WO2003062832A1 - Fertility screening method and kit - Google Patents

Abstract

A method is provided for assessing the fertility status of a mammalian female which comprises determining the level of tm-HB-EGF in a sample of endometrial tissue within the implantation window time for the female, and correlating the appearance of tm-HB-EGF with fertility status. Diagnostic kits are described for carrying out the method as well as contraceptive and pharmaceutical compositions comprising modulators of HB-EGF production.

Description

Fertility Screening Method and Kit

Heparin-binding epidermal growth factor (HB-EGF) is a member of the EGF growth factor family which has been implicated in a variety of biological processes such as wound healing, tumour growth, smooth muscle cell hyperplasia, angiogenesis and reproduction ([Higashiyama et al , Science, 251:936-9,1991]; reviewed in [Raab et al , Biochim Biophys Acta., 1333: F179-99, 1997] [Arkonac et al , Biol Chem., 10; 273(15) :9352, Apr 1998]) . HB-EGF is expressed by many cell types [Abraham et al , Biochem Biophys Res Commun. , 190:125-33, 1993] [Kennedy et al, Biol Reprod. , 50:751- 6, 1994] [Vaughan, Biochem., 287:681-4, 1992] [Yoshizumi et al, Biol Chem., 268:9467-9, 1992] [Yoo et al, Dev Genet., 21:102-8, 1997]. It is synthesised as a 208 acid transmembrane precursor (tm-HB-EGF) containing EGF, heparin-binding and transmembrane domains. The extracellular domain can be released as a soluble form of HB-EGF (sol -HB-EGF) , probably as a result of the action of metalloproteinases [Higashiyama et al , Biol Chem., 267:6205-12, 1992] [Suzuki et al , Biol Chem., 272:31730-7, 1997] [Izumi et al , E bo J. , 17:7260-72, 1998] , although a substantial amount of transmembrane precursor remains uncleaved on the cell surface

[Goishi et al, Mol Biol Cell., 6:967-80, 1995].

Both tm- and sol- forms of HB-EGF are biologically active. Tm-HB-EGF is a juxtacrine growth factor with diverse functions in that it can either stimulate [Goishi et al, Mol Biol Cell., 6:967-80, 1995] [Higashiyama et al, J Cell Biol., 128:929-38, 1995] or suppress [Miyoshi et al, Biol Chem., 272:14349-55, 1997] [Iwamoto et al, Biol Chem., 274:25906-12, 1999] .the proliferation of the neighbouring cells, mediate cell attachment [Raab et al, Development., 112:637-45, 1996], serve as a survival [Takemura et al, Biol Chem., 272:31036-42, 1997] [Miyoshi et al , Biol Chem., 272:14349-55, 1997] or apoptosis-inducing factor [Iwamoto et al, Biol Chem., 274:25906-12, 1999], and is the receptor for diphtheria toxin [Naglich et al, Cell., 69:1051-1061, 1992] . Sol-HB-EGF acts as a potent paracrine and autocrine growth factor and chemotactic agent for many cell types such as vascular smooth muscle cells, keratinocytes, fibroblasts and cardiomyocytes [Higashiyama et al, Science^'., 251:936-9, 1991] [Wilson et al, Exp Eye Res., 59:665-78, 1994] [Kiso et al , Hepatology, 22:1584-90, 1995] [Hashimoto et al, Biol Chem., 269:20060-6, 1994] [Mishima et al , Acta Neuropathol Berl . , 96:322-8, 1998] [Elenius et al, Embo J., 16:1268-78, 1997].

Results from animal models suggest that HB-^'EGF may have an important function in reproduction in rodents. The spatio-temporal expression of HB-EGF suggests a function in rodent uterine receptivity and implantation of the rodent blastocyst . Expression of HB-EGF in the endometrium of rats is regulated by steroid hormones, progesterone and estradiol [Zhang et al, Endocrinology, 134:1089-94, 1994]. In the mouse endometrium, HB-EGF mRNA can be detected at the site of blastocyst apposition, prior to blastocyst implantation [Das et al , Development, 120:171-83, 1994] . Moreover, 32D cells engineered to express tm- HB-EGF adhere to mouse preimplantation blastocysts, but cells expressing sol-HB-EGF do not [Raab et al,

Development, 122:637-45, 1996]. The observation that the targeted disruption of ErbB4 in the mouse does not prevent embryo implantation [Gassmann, M. et al . , Nature 378, 390-394, 1995] may reflect species- specific differences in implantation between the rodent and the human, and/or promiscuity of the EGF- related family and its receptors in the implantation process. However the anatomy and physiology of the mouse and human female reproductive tracts are fundamentally different and therefore extrapolation of functional information from mouse to human, especially concerning implantation, cannot be assumed. HB-EGF mRNA was detected in human throughout the menstrual cycle [Birdsall et al, Mol Hum Repord. , 2:31-4, 1996] and was increased prior to the "implantation window" (day 19-21 of the menstrual cycle) in human endometrium [Yoo et al , Dev. Genet., 21:102-8, 1997]. Immunohistochemical studies revealed that HB-EGF is expressed in the stroma of proliferating endometrium (day 5-14 of the cycle) and in the glandular and lumenal" epithelium where expression of HB-EGF increased during the period of "implantation window" [Yoo et al, Dev Genet., 21:102-8, 1997] [Leach et al , Clin Endocrinol Metab. , 84:3355-63, 1999]. Sol-HB-EGF also improves the development of mouse [Das et al, Development, 120:171-83, 1994] and in-vitro fertilised human [Martin et al, Hum Repod. , 13:1645-52, 1998] embryos to the blastocyst stage and subsequent hatching.

These data suggest a function for HB-EGF in endometrial receptivity. However, the exact function of both soluble and tm-HB-EGF remains poorly understood. In particular, the elucidation of the cellular and molecular aspects of this process remains an intractable problem due to the inevitable difficulties of working with physiologically relevant material .

The biological functions of both sol- and tm-HB- EGF are mediated by the receptors EGFR1 (HER1) and ErbB4 (HER4) . Sol-HB-EGF binds and activates EGF-R1

[Higashiyama et al, Science, 251:936-9, 1991] [Aviezer et al, Proc Natl Acad Sci USA, 91:12173-7, 1994] and induces tyrosine phosphorylation of ErbB4 in NIH 3T3 cells transfected with ErbB4 cDNA [Elenius et al Embo J. 16:1268-78, 1997]. Sol-HB-EGF stimulates proliferation, zona-hatching, outgrowth of trophoblast and tyrosine phosphorylation of EGF-R1 in mouse blastocysts [Das et al, Development, 120:1071-83, 1994] . It has also been suggested that HB-EGF binds to ErbB4 expressed on the trophectoderm of mouse blastocysts [Paria et al, Development, 126:1997-2005, 1999] . Interestingly, sol-HB-EGF has been reported _to act as chemotactic factor, but not as a mitogen for cells expressing ErbB4 , whereas sol-HB-EGF is both chemotactic and mitogenic in cells expressing EGF-R1 [Elenius et al Embo J. 16:1268-78, 1997] . Whatever the downstream effects, activation of these types of receptors is believed to be the consequence of a ligand induced receptor homo- or hetero-di erisation [Yarden et al , Biochemistry, 26:1443-1451, 1987] [Tzahar et al, EMBO Journal, 16:4938-4950, 1997] [Elenius et al Embo J. 16:1268-78, 1997] .

Expression of both receptors for HB-EGF, EGF-R1 and ErbB4, in the human endometrium has also been described [Niikura et al, Human Pathology, 27:282-289, 1996] [Srinivasan et al, Clin. Cancer Res., 5:2877- 2883, 1999] . Expression of EGF-R1 was shown to be. increased in stroma during the secretory phase of ^"the cycle [Moller et al Mol .Hum.Reprod, 7(1), 65-72, 2001]. There are, however, data showing higher levels of EGF- Rl in the endometrium during proliferative, compared to the secretory stages of the cycle [Konopka et al,

European Journal of Gynaecological Oncology, 19:93-97, 1998] . Expression of ErbB4 is also subject to changes during the cycle with higher levels of secretion in secretory glands compared to proliferative glands [Srinivasan et al , Clin. Cancer Res., 5:2877-2883, 1999] . However, the function and specificity of these receptors for both soluble and tm-HB-EGF in blastocyst implantation and in endometrium proliferation has not been established so far.

The inventors have now elucidated models for human embryo implantation and endometrium proliferation that allow the dissection of specific molecular events that occur during the implantation/ proliferation process in the human.

Further the inventors have identified a function for both soluble and tm-HB-EGF in the proliferative activity of stromal cells of the human endometrium. Also, they have determined for the first time a function for the transmembrane form of HB-EGF in implantation of the human blastocyst .

Finally, the inventors have identified the specific HB-EGF receptors involved in blastocyst attachment and endometrium proliferation. In particular, they have demonstrated that the function of HB-EGF in human embryo implantation is mediated via the receptor ErbB4 and that the proliferation of the human endometrium is mediated by EGF-R1.

Based on these observations, the inventors have developed assays for screening compounds capable of modulating the activity of HB-EGF, both sol-HB-EGF and tm-HB-EGF, its receptors and its interactions therewith. The elucidation of the mechanisms involved in human endometrium proliferation and blastocyst attachment has enabled the inventors to identify potential contraceptive or fertility agents, exhibiting specific activity in respect of the above target mechanisms. The screened compounds are potential fertility and/or contraceptive agents. Diagnostic assays are also provided for determining the fertility status of a human female.

Accordingly, in a first aspect, the invention provides a method for identifying a compound which modulates the binding of HB-EGF to an HB-EGF receptor and thereby identifying potential fertility enhancing and/or contraceptive agents, which method comprises: contacting the compound under test with an HB-EGF receptor or a biologically active portion thereof, in the absence or presence of HB-EGF, determining the binding .of HB-EGF to the receptor in the presence and absence of the test compound, determining the effect of the test compound on the binding of HB-EGF to said receptor and, thereby identifying a compound which modulates the binding of HB-EGF to said receptor.

Preferably, the HB-EGF receptor is EGF-R1 or Erb- B4. The assay can be a cell-free or cell-based. Preferably, the assay is carried out on physiologically-relevant cells expressing the desired EGF-R1 or Erb-B4 receptor. The cell, for example, can be a yeast cell or a cell of mammalian origin, such as human embryonal kidney cell line, HEK 293T. More preferably, the cell is an isolated human female endometrial cell, such as a stromal cell.

The method of the invention can advantageously be based upon a phosphorylation assay or upon a proliferation assay, both well known in the art..

Protocols for performing phosphorylation or proliferation assays are well known in the art, such as described in Sambrook et al . (Molecular Cloning: a Laboratory Manual, 1989) ; representative examples are given in the experimental part included herein. In short, the binding of ligands to the EGF family receptors, including EGF-Rl and Erb B4 results in activation of tyrosine kinase and in receptor phosphorylation. Compounds which modulate activation of EGF-Rl or Erb-B4 can be identified by detecting the effect on receptor phosphorylation.

Generally, the phosphorylation assay involves immunoprecipitation of cell lysates (previously exposed to HB-EGF) with an anti- EGF-Rl or ErbB4 antibody followed by Western blotting of the immuno precipitate with an anti-phosphotyrosine antibody.

More specifically, the tissue culture plates (6 well-plate) are coated with isolated cells expressing the desired receptor or with cells expressing said receptor. A sample containing the test compound in the absence or presence of recombinant HB-EGF (or a fragment of the protein which is still capable of binding to EGF-Rl or Erb-B4) is then added to the wells and the plates are incubated to allow time for binding of the test compound to the receptor. The wells are then washed; the cells are lysed, antibodies specific for the receptors are added and complexes are collected. Receptors which ^'have become phosphorylated can be detected via the antibodies specific for the phosphorylated complex and the type of receptor can be identified via an antibody specific for said receptor; this can easily be done by immuno blotting or Western- blotting. Western blotting is a well known technique for the analysis and identification or proteins. Generally, the complexes are separated by polyacrylamide gel electrophoresis and then transferred to a cellulose membrane or chemically treated paper to which the proteins bind; preferably, the complexes are transferred to a PVDF (Polyvinylidene Difluoride) membrane. Phosphotyrosines, EGF-Rl and/or Erb-B4 bound to the membrane are detected by overlaying the appropriate antibody, and bound specific antibodies detected by overlaying with a labelled secondary antibody followed by use of standard detection procedures for that label. For example, the secondary antibody may be an HPR-conjugated secondary antibody detected by standard chemi-immunescent detection procedures.

Antagonists will result in decreasing phosphorylation; agonists will result in increasing phosphorylation, as assessed by the intensity of the bands .

The method of the invention can also be based upon a proliferation assay. The effects of agonists/antagonists of HB-EGF receptors can be identified by measuring the effects on cellular growth or increase, after treatment with the compound. Cellular proliferation assays either directly measure effects on cell growth by counting the cells under microscope or using an electronic particle counter or indirectly, by measuring incorporation of radio-active cDNA precursors, by using chromogenenic dyes to quantitate total protein or by measuring the metabolic •activity of cellular enzymes.

The uptake of ³ [H] thymidine is a common method to indirectly determine cell number after treatment . This method requires a pulse of H³ thymidine followed by washing and counting in a scintillation counter. In these experiments, the wells of microtiter plates are coated with cells expressing the desired receptor. A sample containing the test compound in the absence or presence of recombinant HB-EGF (or fragment of the protein which is still capable of binding to EGF-Rl or Erb-B4) is then added to the wells and the plates are incubated to allow time for binding. ³ [H] thymidine is added to each well, cells are washed and harvested. The amount of incorporation of ³ [H] thymidine is determined by scintillation. Antagonists will result in decreasing thymidine uptake; agonists will result in increasing thymidine uptake.

The above-described method can be used to screen for agonists or antagonists of EGF Rl and/or Erb B4 receptors, and hence for compounds potentially capable of enhancing or inhibiting fertility. The screened compounds can respectively be useful as fertility enhancing agents or as contraceptive agents.

The invention further provides a method for identifying potential fertility enhancing and/or contraceptive agents, based on their capacity to bind HB-EGF receptors, which method comprises: expressing HB-EGF receptor proteins as dimers, contacting said dimers with the compound under test in the presence of a labelled tracer, said labelled tracer being subsequently detected by a conjugated counteragent , determining the binding of HB-EGF to said dimers in the presence and absence of the test compound, - . determining the effect of the test compound oh the binding of HB-EGF to said receptors and, thereby identifying a compound which modulates the receptor- ligand binding and therefore has potential as a fertility enhancing or contraceptive agent.

Preferably, HB-EGF receptor is EGF-Rl and/or Erb B4.

Preferably, the labelled tracer is biotinylated or iodinated HB-EGF; a preferred conjugated counteragent is streptavidin-HRP. The invention further provides a method for identifying potential fertility enhancing and/or contraceptive agents, which method comprises: contacting an HB-EGF producing cell with a compound under test, determining the amount of tm-HB-EGF expressed in the presence and absence of the test compound, determining the effect of the test compound on the amount of tm-HB-EGF expressed and thereby identifying a compound which modulates the production of tm-HB-EGF.

In another embodiment the invention provides a method for identifying potential fertility enhancing and/or contraceptive agents which method comprises contacting an HB-EGF producing cell with a compound under test, determining the amount of soluble HB-EGF secreted in the presence and absence of the test compound, determining the effect of the test compound on the amount of soluble HB-EGF secreted and thereby identifying a compound which modulates the production of soluble HB-EGF.

As used herein, the term soluble HB-EGF refers to -HB-EGF which has been released from any HB-EGF producing cell by the cell's natural mechanism and does not include HB-EGF which has been generated .from tm-HB-EGF by technical intervention of man. Tm-HB-EGF as used herein means an HB-EGF which includes an amino acid sequence encoding the transmembrane domain or an HB-EGF from which all or substantially all the transmembrane domain has been cleaved by a technical intervention of man.

Preferably, the HB-EGF producing cell is an isolated cell of mammalian origin, more preferably, - li ¬

the cell is an isolated human female endometrial stromal cell.

The aforesaid compound screening assay will preferably be carried out in a multiwell plate as is well-known to a person skilled in the art. The cells may be cultured for a suitable period, for example, from 24 to 27 hours in any tissue culture medium suitable for the purpose. For example, where isolated human female endometrial stromal cells are used, DMEM medium is found to be useful, although other suitable media would be well-known to those skilled in the art. The medium may be serum-free for part or all of the incubation period. In test wells the medium will include the compound under test while control wells will not. An inhibitor of protein translocation may be added to the wells.

For determining the amount of soluble HB-EGF, the culture media may be harvested and the resultant potential HB-EGF containing solution tested. Immunoassays are particularly advantageous for the purpose, making use of an antibody which recognises one or more epitopes of soluble HB-EGF, which antibody is conjugated to a molecule which facilitates identification by being a revealing label or being^" suitable for attachment in a revealing label. Such label may be radioactive, luminescent or flourescent or may be an enzyme .

The determination of HB-EGF may advantageously be based upon an enzyme-linked immunosorbent assay (ELISA) , well known in the art; protocols can be found for instance in Sambrook at al . (Molecular Cloning: a Laboratory Manual, 1989) ; representative examples are given in the experimental part included herein. ELISAs provide sensitive and quantitative detection of specific antigens or antibodies. A variety of ELISA formats can be employed. Commercially available ELISAs are often based on the antibody-sandwich format or double-layer variation. The sandwich ELISA generally requires two antibodies that are directed against a particular antigen. One antibody is passively adsorbed (coated) onto the surface of the wells of an ELISA plate. The wells are then "blocked" with a nonspecific protein solution to keep background levels low. The samples containing the antigen in solution are then added to the wells and incubated for a sufficient amount of time for the antigen to bind to the antibody immobilized on the plate. After washing the wells to remove the unbound reagents, the second antibody is added to the well. This second antibody binds to the immobilized antigen completing the sandwich. The second antibody is detected with an enzyme conjugate specific for the second antibody. Alternatively, the second antibody itself can be labelled for subsequent detection. When the enzyme substrate is added to the wells in the final step, the conjugated enzyme, and therefore the antigen, is detected by observing the colorimetric, flourescent or chemiluminescent reaction products -in an appropriate ELISA plate reader. In the double-^" layer technique, antigen is bound to the plastic surface (test tubes, wells or beads) followed by the test sample containing antibody, then the enzyme conjugate. Incubation complexes with a suitable substrate results in a coloured product which may be measured spectrophotometrically.

For determination of the amount of tm-HB-EGF the cells may be cultured in suitable media with or without test compounds as described above . As mentioned above, in addition the media can include an inhibitor of protein translocation, for example monensin to prevent release of HB-EGF from the cell . A suitable antibody specific for one or more epitopes of HB-EGF is added to the culture wells and the wells are washed whereby all but antibody bound to tm-HB-EGF is removed. A secondary antibody is then added, the qualitative signal from which will correlate with the amount of tm-HB-EGF expressed.

For example, wells are coated with an HB-EGF (or a biologically active portion thereof) , producing cell. A sample containing the compound under test together with monensin is then added to the wells and the plates are incubated to allow time for specific modulation of the HB-EGF production. The wells are blocked, for instance with a solution of BSA in PBS. A tag of primary antibody is then added; a suitable labelled antibody for example is biotinylated anti HB- EGF. Many other tag molecules which are equally suitable for this purpose are know in the art and commercially available. The wells are then washed and a secondary antibody with the appropriate specificity is added to the wells. The enzyme substrate is then added and bound proteins are detected, leading to the determination of the amount of tm-HB-EGF production.

In an alternative method for determining the amount of tm-HB-EGF expressed, the cells are cultured in the presence or absence of test compound as described above. The extra-cellular domain of tm-HB-

EGF is cleaved from the molecule using a suitable proteolyte enzyme. This may be achieved by adding the enzyme to the wells following culture of the cells or by adding an inducer of the cell's naturally occurring proteases. Suitable proteolytic enzymes which may be added include ADAM12 (Asahusa et al , 2002, Mature Med. 8., pp35-40) , MDC9/meltrin gamma/71DAM9 (Izumi et al, , 1998, EMBO J. 17, pp7260) or MMP3 (Suzuki et al , 1997, J. Biol. Chem. 272, pp31730-31737) . Preferred enzymes are metalloproteases . Suitable enzyme inducers are selected from phorbol ester PMA (Phorbol 12-myristate 13 acetate) , a metallo proteinase inducer, ionomycin and thapsigargin (Dehlefsen et al, (1998) , J. Cell Biochem, 69., ppl43-153) .

The use of enzymic cleavage effectively converts tm-HB-EGF to a soluble form which then may be measured as described above for soluble HB-EGF.

It will be appreciated that a wide variety of candidate compounds may be tested in the screening methods of the invention. Suitable test compounds may include, for example, compounds having a known pharmacological or biochemical activity, compounds having no such identified activity and completely new molecules or libraries of molecules such as might be generated by combinatorial chemistry. Compounds which are nucleic acids, including naturally occurring nucleic acids and synthetic analogues, polypeptides or proteins are not excluded.

Typically, compound screening assays involve - .

- running a plurality of assay mixtures in parallel with different concentrations of the compound under test . Typically, one of these concentrations serves as a negative control, i.e. zero concentration of test compound.

Compounds which are identifiable as having potential pharmacological activity using the methods of the invention may be used as lead compounds in the further development of drugs with pharmaceutical potential or may themselves be formulated into pharmaceutical compositions. The compounds screened in accordance with the present method can either increase or decrease HB-EGF production. They can respectively be useful as fertility agents or contraceptive agents.

According to a further aspect, the invention refers to the compounds identifiable by the above described methods .

In particular, the invention provides a method of producing a composition suitable for treating infertility in a female or suitable for use as a contraceptive agent in a female which comprises: a) carrying out any one of the compound screening methods described above; and b) formulating any compound identified as capable of modulation of ligand binding to an HB-EGF receptor or modulation of sol- and/or tm-HB-EGF production, into a pharmaceutical composition with a pharmaceutically acceptable carrier or diluent .

According to a further aspect, the invention relates to a method of inducing contraception in a- mammalian (preferably human) female which comprises administering to said female an inhibitor of sol- and/or tm-HB-EGF expression or an antagonist of an HB- EGF receptor. Contraceptive compositions are also provided comprising said inhibitor or antagonist together with a pharmaceutically acceptable carrier of diluent . Preferred receptors are HER1 and HER4.

According to yet a further aspect of the intention, the invention relates to a method of enhancing fertility in a mammalian (preferably human) female which comprises administering to said female an enhancer of sol- and/or tm-HB-EGF expression or an agonist of an HB-EGF receptor. Pharmaceutical compositions are also provided comprising said enhancer or agonist together with a pharmaceutically acceptable carrier or diluent. The use of said enhancer or agonist in the manufacture of a medicament for treatment of human female infertility is also provided.

The enhancer of sol- and/or tm-HB-EGF may be TNFα or TGFβ shown in Example 8 herein to stimulate sol- and tm-HB-EGF expression in endometrial stromal cells.

The contraceptive and pharmaceutical compositions of the present inventions are advantageously formulated for local application to the endometrium and suitable excipients for this purpose will be well- known to those skilled in the art. A gel or viscous tablet is may be used for delivery to the endometrium or tot he vagina or cervix.

The female reproductive tract is more accessible, for specific drug delivery than many other organ systems . The advantages of local application of therapeutic agents to the endometrium are that unwanted effects on other systems that might be induced by systemic drug delivery can be avoided, and the dose can be lower than with systemic administration of drugs. In infertility the need is to deliver drugs directly into the uterus or into the vagina from which natural diffusion may occur. Direct delivery to the uterine cavity is most readily achieved either by canulation to incorporate a molecule in a liquid medium as already occurs at embryo transfer in IVF with the use of transfer medium, or by instillation through the cervical canal by syringe placed at the cervix without canulation of the uterine cavity. Alternatively drug delivery to the upper vagina and cervix in the form of a viscous gel or tablet is a currently recognised route of drug delivery to this area.

According to a further aspect, the invention also provides a diagnostic test to assess fertility status in a female patient. Said test comprises: determining the level of tm-HB-EGF in a isolated endometrial sample within implantation window time for the patient, correlating the appearance of tm-HB-EGF with fertility status.

The above test is aimed at assessing levels of tm-HB-EGF during the implantation window in the endometrium of women.

As used therein, the term "implantation window" encompasses the window of time during which the uterine endometrium is receptive to the conceptus; in the human, this occurs in the secretory stage of the menstrual cycle. Implantation is defined as days 6-8 post the day of the luteinising hormone (LH) surge. The implantation window can be estimated on the basis of a regular menstrual pattern as approximately seven days before the expected first day of the menstrual period; alternatively, it may be determined by using the mid-cycle LH urine test (Clear-Plan Styx) to identify LH surge, starting at day 12 until the surge is detected. Any woman with infertility should have had ovulation confirmed.

The level of tm-HB-EGF expression may be determined in the endometrial sample by direct staining of the tissue sample, for example with a suitably labelled antibody specific for one or more eptiopes of tm-HB-EGF. Preferably the sample is obtained by pipette biopsy. A preferred method is described in Example 6 herein.

In addition the level of tm-HB-EGF expression my be determined by any of the methods already described herein and in particular by using the method involving the release of the extracellular domain of tm-HB-EGF by proteolytic cleavage followed by measurement of the amount of the cleaved product.

The HB-EGF levels may be correlated with endometrial receptivity and likelihood of conception.

Therefore, in yet a further embodiment of the invention, there is provided a kit for assessing the fertility status of a human female which comprises: antibody specific for one or more epitopes of tm-HB-EGF conjugated to a molecule or element facilitating its detection and a proteolytic enzyme and/or a compound for inducing proteolytic enzyme expression in a cell.

The proteolytic enzyme or enzyme inducing agent may be any one of the suitable enzymes and inducing

-agents already mentioned herein. More preferably, the antibody is conjugated to a revealing label or to a molecule such as biotin facilitating attachment of a revealing label. Preferably the revealing label is also an enzyme in which case the kit preferably also includes the substrate for said enzyme.

All documents cited herein are incorporated herein by reference .

The invention will be further understood with reference to the following experimental examples, together with the accompanying Figures in which:

Figure 1 shows the expression of HB-EGF protein throughout the cycle. Tissues derived from proliferative (A, C) and secretory (B) endometrium were sectioned and stained with anti tm-HB-EGF antibodies. Control staining was performed with control peptide (D) . Lumenal surface is marked by arrow. Scale bars in A B and C are 125mm each, bar in C is 50mm; Figure 2 shows the expression of ErbB4 in human endometrium throughout the cycle. Tissues derived from proliferative (A and C) and secretory (B) endometrium were sectioned and stained with anti ErbB4 antibodies. Control staining was performed with blocking peptide (D) . Scale bars in A, B and D are 100mm each, bar in C is 50mm;

Figure 3 shows the expression of tm-HB-EGF and HB-EGF receptors, EGF-Rl and ErbB4 in cultures of stromal cells. Stromal cells were grown on cover slips, fixed and stained as described in Materials and

Methods to detect tm-HB-EGF (A) , EGF-Rl (C) and ErbB4 (D) . Control staining was performed with either goat or mouse IgGs (B and E correspondingly) . Scale bar in each of the pictures is 10μm; Figure 4 shows that soluble HB-EGF stimulates-

•proliferation of stromal cells. Stomal cells derived from secretory (■) and proliferative (♦) endometrial samples were cultured in the media supplemented with different amounts of soluble HB-EGF. Proliferation was assessed by the incorporation of ³ [H] -thymidine .

Incorporation of ³ [H] -thymidine without HB-EGF was taken as 100%. Each value represents mean + SEM of three independent experiments. Proliferation was assessed in either serum free media (A) or in media supplemented with 5% charcoal stripped serum (B) ; Figure 5 shows that transmembrane HB-EGF stimulates proliferation of stromal cells. Stromal cells derived from secretory (dark bars) and proliferative (light bars) endometrial samples were overlaid with either media (1) or fixed CHO cells expressing transmembrane form of HB-EGF (2) or with fixed control cell line (3) and cultured in serum-free media for 18 hours. Proliferation was assessed by incorporation of ³ [H] -thymidine during the last four hours of incubation. Proliferation of stromal cells without CHO cells was taken as 100%. Displayed graph is a representation of a typical experiment which has been repeated at least three times. Each value shows mean of four replicas ± SEM. Dark bars represent stromal cells from secretory endometrium, light bars, stromal cells from proliferative endometrium;

Figure 6 shows that HB-EGF induces phosphorylation of EGF-Rl. Serum starved stromal cells were stimulated with either sol-HB-EGF (A) or tm-HB-EGF (B) . Control cells were treated with medium alone. Lanes 1 and 3, control cells. Lanes 2 and 4, HB-EGF treated cells. Whole cell lysates were prepared and immunoprecipitated with either anti-EGF-Rl or with anti-ErbB4. Samples were separated by SDS-PAGE (7.5%) and subjected to Western blotting with either anti- phosphotyrosine antibodies (A and B) , or with anti- EGF-R1 antibodies (panel C, lanes 1 and 2) and anti- ErbB4 antibodies (panel C, lanes 3 and 4) ;

Figure 7 shows that HB-EGF-induced proliferation of stromal cells is supressed by the EGF Rl tyrosine kinase inhibitor PD153035. Stromal cells derived from secretory stage endometrium were incubated in serum- free medium in the presence of HB-EGF (lOng/ml) , PD153035 (2mM) or combination of both. Each bar represents mean + SEM of three independent experiments ; Figure 8 shows that tm-HB-EGF is expressed on the apical surface of the luminal epithelium in the secretory stage of the cycle. Sections of human endometrium at different stages of the menstrual cycle stained for tm-HB-EGF (brown staining) . A

Proliferative; B Mid-secretory (day 22) ; C High magnification of mid-secretory endometrium showing apical staining for tm-HB-EGF on the luminal epithelium; D Section of tissue shown in B treated with anti-tm-HB-EGF pre-adsorbed with antigenic peptide showing negative staining;

Figure 9 shows expression and purification of HB- EGF-Fc. A SDS-PAGE of purified HB-EGF-Fc showing multiple bands between ~38-42 kDa. B Western blot of gel shown in A hybridised with anti-HB-EGF, confirming that the purified protein is HB-EGF-Fc ;

Figure 10 shows that human blastocysts attach to HB-EGF-Fc in a solid phase assay. Blastocysts cultured on a coverslip pre-coated with HB-EGF-Fc. A) low and B) high magnification of an expanded blastocyst. Blastocyst cultured on HB-EGF-Fc in the presence of sol-HB-EGF did not attach but remained expanded;

Figure 11 shows that human blastocysts attach to CHO/HB-EGF cells expressing tm-HB-EGF. A), B) Embryo cultured on CHO/HB-EGF attached and remained expanded at low and high magnification. C) , D) Degenerating Embryo cultured on CHO/vector at low and high magnification; Figure 12 shows that CHO/HB-EGF express HB-EGF on the cell membrane. A CHO/HB-EGF stained with anti-HB- EGF showing intense staining (green) on the cell surface. B CHO/vector showing negative staining; Figure 13 shows that human peri-implantation blastocysts express ErbB4 abundantly and EGF-Rl to a lesser extent on the surface of the trophectoderm adjacent to the inner cell mass. Day 8 blastocyst stained with anti-ErbB4 (green) , anti-EGF-Rl (red) and DAPI (blue) showing specific cell membrane localisation of ErbB4. EGF-Rl is localised in the inner cell mass, with some faint, punctate staining on the trophectoderm;

Figure 14 shows relative increase in levels of intracellular HB-EGF synthesised by endometrial stromal cells in response to 1 ηg and 10 ηg bFGF and TGFα; Figure 15 shows a standard curve for soluble HB- EGF when measured using a sandwich ELIZA in which the detection antibody is biotin-conjugated and steptavidin-HRP has been added together with TNB substrate; Figure 16 shows the total HB-EGF expression levels (sol + tm) of endometrial cells when stimulated with TMFα, TGFβ, EGF or bFGF;

Figure 17 shows the soluble HB-EGF expression level for endometrial cells when stimulated with TNFα or TGFβ respectively; and

Figure 18 shows the tm-HB-EGF expression levels when endometrial cells are stimulated with TNFα or TGFβ respectively.

Example 1 : Proliferation is mediated via EGF-Rl

Materials and Methods

Tissue samples Tissue samples were collected in accordance with the requirements of the Central Oxford Research Ethics Committee. Endometrial samples were obtained from patients aged 20-46 years undergoing hysterectomy for benign indications, who had a regular 26-33 day menstrual cycle, and who had received no hormonal medication in the preceding three months. The cycle stage of the endometrium was assessed according to Noye's criteria [Noyes et al , Fertility Sterility, 1:3-25, 1950] .

Immunohistochemistry Sections from tissue samples from 15 patients were prepared as described previously [Biddolph et al , Applied Immunohistochemistry and molecular morphology, 7:289-293, 1999]. Primary antibodies (goat anti-tm HB- EGF (Santa Cruz Inc., US) and mouse anti-ErbB4 (clone HFR1 [Srinivasan et al, Journal of Pathology, 185:2_36- 245, 1998]) were optimally diluted in PBS and applied to the sections for one hour at room temperature. Control staining was performed with the same antibodies pre-incubated with the corresponding control peptides. Sections were washed in three changes of PBS. Sections were incubated in peroxidase conjugated anti-goat or anti-mouse IgGs for one hour at room temperature and washed as above . Bound antibodies were detected with HRP substrate (Sigma Ltd. , UK) .

Cultures of endometrial stromal cells (see below) were stained by the use of immunofluorescent techniques. Stromal cells (3-5xl0⁴) were plated on glass cover slips (Chance Propper Ltd,^" UK) and cultured overnight . Cells were fixed for 5 minutes at room temperature with 3% paraphormaldehyde in PBS, permeabilised for 5 minutes with lOmM HEPES, pH7.4 , 200mM sucrose, 3mM MgCl₂, 50mM NaCl, 0.5% Triton-XlOO, 0.2% NaN₃ and blocked in 3% BSA in PBS. Cells were stained for one hour at room temperature with 4mg/ml of goat anti-HB-EGF (Santa Cruz Inc., US), 15mg/ml of HFR1, or 5mg/ml of mouse anti-EGF-Rl (PharMingen, US) . Goat and mouse IgG were used in negative control as appropriate. After washing with PBS cells were incubated for one hour at room temperature with either rabbit anti-goat FITC conjugated (Sigma Ltd. , UK) or with donkey anti-mouse Texas Red-conjugated IgG (Stratech Scientific Ltd., UK) antibodies diluted 1/75 in PBS. Cover slips were washed as above and mounted in Vectashield medium with DAPI (Vector Laboratories Inc., US) . The staining was observed using a LEITZ

DMRBE microscope (Leica Wetzlar, Germany) and Openlab imaging software (Improvision Inc, US) .

Isolation and culture of human endometrial stromal cells

Endometrial tissues were obtained from eight women: four specimens were from proliferative and four secretory endometrium. The endometrial stromal cells were isolated as described previously [Fernandez-Shaw et al, Hum. Repord. , 7:156-161, 1992]. Briefly, tissues were washed, minced into small pieces, digested with Type I collagenase (Worthington Biochemical Corporation, US) and filtered through two sieves (Lockertex, UK) . The filtrate containing stromal cells was centrifuged through a percoll gradient, the pellet washed with PBS and resuspended in culture medium. Cell viability was estimated by trypan blue exclusion in a counting chamber (Improved Neubauer ARH) . Cells were cultured in DMEM (Life Technologies Ltd., UK) supplemented with 10% foetal calf serum, 50IU/ml penicillin, and 50ng/ml streptomycin and passaged according to standard procedures. Cells between passages 2-6 were used in these experiments.

Proliferation assays

Stromal cells were plated (10⁴ cells/well) in 96 well plate in DMEM supplemented with 10% FCS, lOOIU/ml penicillin and lOOng/ml of streptomycin. After 24 hours the medium was changed to serum-free and incubated for 18 hours. Cells were stimulated with either recombinant HB-EGF (R&D systems Ltd. , UK) or PD153035 (Calbiochem) for 24 hours. lμCi H³-thymidine (Amersham Pharmacia Biotech, UK) was added to each well for the last 4 hours of incubation. Cells were washed 3 times in PBS, harvested, and the amount of incorporated H³-thymidine was determined using a b- ^■ plate counter (Wallac Ltd., Finland) .

Preparation of CHO cells expressing transmembrane HB- EGF Transmembrane HB-EGF cDNA was prepared by PCR amplification of the region of cDNA encoding amino acids 1-208 of HB-EGF [Higashiyama et al , Biol Chem., 267:6205-12]. The primers (5' TATCTAGACCACCATGAAGCTGCTGCCGTCGGTG and 3' TATCTAGATCAGTGGGAATTAGTCAT) introduced optimised Kozak sequence [Kozak et al, Cell., 44:283-292, 1986] and Xbal sites which were used for cloning into pEE14 vector (CellTech Ltd, UK) . The nucleotide sequence of the construct was confirmed by automated DNA sequencing. Stable transfectants CHO/TM HB-EGF cells were generated as described before [Bebbington et al , A Companion to Methods in Enzymology. , 2:136-145, 1991] . A control cell line was generated using a similar protocol by which cells were transfected with the pEE14 vector alone (CHO/vector) . Selection for- ^• amplification was performed in one step with 25μM of MSX (Sigma Ltd., UK).

Assessment of juxtacrine activity of HB-EGF Juxtacrine activity was measured using a modification of a method described previously [Takemura et al , Biol Chem. 272:31036-42, 1997]. Briefly, CHO/HB-EGF or CHO/vector cells were plated onto 10 cm dishes in GMEM (First Link Ltd., UK) containing 10% dialysed FCS, penicillin, streptomycin and 25μM of MSX (Sigma Ltd., UK) . When the cells reached confluence, the cultures were washed twice in 2NaCl in PBS and fixed with 3% paraformaldehyde in PBS for 5 min. The fixed cells were washed twice in DMEM containing 10% FCS, scraped from the plate and resuspended in serum-free DMEM. Fixed cells (10⁵) were added to each monolayer of stromal cells in 96-well plates (plated at 10⁴ cells/well) which had been previously serum-starved for 18 hours. The co-cultures were incubated in serum-free medium for 24 hours and the thymidine incorporation assays were performed as described above.

Immunoprecipitation and Western Blotting

Confluent stromal cells were starved in serum free medium for 18 hours, and then stimulated with lOOng/ml of HB-EGF or overlayed with fixed CHO/HB-EGF in serum-free DMEM for 3 min at 37°C Cells were placed on ice and washed two times with ice-cold PBS supplemented with 2mM orthovanadate. Cells were lysed for 10 min in 2mM orthovanadate, 2mM sodium fluoride, 2mM sodium pyrophosphate, 2mM PMSF, lOmg/ml leupeptin, lmg/ml pepstatin (RIPA buffer) . The cell lysates were clarified by microcentrifugation at 14,000rpm at 4°C . Equal volumes of supernatants were mixed with 5mg of either anti-EGF-Rl mouse monoclonal (PharMingen, US) or anti-ErbB4 rabbit polyclonal (Santa Cruz

Biotechnology Inc., US) antibodies. The lysates and antibodies were gently mixed for 24 hours at 4°C . The immune complexes were collected with protein-A sepharose (Amersham Pharmacia Biotech, UK) and were washed 3 times with lysis buffer. Proteins were separated by electrophoresis on 7.5% polyacrylamide gel and transferred to PVDF membrane (using Phast system, Amersham Pharmacia Biotech, UK) . The membranes were blocked in 5% milk in Tris-buffered saline containing 0.5% Tween-20. Phosphotyrosines were detected with antibody clone 4G10 (Upstate Biotechnology, US) . EGF-Rl and ErbB4 were detected in parallel blots hybridised with 2μg/ml of rabbit anti- EGF-Rl (Santa Cruz Biotechnology Inc., US) or rabbit anti-ErbB4 (Santa Cruz Biotechnology Inc., US) antibodies correspondingly.

Results

la) Expression of tm-HB-EGF in the human endometrium is modulated during the menstrual cycle

Tissue sections derived from proliferative and secretory stages of the cycle were stained with antibodies recognising tm-HB-EGF (Fig. 1) . The staining revealed that during proliferative stage tm- HB-EGF was localised in both the stroma and glandular epithelium. Staining was most intense in the basalis, decreasing in intensity through the functionalis, and not detectable in the area adjacent to the lumenal ^■ part of the endometrium (Fig. 1, A, C) . Staining for tm-HB-EGF in early- mid-secretory stage tissues was intense throughout the stroma and epithelium of both the basalis and functionalis layers of the endometrium (Fig. 1, B) . High magnification secretory stage tissues revealed intense, membrane-associated staining for tm-HB-EGF (Fig IC) . There was a punctate pattern of staining around the basal surface of glandular epithelium and some stromal cells. Staining with anti- HB-EGF pre-incubated with control peptide showed no cross-reactivity with tm-HB-EGF in any of the tissue samples (Fig. 1, D) .

lb) Expression of ErbB4 in human endometrium during the menstrual cycle

Immunohystochemical staining of tissue sections showed that during proliferative stage of the cycle there was expression of ErbB4 in the basalis, mainly in stroma and around blood vessels (Fig. 2, A, C) . Secretory stage endometrium was characterised by increased expression of ErbB4 in the stroma and in the glandular epithelium in both the basalis and functionalis layers (Fig. 2, B) . High magnification demonstrated positive staining on the apical, lateral and basal membranes of epithelium (Fig 2, C) , and in this respect the pattern of expression was similar to that seen for tm-HB-EGF. Sections incubated with HFR1 pre-adsorbed with the peptide antigen were negative_ (Fig 1, D) .

Ic) Expression of transmembrane HB-EGF, EGF-Rl and ErbB4 in cultures of endometrial stromal cells

Having demonstrated a similar pattern of expression of tm-HB-EGF and ErbB4 in endometrial tissue, the expression of both ligand and the receptor was determined in cultures of endometrial stromal cells. Stromal cell cultures either from proliferative or secretory endometrium stained with anti-tm-HB-EGF and HFR1 displayed a punctate pattern of staining reminiscent of that seen in tissue sections (Fig. 3, A) . Similar levels of expression of both receptors EGF-Rl and ErbB4 was detected in cells derived from

-both proliferative and secretory endometrium (Fig. 3, C and D) .

Id) Soluble and tm-HB-EGF promote proliferation of stromal cells

Having determined that expression of HB-EGF and its receptors in the endometrium is retained in endometrial stromal cell cultures, the possibility that HB-EGF may act as mitogen for endometrial cells is assessed. The effect of sol- and tm-HB-EGF on DNA synthesis was examined in H³-thymidine incorporation assays. In serum-free medium sol-HB-EGF did not have any effect on DNA synthesis in cells derived from the proliferative stage of the cycle. However DNA synthesis was increased 2.5-fold in cells derived from secretory stage endometrium compared to controls (Fig. 4, A) . In the presence of 5% charcoal stripped serum both proliferative and secretory cells responded to sol-HB-EGF by 3-fold and 6-fold compared to untreated controls. This response was thus two-fold higher in secretory cells compared to proliferative cells (Fig:.. 4,B) .

Results show that HB-EGF can act as such a mediator and contribute to endometrial maturation by promoting the proliferation of endometrial stromal cells. Cells derived from proliferative and secretory endometrium responded differently to sol-HB-EGF. Present data demonstrate that cells from the proliferative endometrium do not proliferate in serum- free medium supplemented with HB-EGF. However, addition of 5% serum elicits a three-fold higher HB- EGF-dependent growth response in these cell lines. This suggests that stromal cells from the proliferative endometrium require additional factors to elicit a HB-EGF-dependent response.^' In contrast; - stromal cells derived from the secretory endometrium respond to sol-HB-EGF in serum free conditions with a two-fold increase in H³-thymidine incorporation. In serum-containing medium the response of these cells to HB-EGF is up to six-fold higher than in the control. These findings suggest that the capacity of endometrial cells to respond to growth factors can be dependent upon the stage of the cycle . Present data suggest that this capacity is retained when endometrial cells are put into culture. The results also suggest endometrial cells progress along a differentiation pathway and the differentiation status of the cells is captured at the point at which the cells are taken out of the endometrial environment and put into culture.

The juxtacrine activity of tm-HB-EGF in endometrial stromal cells has also been tested. Juxtacrine activity of tm-HB-EGF was determined in H³- thymidine incorporation assays in which cultures of endometrial stromal cells were overlaid with fixed CHO/HB-EGF, constitutively expressing full length HB_- EGF, and CHO/vector, a control cell line. In serum- free medium the CHO/HB-EGF preparation induced increase in H³-thymidine incorporation compared to CHO/vector in both proliferative and secretory stromal cells (Fig. 5) .

Results demonstrate the proliferative potential of tm-HB-EGF. In serum-free conditions, tm-HB-EGF CHO cells can promote proliferation of cells derived from both, proliferative and secretory endometrium. However the relative activity of cells overexpressing tm-HB- EGF was less than two fold higher than that of the control cell line and therefore less than the activity of sol-HB-EGF in serum-free conditions. These findings suggest that the molecular environment in which tm-HB- EGF resides may be critical for its activity. It has been shown previously that tm-HB-EGF forms a complex with DRAP27, a homologue of human CD9 antigen which upregulates functional receptors and diphtheria toxin sensitivity in mouse cell lines [Iwamoto et al, Embo

J., 13:2322-30, 1994]. In monkey Vero cells the HB- EGF/DRAP27 complex was shown to be associated with integrin a3bl and localized in cell-cell contact sites [Nakamura et al , J Cell Biol., 129:1691-705, 1995]. HB-EGF expressed on the membrane of CHO cells is associated with other membrane molecules that could modulate the proliferative function of HB-EGF. Indeed punctate staining of ErbB4 in tissues sections and ErbB4 and EGF-Rl in cultures of stromal cells suggested receptor clustering similar to that observed previously for another receptor of EGFR family, ErbB2 [Nagy et al , Journal of Cell Science, 112:1733-1741, 1999] .

HB-EGF induces phosphorylation of EGF-Rl but not ErbB4 in endometrial stromal cells HB-EGF is known to bind two receptors, EGF-Rl and ErbB4 [Higashiyama et al , Science., 251:936-9, 1991] [Elenius et al, Embo J. , 16:1268-78, 1997]. The binding of ligands to the EGF family receptors results in activation of tyrosine kinase and receptor phosphorylation [Alroy et al, FEBS Letters, 410:83- 86, 1997] . HB-EGF has been shown previously to induce phosphorylation of EGF-Rl [Higashiyama et al , J Biol Chem., 267:6205-12, 1992] and ErbB4 [Elenius et al, Embo J. , 16:1268-78, 1997] in cells overexpressing these receptors.

In order to analyse which of the receptors, EGF- Rl or ErbB4 , mediates the activity of HB-EGF in the endometrial stromal cells we examined receptor phosphorylation upon HB-EGF binding. Our data demonstrated that EGF-Rl but not ErbB4 was phosphorylated in response to soluble HB-EGF (Fig. 6, A) . Phosphorylation of ErbB4 was not manifested when cells were induced with soluble HB-EGF in media containing 10% of serum (results not shown) .

Stimulation of cells with transmembrane HB-EGF expressed by CHO cells (CHO/HB-EGF) also resulted in phosphorylation of EGF-Rl but not that of ErbB4 (Fig. 6, B) . PD153035, which selectively inhibits protein- tyrosine kinase activity of EGF-Rl [Fry, Science, 265: 1093-95, 1994] , suppressed HB-EGF-induced proliferation of stromal cells (Fig. 7) . The inventors have now demonstrated that sol- and tm-HB-EGF increase the proliferative capacity of endometrial stromal cells, and that the proliferative effect of both sol- and tm-HB-EGF in human endometrial • stromal cells is mediated via EGFR1 and not ErbB 4.

Presented data for the first time demonstrate a function for both sol- and tm-HB-EGF in the proliferative activity of stromal cells of the human endometrium.

Example 2 : Implantation is mediated via Herb B4

Materials and Methods

Tissue samples and Immunohistochemistry

Expression of tm-HB-EGF in CHO cells

Transfected CHO cells were generated as described above. Briefly, DNA encoding full length HB-EGF was cloned into the pEE14 vector vector (CellTech Ltd, UK) . The resulting construct (pEE14/tm-HB-EGF) or the original plasmid (pEE14) were transfected into CH0-K1. Clones overexpressing tm-HB-EGF (CHO/tm-HB-EGF) and control (CHO/vector) were selected in ^'25 μM of methioninesulfoximine (MSX, Sigma Ltd, UK) . Immunohistochemical detection of tm-HB-EGF in CHO cells was performed according to the protocol described previously. Briefly, CHO cells were plated on glass coverslips (Chance Propper Ltd, UK) , 2xl0⁴ cells per coverslip and grown overnight. Cells were washed 3 times in PBS, fixed in 3% paraformaldehyde in PBS for five minutes at room temperature and permeabilised with permeabilisation buffer (lOmM HEPES, pH 7.4, 200mM sucrose, 3mM MgCl₂, 50mM NaCl,

0.5% Triton-XlOO, 0.2% NaN₃) for five minutes at room temperature. Non-specific binding sites were blocked with 3% BSA in PBS for thirty minutes at room temperature. The cells were incubated for 1 hour at room temperature with goat anti- tm-HB-EGF antibodies at 1 μg/ml (Santa Cruz Inc., US). After PBS wash, rabbit anti-goat FITC-conjugated antibodies (Sigma Ltd, UK) were added at 1/75 dilution and incubation was carried on for one hour at room temperature . Coverslips were washed in PBS and mounted on Vectashield medium with DAPI (Vector Laboratories Inc., US) . The staining was observed under a LEITZ DMRBE fluorescent microscope (Leica Wetzlar, Germany) , images were received with the help of Openlab software (Improvision Inc, US) .

Immobilisation of CHO cells for embryo attachment experiments

CHO/tm-HB-EGF and CHO/vector cells were plated on glass coverslips as described above. The following day, cells were washed with PBS and fixed with 3% paraformaldehyde in PBS for 5 min at room temperature . Sequentially cells were washed with DMEM containing 10%FCS and PBS.

Generation of HB-EGF-Fc fusion protein

The extracellular region of HB-EGF coding for amino acids 1-149 was amplified with the following primers 5' TAGAAGCTTCCACCAATGAAGCTGCTGCCGTCGGTGGT, 3' ACGGATCCACTTACCTGTTGGGAGGCTCAGCCCATGACA which introduced HindiII and optimised Kozak^' sequence [Kozak et al, Cell., 44:283-292, 1986] to the 5' end and BamHI sites and a splice donor sequence to the 3' end. The amplified fragment was cloned into pIGl vector [Simmons, D. A. Hartley ed. , Oxford, IRL Press]. The nucleotide sequence of the construct was verified by automated DNA sequencing. The pIGl/HB-EGF vector was transfected into the human kidney epithelial cell line 293T [Dubrige, Mol. Cell. Biol. 7:379-89, 1987] and soluble HB-EGF-Fc fusion protein was expressed and purified as described before [Hudson, J. Biol. Chem. 271:971-8, 1996] . Purified protein was analysed by 7.5% PAGE and by western blotting using standard protocols. Detection of HB-EGF on western blots was achieved by the use of goat anti-human HB-EGF antibodies (R&D Systems Ltd., UK) at 4μM and rabbit anti-goat HRP-conjugated antibodies (Sigma Ltd. , UK) at 1/8000 dilution.

Immobilisation of HB-EGF-Fc for embryo attachment experiments Glass coverslips (Chance Propper Ltd, UK) were coated with 2 μg/ml of protein A (Sigma Ltd. , UK) , and incubated for eighteen hours at room temperature . Nonspecific binding sites were blocked with 3% BSA (Sigma Ltd., UK) in PBS for one hour at room temperature. HB- EGF-Fc fusion protein was added at a final concentration of 2 μg/ml and the coverslips incubated for a further two hours at room temperature . Coverslips were washed with PBS and used in the embryo attachment experiments described below.

Human embryos

Embryos derived from cryopreservation cycles were donated for research with informed consent by couples attending the Oxford Fertility Unit, John Radcliffe Hospital, Oxford. This project was approved by the

Central Oxford Research and Ethics Committee (COREC) and the Human Fertilisation and Embryology Authority (HFEA) . Ovarian stimulation, IVF and embryo culture until day 2 were performed as previously described [Martin et al, Hum Reprod. , 13:1645-52, 1998]. Day 2 human embryos, destined for cryopreservation, were initially incubated in 0.7ml of PBS containing 20% (v/v) serum for 30min followed by 0.7ml of 1.5M PrOH;

20% serum in PBS for 15 minutes at regular room temperature. Embryos were then transferred into Nunc cryovials (Life Technologies, UK) in regular buffer (1.5M PrOH; 0.1M sucrose; 20%serum in PBS) (Medicult, UK) . Embryos were frozen in a Planner Cryo 10 Series III freezer (Planner Products Ltd, UK) by cooling at 2°C per minute to-7°C and held for 10 minutes. They were then cooled to -30°C at 0.3°C per minute and held for 5 minutes before finally being cooled to -150°C at 50°C per minute and plunged into liquid nitrogen for storage . Embryos were thawed at room temperature for

30 seconds and immersed into water 30°C for 40sec. The embryos were collected and transferred into a graded series of propanediol thawing solutions TI, T2 , T3 and T4. (Medicult) for 5, 5, 10 and 10 minutes , respectively. Embryos displaying ³50% blastomere survival were considered suitable and viable for further culture. Briefly, viable embryos were washed in pre-equilibrated complex serum-free medium containing 2.5% HSA (CSFM3; [Martin et al , Hum Reprod., 13:1645-52, 1998] (Bioproducts Laboratory, UK) and transferred and cultured in CSFM3 supplemented with 2.5%HSA until day 6. Embryos were observed with the use of a Leica MZ8 dissecting microscope. The-- -embryos were cultured individually (I) or in groups (G) of 3 in 15ml of the medium until they reached the expanding blastocyst stage (day 6 or day 7) . If blastocysts did not hatch naturally, their zona pellucida was digested by exposure to Acid Tyrode's (136.9mM NaCl, 2.68mM KCl, 1.63mM CaCl₂.2H₂0, 0.49mM MgCl₂.6H₂0, 5.55mM glucose, 4mg/ml PVP) after which embryos were washed by incubation in PBS/ 0.05%BSA for 5min.

Embryo attachment assays Human blastocysts were transferred on tm-HB- EGF/CHO or HB-EGF-Fc coated coverslips and cultured in 500μl of CSFM3 supplemented with 2.5% HAS. The negative control for CHO-attachment experiments was coverslips coated with CHO/vector cell line. The negative control for HB-EGF-Fc-attachment experiments was the addition of 2 μg/ml of sol-HB-EGF (R&D Systems Ltd., UK) . The blastocysts were cultured for 24-48 hours and assessed for signs of attachment every 4-8 hours by gently shaking the culture dish three times for three seconds each. Observation was performed under the microscope at xlOO magnification. Embryos were fixed, permeabilised and stained for ErbB4 and EGF-Rl using an anti-ErbB4 monoclonal antibody (clone HFR1 [Srinivasan et al, Clin. Cancer Res., 5:2877-

2883, 1999]) and monoclonal anti EGFR-1 (Calbiochem) .

Embryo staining

hCG assay

Blastocyst conditioned medium and controls (CSFM3 + 2.5%HSA) were assayed for hCG using a solid-phase, two site fluoro-immunometric assay and kit (Delfia hCG; Perkin Elmer Ltd., UK) . The sensitivity of the assay is typically better than 0.5U/L, defined as "the ^■ value of 2 standard deviations above the mean of the zero standard measurement values . Each sample provided an estimate of the amount of hCG secreted by a single human blastocyst into 500μl CSFM3 over a 24 to 48 hour incubation period. The hCG secretion by single embryos in 500μl per 24hrs (mU/24hrs) was derived from this value .

Statistical analyses The number of blastocyst that did and did not attach were compared using Fisher's exact test. Levels of hCG and blastocoel diameter measurements were analysed using the unpaired t-test with Welch's correction.

Results

2a) Tm-HB-EGF is expressed on the apical surface of the luminal epithelium in the human endometrium during the window of implantation.

A possible function of HB-EGF in embryo attachment would predict that it must be expressed on the luminal edge of the endometrium at the time of implantation. A detailed analysis of tm-HB-EGF expression in the luminal epithelium of human endometrium was therefore performed (Fig. 8) . The stroma and epithelium of the functionalis layer of proliferative stage endometrium were negative for tm- HB-EGF (Fig. 8, A) . However sections of mid-secretory endometrium showed staining for tm-HB-EGF in both the luminal epithelium and adjacent glands and stroma (Fig. 8, B) . High magnification revealed discreet staining for tm-HB-EGF on the apical surface of the luminal epithelium (Fig. 8, C) . Control sections, treated with anti-tm-HB-EGF antibodies pre-adsorbed with the antigen peptide, were negative (Fig. 8, D) .

Previous studies have demonstrated the expression of HB-EGF in the human endometrium [Yoo et al , Dev Genet., 21:102-8, 1997] [Leach et al, J Clin Endocrinol Metab., 84:3355-63, 1999]. Present results demonstrate distinct apical expression of tm-HB-EGF on the luminal epithelium at the mid-secretory stage of the menstrual cycle. This tightly regulated spatio-temporal pattern of tm-HB-EGF expression in the human endometrium facilitates the attachment of the human blastocyst in vivo, as we have demonstrated in the in vi tro functional studies set out below. The function of tm-HB-EGF on human embryo attachment was investigated by the use of tm-HB-EGF presented in two different forms: either as HB-EGF-Fc fusion protein, that was engineered to allow the presentation of the HB-EGF portion of the fusion protein in the same direction by binding to protein A- coated coverslip (2b) ; or expressed as trans-membrane surface protein in CHO cells (2c) .

2b) Embryos attach to HB-EGF-Fc fusion protein in a_ solid phase assay

Having established that tm-HB-EGF is expressed on the apical surface of the lumenal epithelium at the time of implantation, the function of tm-HB-EGF was investigated in functional assays for embryo attachment using human blastocysts (Figs. 9 and 10; Table 1) . Recombinant HB-EGF-Fc fusion protein was expressed and purified as described above (Materials and Methods) . Analysis of the recombinant protein by

SDS-PAGE (Fig. 9) revealed multiple bands of between -38-42 kDa of HB-EGF which most likely represent products of N-terminal heterogeneity [Higashiyama et al, J Biol Chem., 267:6205-12, 1992] fused to Fc region of human IgG. Western blotting ^"with anti-HB-EGF confirmed the purified protein is HB-EGF-Fc (Fig. 2, B) . A total of 11 hatched blastocysts at day 6 (n=10) or day 7 (n=l) development were placed on coverslips coated with the protein-A/HB-EGF-Fc sandwich either in the presence (n=3) or absence (n=8) of 2 μg/ml sol-HB-

EGF (see Table 1) . Seven of the 8 blastocysts attached to HB-EGF-Fc in the absence of sol-HB-EGF. However, none of the 3 blastocysts cultured on HB-EGF-Fc in the presence of sol-HB-EGF attached after 24-48 hours (Fig. 10; Table 1) . Five of the 7 blastocysts attached to HB-EGF-Fc remained expanded as shown in Figure 10 (A and B) . In the presence of sol-HB-EGF, none of the blastocysts attached to HB-EGF-Fc, whereas 3/3 blastocycsts, although unattached, remained expanded.

2c) Embryos attach to CHO cells expressing tm-HB-EGF

The capacity of tm-HB-EGF expressed on the cell membrane to mediate the attachment of human blastocysts was determined (Fig. 11; Table 1). A total of 15 human hatched blastocysts (13 at day 6 and 2 at day 7 development) were placed on fixed monolayer cultures of CHO/tm-HB-EGF (n=10) or CHO/vector (n=5) . Eight of the 10 blastocysts on CHO/tm-HB-EGF attached to the cells whereas none of the 5 blastocysts cultured on CHO/vector attached. These results were thus similar to those obtained for blastocysts attachment to HB-EGF-Fc (above and Table 1) . Furthermore, 5 of the 8 blastocysts that attached to CHO/tm-HB-EGF remained expanded for the 24-48 hour culture period (Fig. 11, A and B) . However, in contrast to the blastocysts that did not attach to HB-

EGF-Fc in the presence of sol-HB-EGF, none of the unattached blastocysts cultured on CHO/vector (cultured in the absence of sol-HB-EGF) remained expanded after 24-48 hours and degenerated (Fig. 11, C and D; Table 1) . Parallel cultures of CHO/HB-EGF and -CHO/vector were fixed and stained for tm-HB-EGF to^" confirm expression its on the cell surface (Fig. 12) . The CHO/HB-EGF cells showed abundant expression of HB- EGF associated with the cell membrane (Fig. 12, A) whereas CHO/vector were negative (Fig. 12, B) .

The use of these two experimental approaches (2b) and (2c) was designed to test for function of pure HB- EGF dimers (via the Fc hinge region and leading to potentially be much higher density compared to HB-EGF in the transfected CHO cells) , and in the context of other cell surface molecules with which tm-HB-EGF could potentially form juxtacrine complexes. The number of blastocysts that attached to, and remained expanded on, HB-EGF, and the blastoceol diameter, was similar for each set of experiments. Furthermore, blastocysts did not attach to either HB-EGF-Fc in the presence of sol-HB-EGF, or CHO cells transfected with vector alone, suggesting that the activity of HB-EGF in mediating blastocyst attachment is specific. Thus, tm-HB-EGF, in both modes of presentation, was found to significantly promote attachment of human blastocysts compared to the control coverslips.

The average blastocoel diameter of embryos cultured in sol-HB-EGF-free medium that attached to CHO/HB-EGF, was approximately twice that of embryos

(non-attaching) cultured on CHO/vector, and similar to those cultured in the presence of sol-HB-EGF on HB- EGF-Fc coverslips. The average blastocyst diameter of embryos attaching on both types of tm-HB-EGF coverslips was not statistically different to that of embryos cultured on the HB-EGF-Fc in the presence of sol-HB-EGF. These data suggest that exposure of the embryo to both sol- and tm-HB-EGF enhances the development of human peri-implantation embryos.

The presented data demonstrate a function for HB- EGF in human blastocyst attachment. However, none of the attached blastocysts exhibited trophoblast outgrowth or, in the CHO/tm-HB-EGF experiments, invasion of the cell layer. One explanation for these results is that HB-EGF does mediate trophoblast spreading or invasion in vivo, but our model systems do not support these secondary implantation events. For example, fixation of the CHO cells prior to the transfer of blastocysts may have inhibited further dynamic responses to attachment, such as formation of complexes between HB-EGF and additional molecules. A second explanation, as supported by the solid phase assays for tm-HB-EGF-fc function is that the function of tm-HB-EGF in implantation of the human blastocyst is to mediate the primary event of embryo attachment and that additional molecules are required for downstream processes to occur.

2d) HB-EGF does not stimulate hCG production

The production of hCG is a useful indicator of the well-being of the embryo. Levels of hCG secreted by the embryos used in the HB-EGF-Fc and CHO ' attachment assays above were measured to determine if sol- or tm-HB-EGF induced hCG production. Levels of hCG from blastocysts from both HB-EGF-Fc and CHO experiments were pooled into groups of those that attached to either HB-EGF-Fc or CHO/HB-EGF (n=15) and control - sol-HB-EGF (n=5) for statistical analyses and expressed as mIU/24 hours. Blastocysts secreted varying levels of hCG and there was no regular statistically significant difference between those exposed to tm-HB-EGF and those not.

Production of hCG by the blastocyst is thought to be critical for implantation and survival of the early , pregnancy and the production of hCG by trophoblast^" is a marker for the embryo wellbeing and integrity. In the present study embryos that attached to tm-HB-EGF and retained an expanded blastocoel produced more hCG than embryos on the control coverslips, although the difference was not significant. hCG production by human blastocysts cultured in vitro has been reported to reach peak concentrations around day ten [Dokras, Hum. Reprod 6:1143-51, 1991] [Woodward, Hum. Reprod. 8:1463-68, 1993] . Blastocysts were cultured up to day nine in the experiments described here and it is thus possible that differences would be observed with longer in culture. However presented results suggest that HB-EGF is not a primary inducer of hCG expression in these early stage embryos and that additional factors, such as those expressed by endometrial cells, may induce hCG by invading trophoblast in vivo.

2e) ErbB4 and ErbBl are expressed on the surface of the trophectoderm of human peri-implantation blastocysts

Having established that tm-HB-EGF or anchored HB- EGF-Fc can mediate the attachment of human blastocysts in in vi tro model systems, we analysed the expression of the receptors EGF-Rl and HER4 in hatched human blastocysts. Embryos were stained at the termination of the attachment experiments described above. Attaching blastocysts from HB-EGF-Fc (n=3) and non- attaching blastocysts (n=3) were triple stained using anti-EGF-Rl, -ErbB4 and nuclei stain (DAPI) , shown in Figure 13 Staining for EGF-Rl was positive and evenly distributed in the inner cell mass in all but one of the blastocysts. There was also weak, punctate staining for EGF-Rl on the trophectoderm. Staining for ErbB4 was intense and distinct on the outer surface of the trophectoderm and much stronger than for EGF-Rl and was not present in the inner cell mass. Although all the blastocysts exhibited a similar pattern of staining for these molecules, staining was more diffuse in degenerating, less expanded blastocysts. There ,was no staining of control blastocysts treated with mouse or rat IgG.

The present results demonstrate unequivocally that the HB-EGF receptor, ErbB4 is abundantly expressed, and EGFR-1 to a much lesser extent, on the polar trophectoderm of hatched, peri-implantation human blastocysts. Thus it is shown that both the receptor and the ligand are appropriately expressed, on the endometrium and the blastocyst, respectively. Although both receptors for HB-EGF are expressed on the trophectoderm, ErbB4 is diffuse on the cell membrane and absent in the inner cell mass whereas EGF-Rl localisation is punctate and sparse on the trophectoderm, with higher levels in a diffuse pattern in the inner cell mass. These differential patterns of expression of ErbB4 and EGF-Rl suggest that the receptors may have different functions in the implanting embryo.

It is proposed that the function of HB-EGF in implantation is mediated principally via the receptor ErbB4 , and this is now testable experimentally, using model systems for human implantation similar to those we describe here .

Table 1

Number of blastocysts that attached to HB-EGF-fc and transfected CHO cells

Table 2

Mean diameters (μm+SEM) of blastocysts cultured on HB- EGF-fc or transfected CHO cells

Example 3

Test for HB-EGF-derived and other known or novel agonists/antagonists of EGF Rl and Erb B4 in endometrial bioassays

3a) Phosphorylation assay

1. Plate 10^s human endometrial stromal cells in 9 cm Petri dishes and incubate until confluent in DMEM + 10% foetal calf serum (FCS) .

2. Starve in serum free medium for 18 hours, and then stimulate with 10-100ng/ml of HB-EGF-derived agonists/antagonists in the presence or absence of recombinant HB-EGF in serum-free DMEM for 3 min at 37°C.

3. Place cells on ice and wash two times with ice- cold PBS supplemented with 2mM orthovanadate. 4. Lyse cells for 10 min in 2mM orthovanadate, 2mM sodium fluoride, 2mM sodium pyrophosphate, 2mM PMSF, lOμg/ml leupeptin, lμg/ml pepstatin (RIPA buffer) . The cell lysates are then clarified by microcentrifugation at 14,000rpm at 4°C . 5. • Mix equal volumes of supernatants with 5μg of either anti-EGF-Rl mouse monoclonal (PharMingen, US) or anti-ErbB4 rabbit polyclonal (Santa Cruz Biotechnology Inc., US) antibodies, and gently mix for 24 hours at 4°C . 6.- Collect the immune complexes by nutating with protein-A sepharose (Amersham Pharmacia Biotech, UK) and wash 3 times with lysis buffer.

7. Proteins are then separated by electrophoresis on 7.5% polyacrylamide gel and transferred to PVDF membrane (using Phast system, Amersham Pharmacia Biotech, UK) . Block the membranes in 5% milk in Tris-buffered saline containing 0.5% Tween-20.

Phosphotyrosines are detected with antibody clone 4G10 (Upstate Biotechnology, US) . EGF-Rl and ErbB4 were detected in parallel blots hybridised with 2μg/ml of rabbit anti-EGF-Rl (Santa Cruz Biotechnology Inc., US) or rabbit anti-ErbB4

(Santa Cruz Biotechnology Inc., US) antibodies correspondingly.

3b) Proliferation assay

1. Plate human endometrial stromal cells (10⁴ cells/well) in 96 well plate in DMEM supplemented with 10% FCS, lOOIU/ml penicillin and lOOng/ml of streptomycin and incubate for 24 h. 2. Change the medium to serum-free and incubate for 18 hours. 3. Stimulate_. cells with either putative HB-EGF agonist or antagonist in the presence or absence of recombinant HB-EGF for 24 hours. 4. Add lμCi H³-thymidine (Amersham Pharmacia

Biotech, UK) to each well for the last 4 hours of incubation and wash cells 3 times in PBS, harvest, and determine the amount of incorporated H³-thymidine using a b-plate counter (Wallac Ltd. , Finland) .

The above assays (examples 3a and 3b) have been confirmed by screening EGF Rl antagonists PD 15305 (Calbiochem) . PD 15305 inhibits HB-EGF induced proliferation of human endometrial stromal cells, as apparent from Figure 16.

Example 4

Test for HB-EGF-derived and other known or novel agonists/antagonists of EGF Rl and Erb B4 in screens for receptor-ligand binding

Cloning and expression of. EGF-Rl, HER2 (Erb B2) and HER4 (Erb B4)

1. cDNAs of extracellular domains of EGF-Rl, HER2 and HER4 are generated using RT-PCR on mRNA prepared from endometrial stromal cells or placenta.

2. Amplified products are cloned using standard protocols into pIGl vector which is designed -to express Fc-fusion protein dimers (Simmons, 1993, D.A. Hartley ed. , Oxford, IRL Press). Plasmids, EGF-Rl/pIGl, HER2/pIGl and HER4/pIGl are transfected into HEK293T cell line human embryonal kidney) as described before (Hudson et al. ,1996, J. Biol. Chem.271, 11971-8) .

3. Transfection is performed both with individual plasmid (EGF-Rl/pIGl, HER2/pIGl and HER4/pIGl and with a combination of two (EGF-Rl/pIGl and HER2/pIGl; EGF-Rl/pIGl and HER4/pIGl; HER4/pIGl and HER2/pIGl) . This will allow expression of both homo- and hetero-dimeric receptor subunits. Transfected cells are incubated in serum-free media for 3-4 days to allow accumulation of expressed soluble proteins. 4. Conditioned media is collected and Fc-fusion proteins are purified by protein-A affinity column followed in the case of double plasmid transfection by EGF-Rl affinity column followed either by HER2 affinity column (to purify EGF- R1/HER2 hetero-dimers) or by HER4 affinity column (to purify EGF-R1/HER4 hetero-dimers) . HER2/HER4 heterodimer is purified in similar manner using consecutively HER2 and HER4 affinity columns. Proteins are eluted from affinity columns with salt solution and dialysed.

Receptors purified as described above could be used to assess binding of known and unknown ligands; binding assays include using immobilised homo- and ^'hetero-dimers of EGF-Rl, HER2 and HER4 and ELISA and gel shift assays as follows:

1. Chosen receptor homo- or hetero-dimer is immobilised on protein-A coated onto the wells of a 96-well plate. 2. Receptor-binding of the tested ligand is assessed by comparison with the receptor binding of the known ligand (EGF or HB-EGF) in competition with the tracer: biotinylated EGF OR HB-EGF. 3. Biotinylated tracer bound to the receptor is detected using streptavidin-conjugated with HRP using standard procedure.

Receptors purified as described above can also be used to screen HB-EGF mutants or known or novel compounds for proliferation agonist/antagonist activity in bioassays as above. Example 5

Screen for compounds that modulate HB-EGF production in the endometrium

HB-EGF ELISA for measuring levels of HB-EGF synthesised by human endometrial stromal cells.

1. Plate cells on a 96-well plate at 1 x 10⁴ cells/well in DMEM, penecillin/streptomycin, 10% FCS.

2. Incubate cells at 37 °C overnight.

3. Add test compounds (10 ηg/ml) and monensin (2.4 or 14.4 mM) and incubate for 24 hr at 37°C in DMEM F12 (minus phenol red), p/s, 2%FCS.

4. Aspirate off supernatant and wash cells x2 with PBS (gently! don't use plate-washer) .

5. Fix by adding 3% paraformaldehyde/PBS for 5 min RT. 6. Permeabilize cells for 5 min. RT.

7. Wash xl with PBS.

8. Peroxidase treatment: treat cells for 30 min. at RT with 0.6% H₂0₂ in 40% MeOH/PBS.

9. Wash 3-5 min in PBS x2. 10. Block with 3% BSA in PBS x2 (once for 5 minutes and once for 30 minutes) .

11. Wash xl with PBS.

12. Primary antibody: add biotinylated anti-HB-EGF at 100 ng/ml (1:2500 dilution). Leave for 1 hr at RT.

13. Wash x3 in PBS.

14. Secondary antibody: add streptavidin-HRP at 1 μg/ml (1:1000 dilution) . Leave for 1 hr at RT.

15. Wash x2 in PBS. 16. Develop by dissolving one silver and one gold tablet from SigmaFast o-phenyldiamine diHCl in 20 ml dH₂0; add 100 μl per well. 17. Stop reaction after 20 min. with 100 μl 0.5M

H₂S0₄. Read plate at 490 nm.

•18. Wash plate thoroughly with PBS.

19. Add 100 μl 0.1 % crystal violet solution for 15- 30 min. at RT.

20. Wash plate thoroughly with water.

21. Add 100 μl MeOH to each well.

22. Read plate at 600 nm.

23. Relative values are determined by dividing the amount of HB-EGF (OD readings at 490 nm) by th_e_ total number of cells (OD readings at 600 nm) . Statistically significant bars in Figure 15 are asterisked on the graphs as determined using a 2- tailed, paired Student's T-test in Excel. ^'

The above assay (example 5) has been confirmed by screening the two following compounds:

- Basic fibroblast growth factor (bFGF) , and

- Transforming growth factor alpha (TGF-α) . bFGF and TGF-α have been shown to be able to increase HB-EGF levels in human endometrial stromal cells (see Figure 15.

Example 6 : Diagnostic test

The following diagnostic test is aimed to confirm whether HB-EGF is deficient during the implantation window in the endometrium of women with infertility or sub-fertility. The implantation is defined as days 6- 8 post the day of the LH surge.

Generally, an endometrial sample suitable for carrying out the present test fulfills the following requirements: Patient should preferably have ovulation confirmed; the sample should preferably correspond to the "implantation window" time; generally the "implantation window" time can be based on a regular menstrual pattern as approximately seven days before the expected first day of the menstrual period; or, alternatively, it can be based on using the mid-cycle leutenising hormone (LH) urine test (Clear-Plan Styx) to identify LH surge, starting at day 12 (until the surge is identified) .

Generally, the sample can be taken by pipelle biopsy.

1. The isolated suitable endometrial sample is fixed in formaldehyde and processed for paraffin wax embedding .

Sections are cut and HB-EGF detected with the use of primary antibodies (goat anti-tm-HB-EGF (Santa Cruz) optimally diluted in PBS and applied to the sections for one hour at room temperature. Control staining is performed with the same antibodies pre-incubated with the corresponding control peptides.

2. Sections are washed in three changes of PBS and incubated in peroxidase conjugated anti-goat or anti-mouse IgGs for one hour at room temperature.

3. Sections are washed as above and bound antibodies are detected with HRP substrate anti-transmembrane monoclonal antibodies and peroxidase detection system.

4. Correlate the appearance of HB-EGF with endometrial receptivity and pregnancy success. Example 7

Detection protocol to distinguish between transmembrane and soluble HB-EGF

ELISA 96-well plates are coated for 18-24 hours with 4mg/ml of goat anti human HB-EGF polyclonal abs (R&D, catalogue number AF-259-NA) . Plates are blocked with 1%BSA/PBS for 1 hour at room temperature. Cell conditioned media and rh-HB-EGF standards (500-Opg/ml) are incubated for 24-48 hours at 4°C . Following PBS/0.05% Tween-20 wash (3 times) captured HB-EGF is detected with goat anti human HB-EGF polyclonal abs, biotin conjugated (R&D, catalogue number BAF 259) at 125 ng/ml for 2 hours at room temperature. Plates are washed (3 times) with PBS/0.05% Tween-20 and incubated with streptavidin-HRP (dilution 1/1000, Jacksons Immunochemicals) . Plates are washed with PBS/0.05% Tween-20 (3 times) and PBS (2 times) . HRP activity is developed with TNB substrate. Sensitivity of the essay is 15 pg/ml . Average level of HB-EGF expression by stromal cells is 25 pg/ml in 48 hours.

To detect transmembrane HB-EGF cells remaining in 24 well plates were treated for 40 min with 1 μM of -phorbol ester PMA (phorbol 12-myristate 13 acetate) that activated metalloproteinases (1-6) and cleavage of pro-HB-EGF and generation of soluble HB-EGF (7) . Following this treatment (PMA was dissolved in serum- free DMEM and applied at 200 μl/well) media was transferred to HB-EGF ELISA plate and soluble form of HB-EGF was detected as described above.

Example 8 Regulation of soluble and transmembane HB-EGF expression. Endometrial cells were plated in 24 -well plates and cultured until confluent in DMEM/10% FCS. Before stimulation cells were serum-starved overnight. Cells were stimulated by 10 ng/ml of TNFα and lng/ml of TGFβ for 48 hours in serum-free DMEM (200 μl/well) in quadruplicates. Detection of soluble HB-EGF was performed as described above by transferring cell- conditioned media to ELISA plates (200 μl of supernatant from each of the 24 wells was distributed into 2 wells of the 96 well plate at 100 μl/well) .

To detect total (sol+tm) HB-EGF expression cells were stimulated as above with 10 ng/ml of TNFα and lng/ml TGFβ 10 ng/ml EGF and 10 ng/ml bFGF. After 48 hours of incubation PMA was added to the final concentration 1 μM into the conditioned medium and incubation was continued for 40 min. Conditioned medium was analysed by HB-EGF ELISA as described above .

1. Mullberg, J., Durie, F. H. , Otten-Evans, C, Alderson, M. R. , Rose-John, S., Cosman, D., Black, R. A., and Mohler, K. M. (1995) J. Immunol . 155, 5198-5205.

2. Crowe, P. D., Walter, B. N. , Mohler, K. M., Otten, E. C, Black, R. A., and Ware, C. F.

(1995) J. Exp . Med. 181, 1205-1210.

3. Preece, G. , Murphy, G. , and Ager, A. (1996) J^". Biol . Chem. 271, 11634-11640 [Abstract/Free Full

Text] .

4. Feehan, C, Darlak, K. , Kahn, J., Walcheck, B., Spatola, A. F., and Kishimoto, T. K. (1996) J^". Biol . Chem . 271, 7019-7024 [Abstract/Free Full Text] 5. Arribas, J. , Goodly, L., Vollmer, P., Kishimoto,

T. K. , Rose-John, S., and Massague, J. (1996) J^".

Biol . Chem. 271, 11376-11382 [Abstract/Free

Full Text] 6. Suzuki, M. , Raab, G. , Moses, M. A., Fernandez, C.

A., and Klagsbrun, M. (1997) J^". Biol . Chem . 272,

31730-31737 [Abstract/Free Full Text] 7. Goishi K, Higashiyama S, Klagsbrun M, Nakano N,

Umata T, Ishikawa M, Mekada E, Taniguchi N. Phorbol ester induces the rapid processing of cell surface heparin-binding EGF-like growth factor: conversion from juxtacrine to paracrine growth factor activity. Mol Biol Cell 1995

Aug;6 (8) :967-80.

Claims

1. A method of assessing the fertility status of a mammalian female wherein said method comprises: determining the level of tm-HB-EGF in a sample of endometrial tissue within the implantation window time for the female; and correlating the appearance of tm-HB-EGF with fertility status.

2. A method as claimed in claim 1 wherein said mammalian female is a human female.

3. A method as claimed in claim 1 or 2 wherein the level of tm-HB-EGF is determined by staining said tm- HB-EGF in si tu .

4. A method as claimed in claim 3 wherein said stain comprises an antibody specific for one or more epitopes of tm-HB-EGF, which antibody is conjugated to a molecule allowing identification of bound antibody in a quantitative manner.

5. A method as claimed in claim 5 wherein said tm- HB-EGF level is quantified using an ELISA assay.

6. A method as claimed in claim 1 or 2 wherein the level of tm-HB-EGF is determined by cleaving the extracellular domain from said tm-HB-EGF with a proteolytic enzyme and measuring the cleaved HB-EGF.

7. A method as claimed in claim 6 wherein the proteolytic enzyme is a metalloprotease .

8. A method as claimed in claim 6 wherein a proteolytic enzyme is added to the endometrial tissue.

9. A method as claimed in claim 8 wherein the enzyme is selected from ADAM 12, MDC9 and MMP3.

10. A method as claimed in claim 6 or claim 7 wherein an agent capable of inducing proteolytic activity in the endometrial cells is added to the tissue sample.

11. A method as claimed in claim 10 wherein the agent is selected from phorbol ester PMA, ionomycin and thapsigargin.

12. A method as claimed in any one of claims 6 to 11 wherein said cleaved HB-EGF is measured using an antibody specific for one or more epitopes of HB-EGF which is conjugated to a molecule allowing quantitative measurement of HB-EGF/antibody complexes.

13. A method as claimed in claim 12 wherein cleaved HB-EGF is measured by an ELIZA assay.

14. A kit for assessing the fertility status of a mammalian female which comprises: at least one antibody specific for at least one epitope of tm-HB-EGF said antibody being conjugated to -a molecule facilitating it's detection; and a proteolytic enzyme or an agent for inducing proteolytic activity in an endometrial cell .

15. A kit as claimed in claim 14 wherein said antibody is conjugated to an enzyme and said kit further includes the enzyme substrate .

16. A kit as claimed in claim 14 wherein said antibody is conjugated to a molecule which facilitates attachment of an enzyme and the kit further includes the enzyme .

17. A kit as claimed in claim 16 wherein said kit further includes the substrate for the enzyme.

18. A kit as claimed in any one of claims 14 to 17 wherein said proteolytic enzyme is a metalloprotease.

19. A kit as claimed in any one of claims 14 to 17 wherein the proteolytic enzyme is selected from among ADAM 12 , MDC9 and MMP3.

20. A kit as claimed in any one of claims 14 to 17 wherein said agent for inducing proteolytic activity in an endometrial cell is selected from among phorbol ester PMA, ionomycin and thapsigargin.

21. A method of identifying a potential fertility enhancing and/or contraceptive agent, which method comprises : contacting an HB-EGF producing cell with a compound under test; determining the amount of tm-HB-EGF expressed in the presence and absence of said test compound; determining the effect of the test compound on the amount of tm-HB-EGF expressed and thereby ^■ identifying a compound which modulates the production

• of tm-HB-EGF.

22. A method of identifying a potential fertility enhancing and/or contraceptive agent, which method comprises: contacting an HB-EGF producing cell with a compound under test; determining the amount of soluble HB-EGF secreted in the presence or absence of the test compound; determining the effect of the test compound on the amount of soluble HB-EGF secreted and thereby identifying a compound which modulates the production of soluble HB-EGF.

23. A method as claimed in claim 21 or claim 22 wherein the HB-EGF producing cell is an isolated human female endometrial stromal cell.

24. A method as claimed in claim 22 or claim 23 wherein said soluble secreted HB-EGF is detected using an antibody sandwich ELIZA format.

25. A method as claimed in claim 21 or claim 23 which comprises the steps of: a) coating the wells of a multiwell plate with said HB-EGF producing cells; b) adding the compound under test to said wells; c) incubating for sufficient time to allow for any specific modulation of the HB-EGF production; d) blocking said wells to prevent non-specific antibody binding ; e) detecting any expressed HB-EGF using an ELISA assay with a primary antibody having specificity for one or more epitopes of HB-EGF; f) washing said wells; and g) adding a secondary antibody specific for the-, primary antibody which is conjugated to a molecule capable of facilitating its detection in a quantitative manner.

26. A method as claimed in claim 25 wherein said ELISA is a double layer format.

27. A method as claimed in claims 25 or 26 wherein an agent which inhibits protein translocation is added to wells.

28. A method as claimed in claim 27 wherein said inhibitor of translocation is monensin.

29. A method as claimed in claim 21 or claim 23 wherein the amount of expression of tm-HB-EGF is determined by cleaving the extracellular domain from said tm-HB-EGF with a proteolytic enzyme and measuring the cleaved HB-EGF.

30. A method as claimed in claim 29 wherein the proteolytic enzyme is a metalloprotease.

31. A method as claimed in claim 29 or 30 wherein a proteolytic enzyme is added to the tm-HB-EGF producing cells following incubation in the presence or absence of test compound.

32. A method as claimed in claim 29 or 31 wherein the enzyme is selected from ADAM 12, MDC9 and MMP3.

33. A method as claimed in^' claim 29 or 30 wherein an agent capable of inducing proteolytic activity in said tm-HB-EGF producing cells is added following incubation in the presence or absence of said compound.

34. A method as claimed in claim 33 wherein the agent is selected from phorbol ester PMA, ionomycin and thapsigargin.

35. A method as claimed in any one of claims 29 to 34 wherein said cleaved HB-EGF is measured using an ELIZA assay.

36. A method for producing a composition suitable for treating infertility in a mammalian female or suitable as a contraceptive agent in a mammalian female which method comprises :

a) carrying out a compound screening method as^' claimed in any one of claims 21 to 35; and b) formulating any compound identified as capable of modulation of expression of sol- and/or tm-HB-EGF into a composition with a pharmaceutically acceptable carrier or diluent.

37. The method of claim 36 wherein said mammalian female is a human female.

38. A method of inducing contraception in a mammalian female which comprises administering to said female an inhibitor of sol- and/or tm-HB-EGF production in endometrial cells or an antagonist of an HB-EGF receptor.

39. A method for enhancing fertility in a mammalian female which comprises administering to said female an effective amount of an enhancer of sol- and/or tm-HB- EGF production in endometrial cells or an agonist of an HB-EGF receptor.

-40. A method as claimed in claim 38 or 39 wherein^" the receptor is selected from HER1 and HER4.

41. A method as claimed in any one of claims 38 to 40 wherein the female is human.

42. A method as claimed in any one of claims 39 to 40 wherein said enhancer of sol- and/or tm-HB-EGF production is selected from TNFα and TGFβ.

43. Use of an agonist of an HB-EGF receptor in the manufacture of a composition for enhancing fertility in a mammalian female.

44. The use as claimed in claim 43 wherein the receptor is selected from HER1 and HER4.

45. Use of an enhancer of sol-and/or tm-HB-EGF production in the manufacture of a composition for enhancing fertility in a mammalian female.

46. The use as claimed in claim 45 wherein said enhancer is selected from TNFα and TGFβ.

47. The use as claimed in any one of claims 43 to 46 wherein said mammalian female is a human female.

48. A ^'contraceptive composition which comprises an HB-EGF receptor antagonist and/or an inhibitor of sol- and/or tm-HB-EGF production and a pharmaceutically acceptable carrier or diluent.

49. A pharmaceutical composition which comprises an HB-EGF receptor agonist and/or an enhancer of sol- and/or tm-HB-EGF production and a pharmaceutically- acceptable carrier or diluent .

50. A composition as claimed in claim 48 or 49 wherein said receptor is selected from HER1 or HER4.

51. A composition as claimed in claim 49 wherein the enhancer of sol- and/or tm-HB-EGF production is TNFα or TGFβ.

52. A composition as claimed in any one of claims 48 to 51 which is formulated for administration locally to the endometrium.

53. A composition as claim in claim 52 in the form of a gel, cream, ointment or liquid.