Propionibacteium acnes in bacteria

The cDNA of the CLA isomerase from Propionibacterium acnes, which converts linoleic acid into the t10, c12-CLA isomer, was known from WO 01/00846 and was - using the following primers - via PCR with Pfu polymerase (Röche - Diagnostics) amplified and cloned into the pSE380 vector (Invitrogen):

Primer A: 5 '- ATC TGC AGA TGT CCA TCT CGA AGG AT - 3 "forward primer (with Pstl interface)

Primer B: 5 '- GCG AGC TCA CAC GAA GAA CCG CGT C - 3' Reverse Primer (with Sacl interface) The PCR reaction mixture was composed as follows: dNTP mix (IO mM) 1.0 μl

Forward primer (10 μM) 2.0 μl

Reverse primer (10 μM) 2.0 μl

Template (1/100 diluted genomic DNA from Propionibacterium acnes) * 1.0 ul

10-fold buffer 5.0 μl

Polymerase (3.5 U / µl) 0.5 µl

Water 38.5 ul

Total volume 50.0 μl

It was genomic DNA from Propionibacterium acnes ATCC 6919 from the

German collection of microorganisms and cell cultures (DSMZ, Braunschweig) used.

The following PCR program was used:

1.2 min 94 ° C

2. 30 sec 94 ° C

3. 1 min 62 ° C

4.2 min 72 ° C

5. 35 x 2nd to 4th

6.5 min 72 ° C The amplified DNA fragment was cut from a preparative agarose gel and eluted with the QiaQuick Gel Elution Kit (Qiagen). Both the PCR fragment and the pSE380 were cut with Pstl and Sacl and the open vector was additionally dephosphorylated with an alkaline phosphatase. Both DNA fragments were ligated to one another with the T4 ligase. The pSE-PAI construct produced in this way was amplified in E. coli and sequenced as a double-stranded control.

Example 2: Expression of a codon-optimized CLA isomerase from Propionibacterium acnes in yeast

In a first approach, the N-terminus of the isomerase was changed so that the first 60 base pairs of the coding sequence correspond to the optimal codon composition of the yeast. The modified cDNA was then cloned into a yeast expression vector and the functionality of the modified isomerase in yeast was checked.

A forward primer with a codon-optimized sequence was used to generate a codon-optimized Propionibacterium isomerase by means of PCR. The PCR was carried out using the Expand High Fidelity PCR system (Röche Diagnostics) using the following primers:

Primer C: 5 ^' - GAA TTC CAC CAT GGG TTC CAT TTC CAA GGA CTC CAG AAT TGC TAT TAT TGG TGC TGG CCC GGC CGG GCT GGC - 3 ^' Forward Primer (with EcoRI interface)

Primer D: 5 '- GCG GCC GCT CAC ACG AAG AAC CGC GTC ACC AG - 3 ^'

Reverse primer (with Notl interface)

By using the primer the following original sequence becomes: atg - tcc atc tcg aag gat tca cgt atc gcc atc atc ggg gct ggc ccg gcc ggg ctg gc

changed to the following modified sequence: atg ggt tcc att tcc aag gac tcc aga att gct att att ggt gct ggc ccg gcc ggg ctg gc

SEQ ID NO: 1 shows the optimized, modified overall sequence of the Propionibacterium acnes nucleic acid sequence. SEQ ID NO: 7, the original sequence can be found.

The PCR reaction mixture was composed as follows: dNTP mix (10 mM) 1.0 μl Forward primer (10 μM) 4.0 μl reverse primer (10 μM) 4.0 μl template (1/50 diluted pSE-PAl plasmid DNA) 1.0 μl 10-fold buffer 5.0 μl polymerase (3.5 U / μl) 0.5 μl water 34.5 μl total volume 50.0 μl

The following PCR program was used:

1. 2 min 94 ° C 2. 30 sec 94 ° C 3. 30 sec 51 ° C 4. 2 min 72 ° C 5. 10 x 2. to 4. 6. 30 sec 94 ° C 7. 30 sec 51 ° C 8. 2 min 72 ° C, time increment 5 sec per cycle 5. 15 x 6th to 8th 6th 5 min 72 ° C

The amplified DNA fragment was cut from a preparative agarose gel, eluted with GFXTM PCR DNA and Gel Band Purification Kit (Amersham Bioscience) and cloned into the pGEM-T vector (Promega) according to the manufacturer's instructions. After amplification of the plasmid DNA in E. coli, the codon-optimized isomerase cDNA was ligated into the likewise cut vector pYES2 via the EcoRI and NotI interfaces. The pY2-coPAI construct thus produced was amplified in E. coli and for yeast expression in the yeast strain INVSd (Invitrogen) with the LiAc method - (Ausubel et al., Current Protocols in Molecular Biology, John Wiley & Sons, New York, 1995).

a) Expression in yeast cells

All solid and liquid media for yeast were prepared according to protocols from Ausubel et al. (Current Protocols in Molecular Biology, John Wiley & Sons, New York, 1995).

The expression of coPAl in S. cerevisiae INVSd was modified according to Avery et al. (Appl. Environ. Microbiol., 62, 1996: 3960-3966) and Girke et al. (The Plant Journal, 5, 1998: 39-48). In order to prepare a starter culture, 20 ml of SD medium with glucose and amino acid / base solution without uracil were inoculated for selection with a single yeast colony and incubated overnight at 30 ° C. and 140 rpm. The cell culture was washed twice by centrifuging and resuspending in SD medium without supplements and without sugar. A main culture was inoculated with the washed cells to an OD600 of 0.1 to 0.3. The main culture was grown in 25 ml SD medium with 2% (w / v) galactose, amino acid / base solution without uracil for selection, 0.02% linoleic acid (2% stock solution in 5% Tergitol NP40), 10% Tergitol NP40 for 72 hours at 30 ° C. The main culture was harvested by centrifugation (10 min, 4000 rpm, 4 ° C.). The cell pellet was frozen at -20 ° C and then lyophilized for at least 18 hours. b) Lipid extraction of the fatty acids from transgenic yeast

The lyophilized yeast pellets were extracted in 1.35 ml of methanol / toluene (2: 1) and 0.5 ml of sodium methoxide solution. The cell material was ground up as finely as possible with a glass rod and then incubated for 1 hour at room temperature with shaking. Then 1.8 ml of 1 M NaCl solution and 3 ml of n-heptane were added and incubated for 10 min at RT with shaking. After phase separation by centrifugation (10 min, 4000 rpm, 4 ° C) the heptane supernatant was transferred to a test tube and evaporated under nitrogen. The residue was taken up in 3 times 0.3 ml of hexane, transferred to an Eppendorf tube and again evaporated under nitrogen. The residue was taken up in 50 μl acetonitrile and the sample was analyzed by GC or GC / MS. c) Extraction of the free fatty acids from transgenic yeast

The P. acnes isomerase takes free linoleic acid as the substrate. In order to demonstrate whether the t10, c12-CLA isomer occurs in the pool of free fatty acids after expression of the coPAl in yeast cells, the free fatty acids were extracted using the HIP method, methylated with methanol and then detected by GC or GC / MS.

For the HJP extraction, the yeast pellet was placed in 15 ml HIP buffer (hexane / isopropanol 3: 2 (v / v) with 0.0025% BHT (2,6-di-tert-butyl-4-methylphenol) ) recorded and homogenized as finely as possible with a glass rod. After addition of 75 μl of 1 M HCl, the mixture was incubated for 5 min at RT with shaking. After phase separation by centrifugation (10 min, 4000 rpm, 4 ° C), the supernatant was transferred to a new centrifuge tube, made up to 22.5 ml with a K ₂ SO ₄ solution (66.6 g K ₂ SO / 1 H ₂ O) and again incubated for 5 min at RT with shaking. After another phase separation by centrifugation (5 min, 4000 rpm, 4 ° C), the supernatant was transferred to a new test tube and evaporated under nitrogen. The residue was transferred into a new Eppendorf tube with 2 × 1 ml of hexane and again evaporated under nitrogen. Ultimately, the residue was taken up in 400 ul methanol.

To methylate the extracted free fatty acids, the extracted sample in 400 μl of methanol was mixed with 10 μl of EDAC solution (N- (3-dimethylaminoproyl) -N ^" -ethylcarbodiimide hydrochloride, 1 mg in 10 ml of methanol) and shaken for 2 h at RT After adding 200 μl of 0.1 M Tris / HCl solution, pH 7.5, and also 1 ml of hexane, the mixture was thoroughly mixed by vortexing and centrifuged (5 min, 12000 rpm, RT) the upper phase was transferred to a new microcentrifuge tube. The mixture was extracted again with 1 ml of hexane, both hexane phases combined and evaporated under nitrogen. The residue was taken up in 40 μl acetonitrile. d) GC analysis

For GC analysis of the fatty acid methyl esters (FAME), 7 μl of the sample (in acetonitrile) was transferred to a sample tube and 1 μl was injected. The GC analysis was carried out using an HP-DB23 (cross-linked PEG; 30 m × 0.32 mm × 0.5 μm coating thickness) at a flow rate of 1.5 ml / min. Helium served as the carrier gas. The injection temperature was 220 ° C. The following temperature gradient was applied: 1 min 150 ° C, 150 ° C to 200 ° C (with 15 ° C / min), 200 ° C to 250 ° C (with 2 ° C / min), 5 min 250 ° C. The FAME was detected using a flame ionization detector (FID) at 275 ° C. The retention times for conjugated linoleic acid 10c, 12-CLA were 14.3 min. The retention times were 12.68 min for linoleic acid and 11.86 min for oleic acid.

results

1 shows the production of t10, c12-CLA in yeast cells (yeast expression PAI - transmethylated), which were transformed with the codon-optimized CLA isomerase from Propionibacterium acnes (= PAI isomerase or PAI for short). 1A shows the gas chromatogram of the lipid extracts from yeast cells which have been transformed with the empty vector pYES2. The cells were grown for 72 hours at 30 ° C with 0.02% linoleic acid. The gas chromatogram shows no FAME with a retention time of t10, c12-CLA. 1B shows the gas chromatogram of the lipid extracts from yeast cells transformed with pY2-coPAI. The cells were again grown for 72 hours at 30 ° C with 0.02% linoleic acid. The gas chromatogram has a clear peak with a retention time of 14.37 min, which does not occur in the control batch (see FIG. 1A) and has the same retention time as t10, c12-CLA (see FIG. 1C). The expression was carried out in the INVSd strain, which was grown on linoleic acid at 30 ° C. for 3 days, and then the fatty acids were transmethylated.

Figure 2 shows the presence of the t10, c12-CLA isomer in the free fatty acid pool. 2A shows the gas chromatogram of the methylated fatty acids from yeast cells which were transformed with the empty vector pYES2. The cells were grown for 72 hours at 30 ° C with 0.02% linoleic acid. The gas chromatogram shows no FAME with a retention time of t10, c12-CLA. 2B shows the gas chromatogram of the methylated fatty acids from yeast cells transformed with pY2-coPAl. The cells were again grown for 72 hours at 30 ° C with 0.02% linoleic acid. The gas chromatogram has a clear peak with a retention time of 14.29 min, which does not occur in the control batch (see FIG. 2A) and has the same retention time as the t10, c12-CLA isomer (see FIG 2C). The expression took place in the INVSd strain, which was grown on linoleic acid at 30 ° C. for 3 days, and then the fatty acids were methylated.

Table 1 shows the results of the GC analyzes. The empty control shows the fatty acid composition of transgenic yeast cells, which with the empty pYES Vector were transformed. PAI 4.3.1, PAI 4.3.2, PAI 6.1.1 and PAI 6.1.2 correspond to independent repeats of coPAI expression in transgenic yeast cells. Experiment A shows the FAME analyzes of the lipids after incubation for 72 h at 30 ° C with 0.02% linoleic acid. Experiment B shows the FAME analyzes of the free fatty acids after incubation for 72 h at 30 ° C with 0.02% Linoleic acid. Experiment C shows the FAME analyzes of the lipids after incubation for 10 days at 16 ° C. with 0.02% linoleic acid.

The results shown in FIG. 1, FIG. 2 and Table 1 show that the codon-optimized isomerase from P. acnes leads to the formation of t10, c12-CLA in yeast by the conversion of linoleic acid. The detection of t10, c12-CLA from transformed yeast cells was achieved after hydrolysis of the lipids. Since yeast contains hardly any triacylglycerides, it must be assumed that the majority of the t10, c12-CLA detected in this way was bound in the yeast phopholipids. Detection of t10, c12-CLA from transformed yeast cells was also successful after extraction and methylation of the free fatty acids. This indicates that the coPAl in transgenic yeast cells also use the free fatty acids as a preferential substrate.

Example 3: Expression of the isomerase from Propionibacterium acnes in yeast

In order to demonstrate the functionality of the Propionibacterium acnes isomerase (PAI) cDNA from the WO 01/00846 application in a eukaryotic organism, the coding region of the cDNA of PAI was cloned into a yeast expression vector and expressed in S. cerevisiae. The isomerase produced in the yeast should convert added linoleic acid into the t10, c12-CLA isomer. This in turn should be demonstrated in transmethylated lipid extracts as well as in methylated yeast extracts using GC and GC / MS as methyl esters. The PAI cDNA was amplified via PCR using the Expand High Fidelity PCR system (Röche Diagnostics) using the following primers and cloned into the pYES2 vector:

Primer C: 5 ^' - CAG ACA TAT GTC CAT CTC GAA GGA TTC - 3 Forward Primer (with Ndel interface) Primer D: 5' - CTA TCT CGA GTC ACA CGA AGA ACC GCG TC - 3 ^' Reverse Primer (with Xhol interface)

The PCR reaction mixture was composed as follows: dNTP mix (10 mM) 1.0 μl

Forward primer (10 μM) 4.0 μl reverse primer (10 μM) 4.0 μl template (1/50 diluted pSE-PA1 plasmid DNA) 1.0 μl

10-fold buffer 5.0 μl Polymerase (3.5 U / µl) 0.5 µl

Water 34.5 ul

Total volume 50.0 μl

The following PCR program was used:

1.2 min 94 ° C

2. 30 sec 94 ° C

3. 30 sec 51 ° C

4.2 min 72 ° C

5. 10 x 2nd to 4th

10 6. 30 sec 94 ° C

7. 30 sec 51 ° C

8. 2 min 72 ° C, time increment 5 sec per cycle

9. 15 x 6th to 8th

10. 5 min 72 ° C

15 The amplified DNA fragment was cut from a preparative agarose gel, eluted with GFX ™ PCR DNA and Gel Band Purification Kit (Amersham Bioscience) and cloned into the pGEM-T vector (Promega) according to the manufacturer's instructions. After amplification of the plasmid DNA in E. coli, the isomerase cDNA was cut out over the Ndel and Xhol interfaces and the cDNA ends with the T4-

20. Polymerase smoothed. The pYES2 vector was opened with EcoRI, the cDNA ends - smoothed with the T4 polymerase and dephosphorylated with an alkaline phosphatase. Both DNA fragments were alloyed with each other using the T4 ligase and the direction of insertion was checked by a BamHI digest. The pY2-PAI construct thus produced was amplified in E. coli and for yeast expression in the yeast strain

25 INVSd (Invitrogen) was transformed with the LiAc method (Ausubel et al., Current Protocols in Molecular Biology, John Wiley & Sons, New York, 1995). a) Expression in yeast cells

The expression of PAI in S. cerevisiae INVSd was carried out as described above, modified according to Avery et al. (Appl. Environ. Microbiol., 62, 1996: 3960-3966) and Girke et 30 al. (The Plant Journal, 5, 1998: 39-48). b) Lipid extraction of the fatty acids from transgenic yeast

The lyophilized pellets from transgenic pY2-PAI yeast cells were extracted as described in Example 2. c) Extraction of the free fatty acids from transgenic yeast

35 The free fatty acids from transgenic pY2-PAI yeast cells were extracted as described in Example 2 using the HIP method, metήylated and then detected by GC or GC / MS. d) GC analysis

The GC analysis was carried out as described in Example 2 above.

results

In example 2 it was shown that the codon-optimized isomerase from Propionibacterium acnes (coPAl), when expressed in yeast cells, can convert the added linoleic acid into the t10, c12-CLA isomer. In analogous experiments with the PAI from WO 01/00846 it was also possible to show a conversion of linoleic acid into the t10, c12-CLA isomer in transgenic yeast cells, albeit to a much lesser extent. We therefore show that the codon optimization can significantly increase the expression of an active isomerase protein, which can convert linoleic acid into t10, c12 CLA, in a eukaryotic cell such as S. cerevisiae.

4 shows the production of t10, c12-CLA in yeast cells (yeast expression PAI - transmethylated), which were transformed with the bacterial CLA isomerase from Propionibacterium acnes (= PAI isomerase or briefly bakt.PAl). 4A shows the gas chromatogram of the lipid extracts from yeast cells which were transformed with the empty vector pYES2. The cells were grown for 72 hours at 30 ° C with 0.02% linoleic acid. The gas chromatogram shows no FAME with a retention time of t10, c12-CLA. 4B shows the gas chromatogram of the lipid extracts from yeast cells transformed with pY2-bakt.PAI. The cells were again grown for 72 hours at 30 ° C with 0.02% linoleic acid. The gas chromatogram has a very small peak with a retention time of 14.37 min, which does not occur in the control batch (cf. FIG. 4A). As a comparison, the gas chromatogram of the lipid extracts from yeast cells, which were transformed with pY2-PAI and cultivated under the same conditions as in FIGS. 4A and b, is shown in FIG. 4C. As in FIG. 1B, the chromatogram shows a clear peak with a retention time of 14.37 min, the retention time of t10, c12-CLA (see FIG. 1C). The expression was carried out in the INVSd strain, which was grown on linoleic acid at 30 ° C. for 3 days, and then the fatty acids were transmethylated.

Table 1 shows the results of the GC analyzes. The empty control shows the fatty acid composition of transgenic yeast cells, which with the empty pYES

Vector were transformed. PAI 4.3.1, PAI 4.3.2, PAI 6.1.1 and PAI 6.1.2 correspond to independent repeats of coPAI expression in transgenic yeast cells.

Bakt.PAl 4.1, 4.2, 9.1, 9.2 correspond to independent repetitions of the bakt.PAI-

Expression in transgenic yeast cells. Experiment E shows the FAME analyzes of the lipids after incubation for 72 h at 30 ° C. with 0.02% linoleic acid. Experiment F shows the

FAME analyzes of free fatty acids after incubation for 72 h at 30 ° C with 0.02%

Linoleic acid. Example 4: Incubation of disrupted transgenic yeast cells with linoleic acid

In addition to the functional expression of PAI and coPAl in transgenic yeast cells, the conversion of linoleic acid into the t10, c12-CLA isomer was also examined in vitro. For this purpose, both clones were transformed into yeast cells, and after a main culture, the yeast cells were mechanically disrupted and incubated with free linoleic acid. The activity of both isomerases was determined by GC or GC / MS.

A main culture with transgenic yeasts carrying either the pY2-PAI or pY2-coPAI construct was grown as described above. After the OD600 had been determined, the main culture was harvested by centrifugation (7 min, 3800 rpm, 4 ° C.) in sterile centrifuge tubes. The cell pellets were washed with 5 ml of sterile H ₂ O and harvested again (7 min, 3800 rpm, 4 ° C.). The cell pellet was washed with 5 ml of 0.1 M sodium phosphate buffer, pH 7.0 and harvested again by centrifugation (7 min, 3800 rpm, 4 ° C.). The supernatant was removed as completely as possible and the yeast pellets were snap-frozen at -80 ° C. for at least 2 h. The pellets were then taken up in 0.1 M sodium phosphate buffer, pH 7.0, so that an OD600 of 30 was obtained. 3 large glass balls (diameter 0.4 cm) and 1.3 g small glass balls (diameter 0.25 to 0.5 mm) were added per centrifuge tube. The cell material was vortexed for 1 min at maximum shaking frequency and then incubated for 1 min in an ice bath. This process was repeated 6 times. After the last repetition, the cell material was centrifuged off (7 min, 3800 rpm, 4 ° C.) and the supernatant was transferred to a new reaction vessel. This supernatant was centrifuged off again (10 min, 13000 rpm, 4 ° C.) and the supernatant was transferred to a new reaction vessel. Ultimately, 900 ml of cell lysate were incubated with 250 ng of linoleic acid for 30 min at RT (= approx. 23 ° C). After the incubation, the fatty acids were extracted according to Bligh and Dyer (Can. J. Biochem. Physiol., 37, 1959: 911-917); 100 ml of glacial acetic acid and 1.5 ml of 0.1 M sodium phosphate buffer, pH 7.0, 2.5 ml of methanol and 2.5 ml of chloroform were added and the mixture was shaken for 1 min. After phase separation by centrifugation (10 min, 4000 rpm, RT), the lower phase was transferred to a new test tube and evaporated under nitrogen. The residue was transferred to a reaction vessel with twice 500 ml of chloroform and again evaporated under nitrogen. The residue was finally dissolved in 100 ul methanol.

The remaining 90 μl sample was methylated as described above and measured by GC. Table 1: Results of the GC analyzes

results

The results of the in vitro conversion of linoleic acid into the t10, c12-CLA isomer by PAI and coPAl behaved analogously to the results from Example 2. In FIG. 3 it can be seen that disrupted yeast cells which express the codon-optimized PAI are able to convert added linoleic acid to t10, c12-CLA. 3A shows the gas chromatogram of the methylated fatty acids from yeast cell lysates which were transformed with the empty pYES2 vector. The cell lysates were incubated for 30 min at RT with 200 ng linoleic acid. The gas chromatogram shows no FAME with a retention time of t10, c12-CLA. 3B shows the gas chromatogram of the methylated fatty acids from yeast cell lysates transformed with pY2-coPAI. The cell lysates were again incubated for 30 min at RT with 200 ng linoleic acid. The gas chromatogram has a clear peak with a retention time of 14.34 min, which does not occur in the control batch (cf. FIG. 3A) and has the same retention time as the t10, c12-CLA isomer (cf. FIG. 3C ). The expression was carried out in the INVSd strain, which was grown for 3 days at 30 ° C., followed by mechanical digestion and incubation in the presence of linoleic acid with subsequent methylation of the fatty acids. Table 1 shows the results of the GC analyzes. The empty control shows the fatty acid composition of transgenic yeast cells which have been transformed with the empty pYES vector. PAI 4.3.1, PAI 4.3.2, PAI 6.1.1 and PAI 6.1.2 correspond to independent repeats of coPAI expression in transgenic yeast cells. Experiment D shows the results of the FAME analyzes of methylated free fatty acids after incubation of yeast cell lysates for 30 min at RT with 200 ng linoleic acid. Experiment E is an independent repetition of Experiment D.

The results shown in FIG. 3 and Table 1 show that a conversion of linoleic acid into the t10, c12-CLA isomer by the codon-optimized isomerase from Propionibacterium acnes is also possible in vitro. Example 5: Expression in E. coli BL21 (DE3) pLysS cells a) cell cultivation

The PAI-carrying DNA fragment isolated in accordance with Example 3 was cloned into the vector pET24a (Novagen) with the aid of the T4 ligase (MBI fermentas) and then first transformed into E. coli XL1 blue cells. After confirmation of a successful cloning, the resulting plasmid pET24a-PAI (0.2 μg) was used to transform E. coli BL21 (DE3) pLysS cells.

A single colony of the resulting E.coli BL21 (DE3) pLysS cells transformed with pET24a-PAI was used to inoculate 3 ml LB medium preculture, which additionally contained the antibiotics kanamycin and chloramphenicol for selection. The cells were grown overnight at 37 ° C, 200 rpm. A main culture with 25 ml LB medium, to which kanamycin and chloramphenicol was added for the selection, was inoculated with 250 μl of this preculture and grown at 37 ° C., 200 rpm to an OD ₆ oo of 0.5-0.6. Two 5 ml portions of this culture were transferred to a centrifuge tube, centrifuged (3800 rpm, 15 min, 4 ° C.), the supernatant was discarded and the pellet was frozen at -80 ° C.

The rest of the main culture was induced with 10 ul of 1M IPTG and another 3 h shaking at 37 ° C and then transferred into centrifuge tubes, centrifuged (3800 rpm, 15 min, 4 ^C C), the supernatant discarded and the pellet at -80 ° C frozen. b) Implementation of fatty acids

The cells were disrupted for the implementation of various fatty acids and incubated with the fatty acids.

Lysis buffer 10 mM NaCI 100 mM Tris / HCl pH 7.3

10% (v / v) glycerol 2mM DTT

1.5 ml of lysis buffer was added to the Zeil pellets harvested before induction and 5 ml to the Zeil pellets harvested after induction. The cells were resuspended by vortexing and snap-frozen in liquid N ₂ for cell disruption and then thawed at 37 ° C. in a water bath. This process was repeated again. After the Zeil pellets were completely resuspended, the digestion and shearing of the genomic DNA was finally carried out by ultrasound: 45 seconds at 50% power in ice. Subsequently, 1.5 ml of lysate were incubated with the fatty acids to be reacted at 37 ° C. with shaking at 180 rpm for 1 to 3 h.

The extraction of the fatty acids takes place according to the Bligh and Dyer method by adding 100 μl glacial acetic acid, 900 μl 0.1M sodium phosphate buffer pH 7.0; 2.5 ml of methanol and 2.5 ml chloroform. The entire batch was shaken for 1 min, centrifuged off (4000 rpm, 10 min, RT ie at approx. 23 ° C.). The organic lower phase was transferred to a test tube and blown to dryness under N ₂ and transferred to another test tube with 2 × 500 μl chloroform and dried again with N ₂ . The residues were dissolved with 400 μl.

The sample extracted in this way was mixed with 10 μl EDAC solution [EDAC: N- (3-dimethyiaminopropyl) -N'-ethylcarodiimide hydrochloride, 1 mg / 10 μl methanol) and shaken at RT for 2 h. Then 200 μl of 0.1 M Tris / HCl solution pH 7.5 and 1 ml of hexane were added, shaken vigorously (vortexing) and centrifuged off (5 min, 12000 rpm, RT). The top phase was transferred to a new microcentrifuge tube and the extraction repeated with 1 ml of hexane. The hexane phases were then combined and evaporated to dryness under a stream of N ₂ . The residue was taken up in 40 μl acetonitrile. 7 μl of this sample were used for GC analysis. 1 μl was injected into the GC. Column: HP-DB23 (Cross-ünked PEG), 30mx0.32mmx0.5μm

Flow rate: 1.5 ml / min (constant flow) helium 150 ° C

Injection: 220 ° C

Oven: 150 ° C (1 min), to 200 ° C (15k / min), to 250 ° C (2K / min), 250 ° C (5 min)

Detection: FID 275 ° C Table 2 clearly shows that a wide variety of fatty acids are used as substrates in the reaction. Depending on the substrate, conjugated dienes and trienes or mixtures of both can be formed.

Table 2: Conversions of the different fatty acids

Example 6: Cloning and expression of the Bifidobacterium breve isomerase (= BBI) and the Lactobacillus reuteri isomerase (= LRI)

Analogously to the examples described under Examples 1 to 3, the isomerases from Bifidobacterium breve isomerase (= BBI) and the Lactobacillus reuteri isomerase (= LRI) were cloned and expressed in E. coli or yeast.

The modification of the BBI isomerase, that is to say the adaptation of the codon usage, was carried out with the following primers:

BBI-5 'primer: GGT ACC ATG GGT TAC TAC TCC TCC GGT AAC TAC GAA GCT TTC GCT AGA CCA AAG AAG CCA GCT GGT GTT G Primer contains Kpnl interface

BBI-3 'primer: CTC GAG CAG ATC ACA TGG TAT TCG CGT AGC AG Primer contains an Xhol interface

The original Bifidobacterium breve isomerase sequence (SEQ ID NO: 9) is as follows: atg - tac tac agc agc ggc aac tat gag gcg ttt gcc cgt ccg aag aag cca gcc ggc gta g The codon usage optimized modified sequence (SEQ ID NO : 3) then results as follows: atg ggt tac tac tcc tcc ggt aac tac gaa gct ttc gct aga cca aag aag cca gct ggt gtt g

The modification of the LRI isomerase was carried out with the following primers:

LRI-5 'primer: GAA TTC ACC ATG GGT TAC TAC TCC AAC GGT AAC TAC GAA GCT TTC GCT AGA CCA AAG AAG CCA GCT GGT G

Primer contains an EcoRI interface

LRI-3 'primer: CTC GAG TTA TAG TAA GTG CTG TTG CTC CAT TAA TTC primer contains an Xhol interface

The original Lactobacillus reuteri isomerase sequence can be found in SEQ ID NO: 11. The first base pairs of the nucleic acid sequence are as follows: atg - tat tat tca aac ggg aat tat gaa gcc ttt gct cga cca aag aag cct gct ggc g

The corresponding modified sequence (SEQ ID NO: 5) is as follows: atg ggt tac tac tcc aac ggt aac tac gaa gct ttc gct aga cca aag aag cca gct ggt g The PCR reaction was carried out with Expand Fidelity PCR system from Röche Diagnostics and was composed as follows: dNTP mix (10 mM) 1.0 μl 5'-forward primer (10 μM) 4.0 μl 3'- Reverse primer (10 μM) 4.0 μl template (1/50 diluted PSE380-PAI plasmid DNA) 1.0 μl 10-fold buffer 5.0 μl polymerase (3.5 U / μl) 0.5 μl water 34 , 5 ul

Total volume 50.0 μl

The following PCR program was used:

1.2 min 94 ° C

2. 30 sec 94 ° C 3. 30 sec 51 ° C

4.2 min 72 ° C

5. 10 x 2nd to 4th

6. 30 sec 94 ° C

7. 30 sec 51 ° C 8.2 min 72 ° C, time increment 5 sec per cycle

9. 15 x 6th to 8th

10. 5 min 72 ° C

The amplified DNA fragment was cut from a preparative agarose gel, eluted with GFX ™ PCR DNA and Gel Band Purification Kit (Amersham Bioscience) and cloned into the pGEM-T vector (Promega) according to the manufacturer's instructions. After amplification of the plasmid DNA in E. coli, the isomerase cDNA was cut out via the Kpnl and Xhol interfaces or EcoRI and Xhol interfaces and the cDNA ends were smoothed with the T4 polymerase. pYES2 vector was opened with EcoRI, the cDNA ends were smoothed with the T4 polymerase and dephosphorylated with an alkaline phosphatase. Both DNA fragments were alloyed with each other using the T4 ligase and the direction of insertion was checked by a BamHI digest. The pY2-PAI construct thus produced was amplified in E. coli and used for yeast expression in the yeast strain INVSd (Invitrogen) using the LiAc method (Ausubel et al., Current Protocols in Molecular Biology, John Wiley & Sons, New York , 1995) transformed. If a cloning was carried out in the pET24a vector, the vector was cut with the same enzymes for cloning and the isomerase genes were cloned into the vector via these interfaces using the T4 ligase.

The fatty acids were analyzed as described in the examples for the Propionbacterium acnes. Example 7: Expression of the Bifidobacterium breve isomerase (= BBI) and the Lactobacillus reuteri isomerase (= LRI) in plants

The expression of the isomerase from Bifidobacterium breve or Lactobacillus reuteri in transgenic plants is advantageous in order to increase the CLA content in these plants. For this purpose, the cDNA coding for the isomerases was cloned into binary vectors and transferred via Agrobacterium-mediated DNA transfer into Arabidopsis thaliana, Nicotiana tabacum, Brassica napus and Linum usitatissimum. The expression of the isomerase cDNA was under the control of the cohesive CaMV 35 S promoter or the seed-specific USP promoter. Arabidopsis is particularly suitable as a model plant because it has a short generation time and sufficient amounts of linoleic acid, the substrate of the isomerase for the production of CLA.

Tobacco and high linoleic acid varieties of linseed, such as the Linola variety, are particularly suitable as oilseeds with a high content of linoleic acid for the heterologous expression of isomerase genes, since linoleic acid is the substrate of the isomerases for the formation of conjugated linoleic acid.

The expression vectors were the vector pBinAR (Höfgen and Willmitzer, Plant Science, 66, 1990: 221-230) and the pBinAR derivative pBinAR-USP, in which the CaMV 35 S promoter was exchanged for the USP promoter from V. faba , used. The vectors pGPTV and pGPTV-USP were also used. For the recloning, the isomerase cDNA had to be cut out from the vector pGEM-T and cloned into pBinAR or pBinAR-USP.

The resulting plasmids were transformed into Agrobacterium tumefaciens (Höfgen and Willmitzer, Nucl. Acids Res., 16, 1988: 9877). The transformation of A. thaliana was carried out by means of a "floral dip" (Clough and Bent, Plant Journal, 16, 1998: 735-743), that of N. tabacum via cocultivation of tobacco leaf fragments with transformed A. tumefaciens cells, that of linseed and rapeseed by coculturing hypocotyl pieces with transformed A. tumefaciens cells.

The expression of the isomerase genes in transgenic Arabidopsis, tobacco, rapeseed and linseed plants was investigated using Northem blot analysis. Selected plants were examined for their CLA content in the seed oil.

Analogously to the USP promoter, the napin promoter can also be used to achieve seed-specific expression of the isomerase.

Table 3 shows the results in plants. Table 3: Compilation of the experiments in transgenic tobacco plants

Fatty acid levels in

%

5 mg tobacco seeds (Nicotiana tabacum var. SNN) transformed with pCAMBIA-PAI-USP, transmethylated

co

Result: CLA (18: 2, Δ10E.12Z) was detected in 16 of 29 transgenic lines.

Claims

claims

1. Process for the production of conjugated polyunsaturated fatty acids with at least two double bonds dissolved in transgenic eurkaryotic organisms, characterized in that it comprises the following process steps: a) introducing at least one nucleic acid sequence selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 3 or SEQ ID NO: 5 in an organism producing unsaturated fatty acids; or b) introducing at least one nucleic acid sequence which is derived by back-translation into a nucleic acid sequence from the amino acid sequence shown in SEQ ID NO: 2, SEQ ID NO: 4 or SEQ ID NO: 6 on the basis of the degenerated genetic code, or c) introducing at least one Derivatives of the nucleic acid sequence shown in SEQ ID NO: 1, SEQ ID NO: 3 or SEQ ID NO: 5, which code for polypeptides with the amino acid sequences shown in SEQ ID NO: 2, SEQ ID NO: 4 or SEQ ID NO: 6 and have at least 90% identity at the amino acid level without significantly changing the enzymatic action of the polypeptides, and d) expression of the nucleic acid in the organism produced according to (a), (b) or (c), and b) cultivation and harvesting of the ( a), (b) or (c) produced organism.

2. A process for the production of conjugated polyunsaturated fatty acids with at least two double bonds according to claim 1, characterized in that the conjugated polyunsaturated fatty acid is conjugated linoleic acid.

3. The method according to claim 1 or 2, characterized in that the oils contained in the - organism or. Triglycerides contained in the organism can be isolated.

4. The method according to claims 1 to 3, characterized in that the fatty acids contained in the oil or in the triglycerides are released.

5. Process according to claims 1 to 4, characterized in that the transgenic eurkaryotic organism is an oil-producing organism.

6. The method according to claims 1 to 5, characterized in that the transgenic eurkaryotic organism is a plant, a yeast or a fungus.

7. The method according to claims 1 to 6, characterized in that the transgenic plant is an algae, an oil fruit plant selected from the group consisting of peanut, rapeseed, canola, sunflower, safflower (safflower), poppy, mustard, hemp , Castor oil, olive, sesame, calendula, punica, evening primrose, mullein, thistle, wild roses, hazelnut, almond, macadamia, avocado, laurel, pumpkin, flax, soy, pistachio, borage, oil palm, coconut or

Walnut or a crop plant selected from the group consisting of corn, wheat, rye, oats, triticale, rice, barley, cotton, cassava, pepper, tagetes, potato, tobacco, eggplant, tomato, pea, alfalfa, coffee, cocoa or tea ,

8. The method according to claims 1 to 7, characterized in that at least one further nucleic acid which codes for a polypeptide of fatty acid biosynthesis is additionally introduced into the transgenic eurkaryonic organism.

9. The method according to claims 1 to 8, characterized in that the further nucleic acid which codes for a polypeptide of fatty acid biosynthesis is selected from the group of nucleic acid sequences which are used for an acyl-CoA dehydrogenase, an acyl-ACP [ = acyl carrier proteinj desaturase, an acyl ACP thioesterase, a fatty acid acyl transferase, a fatty acid synthase, a fatty acid hydroxylase, an acetyl coenzyme A carboxylase, an acyl coenzyme A oxidase, a fatty acid Encode desaturase, a fatty acid acetylenase, a lipoxygenase, a triacylglycerol lipase, an allen oxide synthase, a hydroperoxide lyase, a fatty acid transporter or a fatty acid elongase.

10. oils, triglycerides or fatty acid mixture with an increased content of conjugated polyunsaturated fatty acids, produced by a process according to claims 1 to 9.

11. oils or triglycerides with an increased content of conjugated linoleic acid, produced by a process according to claims 1 to 10.

12. Use of a nucleic acid sequence selected from the group: a) Nucleic acid sequence selected from the group consisting of SEQ ID

NO: 1, SEQ ID NO: 3 or SEQ ID NO: 5, or b) nucleic acid sequence which is derived by back-translation into a nucleic acid sequence from the amino acid sequence shown in SEQ ID NO: 2, SEQ ID NO: 4 or SEQ ID NO: 6 on the basis of the degenerate genetic code, or c) derivatives of those in SEQ ID NO: 1, SEQ ID NO: 3 or SEQ ID NO: 5, which encode polypeptides with the amino acid sequences shown in SEQ ID NO: 2, SEQ ID NO: 4 or SEQ ID NO: 6 and have at least 90% identity at the amino acid level , without the enzymatic action of the polypeptides being significantly changed, or d) a nucleic acid sequence which differs from the prokaryotic codon usage of the nucleic acid sequences SEQ ID NO: 7, SEQ ID NO: 9 or SEQ ID NO: 11 by at least 0.5 %, advantageously at least 1, 2, 3 or 5%, preferably at least 6, 7, 8, 9 or 10%, particularly preferably at least 20, 30, 40 or 50%, very particularly preferably at least 60, 70, 80 or 90% of one eukaryotic codon u sage distinguishes, or e) derivatives of the nucleic acid sequences claimed under (d) which are at least one, advantageously at least 2, preferably at least 3, particularly preferably at least 4, very particularly preferably at least 5 - codon triplets advantageously at the 5 'end of the nucleic acid sequences which are suitable for encoding an amino acid is extended, without the enzymatic effect of the polypeptides encoded by the nucleic acids being significantly changed, for the production of transgenic plants.

13. Use of a nucleic acid sequence according to claim 12 or a fragment thereof for the isolation of a nucleic acid sequence via homology screening.

14. Use of triglycerides or fatty acid mixtures according to claim 10 or 11 with an increased content of conjugated polyunsaturated fatty acids or conjugated linoleic acid for the production of foods, animal feed, cosmetics or pharmaceuticals.

15. Isolated nucleic acid sequence which codes for a polypeptide with isomerase activity selected from the group: a) a nucleic acid sequence with the sequence shown in SEQ ID NO: 1, SEQ ID NO: 3 or SEQ ID NO: 5, or b) one Nucleic acid sequence, which is converted back into a nucleic acid sequence from the amino acid sequence shown in SEQ ID NO: 2, SEQ ID NO: 4 or SEQ ID NO: 6 due to the degenerate genetic

Derives codes, or c) Derivatives of the nucleic acid sequence shown in SEQ ID NO: 1, SEQ ID NO: 3 or SEQ ID NO: 5, those for polypeptides with the amino acid sequences shown in SEQ ID NO: 2, SEQ ID NO: 4 or SEQ ID NO: 6 encode and have at least 90% identity at the amino acid level, or d) a nucleic acid sequence which differs from the prokaryotic codon usage of the nucleic acid sequences SEQ ID NO: 7, SEQ ID NO: 9 or SEQ ID NO: 11 by at least 0.5%, advantageously at least 1, 2, 3 or 5%, preferably at least 6, 7, 8, 9 or 10%, particularly preferably at least 20, 30, 40 or 50%, very particularly preferably at least 60, 70, 80 or 90% of a eukaryotic codon -usage distinguishes, or e) derivatives of the nucleic acid sequences claimed under (d), which by at least one, advantageously at least 2, preferably at least 3, particularly preferably at least 4, very particularly preferably at least 5 codon triplets advantageously at the 5 'end of the nucleic acid sequences which are for an A coding amino acid, is extended without the enzymatic effect of the polypeptides encoded by the nucleic acids having been significantly changed.

16. Nucleic acid sequence according to claim 15, characterized in that the codon usage under (d) is introduced at the amino-terminal end.

17. Amino acid sequence encoded by a nucleic acid sequence according to claim 14 (d) and (e) or claim 16.

18. A nucleic acid construct containing a nucleic acid sequence according to claim 15 or 16, wherein the nucleic acid sequence is linked to one or more regulation signals.

19. Vector containing a nucleic acid sequence according to claim 15 or 16 or a nucleic acid construct according to claim 18.

20. Transgenic organism containing at least one nucleic acid sequence according to claim 15 or 16, at least one nucleic acid construct according to claim 18 or at least one vector according to claim 19.

21. The transgenic organism according to claim 20, wherein the organism is a yeast, a fungus or a plant.

22. Food, nutritional supplement, animal feed or pharmaceutical preparation containing oils or triglycerides with an increased content of conjugated polyunsaturated fatty acids or conjugated linoleic acid according to claim 10 or 11.

23. Process for the production of conjugated linoleic acid with transgenic eurkaryotic organisms, characterized in that it comprises the following process steps: a) introducing at least one nucleic acid sequence selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 3 or SEQ ID NO: 5 into an organism producing unsaturated fatty acids; or b) introducing at least one nucleic acid sequence which is converted back into a nucleic acid sequence of the type shown in SEQ ID NO: 2, SEQ

ID NO: 4 or SEQ ID NO: 6 derived from the degenerate genetic code, or c) introducing at least one derivative of the nucleic acid sequence shown in SEQ ID NO: 1, SEQ ID NO: 3 or SEQ ID NO: 5, which for Encode polypeptides with the amino acid sequences shown in SEQ ID NO: 2, SEQ ID NO: 4 or SEQ ID NO: 6 and have at least 90% identity at the amino acid level, without the enzymatic action of the polypeptides being significantly changed, or d) introduction at least one nucleic acid sequence that differs from the prokaryotic codon usage of the nucleic acid sequences SEQ ID NO: 7,

SEQ ID NO: 9 or SEQ ID NO: 11 differs by at least 0.5% of a eukaryotic codon usage, or e) introducing at least one derivative of the nucleic acid sequences claimed under (d), which by at least one codon triplet of the nucleic acid sequences, the encoded for an amino acid, is extended without significantly changing the enzymatic effect of the polypeptides encoded by the nucleic acids. f) Expression of the nucleic acid in the organism produced according to (a), (b), (c), (d) or (e).

24. A process for the production of conjugated linoleic acid according to claim 23, characterized in that the organism is fed linoleic acid.

25. A process for the production of conjugated linoleic acid according to claim 23 or 24, characterized in that the organism produced according to (a), (b), (c), (d) or (e) is grown and harvested. 25. A process for the production of conjugated linoleic acid according to claims 23 to 25, characterized in that the organism is disrupted and the conversion of linolenic acid to CLA takes place in vitro.