WO2003094860A2

WO2003094860A2 - Use of homo sapiens chromosome 1 open reading frame 28 (c1orf28) in the diagnosis of hyperparathyroidism-jaw tumor syndrome

Info

Publication number: WO2003094860A2
Application number: PCT/US2003/015081
Authority: WO
Inventors: John Carpten; Jeffrey Trent; Raman B. Sood; Rajesh Thakker; Sunita K. Agarwal; Bin Tean Teh; Catharina Larsson; Christiane Robbins
Original assignee: The Government Of The United States Of America, Represented By The Secretary, Department Of Health And Human Services; Duke University
Priority date: 2002-05-13
Filing date: 2003-05-13
Publication date: 2003-11-20
Also published as: AU2003232127A8; AU2003232127A1; WO2003094860A3

Abstract

The present invention provides an isolated or purified oligonucleotide consisting essentially of the nucleotide sequence of Clorf28 and comprising a mutation; a fragment of the oligonucleotide; a vector comprising the oligonucleotide or fragment thereof; a cell comprising the vector; an isolated or purified polypeptide encoded by the above oligonucleotide or fragment thereof; a method of detecting HPT-JT or a predisposition to HPT-JT in a human, which method comprises detecting either at least one mutation in a nucleic acid comprising the nucleotide sequence of C1orf28 or a mutant C1orf28 protein; and an antibody which binds to a mutant C1orf28 protein.

Description

USE OF HOMO SAPIENS CHROMOSOME 1 OPEN READING FRAME 28 (C1ORF28) IN THE DIAGNOSIS OF HYPERPARATHYROIDISM-JAW TUMOR SYNDROME

(HPT-JT)

FIELD OF THE INVENTION [0001] This invention pertains to isolated or purified oligonucleotides and polypeptides consisting essentially of the sequence of Clorf28 and comprising a mutation, fragments thereof, vectors and cells comprising the same, antibodies and oligonucleotides that detect a mutation, and methods of detecting HPT-JT or a predisposition to HPT-JT.

BACKGROUND OF THE INVENTION [0002] HPT-JT is an autosomal dominant disorder clinically characterized by the presence of multiple parathyroid adenomas and the development of rare fibro-osseous tumors of the mandible and maxilla. This disease has been mapped to a 15 centiMorgan (cM) region on chromosome 1 (lq31), which comprises 67 genes (see, Szabo et al., Am. J. Hum. Genet. 56: 944-950 (1995) ; Teh et al., J. Clin. Endocrinol. Metab. 81(12): 4204-4211 (1993); Hobbs et al., Am. J. Hum. Genet. 64: 518-525 (1999); Haven et al., J. Clin. Endocrinol. Metab. 85(4): 1449-1454 (2000); Cavaco et al., Q. J. Med. 94: 213-222 (2001); and Sood et al., Genomics 73: 211-222 (2001)). However, the gene located within this region that is mutated, thereby leading to the onset of HPT-JT, has not yet been identified. This gene has generally been referred to in the art as the Hyperparathyroidism 2 (HRPT2) gene.

[0003] In view of the foregoing, a method of detecting HPT-JT or a predisposition to HPT-JT before the onset of clinical signs and symptoms has been unavailable. The present invention identifies the gene responsible for HPT-JT and provides materials and methods for the detection of HPT-JT or a predisposition thereto. These and other objects and advantages of the present invention, as well as additional inventive features, will be apparent from the description of the invention provided herein. ^•

BRIEF SUMMARY OF THE INVENTION [0004] The present invention provides an isolated or purified oligonucleotide consisting essentially of the nucleotide sequence of Clorf28 (SEQ ID NO:l) and comprising a mutation. The present invention also provides a f agment of the isolated or purified oligonucleotide, wherein the fragment comprises the mutation. A vector comprising the isolated or purified oligonucleotide, or the fragment thereof, as well as a cell comprising the isolated or purified oligonucleotide, optionally in the form of a vector, is further provided by the present invention. An isolated or purified polypeptide encoded by the above- identified isolated or purified oligonucleotide, or a fragment thereof, is also provided. [0005] The present invention further provides an isolated or purified oligonucleotide consisting essentially of a nucleotide sequence of SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 40, SEQ J-D NO: 41, SEQ ID NO: 42, SEQ ID NO: 43, SEQ ID NO: 44, SEQ ID NO: 45, SEQ ID NO: 46, SEQ ID NO: 47, SEQ ID NO: 48, or SEQ ID NO: 49.

[0006] A method of detecting HPT-JT or a predisposition to HPT-JT in human is also provided by the present invention. The method comprises detecting at least one mutation in the nucleotide sequence of Clorf28 (SEQ ID NO: 1) in a test sample comprising a nucleic acid comprising the nucleotide sequence of Clorf28 obtained from the human. Further provided by the present invention is an alternative method of detecting HPT-JT or a predisposition to HPT-JT in a human. The method comprises detecting a mutated Clorf28 protein in a test sample comprising a Clorf28 protein obtained from the human. In this method, an antibody that binds to the amino acid sequence

CLASCEQCLASYDSTTSRRRRLW (SEQ ID NO: 28), YRRRRLW (SEQ ID NO: 29), RRRRLW (SEQ ID NO: 30), NCSQS (SEQ ID NO: 31), RDLLKSNELQMKF (SEQ ID NO: 32), LWMLR (SEQ ID NO: 33), EYGGHEQLSYKAQERIFPRTFLQFFNL (SEQ ID NO: 34), or HQGALQLNLQYLIE (SEQ ID NO: 35) of a mutant Clorf28 protein can be used to detect a mutant Clorf28 protein. Such an antibody is further provided by the present invention.

BRIEF DESCRIPTION OF THE DRAWINGS • [0007] Figure 1 represents a table of mutations of Clorf28 that are indicative of HPT- JT.

[0008] Figure 2 represents a listing of nucleotide sequences (5' -> 3' when read from left to right and top to bottom) and amino acid sequences (N-> C terminal when read from left to right and top to bottom).

DETAILED DESCRIPTION OF THE INVENTION [0009] The present invention provides an isolated or purified oligonucleotide consisting essentially of the nucleotide sequence of Homo sapiens Clorf28 (SEQ ID NO: 1; Gen Bank Accession No. AF312865) and comprising a mutation. The term "isolated" as used herein means having been removed from its natural environment. The term "purified" as used herein means having been increased in purity, wherein "purity" is a relative term, and not to be construed as absolute purity. The term "oligonucleotide" as used herein means a polymer of DNA or RNA, (i.e., a polynucleotide), which can be single-stranded or double- stranded, synthesized or obtained from natural sources, and which can contain natural, non- natural or altered nucleotides. The present invention further provides a fragment of the isolated or purified oligonucleotide, wherein the fragment comprises the mutation. [0010] The term "mutation" as used herein refers to any insertion, deletion, substitution and/or inversion in a given oligonucleotide. Such mutated oligonuclorides and fragments thereof can be obtained from naturally occurring sources or generated using methods known in the art. For instance, site-specific mutations can be introduced by ligating into an expression vector a synthesized oligonucleotide comprising the modified site. Alternately, oligonucleotide-directed site-specific mutagenesis procedures can be used, such as disclosed in Walder et al., Gene 42: 133 (1986); Bauer et al., Gene 37: 73 (1985); Craik, Biotechniques, 12-19 (January 1995); and US. Patent Nos. 4,518,584 and 4,737,462. A preferred means for introducing mutations is the QuikChange Site-Directed Mutagenesis Kit (Stratagene, LaJolla, CA). While the above-described mutated oligonucleotides and fragments thereof can be generated in vivo and then isolated or purified, alternatively, they can be synthesized. A variety of techniques used to synthesize the oligonucleotides and fragments thereof of the present invention are known in the art. See, for example, Lemaitre et al., Proceedings of the National Academy of the Sciences 84: 648-652 (1987) and the references cited herein under "EXAMPLES." The oligonucleotides and fragments thereof ; of the present invention can alternatively be synthesized by companies, such as Eurogentec Belgium.

[0011] The isolated or purified oligonucleotides of the present invention, and fragments thereof, can be mutated within any exon of the Clorf28 gene. Preferably, the mutation is located in exon 1, exon 2, exon 3, exon 4, exon 5, exon 7, or exon 14. Preferably, the mutation is a substitution of G at nucleotide position 3 of the Clorf28 coding sequence with A, an insertion of GCAGTGCTTAGCGTCCTGCGAACAGTGCTTAGCGTCCTACG (SEQ ID NO: 25) after the G at nucleotide position 26 of the Clorf28 coding sequence, a deletion of nucleotides 34-40, which consists of the sequence AACATCC (SEQ ID NO: 26), of the Clorf28 coding sequence, a deletion of C at nucleotide position 39 of the Clorf28 coding sequence, a substitution of C at nucleotide position 165 of the Clorf28 coding sequence with G, a mutation comprising a deletion of nucleotides 306-307, which consists of the sequence GT, from the Clorf28 coding sequence and a deletion of the nucleotides GTGAGTACTTTTT (SEQ ID NO: 27) from the intron that is 3' to nucleotide position 307 (as shown in SEQ ID NO: 50), a deletion of A at nucleotide position 356 of the Clorf28 coding sequence, a substitution of A at nucleotide position 406 of the Clorf28 coding sequence with T, a deletion of T at nucleotide position 636 of the Clorf28 coding sequence, an insertion of AG after the G at nucleotide position 688 of the Clorf28 coding sequence, or a deletion of A at nucleotide position 1238 of the Clorf28 coding sequence. The nucleotide positions are numbered with respect to A of the initiation codon, ATG, which is numbered 1. "A," "T," "C," and "G" are used to denote a particular nucleotide in accordance with convention. The oligonucleotide of the present invention can consist essentially of a nucleotide sequence of SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, or SEQ ID NO: 12.

[0012] A vector comprising any of the above-described isolated or purified oligonucleotides, or fragments thereof, is further provided by the present invention. Any of the above oligonucleotides, or fragments thereof, can be cloned into any suitable vector and can be used to transform or transfect any suitable host. The selection of vectors and methods to construct them are commonly known to persons of ordinary skill in the art and are described in general technical references (see, in general, "Recombinant DNA Part D," Methods in Enzymology, Vol. 153, Wu and Grossman, eds., Academic Press (1987) and the references cited herein under "EXAMPLES"). Desirably, the vector comprises regulatory sequences, such as transcription and translation initiation and termination codons, which are specific to the type of host (e.g., bacterium, fungus, plant or animal) into which the vector is to be introduced, as appropriate and taking into consideration whether the vector is DNA or RNA. Preferably, the vector comprises regulatory sequences that are specific to the genus of the host. Most preferably, the vector comprises regulatory sequences that are specific to the species of the host.

[0013] Constructs of vectors, which are circular or linear, can be prepared to contain an entire nucleic acid sequence as described above or a portion thereof ligated to a replication system functional in a prokaryotic or eukaryotic host cell. Replication systems can be derived from ColEl, 2 mμ plasmid, λ, SV40, bovine papilloma virus, and the like. [0014] In addition to the replication system and the inserted nucleic acid, the construct can include one or more marker genes, which allow for selection of transformed or transfected hosts. Marker genes include biocide resistance, e.g., resistance to antibiotics, heavy metals, etc., complementation in an auxotrophic host to provide prototrophy, and the like.

[0015] Suitable vectors include those designed for propagation and expansion or for expression or both. A preferred cloning vector is selected from the group consisting of the pUC series, the pBluescript series (Stratagene, LaJolla, CA), the pET series (Novagen, Madison, WI), the pGEX series (Pharmacia Biotech, Uppsala, Sweden), and the pEX series (Clontech, Palo Alto, CA). Bacteriophage vectors, such as λGTIO, λGTl 1, λZapU (Stratagene), λ EMBL4, and λ NM1149, also can be used. Examples of plant expression vectors include pBIlOl, pBI101.2, pBI101.3, pBI121 and pBIN19 (Clontech). Examples of animal expression vectors include pEUK-Cl, pMAM and pMAMneo (Clontech). With respect to the present inventive vectors, it is preferred that the TOPO cloning system (Invitrogen, Carlsbad, CA) is used in accordance with the manufacturer's recommendations. [0016] An expression vector can comprise a native or normative promoter operably linked to an isolated or purified oligonucleotide as described above. The selection of promoters, e.g., strong, weak, inducible, tissue-specific and developmental-specific, is within the skill in the art. Similarly, the combining of an oligonucleotide, or fragment thereof, as described above with a promoter is also within the skill in the art. [0017] Optionally, the isolated or purified oligonucleotide, or fragment thereof, upon linkage with another oligonucleotide, can encode a fusion protein. The generation of fusion proteins is within the ordinary skill in the art (see, e.g., references cited under "EXAMPLES") and can involve the use of restriction enzyme or recombinational cloning techniques (see, e.g., Gateway ™ (Invitrogen)). See, also, U.S. Patent No. 5,314,995. [0018] The present invention also provides a cell comprising any of the above-described vectors. It is most preferable that the cell of the present invention expresses the vector, such that the oligonucleotide, or fragment thereof, is both transcribed and translated efficiently by the cell. Examples of cells include, but are not limited to, a human cell, a human cell line, E. coli (e.g., E. coli TB-1, TG-2, DH5 , XL-Blue MRF' (Stratagene), SA2821 and Y1090), B. subtilis, P. aerugenosa, S. cerevisiae, N. crassa, insect cells (e.g., Sf9, Ea4) and others set forth herein below. With respect to the present inventive cells, it is preferred that the cells are E. coli DH5 cells.

[0019] An isolated or purified polypeptide encoded by any of the above described isolated or purified oligonucleotides, or a fragment thereof, are further provided by the present invention. In a preferred embodiment of the present invention-, the polypeptide consists essentially of an amino acid sequence of SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 23 or SEQ ID NO: 24.

[0020] The isolated or purified polypeptides can optionally be modified, for instance, by glycosylation, amidation, carboxylation, or phosphorylation, or by the creation of acid addition salts, amides, esters, in particular C-terminal esters, and N-acyl derivatives of the polypeptides of the invention. The polypeptides also can be modified to create polypeptide derivatives by forming covalent or noncovalent complexes with other moieties in accordance with methods known in the art. Covalently-bound complexes can be prepared by linking the chemical moieties to functional groups on the side chains of amino acids comprising the polypeptides, or at the N- or C-terminus.

[0021] The polypeptide desirably comprises an amino end and a carboxyl end. The polypeptide can comprise D-amino acids, L-amino acids or a mixture of D- and L-amino acids. The D-form of the amino acids, however, is particularly preferred since a polypeptide comprised of D-amino acids is expected to have a greater retention of its biological activity in vivo, given that the D-amino acids are not recognized by naturally occurring proteases.

[0022] The polypeptides can be prepared by any of a number of conventional techniques. They can be isolated or purified from a naturally occurring source or from a recombinant source. With respect to the present invention, recombinant production is preferred. For instance, in the case of recombinant polypeptides, a DNA fragment encoding a desired peptide can be subcloned into an appropriate vector using well-known molecular genetic techniques (see, e.g., Maniatis et al., Molecular Cloning: A Laboratory Manual, 2nd ed. (Cold Spring Harbor Laboratory, 1982); et al., Molecular Cloning: A Laboratory Manual, 2^nd ed. (Cold Spring Harbor Laboratory, 1989). The fragment can be transcribed and the polypeptide subsequently translated in vitro. Commercially available kits also can be employed (e.g., such as manufactured by Clontech, Palo Alto, CA; Amersham Pharmacia Biotech Inc., Piscataway, NJ; hiNitrogen, Carlsbad, CA, and the like). The polymerase chain reaction (PCR) optionally can be employed in the manipulation of nucleic acids.

[0023] Any appropriate expression vector (e.g., as described in Pouwels et al., Cloning Vectors: A Laboratory Manual (Elsevier, ΝY: 1985)) and corresponding suitable host can be employed for production of recombinant polypeptides. Expression hosts include, but are not limited to, bacterial species within the genera Escherichia, Bacillus, Pseudomonas, Salmonella, mammalian or insect host cell systems including baculovirus systems (e.g., as described by Luckow et al., Bio/Technology 6: 47 (1988)), and established cell lines such as the COS-7, C127, 3T3, CHO, HeLa, and BHK cell lines, and the like. The ordinarily skilled artisan is, of course, aware that the choice of expression host has ramifications for the type of polypeptide produced. For instance, the glycosylation of polypeptides produced in yeast or mammalian cells (e.g., COS-7 cells) will differ from that of polypeptides produced in bacterial cells, such as Escherichia coli.

[0024] Alternately, the polypeptides can be synthesized using standard peptide synthesizing techniques well-known to those of ordinary skill in the art"(e.g., as summarized in Bodanszky, Principles of Peptide Synthesis, (Springer- Verlag, Heidelberg: 1984)). In particular, the polypeptide can be synthesized using the procedure of solid-phase synthesis (see, e.g., Merrifield, J. Am. Chem. Soc. 85: 2149-54 (1963); Barany et al, Int. J. Peptide Protein Res. 30: 705-739 (1987); and U.S. Patent No. 5,424,398). If desired, this can be done using an automated peptide synthesizer. Removal of the t-butyloxycarbonyl (t-BOC) or 9-fluorenylmethyloxycarbonyl (Fmoc) amino acid blocking groups and separation of the polypeptide from the resin can be accomplished by, for example, acid treatment at reduced temperature. The polypeptide-containing mixture can then be extracted, for instance, with dimethyl ether, to remove non-peptidic organic compounds, and the synthesized polypeptide can be extracted from the resin powder (e.g., with about 25% w/v acetic acid). Following the synthesis of the polypeptide, further purification (e.g., using high performance liquid chromatography (HPLC)) optionally can be done in order to eliminate any incomplete polypeptides or free amino acids. Amino acid and/or HPLC analysis can be performed on the synthesized polypeptide to validate its identity. For other applications according to the invention, it may be preferable to produce the polypeptide as part of a larger fusion protein, such as by the methods described herein or other genetic means, or as part of a larger conjugate, such as through physical or chemical conjugation, as known to those of ordinary skill in the art and described herein.

[0025] Further provided by the present invention is an isolated or purified oligonucleotide consisting essentially of a nucleotide sequence of SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 40, SEQ ID NO: 41, SEQ ID NO: 42, SEQ ID NO: 43, SEQ ID NO: 44, SEQ ID NO: 45, SEQ ID NO: 46, SEQ ID NO: 47, SEQ ID NO: 48, or SEQ ID NO: 49. These oligonucleotides can be used as forward or reverse primers in the methods described herein.

[0026] A method of detecting HPT-JT or a predisposition to HPT-JT in a human is provided by the present invention. The method comprises detecting at least one mutation in Clor£28 (SEQ ID NO: 1) in a test sample comprising a nucleic acid comprising the nucleotide sequence of Clorf28 obtained from the human.

[0027] It is preferred that the at least one mutation is located in at least one of the 17 exons of the Clorf28 gene. It is more preferred that the at least one mutation occurs in exon 1, exon 2, exon 3, exon 4, exon 5, exon 7, or exon 14 of the Clorf gene. [0028] The at least one mutation can be a substitution of G at nucleotide position 3 of the Clorf28 coding sequence with A, an insertion of

GCAGTGCTTAGCGTCCTGCGAACAGTGCTTAGCGTCCTACG (SEQ ID NO: 25) after the G at nucleotide position 26 of the Clorf28 coding sequence, a deletion of nucleotides 34-40, which consists of the sequence AACATCC (SEQ ID NO: 26), of the Clorf28 coding sequence, a deletion of C at nucleotide position 39 of the Clorf28 coding sequence, a substitution of C at nucleotide position 165 of the Clorf28 ^•coding sequence with G, a mutation comprising a deletion of nucleotides 306-307, which consists of the sequence GT, from the Clorf28 coding sequence and a deletion of the nucleotides GTGAGTACTTTTT (SEQ ID NO: 27) from the intron that is 3' to nucleotide position 307 (as shown in SEQ ID NO: 50), a deletion of A at nucleotide position 356 of the Clorf28 coding sequence, a substitution of A at nucleotide position 406 of the Clorf28 coding sequence with T, a deletion of T at nucleotide position 636 of the Clorf28 coding sequence, an insertion of AG after the G at nucleotide position 688 of the Clorf28 coding sequence, or a deletion of A at nucleotide position 1238 of the Clorf28 coding sequence. Preferably, the nucleotide sequence of Clorf28 consists essentially of a nucleotide sequence of SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, or SEQ ID NO: 12. [0029] In a preferred embodiment of the present inventive method, the method comprises detecting the at least one mutation in Clorf28 using at least one isolated or purified oligonucleotide consisting essentially of a nucleotide sequence as set forth in SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 40, SEQ ID NO: 41, SEQ ID NO: 42, SEQ ID NO: 43, SEQ ID NO: 44, SEQ ID NO: 45, SEQ ID NO: 46, SEQ ID NO: 47, SEQ ID NO: 48, or SEQ ID NO: 49. These oligonucleotides can be used as forward or reverse primers in a PCR. The forward primer and the reverse primer selectively hybridize to the cDNA template of the Clorf28 mRNA transcript under conditions that permit selective hybridization. Preferably, the hybridization is done under high stringency conditions. By "high stringency conditions," it is meant that the primers specifically hybridize to target sequences of the cDNA template in an amount that is detectably stronger than non-specific hybridization. High stringency conditions, then, would be conditions that distinguish a polynucleotide with an exact complementary sequence of the cDNA template from one containing a only few small regions (e.g., 3-10 bases) with exact complementary sequence of the cDNA template. Such small regions of complementarity are more easily melted than a full-length complement of 14-17 or more bases and high stringency hybridization makes them easily distinguishable. Relatively high stringency conditions would include, for example, low salt and/or high temperature conditions, such as provided by about 0.02-0.1 M NaCl or the equivalent,, at temperatures of about 50-70 °C. Such high stringency conditions tolerate little, if any, mismatch between the primer and the cDNA template of the Clorf28 mRNA transcript, and are particularly suitable for amplifying and detecting a Clorf28 mRNA. It is generally appreciated that conditions can be rendered more stringent by the addition of increasing amounts of formamide.

[0030] Once hybridized, the complex comprising the forward primer, the reverse primer, and the cDNA template is contacted with one or more enzymes that facilitate template-dependent nucleic acid synthesis. Preferred enzymes include, for example, TaqMan DNA polymerase (Applied Biosystems, Foster City, CA). Multiple rounds of amplification, also referred to as "cycles," are conducted until a sufficient amount of amplification product, or amplicons, is produced.

[0031] Following amplification of Clorf28, it can be desirable to separate the amplification products from the template and the excess primers for the purpose of determining whether specific amplification has occurred, hi one embodiment, amplification products are separated by agarose, agarose-acrylamide or polyacrylamide gel electrophoresis using standard methods. See Sambrook et al. (1989), supra. [0032] Alternatively, chromatographic techniques can be employed to effect separation. There are many kinds of chromatography which can be used in the context of the present inventive methods, e.g., adsorption, partition, ion-exchange and molecular sieve, and many specialized techniques for using them including column, paper, thin-layer and gas chromatography (Freifelder, Physical Biochemistry Applications to Biochemistry and Molecular Biology, 2^nd Ed., Wm. Freeman and Co., New York, N.Y. (1982)). [0033] Amplification products must be visualized in order to confirm amplification of Clorf28. One typical visualization method involves staining of a gel with ethidium bromide and visualization under UV light. Alternatively, if the amplification products are integrally labeled with radio- or fluorometrically-labeled nucleotides, the amplification products can then be exposed to x-ray film or visualized under the appropriate stimulating spectra, following separation.

[0034] In one embodiment, visualization is achieved indirectly. Following separation of amplification products, a labeled, nucleic acid probe is brought into contact with the amplified Clorf28 sequence. The probe preferably is conjugated to a chromophore, but may be radiolabeled. In another embodiment, the probe is conjugated to a binding partner, such as an antibody or biotin, where the other member of the binding pair carries a detectable moiety (i.e., a label).

[0035] One example of the foregoing is described in U.S. Patent No. 5,279,721, which discloses an apparatus and method for the automated electrophoresis and transfer of nucleic acids. The apparatus permits electrophoresis and blotting without external manipulation of the gel and is ideally suited to carrying out methods according to the present invention. [0036] It will be understood that the probes described above are exemplary in as much as any nucleic-acid sequence can be used as long as the nucleic acid sequence is hybridizable to nucleic acids encoding Clorf28 or functional sequence analogs thereof. For example, a nucleic acid of partial sequence can be used to quantify the expression of a structurally related gene or the full-length genomic or cDNA clone from which it is derived. [0037] In addition to PCR-based techniques, other assays can be used to detect HPT-JT or a predisposition to HPT-JT in a human. As used herein, the term "assay" refers to any qualitative analysis of a nucleic acid or polypeptide that is known in the art. For instance, if the nucleic acid comprising the nucleotide sequence of Clorf28 is DNA, then Southern blotting, in situ hybridization, and microarray analysis can be performed to detect at least one mutation in Clof28. If the nucleic acid comprising the nucleotide sequence of Clorf28 is RNA, then Northern blotting, in addition to in situ hybridization and microarray analysis can be performed to detect at least one mutation in Clorf28. These assays are described in Sambrook et al. (1989), supra.

[0038] With respect to the present inventive method of detecting HPT-JT or a predisposition to HPT-JT, one skilled in the art will appreciate that the method, although directed to humans, can be additionally directed to other mammals that express a gene which is homologous to Clorf28. Mammals include, but are not limited to, the order Rodentia, such as mice, and the order Logomorpha, such as rabbits. It is preferred that the mammals are from the order Carnivora, including Felines (cats) and Canines (dogs). It is more preferred that the mammals are from the order Artiodactyla, including Bovines (cows) and Suines (pigs) or of the order Perssodactyla, including Equines (horses). It is most preferred that the mammals are of the orders Primate, Ceboid, or Simoid (monkeys) or of the order Anthropoid (humans and apes). As Clorf28 is evolutionarily^' conserved, either in part or in full, it is likely that genes homologous to Clor£28 genes do exist in the above- mentioned mammals.

[0039] The present invention further provides a method of detecting HPT-JT or a predisposition to HPT-JT in a human in which the method comprises detecting a mutated Clorf28 protein in a test sample comprising a Clorf28 protein obtained from the human. The mutated Clorf28 protein can be mutated within any exon of the Cϊorf28 coding sequence. Preferably, it is mutated in exon 1, exon 2, exon 3, exon 4, exon 5, exon 7, or exon 14.

[0040] With respect to the present invention, the mutated Clorf28 protein can comprise the first 10 amino acids of a wild-type Clorf28 protein and can further comprise CLASCEQCLASYDSTTSRRRRLW (SEQ ID NO: 28) after Q10, can comprise the first 10 amino acids of a wild-type Clorf28 protein and can further comprise YRRRRLW (SEQ ID NO: 29) after Q10, can comprise the first 12 amino acids of a wild-type Clorf28 protein and can further comprise RRRRLW (SEQ ID NO: 30) after 112, can comprise the first 54 amino acids of a wild-type Clorf28, can comprise the first 102 amino acids of a wild-type Clorf28 protein and can further comprise NCSQS (SEQ ID NO: 31) after A102, can comprise the first 118 amino acids of a wild-type Clorf28 protein and can further comprise RDLLKSNELQMKF (SEQ ID NO: 32) after LI 18, can comprise the first 212 amino acids of a wild-type Clorf28 protein and can further comprise LWMLR (SEQ ID NO: 33) after S212, can comprise the first 234 amino acids of a wild-type Clorf28 protein and can further comprise EYGGHEQLSYKAQERIFPRTFLQFFNL (SEQ ID NO: 34) after R234, or can comprise the first 414 amino acids of a wild-type Clorf28 protein and can further comprise HQGALQLVLQYLIE (SEQ ID NO: 35) after M414. The amino acid positions are numbered with respect to the methionine encoded by the initiation codon of the gene, which is amino acid 1. The single-letter abbreviations of amino acids have been used herein in accordance with convention.

[0041] Several assays for the detection of a protein are well-known in the art. For example, Western blotting, which is described in Sambrook et al. (1989), supra, can be used to detect a mutated Clorf28 for the detection of HPT-JT or a predisposition to HPT-JT in a human.

[0042] Further provided by the present invention is an antibody that binds to the amino acid sequence CLASCEQCLASYDSTTSRRRRLW (SEQ ID NO: 28), YRRRRLW (SEQ ID NO: 29), RRRRLW (SEQ ID NO: 30), NCSQS (SEQ ID NO: 31), RDLLKSNELQMKF (SEQ ID NO: 32), LWMLR (SEQ ID NO: 33), EYGGHEQLSYKAQERIFPRTFLQFFNL (SEQ ID NO: 34), or HQGALQLVLQYLIE (SEQ ID NO: 35) of a mutant Clorf28 protein. The antibody can be used in the above method of detecting a mutated CI of 28 protein. One in the art will appreciate that the term "antibody" as used herein refers to "a protein that binds specifically to a particular substance -its antigen. Each antibody molecule has a unique structure that enables it to bind specifically to its corresponding antigen, but all antibodies have the same overall structure and are known collectively as immunoglobulins," (Janeway et al., hnmunobiology: The Immune System in Health and Disease, 4^th Ed., Garland Publishing, New York, NY (1999)). Antibodies can be either monoclonal or polyclonal, both of which are included in the present invention. Fragments of an antibody, including, for example, an Fab fragment and an F(ab )' fragment, that retain the ability to recognize and bind specifically to the antigen are also included in the present invention. One in the art will appreciate that the above-listed amino acid sequences to which the present inventive antibodies bind serve as epitopes. The term "epitope," which is the singular form of "epitopes" as used herein, refers to "a site on an antigen recognized by an antibody" and is known as an antigenic determinant, (Janeway et al. (1999), supra). [0043] Methods of making antibodies are known in the art. See, for example, Harlow et al., Antibodies: A Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY (1988) and Harlow et al., Using Antibodies: A Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY (1999)). EXAMPLES

The following examples further illustrate the invention but, of course, should not be construed as in any way limiting its scope.

The following references, to the extent that they provide exemplary procedural or other details supplementary to those set forth herein, are specifically incorporated herein by reference:

Birren et al., Genome Analysis: A Laboratory Manual Series, Volume 1, Analyzing DNA, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY (1997),

Birren et al., Genome Analysis: A Laboratory Manual Series, Volume 2, Detecting Genes, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY (1998),

Birren et al., Genome Analysis: A Laboratory Manual Series, Volume 3, Cloning Systems, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY (1999),

Birren et al., Genome Analysis: A Laboratory Manual Series, Volume 4, Mapping Genomes, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY (1999),

Harlow et al., Antibodies: A Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY (1988),

Harlow et al., Using Antibodies: A Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY (1999),

Hoffman, Cancer and the Search for Selective Biochemical Inhibitors, CRC Press (1999),

Pratt, The Anticancer Drugs, 2nd edition, Oxford University Press, NY (1994), and

Sambrook et al., Molecular Cloning: A Laboratory Manual, 2nd edition, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY (1989).

[0044] Abbreviations

[0045] For convenience, the following abbreviates are used herein: Clorf28, Homo sapiens Chromosome 1 open reading frame 28; HPT-JT, hyperparathyroidism-jaw tumor syndrome cM, centiMorgan; HRPT2, hyperparathyroidism 2; NCBI, National Center for Biotechnology Information; PCR, polymerase chain reaction; t-BOC, t-butyloxycarbonyl; Fmoc, 9-fluorenyhnethyloxycarbonyl; HPLC, high performance liquid chromatography; cDNA, complementary DNA; mRNA, messenger RNA; UV, ultraviolet, FIHP, familial isolated primary hyperparathyroidism, CEPH, Centre d'Etude du Polymorphisme Humain; and RACE, random amplification of cDNA ends. [0046] Example 1

[0047] This example describes the collection of families used in the study aimed at identifying the gene that is mutated in HPT-JT.

[0048] A total of 31 multiplex kindreds were included in the study based upon the presence of familial hyperparthyroidism. A number of these kindreds has been described elsewhere and showed linkage to Iq24-lq32 (Dinnen et a\., JClin Pαthol. 30(10): 966-75 (1977); Szabo et all 995, supra; Teh et al., ClinicalEndocrin. Metab. 81: 4204-4211 (1996); Hobbs et al. 1999, supra; Wassif et al., Clin. Endocrinol. (Oxf.) 50: 191-196 (1999); Williamson et al, J. Bone Miner. Res. 14: 230-239 (1999); Haven et al. 2000, supra; Cavaco et al. 2001, supra; and Simonds, Medicine (Baltimore) 81: 1-26 (2002)). Of these 31 kindreds, twenty-three have HPT-JT based on the presence of two or more affected individuals with hyperparathyroidism, and either parathyroid cancer, ossifying jaw tumors, or kidney tumors. The remaining eight kindreds are familial isolated primary hyperparathyroidism (FIHP) kindreds, with evidence of linkage at Iq24-q32 and no mutations in the MEN1 gene (personal communication with Maurine Hobbs and Teh et al., J. Clin. Endocrinol. Metab. 83: 2114-2120 (1998)).

[0049] Example 2

[0050] This example demonstrates genotyping for the identification of critical recombinants.

[0051] Genomic DNA samples from 27 families were genotyped using 26 short tandem repeat microsatellite markers in the chromosome Iq24-q32 region of interest. Primer sequences for the microsatellite repeat markers can be obtained from the Genome Database at www.gdb.org. PCR reactions were set up using a TECAN Genesis200 robot (Tecan, Foster City, CA). PCR amplification was done in 15 μl reactions using GeneAmp 9600 thermocyclers (Applied Biosystems) and using standard conditions. Depending on the PCR yield, 5-15 μl of product was combined from up to 12 individual markers of appropriate size and fluorescent label. PCR products were separated using the ABI 377 DNA sequencer (Applied Biosystems), which allows multiple fluorescently-labeled markers to be co- electrophoresed in a single lane. The ROX 400 size standard (Applied Biosystems) was run as an internal size-standard in each lane (Applied Biosystems). Allele sizes were calculated using the local southern algorithm available in the GENESCAN software program (Applied Biosystems). Allele calling and binning were performed using the GENOTYPER software (Applied Biosystems). A Centre d'Etude du Polymorphisme Humain (CEPH) control individual (1347-02) was included in the genotyping analysis for quality control purposes. [0052] Of the twenty-seven kindreds that were genotyped, only 18 were informative for genetic analysis. Although no new distal recombination events were identified, a novel proximal recombination event between D1S238 and D1S461 in Kindred-02 reduced the candidate interval by 3cM. The distal recombination event in Kindred-03 has been previously described (Haven et al. (2000), supra). Although additional markers at the distal end of the region were used, no further recombination events were identified in this kindred. Therefore, the genetic locus was reduced from 15cM to 12cM flanked by D1S238 and D1S477.

[0053] This example demonstrates that the critical region in which the gene that is mutated in HPT-JT is located between D1S238 and D1S477 and is 12 cM in length.

[0054] Example 3

[0055] This example identifies candidate genes in the interval flanked by D1S238 and D1S477 that might be mutated in HPT-JT.

[0056] The UCSC Human Genome Project Working Draft (Browser: August 2001 freeze) (http://genome.cse.ucsc.edu was analyzed for the identification and detailed mapping of transcripts located within the HPT-JT critical interval (Carpten et al., Genomics 64(1): 1-14. (2000); and Sood et al. (2001), supra). The region flanked by D1S238 and D1S477 contains 67 candidate genes, including known genes, full-length cDNAs with no homology to known genes, spliced ESTs, and predicted genes. Candidate genes were prioritized for mutational analysis on the basis of their predicted expression in tissues affected in the HPT-JT syndrome, including parathyroid, bone, and kidney, in addition to their predicted function, as derived by proven experimental or putative bioinformatics data. Table 1 lists high priority genes that were analyzed for mutations.

Table 1. High priority genes analyzed for mutation

[0057] This example identifies the genes that could be mutated in HPT-JT.

[0058] Example 4

[0059] This example demonstrates the analysis of DNA samples for mutations and the analysis of the gene identified as the one, which is mutated in HPT-JT.

[0060] Mutational analysis was performed on a panel of 31 DNA samples, each representing one affected individual from a different kindred. Eighty coding exons, representing approximately 20 kilobasepairs (kb) of human genomic DNA, were analyzed for mutations in this dataset by double-stranded DNA sequencing of PCR-amplified DNA. PCR reactions for individual exons were performed in 50 μl reaction volumes containing 20 ng of genomic DNA, PCR buffer (Invitrogen, Carlsbad, CA), 2.25 mM Mg²⁺, 250 nM dNTPs, 10 pmol M13-tailed-forward/reverse primer mix (see Table 2), 0.06 unit Platinum Taq DNA polymerase (Gibco BRL), and 0.06 unit AmpliTaq Gold (PE Biosystems, Foster City, CA). PCR cycles consisted of an initial denaturation at 94°C for 12 min, followed by 10 cycles of 94°C for 20 sec, annealing for 20 sec, 72°C for 20 sec, then 25 cycles of 89°C for 20 sec, annealing for 20 sec, 72°C for 20 sec and a final extension at 72°C for 10 min. The annealing temperature for all primer sets, except for the primer set for exon 1, was 57°C. For the exon 1 primer set, Pfu Turbo Taq polymerase (Stragene, La Jolla, CA) was used instead of Platinum Taq DNA polymerase and the annealing temperature was 59°C. A 5 μl aliquot of PCR product from each reaction was analyzed on 2% agarose gels to determine robustness of amplification.

Table 2. Forward and reverse primer pairs

[0061] The subsequent PCR products were purified using the QiaQuick PCR purification kit on the BioRobot 8000 Automated Nucleic Acid Purification and Liquid Handling system (Qiagen, Valencia, CA). Quarter volume cycle sequencing reactions were prepared in 96 well format using standard Ml 3 forward and reverse primers with the Big Dye ™ Terminator Chemistry (PE/ Applied Biosystems). Following sephadex purification, sequence products were separated on a 3700 Capillary DNA Analyzer (PE/Applied Biosystems) using manufacturer's protocols. Sequence chromatograms were aligned and analyzed using Sequencher version 4.1 (Gene Codes, Ann Arbor, MI). For PCR products containing potential frameshift mutations, PCR products from patients were subcloned using the TOPO TA-cloning system (Invitrogen) according to the manufacturer's recommendations. Positively selected subclones were grown in 3 ml of LB broth supplemented with the appropriate antibiotic selection. DNA from subclones was prepared using the Qiagen Miniprep Plasmid Purification System (Qiagen). Plasmid DNA was sequenced with the standard T7 and Ml 3 reverse primers using Big Dye ™ Terminator Chemistry (PE/Applied Biosystems).

[0062] Upon analysis of sequence data from the initial set of prioritized candidate genes, only the Clorf28 gene (AF312865; Unigene cluster Hs.5722) showed likely disease- causing mutations. A total of 11 different germline mutations were identified in 12 of the 31 probands screened. These included an initiation codon missense mutation, two nonsense mutations, and a series of frameshift mutations, including a 20 bp duplication, and a series of small nucleotide deletions and insertions (see Figure 1). One frameshift mutation, a 2bp insertion within exon 7, was found in two independently ascertained, seemingly unrelated kindreds, Kindred-01 and Kindred-33. Interestingly, Kindred-33 is an FIHP family. Initially, a disease haplotype could not be constructed for Kindred-33, due to a lack of typed affected relatives, so it was not included in the recombinant study. However, the proband's genotype turned out to be compatible with the presence of a haplotype identical to the affected haplotype of Kindred-01 along the entire 26 markers interval. This suggested that these two kindreds shared a common ancestor, a relatively small number of generations ago. All mutation carriers were heterozygous, and none of these mutations was found in 100 control chromosomes. ,

[0063] This example demonstrates the mutations that were discovered in the Clorf28 gene of HPT-JT kindreds.

[0064] Example 5

[0065] This example demonstrates the characterization of Clorf28 through computer database mining.

[0066] C 1 orf28 was previously reported as part of a comprehensive characterization of transcripts mapping to Iq24-q32 (Sood et al. (2001), supra). Analysis of Unigene cluster Hs.5722 cDNA library information shows that this gene is represented in cDNA libraries from all tissues of interest (parathyroid, kidney and bone), but is probably ubiquitously expressed. Genomic structure reveals that the Clorf28 gene consists of 17 exons. Alignment of EST and full-length cDNA sequences from Unigene cluster Hs.5722 revealed an open reading frame of 1596 nucleotides encoding a 531 amino acid protein of unknown function. A 5' random amplification of cDNA ends (RACE) reaction identified an upstream stop codon, suggesting that the 5' end of the gene has been cloned and the true initiation codon has been identified. A poly-A signal also has been detected, and these data, taken together, suggest a full-length sequence of approximately 2.6 kb for this transcript. [0067] Clorf28 is evolutionarily conserved, as full or partial cDNA sequences or open reading frames from C.elegans (NM_068064), Drosophila (AY061525), and mouse (BI083367) were identified by BLAST of the nonredundant nucleotide database (http://www.ncbi.nlm.nih.gov/BLAST/). The amino acid sequence of the Clorf28 protein was aligned against the Drosophila and C.elegans protein sequences to assess the amino acid identities and similarities for this protein across remote species. The human Clorf28 protein has 54% identity and 67% similarity to the Drosophila protein and has 25% identity and 45% similarity to the C.elegans protein. Drosophila and C.elegans share 26% identity and 45% similarity between their respective protein sequences. No functional data is available for the C.elegans ox Drosophila proteins and there are no significant homologies or similarities to known protein domains. However, there is moderate identity (32%) and similarity (54%) to an S.cerevzsz^'αe protein known as CdC73p (NP_013522), which is an accessory factor associated with an alternative RNA polymerase II important for the expression of a subset of yeast genes (Shi et al, Mol. Cell. Biol. 17: 1160-1169 (1997); Kerkmann et al., Curr. Genet. 39: 284-290 (2001)). Alignment of CdC73p to the human, Drosophila, and C.elegans proteins show that the identity and similarity of CdC73p to the other three proteins is primarily at the carboxy end, whereas the identity and similarity of the human, Drosophila, and C.elegans proteins is more evenly distributed throughout the sequence.

[0068] This example demonstrates that Clorf28 is an evolutionarily conserved open reading frame of 1596 nucleotides that encodes a 531 amino acid protein of unknown function.

[0069] Example 6

[0070] This example demonstrates the confirmation of the transcript size(s) and tissue distribution pattern of Clorf28.

[0071] Northern blots with mRNA from multiple human tissues were purchased from

Clontech. MTNl blots were hybridized with PCR products spanning the coding region of the Clorβ8 mRNA sequence. The probes were labeled with γ-³²P-dCTP by random priming (Stratagene) following the manufacturer's recommendations: Hybridization was carried out at 42°C overnight in Hybrisol 1 hybridization buffer (Intergen, Norcross, GA) followed by stringent washing. Filters were subsequently subjected to autoradiography. [0072] Northern analysis using a probe derived from the Clorf28 coding region reveals a major band of 2.6 kb, which correlates well with the size of the cloned sequence for this gene. There are at least three other bands migrating above 4.4 kb in all tissues analyzed. [0073] This example demonstrates that the Clorf28 gene is 2.6 kb in length and is expressed in parathyroid, bone, and kidney.

[0074] All references, including publications, patent applications, and patents, cited herein are hereby incorporated by reference to the same extent as if each reference were individually and specifically indicated to be incorporated by reference and were set forth in its entirety herein.

[0075] The use of the terms "a" and "an" and "the" and similar referents in the context of describing the invention (especially in the context of the following claims) are to be construed to cover both the singular and the plural, unless otherwise indicated herein or clearly contradicted by context. The terms "comprising," "having," "including," and "containing" are to be construed as open-ended terms (i.e., meaning "including, but not limited to,") unless otherwise noted. Recitation of ranges of values herein are merely intended to serve as a shorthand method of referring individually to each separate value falling within the range, unless otherwise indicated herein, and each separate value is incorporated into the specification as if it were individually recited herein. All methods described herein can be performed in any suitable order unless otherwise indicated herein or otherwise clearly contradicted by context. The use of any and all examples, or exemplary language (e.g., "such as") provided herein, is intended merely to better illuminate the invention and does not pose a limitation on the scope of the invention unless otherwise claimed. No language in the specification should be construed as indicating any non- claimed element as essential to the practice of the invention.

Preferred embodiments of this invention are described herein, including the best mode known to the inventors for carrying out the invention. Variations of those preferred embodiments may become apparent to those of ordinary skill in the art upon reading the foregoing description. The inventors expect skilled artisans to employ such variations as appropriate, and the inventors intend for the invention to be practiced otherwise than as specifically described herein. Accordingly, this invention includes all modifications and equivalents of the subject matter recited in the claims appended hereto as permitted by applicable law. Moreover, any combination of the above-described elements in all possible variations thereof is encompassed by the invention unless otherwise indicated herein or otherwise clearly contradicted by context.

Claims

WHAT IS CLAIMED IS:

1. An isolated or purified oligonucleotide consisting essentially of the nucleotide sequence of Homo sapiens chromosome 1 open reading frame 28 (Clorf28) (SEQ ID NO: 1) and comprising a mutation, or a fragment of the isolated or purified oligonucleotide, wherein the fragment comprises the mutation.

2. The isolated or purified oligonucleotide of claim 1 , wherein the mutation is located in an exon of the Clorf28 gene selected from the group consisting of exon 1, exon 2, exon 3, exon 4, exon 5, exon 7, and exon 14.

3. The isolated or purified oligonucleotide of claim 2, wherein the mutation is selected from the group consisting of: a substitution of G at nucleotide position 3 of the Clorf28 coding sequence with A, an insertion of GCAGTGCTTAGCGTCCTGCGAACAGTGCTTAGCGTCCTACG (SEQ ID NO: 25) after the G at nucleotide position 26 of the Clorf28 coding sequence, a deletion of nucleotides 34-40, which consists of the sequence AACATCC (SEQ ID NO: 26), of the Clorf28 coding sequence, a deletion of C at nucleotide position 39 of the Clorf28 coding sequence, a substitution of C at nucleotide position 165 of the Clorf28 coding sequence with G, a mutation comprising a deletion of nucleotides 306-307, which consists of the sequence GT, from the Clorf28 coding sequence and a deletion of the nucleotides GTGAGTACTTTTT (SEQ ID NO: 27) from the intron that is 3' to nucleotide position 307, a deletion of A at nucleotide position 356 of the Clorf28 coding sequence, a substitution of A at nucleotide position 406 of the Clorf28 coding sequence with T, a deletion of T at nucleotide position 636 of the Clorf28 coding sequence, an insertion of AG after the G at nucleotide position 688 of the Clorf28 coding sequence, and a deletion of A at nucleotide position 1238 of the Clorf28 coding sequence.

4. The isolated or purified oligonucleotide of claim 3, wherein the oligonucleotide consists essentially of a nucleotide sequence selected from the group consisting of SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, and SEQ ID NO: 12.

5. A vector comprising the isolated or purified oligonucleotide, or the fragment thereof, of any of claims 1-4.

6. A cell comprising the isolated or purified oligonucleotide of any of claims 1 - 4, optionally in the form of a vector.

7. An isolated or purified polypeptide encoded by the isolated or purified oligonucleotide, or fragment thereof, of any of claims 1-4.

8. The isolated or purified polypeptide of claim 7, wherein the polypeptide consists essentially of an amino acid sequence selected from the group consisting of SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ED NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ED NO: 23 and SEQ ID NO: 24.

9. An isolated or purified oligonucleotide consisting essentially of a nucleotide sequence selected from the group consisting of:

SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 40, SEQ ID NO: 41, SEQ ED NO: 42, SEQ ID NO: 43, SEQ ID NO: 44, SEQ ID NO: 45, SEQ ID NO: 46, SEQ ED NO: 47,

SEQ ID NO: 48, and SEQ ID NO: 49.

10. A method of detecting Hyperparathyroidism- Jaw Tumor Syndrome (HPT- JT) or a predisposition to HPT-JT in a human, which method comprises detecting at least one mutation in the nucleotide sequence of Clorf28 in a test sample comprising a nucleic acid comprising the nucleotide sequence of Clorf28 obtained from the human, whereupon the presence of at least one mutation in the nucleotide sequence of Clorf28 in the test sample is indicative of HPT-JT or a predisposition to HPT-JT in the human.

11. The method of claim 10, in the nucleotide sequence of C 1 orf28 in the test sample wherein the at least one mutation is located in an exon of the Clorf28 gene selected from the group consisting of exon 1, exon 2, exon 3, exon 4, exon 5, exon 7, and exon 14.

12. The method of claim 11, wherein the at least one mutation is selected from the group consisting of: a substitution of G at nucleotide position 3 of the Clorf28 coding sequence with A, an insertion of GCAGTGCTTAGCGTCCTGCGAACAGTGCTTAGCGTCCTACG (SEQ ID NO: 25) after the G at nucleotide position 26 of the Clorf28 coding sequence, a deletion of nucleotides 34-40, which consists of the sequence AACATCC (SEQ ID NO: 26), of the Clorf28 coding sequence, a deletion of C at nucleotide position 39 of the Clorf28 coding sequence, a substitution of C at nucleotide position 165 of the Clorf28 coding sequence with G, a mutation comprising a deletion of nucleotides 306-307, which consists of the sequence GT, from the Clorf28 coding sequence and a deletion of the nucleotides GTGAGTACTTTTT (SEQ ID NO: 27) from the intron that is 3* to nucleotide position 307, a deletion of A at nucleotide position 356 of the Clorf28 coding sequence, a substitution of A at nucleotide position 406 of the Clorf28 coding sequence with T, a deletion of T at nucleotide position 636 of the Clorf28 coding sequence, an insertion of AG after the G at nucleotide position 688 of the Clorf28 coding sequence, and a deletion of A at nucleotide position 1238 of the Clorf28 coding sequence.

13. The method of claim 12, wherein the nucleotide sequence of C 1 orf28 consists essentially of a nucleotide sequence selected from the group consisting of SEQ ID NO: 2, SEQ ED NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ED NO: 7, SEQ ID NO: 8, SEQ ED NO: 9, SEQ ED NO: 10, SEQ ID NO: 11, and SEQ ID NO: 12.

14. The method of any of claims 10-13, wherein the method comprises detecting the at least one mutation in Clorf28 using at least one isolated or purified oligonucleotide consisting essentially of a nucleotide sequence selected from the group consisting of:

SEQ ED NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 40, SEQ ID NO: 41, SEQ ID NO: 42, SEQ ID NO: 43, SEQ ID NO: 44, SEQ ID NO: 45, SEQ ID NO: 46, SEQ ID NO: 47, SEQ ID NO: 48, and SEQ ED NO: 49.

15. A method of detecting HPT-JT or a predisposition to HPT-JT in a human, which method comprises detecting a mutated Clorf28 protein in a test sample comprising a Clorf28 protein obtained from the human, whereupon the presence of a mutated Clorf28 protein in the test sample from the human is indicative of HPT-JT or a predisposition to HPT-JT in the human.

16. The method of claim 15, wherein the mutated Clorf28 protein is mutated within exon 1, exon 2, exon 3, exon 4, exon 5, exon 7, or exon 14 of the Clorf28 coding sequence.

17. The method of claim 16, wherein the mutated Clorf28 protein: comprises the first 10 amino acids of a wild-type Clorf28 protein and further comprises CLASCEQCLASYDSTTSRRRRLW (SEQ ID NO: 28) after QIO, comprises the first 10 amino acids of a wild-type Clorf28 protein and further comprises YRRRRLW (SEQ ID NO: 29) after QIO, comprises the first 12 amino acids of a wild-type Clorf28 protein and further comprises RRRRLW (SEQ ID NO: 30) after 112, consists essentially of the first 54 amino acids of a wild-type Clorf28, comprises the first 102 amino acids of a wild-type Clorf28 protein and further comprises NCSQS (SEQ ED NO: 31) after A102, comprises the first 118 amino acids of a wild-type Clorf28 protein and further comprises RDLLKSNELQMKF (SEQ ID NO: 32) after LI 18, comprises the first 212 amino acids of a wild-type Clorf28 protein and further comprises LWMLR (SEQ ID NO: 33) after S212, comprises the first 234 amino acids of a wild-type Clorf28 protein and fiirther comprises EYGGHEQLSYKAQEREFPRTFLQFFNL (SEQ ID NO: 34) after R234, or comprises the first 414 amino acids of a wild-type Clorf28 protein and further comprises HQGALQLVLQYLIE (SEQ ID NO: 35) after M414.

18. The method of claim 17, wherein the mutated Clorf28 protein is detected using an antibody that binds to an amino acid sequence of a of a mutant C 1 orf28 protein selected from the group consisting of SEQ ID NO: 28, SEQ ED NO: 29, SEQ ID NO: 30, SEQ ED NO: 31, SEQ ID NO: 32, SEQ JD NO: 33, SEQ JD NO: 34 and SEQ ID NO: 35.

19. An isolated or purified antibody that binds to the amino acid sequence CLASCEQCLASYDSTTSRRRRLW (SEQ JD NO: 28), YRRRRLW (SEQ ED NO: 29), RRRRLW (SEQ ID NO: 30), NCSQS (SEQ ED NO: 31), RDLLKSNELQMKF (SEQ JD NO: 32), LWMLR (SEQ JD NO: 33), EYGGHEQLSYKAQERIFPRTFLQFFNL (SEQ ED NO: 34), or HQGALQLVLQYLIE (SEQ ID NO: 35) of a mutant Clorf28 protein.