WO2003056032A1

WO2003056032A1 - Amp kinase beta-subunit oligosaccharide binding domain

Info

Publication number: WO2003056032A1
Application number: PCT/AU2002/001769
Authority: WO
Inventors: David Stapleton; Bruce E. Kemp
Original assignee: St Vincent's Institute Of Medical Research
Priority date: 2001-12-21
Filing date: 2002-12-23
Publication date: 2003-07-10
Also published as: AUPR972801A0

Abstract

The present invention relates to the identification of an oligosaccharide binding domain in the beta-subunit of AMP kinase. Methods are provided for screening for compounds that modulate oligosaccharide binding to the beta-subunit of AMP kinase. Methods of using such compound in the treatment of conditions associated with uncoupled AMP kinase activity are also provided.

Description

AMP Kinase Beta-subunit oligosaccharide binding domain

Field of the Invention:

The present invention relates to oligosaccharide binding domains, the use of these domains in screening for compounds that modulate the binding of an oligosaccharide thereto, and/or for disrupting oligosaccharide binding for the treatment of diseases such as Type II diabetes, atherosclerosis, obesity, cancer, hypercholesterolemia, hypertriglyceridemia and elevated glucose. In particular, the present invention relates to the oligosaccharide binding domain of the beta subunit of AMP kinase family of enzymes.

Background of the Invention:

The AMP activated protein kinase (AMPK) is a metabolic stress sensing protein kinase that is a powerful regulator of metabolism in response to energy demand and supply. Yeh et al (1980) referred to the activation of AMPK by AMP as regulation by adenylate energy charge, a concept where the ratio of [ATP]/[ADP][AMP] modulates enzyme activity. The "adenylate charge hypothesis" for the metabolic coupling of anabolic and catabolic pathways was proposed earlier by Daniel Atkinson (1970) and according to this concept the ratio of adenine nucleotides modulated metabolic enzyme activities through allosteric control. Thus a reduction in the energy charge (decrease in ATP and increase in AMP) would switch off anabolic pathways such as fatty acid, triglyceride and cholesterol synthesis and switch on catabolic pathways such as glycolysis, glucose and fatty acid oxidation.

AMPK has been purified from rat liver as an αβγ heterotrimer comprising an α catalytic subunit and βγ non catalytic subunits (Mitchelhill et al., 1994; Davies, et al., 1994). The catalytic α subunit turned out to be the mammalian homolog of the yeast Snflp kinase (Mitchelhill et al., 1994; Carling et al., 1994) and the non catalytic βγ subunits also have yeast homologs.

AMPK/Snflp kinase homologs have now been detected in all species examined and this has led to the understanding that they represent an ancient metabolite sensing protein kinase subfamily.

Although yeast has a single SNF1 gene most mammals, insects, nematodes and plants tend to have multiple genes encoding this catalytic subunit. In mammals the two (αl and α2) subunits share approximately 90% identity in their N-terminal catalytic domains (residues 1-270) but only approximately 60% identity in their C-terminal α sequence (Stapleton et al., 1996). Structure functions studies on both Snflp and AMPK α subunits have shown that the C-terminal domain is responsible for binding the non catalytic subunits βγ (Crute et al., 1998). Thus, truncating the α subunit from 1-548 to 1-392 results in loss of βγ binding and catalytic activity. Further truncation to 1-312 results in a constitutively active kinase fragment that is not activated by AMP suggesting the possibility that the sequence between 312 and 392 contains an autoregulatory inhibitory sequence (AIS). In addition, the C-terminus also contains a Ser/Glu-rich region known to influence enzyme turnover (Crute et al., 1998).

There are two βl and β2 subunits in mammals whereas in yeast there are three, Gal83p, siplp and sip2p. The βl subunit is myristoylated and removal of the myristoylation site increases the cytoplasmic fraction of the AMPK but the subcellular location of the AMPK in mammals is poorly understood.

There are three γl, γ2, γ3 subunits in mammals. These proteins contain 4 copies of a structural motif called a CBS domain that is found in a number of enzymes and named after the corresponding motif found in cystathionine β synthase. Several lines of evidence suggest that the γ subunit may be important in mediating the AMP regulation of AMPK. Firstly the γ subunit of AMPK is labelled by the photoaffinity nucleotide analog, 8-azido-[³²P]AMP and this can be blocked with AMP (Cheung et al., 2000). Depending on the combination of α and γ subunits variations in the degree of AMP activation have been reported with holoenzymes containing the γ2 complexes having the highest dependence and γ3 having the lowest AMP dependence (Cheung et al., 2000). In the case of cystathionine β synthase mutation in the CBS domain 1 (D444N) (Kluijtmans et al., 1996) results in a loss of allosteric control by S-adenosyl methionine, indicating that the CBS domain may be involved in binding the allosteric regulator. ATP competes with AMP binding to AMPK and suppresses activation reminiscent of the regulation of phosphorylase b (Sprang et al., 1991).

Several important mutations in the γ subunits have been reported recently highlighting the physiological functions of the AMPK. Pigs carrying R200Q mutation have high skeletal muscle glycogen levels that are deleterious in meat processing. While the consequences of the γ3 R200Q mutation on AMPK activity have not yet been characterised the corresponding R70Q mutation in the γl subunit is a strongly activating mutation in transfected cells (Hamilton et al., 2001). Since AMPK regulates glucose uptake one interpretation is that the γ3 R200Q mutation leads to accumulated glycogen as a result of constitutive activation of skeletal muscle glucose transport.

The γ2 subunit is present as alternate transcripts, either full-length 569 residues or a shorter 328 residue transcript. A series of mutations have been found in the γ2 subunit that is expressed in the heart. Gollob and his colleagues (2001) were the first to detect an R302Q mutation in CBS domain 1 of γ2 in two families with Wolf-Parkinson- White syndrome. These patients exhibit ventricular preexcitation and early onset of atrial fibrillation and conduction disease thought to be the consequence of an embryonic defect that results in altered electrical conduction between the atria and ventricles. The R302Q mutation corresponds to the relative position of the R200Q mutation seen in the pig γ3 subunit CBS 1 domain. Two further families with familial hypertrophic cardiomyopathy have been found to contain mutations in the γ2 subunit. These were H142R (short γ2 transcript numbering) in CBS 2 domain and a Leu insertion between R109E110 in the connecting peptide between CBS 1 and 2 domains. The positions of the γ2 mutations giving rise to these cardiac phenotypes are shown in the modelled CBS domains. The R302Q, H142R and R351G mutations all cluster in the interface between the CBS domains. Because of AMPK's role in maintaining energy balance it has been hypothesised that AMPK may play a more general role in hypertrophic cardiomyopathy that results from mutations in other proteins that lead to inefficiencies in cardiac function and consequent increased energy demand and metabolic stress.

AMPK is activated by an upstream kinase (AMPKK) that is responsible for phosphorylating AMPK α subunit in the activation loop at Thr-172 (Hawley et al., 1996). AMPK appears to have an absolute dependence on Thr-172 phosphorylation since bacterially expressed AMPK (1-312) is inactive unless phosphorylated on Thr- 172. Although, the identity of the AMPKK(s) or Snflp kinase kinase(s) are not yet known some of the regulatory features have been revealed using partially purified enzyme preparations. AMPKK is itself activated by AMP. In addition AMP binding to AMPK facilitates phosphorylation by AMPKK as well as suppressing dephosphorylation by the phosphatase PP2C. These multiple effects of AMP on regulating the phosphorylation of AMPK at Thr-72 serve to substantially amplify the systems responsiveness to AMP.

In general, there is a need to better understand the regulation and mode of action of AMP kinase.

Summary of the Invention:

The present inventors have unexpectedly found that the β subunit of AMP kinase binds oligosaccharides and have identified the oligosaccharide binding domain within the β subunit. The present inventors have also found that the binding of oligosaccharide to the β subunit modulates the activity of AMP kinase. As the inventors have identified a previously unknown binding event, this allows for known assay systems to be used to screen for agonists or antagonists which modulate the binding of an oligosaccharide to AMP kinase.

In one aspect, the present invention provides a method of screening for a compound that modulates the binding of an oligosaccharide to a beta subunit of AMP kinase, the method comprising; a) exposing a candidate compound to an oligosaccharide and a polypeptide comprising a beta subunit of AMP kinase, or a mutant and/or fragment thereof which binds an oligosaccharide; and b) assessing the ability of the candidate compound to modulate binding of the polypeptide to the oligosaccharide.

Preferably, the polypeptide comprises a sequence selected from the group consisting of: i) a sequence shown in SEQ ID NO: 1, ii) a sequence shown in SEQ ID NO: 2, iii) a sequence shown in SEQ ID NO:3, iv) a sequence shown in SEQ ID NO:4, v) a sequence from a region corresponding to any one of i) to iv) of an AMP kinase beta polypeptide, vi) a sequence which is at least 21% identical to any one of i) to v), vii) a sequence shown in SEQ ID NO: 5, viii) a sequence shown in SEQ ID NO: 6, and ix) a fragment of any one of i) to viii) which binds an oligosaccharide. Preferably, the oligosaccharide is a homopolymer of glucose. More preferably, the oligosaccharide is selected from the group consisting of glycogen, starch, amylose, amylopectin and dextran. Most preferably, the oligosaccharide is glycogen.

Preferably, the polypeptide is at least 30%, more preferably at least 40%, even more preferably at least 50%, even more preferably at least 60%, even more preferably at least 70%, even more preferably at least 80%, even more preferably at least 90%, even more preferably at least 95%, even more preferably at least 97%, and most preferably at least 99% identical to a sequence provided in SEQ ID NO's: 1 to 4.

Preferably, when the polypeptide is the full length beta subunit of AMP kinase, the polypeptide is present as a heterotrimer further comprising the alpha and gamma subunits of AMP kinase.

As an example of the abovementioned method, the method can be performed in a similar manner as disclosed herein which shows that cyclodextran binds the 68-163 fragment of rat AMPK βl subunit, with the candidate compound being used instead of the cyclodextran.

Preferably, the compound, when bound to the AMP kinase, does not adversely affect the kinase activity of the enzyme. Preferably, the oligosaccharide is detectably labeled. The oligosaccharide can be detectably labeled using known labels such as those selected from the group consisting of: radioisotopes, fluorophores and chromophores.

In another aspect, the present invention provides a method of screening for a compound that modulates the binding of an oligosaccharide to a beta subunit of AMP kinase, the method comprising; a) obtaining a set of atomic coordinates defining the three-dimensional structure of a crystal of a polypeptide comprising a beta subunit of AMP kinase, or a mutant and/or fragment thereof which binds an oligosaccharide; b) selecting a candidate compound by performing rational drug design with the atomic coordinates obtained in step a), wherein said selecting is performed in conjunction with computer modeling; and c) assessing the ability of the candidate compound to modulate binding of the polypeptide to the oligosaccharide.

In a further aspect, the present invention provides a crystal of a beta subunit of AMP kinase, or a mutant and/or fragment thereof which binds an oligosaccharide.

In another aspect, the present invention provides a method of drug design comprising using the structural coordinates of a crystal according to the invention to computationally evaluate a compound for its ability to associate with the oligosaccharide binding domain of the beta subunit of AMP kinase. In one embodiment, the compound enhances oligosaccharide binding to the polypeptide. In another embodiment, the compound decreases or inhibits oligosaccharide binding to the polypeptide.

Upon the identification of a compound that modulates oligosaccharide binding to the polypeptide using the methods of present invention, the agent can be considered as "a lead compound" which is tested by various means to determine if it is useful for various methods as outlined below. Depending on the nature of the identified compound the testing means will vary significantly but will be well within the skill of those in the art.

In another aspect, the present invention provides a compound identified by a method according to the invention. In some cases, the compound identified may already be known. Thus, the present invention provides for the use of this compounds in the methods outlined below. One such compound identified herein which modulates oligosaccharide binding to the beta subunit of AMP kinase is cyclodextran. In a further aspect, the present invention provides a method of treating or preventing a condition associated with AMP kinase activity, the method comprising administering to the subject a compound identified according to the invention.

In one embodiment, the condition can be alleviated by activation of AMPK activity. In another embodiment, the condition can be alleviated by inhibition of AMPK activity.

Preferably, the compound inhibits or reduces glycogen binding to AMP kinase.

Preferably, the compound does not adversely affect the kinase activity of the AMP kinase. Preferably, the condition is associated with a lack of glucose uptake by cells of the subject. More preferably, the condition is selected from the group consisting of: Type II diabetes, atherosclerosis, obesity, cancer, hypercholesterolemia, hypertriglyceridemia and elevated glucose in pre-diabetes

The present invention can also be used to facilitate athletic training or improve the metabolic profile of sedentary people. In each instance, the invention would be useful through promoting catabolic pathways.

Accordingly, in another aspect the present invention provides a method of increasing catabolism in a subject, the method comprising method comprising administering to the subject a compound identified according to the invention, wherein the compound does not adversely affect the kinase activity of the AMP kinase.

Compounds used in this method would activate, altering gene transcription mimicking the effects of exercise and or caloric restriction.

Preferably, the compound still enables AMP kinase to be phosphorylated at Thr- 172. In yet another aspect, the present invention provides a method of increasing fatty acid oxidation in a subject, the method comprising administering to the subject a compound identified according to the invention, wherein the compound does not adversely affect the kinase activity of the AMP kinase.

In a further aspect, the present invention provides a method of reducing cellular malonyl CoA levels in a subject, the method comprising administering to the subject a compound identified according to the invention, wherein the compound does not adversely affect the kinase activity of the AMP kinase.

In another aspect, the present invention provides a method of reducing cholesterol and/or fatty acid synthesis in a subject, the method comprising administering to the organism a compound identified, according to the invention, wherein the compound does not adversely affect the kinase activity of the AMP kinase.

In a further aspect, the present invention provides a method of inhibiting release of cholesterol and/or fatty acid synthesis from intracellular stores by hormone sensitive lipase in a subject, the method comprising administering a compound identified according to the invention, wherein the compound does not adversely affect the kinase activity of the AMP kinase.

In another aspect, the present invention provides a method of regulating transcription of a gene under control of AMP kinase, the method comprising administering a compound identified according to the invention. It is known that cancer cells generally are in a stressed state, relying on pathways involving AMP kinase to provide the necessary energy requirements of the cell. Thus, it is expected that reducing the activity of AMP kinase in cancer cells will be detrimental to the proliferation of the cancer cells.

Accordingly, in another aspect, the present invention provides a method of treating cancer in a subject, the mention comprising administering a compound identified according to the invention that binds the oligosaccharide binding domain of the beta subunit of AMP kinase, and reduces or inactivates kinase activity of AMP kinase.

Preferably, the compound is administered directly to the cancer in the patient. In a further aspect, the present invention provides a method of reducing levels of free glycogen in the cell of a subject, the method comprising administering to the subject a beta subunit of AMP kinase, or a mutant and/or fragment thereof which binds an oligosaccharide, or a compound identified according to the invention.

Preferably, the polypeptide does not bind to other subunits of AMP kinase. Preferably, the kinase is administered as an expression vector encoding the kinase.

In another aspect, the present invention provides a method of modulating AMP kinase activity in a patient, the method comprising administering to the patient a polynucleotide encoding a polypeptide selected from the group consisting of: i) a beta subunit of AMP kinase, ii) a mutant and/or fragment of i) which binds an oligosaccharide, or iii) a mutant and/or fragment of i) which does not bind an oligosaccharide but still maintains at least some AMK kinase activity.

It is well within the capability of the skilled reader to perform routine experiments to identify AMP kinase mutants which have the desired characteristics. With regard to mutants that do not bind an oligosaccharide but still maintain at least some AMK kinase activity, the most likely residues which could be mutated are those which are highly conserved in the oligosaccharide binding domains of the beta subunit of AMP kinases. Accordingly, the present invention also provides mutants of the beta subunit of AMP kinase which do not bind an oligosaccharide but maintain kinase activity.

In another aspect, the present invention provides a method of diagnosing a disease associated with AMP kinase activity, the method comprising obtaining a nucleic acid sample from a subject and characterising the gene sequence encoding the oligosaccharide binding domain of the beta subunit of AMP kinase. Preferably, the nucleic acid is genomic DNA.

More preferably, the characterisation involves comparing the gene sequence in the DNA sample obtained from the subject with that of the wild type sequence for the oligosaccharide binding domain of the beta subunit of AMP kinase.

The identification of an oligosaccharide binding domain in the beta subunit of the AMP kinase enables this domain to be used to detect an oligosaccharide in a sample.

Accordingly, in another aspect the present invention provides a system for identifying an oligosaccharide in a sample, the system comprising a polypeptide which is a beta subunit of AMP kinase, or a mutant and/or fragment thereof which binds an oligosaccharide, and means for detecting an oligosaccharide bound to the polypeptide.

Preferably, the polypeptide is attached to a molecule that is identified by the detection means. More preferably, the polypeptide is a fusion protein. Even more preferably, the fusion protein comprises an enzyme that can be detected by the production of an assayable product. Examples of such enzymes include luciferases, fluorescent proteins such as the green fluorescent protein, or chloramphenicol acetyl transferase.

In yet another aspect, the present invention provides a substantially purified polypeptide which binds to an oligosaccharide, the polypeptide comprising a sequence selected from the group consisting of: i) a sequence shown in SEQ ID NO: 1, ii) a sequence shown in SEQ ID NO: 2, iii) a sequence shown in SEQ ID NO:3, iv) a sequence shown in SEQ ID NO:4, v) a sequence from a region corresponding to any one of i) to iv) of an AMP kinase beta polypeptide, vi) a sequence which is at least 21% identical to any one of i) to v), vii) a sequence shown in SEQ ID NO: 5, viii) a sequence shown in SEQ ID NO: 6, and ix) a fragment of any one of i) to viii) which binds an oligosaccharide, wherein the polypeptide does not comprise a full length sequence of an AMP kinase beta subunit.

Preferably, the oligosaccharide is a homopolymer of glucose. More preferably, the oligosaccharide is selected from the group consisting of glycogen, starch, amylose, amylopectin and dextran. Most preferably, the oligosaccharide is glycogen.

Preferably, the polypeptide is less than about 200 amino acids in length, more preferably less than about 150 amino acids in length, and even more preferably less than about 100 amino acids in length.

Preferably, a region corresponding to any one of i) to iv) of an AMP kinase beta polypeptide is selected from the group of polypeptides provided in Figure 9.

In another aspect, the present invention provides a fusion protein comprising a beta subunit of AMP kinase, or a mutant and/or fragment thereof which binds an oligosaccharide, fused to at least one other polypeptide sequence.

In a preferred embodiment, the at least one other polypeptide is selected from the group consisting of: a polypeptide that enhances the stability of the polypeptide of the invention, a polypeptide that assists in the purification of the fusion protein, and a polypeptide that assists in the detection of an oligosaccharide bound to the polypeptide of the invention.

Preferably, a polypeptide that assists in the detection of the oligosaccharide bound to the polypeptide of the invention is selected from the group consisting of: a luciferase, a fluorescent protein such as the green fluorescent protein, or chloramphenicol acetyl transferase. In a further aspect the present invention provides an isolated polynucleotide encoding a polypeptide of the invention, or encoding a fusion polypeptide of the invention.

In another aspect, the present invention provides a suitable vector for the replication and/or expression of a polynucleotide of the invention. The vector may be a, for example, plasmid, virus or phage vector provided with an origin of replication, and preferably a promotor for the expression of the polynucleotide and optionally a regulator of the promotor. The vector may contain one or more selectable markers, for example an ampicillin resistance gene in the case of a bacterial plasmid or a neomycin resistance gene for a mammalian expression vector. The vector may be used in vitro, for example for the production of RNA or used to transfect or transform a host cell.

In another aspect of the invention relates to host cells transformed or transfected with a vector of the invention.

In yet a further aspect, the present invention provides a process for preparing a polypeptide according to the invention which includes cultivating a host cell transformed or transfected with a vector of the invention under conditions providing for expression of the polynucleotide encoding the polypeptide, and recovering the expressed polypeptide. Such cells can be used for the production of commercially useful quantities of the encoded polypeptide. In another aspect, the present invention provides a composition, the composition comprising a polypeptide of the invention, or a fusion polypeptide of the invention, and an acceptable carrier.

In a further aspect, the present invention provides a composition comprising a vector according to the invention and an acceptable carrier. In another aspect, the present invention provides a method generating a sequence provided as SEQ ID NO:l, the method comprising exposing rat βl subunit of AMP kinase to multiple proteases.

Preferably, the multiple proteases are chymotrypsin, endoproteinase Asp-N, and endoproteinase Lys-C. The present inventors have also shown that the presence of an agonist in a sample stimulates AMP kinase phosphorylation.

Accordingly, in a further aspect, the present invention provides a method of stimulating phosphorylation of AMP kinase, the method comprising exposing the AMP kinase to an agonist which binds the oligosaccharide binding domain of the AMP kinase, and an enzyme capable of phosphorylating AMP kinase.

In one embodiment, the agonist is an oligosaccharide. Preferably, the oligosaccharide is a homopolymer of glucose. More preferably, the oligosaccharide is selected from the group consisting of glycogen, starch, amylose, amylopectin and dextran. Most preferably, the oligosaccharide is glycogen.

Preferably, the enzyme capable of phosphorylating AMP kinase is AMP kinase kinase.

As will be apparent, preferred features and characteristics of one aspect of the invention are applicable to many other aspects of the invention.

The invention is hereinafter described by way of the following non-limiting example and with reference to the accompanying figures.

Brief Description of the Accompanying Drawings

Figure 1: JPRED secondary structure prediction of the βl subunit of rat AMP kinase. The rat AMPK βl subunit (SEQ ID NO:7) was analysed using the JPRED server (found at http ://jura. ebi. ac.uk: 8888/submit. html) (Cuff et al., 1998).

Figure 2: Comparison of AMPK βl oligosaccharide-binding domain (OBD) with oligosaccharide-binding domains from the following proteins; rat AMPK βl (accession number P80386) (SEQ ID NO:l), rat AMPK β2 (accession number Q9QZH4) (SEQ ID NO:2), SIP2 (accession number P341640) (SEQ ID NO:8), GAL83 (accession number Q04739) (SEQ ID NO:9), Human Glycogen Branching Enzyme (accession number NP_000149) (SEQ ID NO: 10), P. sativum Starch Branching Enzyme I (accession number CAA56319) (SEQ ID NO: 11), Guillardia theta (accession number AAK39740) (SEQ ID NO:12), A. niger Glucoamylase (accession number 1633184) (SEQ ID NO: 13), Bacillus Cereus Beta-Amylase (accession number 5822031) (SEQ ID NO: 14) and Bacillus circulans Alpha-amylase (accession number 1310942) (SEQ ID NO: 15). Amino acid sequences were aligned with Clustalw and formatted by an Excel macro (Haygood, 1993). Conserved amino acids are shaded black and conservative substitutions shaded grey.

Figure 3: Purification of AMPK βl OBD. Shown here are purification steps taken to purify the AMPK βl OBD (68-163) from bacterial lysates as described in then methods. Briefly, the OBD was expressed with an N-terminal His tag and purified by Ni-agarose affinity chromatography (Lanes 1-5). The N-terminal His tag was cleaved with the TEV protease. The final OBD product can be see in lane 6. Figure 4: Saturation curve for AMP kinase OBD βl binding to glycogen. Increasing amounts (1 - 75μg) of purified AMPK βl (68-163) fragment were incubated with 0.5% glycogen for 60 minutes at 4°C with mixing, followed by centrifugation at 200,000g / 60 minutes / 4°C. The pellets were briefly washed and resuspended in gel electrophoresis sample buffer containing 10 mM DTT, boiled and analysed by Tris- tricine gel electrophoresis (16.5%). Relative amounts of the OBD that precipitated with the glycogen fraction was determined by densitometry of the Coommassie-stained gel (see inset) and plotted as shown here.

Figure 5: β cyclodextran inhibition of AMPK βl OBD binding to glycogen. The OBD / glycogen-binding experiment shown above was repeated using 20μg OBD and incubated with increasing concentrations of either β-cyclodextrin or sulfo-β- cyclodextrin. Relative amounts of the OBD that precipitated with the glycogen fraction (pellet) was determined by densitometry of the Coommassie-stained gel (see inset) and plotted as shown here.

Figure 6: β cyclodextran inhibits AMPK βl OBD binding to glycogen but not the maltose binding protein. To determine the specificity of the AMPK βl OBD glycogen- binding assay, 20μg of AMPK βl OBD, 20μg of purified maltose-binding protein or 20μg of bovine serum albumin were incubated on their own or in the presence of 0.5% glycogen +/- 10 mM β-cyclodextrin / 60 minutes / 4°C with mixing. Samples were centrifuged and the pelleted fraction was analysed by Tris-tricine gel electrophoresis (16.5%).

Figure 7: β cyclodextran inhibition of AMPK requires β subunit. Purified AMPK (lOng/μl) was incubated with increasing concentrations (2 - 4 mM) of sulfo-β- cyclodextrin in a buffer containing 50 mM Hepes pH 7.5, 150 mM NaCl and 0.1 % NP- 40, for 60 minutes at 4°C with mixing. Duplicate aliquots (20μl) were taken and the AMPK assayed using the SAMS peptide substrate, HMRSAMSGLHLVKRR-amide for 10 minutes. AMPK activity is expressed as a percentage of the control that did not contain any sulfo-β-cyclodextrin. 3.8ng/μl MBP-AMPK alpha (1-312) was activated with purified CAMKIK and incubated with increasing concentrations (2 - 4 mM) of sulfo-β-cyclodextrin in a buffer containing 50 mM Hepes pH 7.5, 150 mM NaCl and 0.1 % NP-40, for 60 minutes at 4°C with mixing. Duplicate aliquots (20μl) were taken and the MBP-AMPK alpha (1-312) assayed using the SAMS peptide substrate, HMRSAMSGLHLVKRR-amide for 10 minutes. Activity is represented as cpm, ³²P phosphate transferred to the peptide substrate.

Figure 8: Sequence comparison of OBD with starch binding residues known to be important in binding. A: Comparison of AMPK βl oligosaccharide binding domain (accession number P80386) (SEQ ID NO:l) with the starch-binding domain from A. niger Glucoamylase (accession number 1633184) (SEQ ID NO:16). Amino acid sequences were aligned with Clustalw and formatted by an Excel macro (Haygood, 1993). Conserved amino acids are shaded black and conservative substitutions shaded grey. B: Comparison of rat AMPK βl oligosaccharide-binding domain (accession number P80386) with the putative glycogen-binding domains of rat PPP1R4 (serine- threonine protein phosphatase, glycogen-binding (GL) subunit) (accession number CAA77083) (SEQ ID NO: 17) and Human Liver Glycogen Synthase (accession number P54840) (SEQ ID NO: 18). Amino acid sequences were aligned with Clustalw and formatted by an Excel macro (Haygood, 1993). Conserved amino acids are shaded black and conservative substitutions shaded grey.

Figure 9: Comparison of the AMPK βl OBD sequence with β/gal83 family members. Comparison of rat AMPK βl oligosaccharide-binding domain (accession number P80386) (SEQ ID NO:l) with rat AMPK β2 (accession number Q9QZH4) (SEQ ID NO:2), human AMPK βl (accession number Q9Y478) (SEQ ID NO:3), human AMPK β2(accession number NP_005390) (SEQ ID NO:4), S. cerevisiae GAL83 (accession number Q04739) (SEQ ID NO:9) , S. cerevisiae SIP2 (accession number P34164) (SEQ ID NO:8), S. cerevisiae SIP1 (accession number AAB64887) (SEQ ID NO: 19), C. elegans AMPK βl (accession number CAB04480) (SEQ ID NO:20), C. elegans AMPK β2 (accession number NP_499446) (SEQ ID NO:21), A. thalania AMPK βl (accession number NP_197615) (SEQ ID NO:22), A. thalania AMPK β2 (accession number CAB64719) (SEQ ID NO:23), S. pombe AMPK β (accession number CAA22634) (SEQ ID NO:24) and G. theta AMPK β (accession number AAK39740) (SEQ ID NO: 12). Amino acid sequences were aligned with Clustalw and formatted by an Excel macro (Haygood, 1993). Conserved amino acids are shaded black and conservative substitutions shaded grey.

Figure 10: A: Consensus sequence for the oligosaccharide binding domain of the β subunit of members of the AMP kinase protein family (SEQ ID NO:6). B: Consensus sequence for the oligosaccharide binding domain of the β subunit of mammalian AMP kinases (SEQ ID NO:5). § represents a hydrophobic residue (I,V,F,M,L), X represents any amino acid, X followed by a number (e.g. X₂) represents that the designated number of any amino acids follows the previous amino acid, X followed by a range of numbers (e.g. _4-10) represents that the number of amino acids can be any number within the designated range, and where two amino acids are flanked by 7" (e.g. F/I) this represents that either of the designated amino acids could be at this position.

Figure 11: Panel A: Rat liver AMPK (αβγ) associates with glycogen however AMPK activity is not inhibited in the presence of glycogen, n=6. S and P are supernatant and pellet fractions following centrifugation Panel B: Glycogen (3 %) stimulates 3 -fold activation of bacterially expressed AMPK heterotrimer (αβγ) by an AMPKK present in rat muscle cell lysate. The graph shows duplicate values and represents 3 separate experiments.

Figure 12: Residues important for glycogen-binding were predicted by the structural alignment and model. Wild type and mutant β-OBD were incubated with glycogen; I = starting material, S = supernatant and P = glycogen pellet. As predicted from the model shown in Figures 9 and 13, essential residues include W100 and K126 whilst W133 and G147 contribute to glycogen binding.

Figure 13: Structural alignment of Snfl family of β subunits based on the structure of E.coli glycogen branching enzyme. A ribbon representation of the OBD model shown as a sandwich, with two anti-parallel β sheets (grey scale), was constructed based on the structural alignment of N-isoamylase domains (PDB entries: 1M7X, 1EH9, 1BF2). Residues conserved across the larger starch/glycogen-binding domain family are labelled orange whilst AMPK specific residues including an autophosphorylation site at Ser 108 are labelled black. Potential sugar-binding mode for the OBD based on the crystal structure of cyclodextrin glycosyltransferase complexed with carbohydrate (PDB entry 1DIJ). Maltotriose, a small polysaccharide, (shown with dark bonds) and relevant residues are shown in ball-and-stick representation. Dashed lines indicate possible hydrogen bonds.

Key to the Sequence Listing

SEQ ID NO: 1 - Rat βl AMP kinase oligosaccharide binding domain. SEQ ID NO:2 - Rat β2 AMP kinase oligosaccharide binding domain. SEQ ID NO:3 - Human βl AMP kinase oligosaccharide binding domain. SEQ ID NO:4 - Human β2 AMP kinase oligosaccharide binding domain.

SEQ ID NO: 5 - Consensus sequence for the oligosaccharide binding domain of the β subunit of mammalian AMP kinases.

SEQ ID NO: 6 - Consensus sequence for the oligosaccharide binding domain of the β subunit of members of the AMP kinase protein family.

SEQ ID NO:7 - Full length rat βl AMP kinase.

SEQ ID NO: 8 - Region of S. cerevisiae SIP2 which corresponds to the rat βl AMP kinase oligosaccharide binding domain.

SEQ ID NO: 9 - Region of S. cerevisiae gal83 which corresponds to the rat βl AMP kinase oligosaccharide binding domain.

SEQ ID NO: 10 - Region of human glycogen branching enzyme which corresponds to the rat βl AMP kinase oligosaccharide binding domain.

SEQ ID NO: 11 - Region of P. sativum starch branching enzyme I which corresponds to the rat βl AMP kinase oligosaccharide binding domain. SEQ ID NO: 12 - Region of Guillardia theta β subunit of AMP kinase which corresponds to the rat βl AMP kinase oligosaccharide binding domain.

SEQ ID NO: 13 - Region of A. niger glucoamylase which corresponds to the rat βl

AMP kinase oligosaccharide binding domain.

SEQ ID NO: 14 - Region of Bacillus cereus beta-amylase which corresponds to the rat βl AMP kinase oligosaccharide binding domain.

SEQ ID NO: 15 - Region of Bacillus circulans Alpha-amylase which corresponds to the rat βl AMP kinase oligosaccharide binding domain.

SEQ ID NO: 16 - Region of A. niger glucoamylase which corresponds to the rat βl

AMP kinase oligosaccharide binding domain (slightly different length than SEQ ID NO: 13).

SEQ ID NO: 17 - Region of rat PPP1R4 which corresponds to the rat βl AMP kinase oligosaccharide binding domain.

SEQ ID NO: 18 - Region of human liver glycogen synthase which corresponds to the rat βl AMP kinase oligosaccharide binding domain. SEQ ID NO:19 - Region of S. cerevisiae SIPl which corresponds to the rat βl AMP kinase oligosaccharide binding domain.

SEQ ID NO:20 - Region of C. elegans AMPK βl which corresponds to the rat βl AMP kinase oligosaccharide binding domain.

SEQ ID NO:21 - Region of C. elegans AMPK β2 which corresponds to the rat βl AMP kinase oligosaccharide binding domain. SEQ ID NO:22 - Region of A. thalania AMPK βl which corresponds to the rat βl

AMP kinase oligosaccharide binding domain.

SEQ ID NO:23 - Region of A. thalania AMPK β2 which corresponds to the rat βl

AMP kinase oligosaccharide binding domain. SEQ ID NO:24 - Region of S. pombe AMPK β which corresponds to the rat βl AMP kinase oligosaccharide binding domain.

SEQ ID NO:25 - Partial sequence of sense PCR primer for amplifying AMPK βl (42-

183).

SEQ ID NO:26 - Partial sequence of antisense PCR primer for amplifying AMPK βl (42-183).

SEQ ID NO:27 - Partial sequence of sense PCR primer for amplifying AMPK βl (68-

163).

SEQ ID NO:28 - Partial sequence of antisense PCR primer for amplifying AMPK βl

(68-163). SEQ ID NO:29 - Fusion protein comprising His6 tag and the rat AMPK βl (68-163) fragment.

SEQ ID NO:30 - N-terminal sequence cleaved AMPK βl (68-163) fusion protein.

SEQ ID O:31 - SAMS peptide substrate.

SEQ ID NO's:32 to 43: PCR primers used in mutagenesis studies.

Detailed Description of the Invention:

General Techniques

Unless otherwise indicated, the recombinant DNA techniques utilized in the present invention are standard procedures, well known to those skilled in the art. Such techniques are described and explained throughout the literature in sources such as, J.

Perbal, A Practical Guide to Molecular Cloning, John Wiley and Sons (1984), J.

Sambrook et al., Molecular Cloning: A Laboratory Manual, Cold Spring Harbour

Laboratory Press (1989), T.A. Brown (editor), Essential Molecular Biology: A

Practical Approach, Volumes 1 and 2, IRL Press (1991), D.M. Glover and B.D. Hames (editors), DNA Cloning: A Practical Approach, Volumes 1-4, IRL Press (1995 and

1996), and F.M. Ausubel et al. (Editors), Current Protocols in Molecular Biology,

Greene Pub. Associates and Wiley-Interscience (1988, including all updates until present) and are incorporated herein by reference. Definitions

As used herein, the "beta subunit of AMP kinase, or a mutant and/or fragment thereof which binds an oligosaccharide" refers to a polypeptide comprising a sequence selected from the group consisting of: i) a sequence shown in SEQ ID NO: 1, ii) a sequence shown in SEQ ID NO: 2, iii) a sequence shown in SEQ ID NO:3, iv) a sequence shown in SEQ ID NO: 4, v) a sequence from a region corresponding to any one of i) to iv) of an AMP kinase beta polypeptide, vi) a sequence which is at least 21% identical to any one of i) to v) which binds an oligosaccharide, vii) a sequence shown in SEQ ID NO: 5, viii) a sequence shown in SEQ ID NO: 6, and ix) a fragment of any one of i) to viii) which binds an oligosaccharide.

"A region corresponding to any one of i) to iv) of an AMP kinase beta polypeptide" can be determined by aligning the sequences provided herein with other AMP kinase as, for example, provided as Figure 9 herein.

An "oligosaccharide" is a carbohydrate formed from monosaccharide units of the same or different type. As used herein, there is no upper limit on the number of subunits in the oligosaccharide. Examples of oligosaccharides include, but are not limited to, glycogen, starch, amylose, amylopectin, dextran and cyclodextran.

By "substantially purified" we mean a polypeptide that has been separated from the lipids, nucleic acids, other polypeptides, and other contaminating molecules with which it is associated in its native state. Preferably, the substantially purified polypeptide is at least 60% free, preferably at least 75% free, and most preferably at least 90% free from other components with which they are naturally associated.

By "isolated polynucleotide", we mean a polynucleotide separated from the polynucleotide sequences with which it is associated or linked in its native state. Preferably, the isolated polynucleotide is at least 60% free, preferably at least 75% free, and most preferably at least 90% free from other components with which they are naturally associated. Furthermore, the term "polynucleotide" is used interchangeably herein with the term "nucleic acid molecule".

Throughout this specification the word "comprise", or variations such as "comprises" or "comprising", will be understood to imply the inclusion of a stated element, integer or step, or group of elements, integers or steps, but not the exclusion of any other element, integer or step, or group of elements, integers or steps.

As used herein a "lead compound" is a compound which is subject to trials with the goal of ultimately being formulated in, for example, a composition and sold for use in methods of treating or preventing a condition associated with AMP kinase activity.

Polypeptides

The % identity of a polypeptide is determined by GAP (Needleman and Wunsch, 1970) analysis (GCG program) with a gap creation penalty=5, and a gap extension penalty=0.3. The query sequence is at least 15 amino acids in length, and the GAP analysis aligns the two sequences over a region of at least 15 amino acids. More preferably, the query sequence is at least 50 amino acids in length, and the GAP analysis aligns the two sequences over a region of at least 50 amino acids. Even more preferably, the query sequence is at least 100 amino acids in length and the GAP analysis aligns the two sequences over a region of at least 100 amino acids.

Amino acid sequence mutants of the polypeptides of the present invention can be prepared by introducing appropriate nucleotide changes into a nucleic acid of the present invention, or by in vitro synthesis of the desired polypeptide. Such mutants include, for example, deletions, insertions or substitutions of residues within the amino acid sequence. A combination of deletion, insertion and substitution can be made to arrive at the final construct, provided that the final protein product possesses the desired functional characteristics.

In designing amino acid sequence mutants, the location of the mutation site and the nature of the mutation will depend on characteristic(s) to be modified. The sites for mutation can be modified individually or in series, e.g., by (1) substituting first with conservative amino acid choices and then with more radical selections depending upon the results achieved, (2) deleting the target residue, or (3) inserting other residues adjacent to the located site.

Amino acid sequence deletions generally range from about 1 to 30 residues, more preferably about 1 to 10 residues and typically about 1 to 5 contiguous residues.

Substitution mutants have at least one amino acid residue in the polypeptide molecule removed and a different residue inserted in its place. The sites of greatest interest for substitutional mutagenesis include sites identified as not being essential for oligosaccharide binding. Sites falling within a sequence of at least three other identically conserved sites, are preferably substituted in a relatively conservative manner. Such conservative substitutions are shown in Table 1 under the heading of "exemplary substitutions".

TABLE 1 - Exemplary Substitutions

Furthermore, if desired, unnatural amino acids or chemical amino acid analogues can be introduced as a substitution or addition into the polypeptides of the present invention. Such amino acids include, but are not limited to, the D-isomers of the common amino acids, 2,4-diaminobutyric acid, α-amino isobutyric acid, 4- aminobutyric acid, 2-aminobutyric acid, 6-amino hexanoic acid, 2-amino isobutyric acid, 3 -amino propionic acid, ornithine, norleucine, norvaline, hydroxyproline, sarcosine, citrulline, homocitrulline, cysteic acid, t-butylglycine, t-butylalanine, phenylglycine, cyclohexylalanine, β-alanine, fluoro-amino acids, designer amino acids such as β-methyl amino acids, Cα-methyl amino acids, Nα-methyl amino acids, and amino acid analogues in general.

Also included within the scope of the invention are polypeptides of the present invention which are differentially modified during or after synthesis, e.g., by biotinylation, benzylation, glycosylation, acetylation, phosphorylation, amidation, derivatization by known protecting/blocking groups, proteolytic cleavage, linkage to an antibody molecule or other cellular ligand, peptide epitope tag etc. These modifications may serve to increase the stability and/or bioactivity of the polypeptide of the invention.

Polypeptides of the present invention can be produced in a variety of ways, including production and recovery of natural proteins, production and recovery of recombinant proteins, and chemical synthesis of the proteins. In one embodiment, an isolated polypeptide of the present invention is produced by culturing a cell capable of expressing the polypeptide under conditions effective to produce the polypeptide, and recovering the polypeptide. A preferred cell to culture is a recombinant cell of the present invention. Effective culture conditions include, but are not limited to, effective media, bioreactor, temperature, pH and oxygen conditions that permit protein production. An effective medium refers to any medium in which a cell is cultured to produce a polypeptide of the present invention. Such medium typically comprises an aqueous medium having assimilable carbon, nitrogen and phosphate sources, and appropriate salts, minerals, metals and other nutrients, such as vitamins. Cells of the present invention can be cultured in conventional fermentation bioreactors, shake flasks, test tubes, microtiter dishes, and petri plates. Culturing can be carried out at a temperature, pH and oxygen content appropriate for a recombinant cell. Such culturing conditions are within the expertise of one of ordinary skill in the art.

Polynucleotides

The % identity of a polynucleotide is determined by GAP (Needleman and Wunsch, 1970) analysis (GCG program) with a gap creation penalty=5, and a gap extension penalty=0.3. The query sequence is at least 45 nucleotides in length, and the GAP analysis aligns the two sequences over a region of at least 45 nucleotides. Preferably, the query sequence is at least 150 nucleotides in length, and the GAP analysis aligns the two sequences over a region of at least 150 nucleotides. More preferably, the query sequence is at least 300 nucleotides in length and the GAP analysis aligns the two sequences over a region of at least 300 nucleotides.

A polynucleotide of the present invention may selectively hybridise to a polynucleotide that encodes a polypeptide of the present invention under high stringency. As used herein, stringent conditions are those that (1) employ low ionic strength and high temperature for washing, for example, 0.015 M NaCl/0.0015 M sodium citrate/0.1% NaDodSO₄ at 50°C; (2) employ during hybridisation a denaturing agent such as formamide, for example, 50% (vol/vol) formamide with 0.1% bovine serum albumin, 0.1% Ficoll, 0.1% polyvinylpyrrolidone, 50 mM sodium phosphate buffer at pH 6.5 with 750 mM NaCl, 75 mM sodium citrate at 42°C; or (3) employ 50% formamide, 5 x SSC (0.75 M NaCl, 0.075 M sodium citrate), 50 mM sodium phosphate (pH 6.8), 0.1% sodium pyrophosphate, 5 x Denhardt's solution, sonicated salmon sperm DNA (50 g/ml), 0.1% SDS and 10% dextran sulfate at 42°C in 0.2 x SSC and 0.1% SDS. Polynucleotides of the present invention may possess one or more mutations which are deletions, insertions, or substitutions of nucleotide residues. Mutants can be either naturally occurring (that is to say, isolated from a natural source) or synthetic (for example, by performing site-directed mutagenesis on the nucleic acid). It is thus apparent that polynucleotides of the invention can be either naturally occurring or recombinant.

Recombinant Vectors

One embodiment of the present invention includes a recombinant vector, which includes at least one isolated polynucleotide molecule of the present invention, inserted into any vector capable of delivering the polynucleotide molecule into a host cell. Such a vector contains heterologous polynucleotide sequences, that is polynucleotide sequences that are not naturally found adjacent to polynucleotide molecules of the present invention and that preferably are derived from a species other than the species from which the polynucleotide molecule(s) are derived. The vector can be either RNA or DNA, either prokaryotic or eukaryotic, and typically is a virus or a plasmid.

One type of recombinant vector comprises a polynucleotide molecule of the present invention operatively linked to an expression vector. The phrase operatively linked refers to insertion of a polynucleotide molecule into an expression vector in a manner such that the molecule is able to be expressed when transformed into a host cell. As used herein, an expression vector is a DNA or RNA vector that is capable of transforming a host cell and of effecting expression of a specified polynucleotide molecule. Preferably, the expression vector is also capable of replicating within the host cell. Expression vectors can be either prokaryotic or eukaryotic, and are typically viruses or plasmids. Expression vectors of the present invention include any vectors that function (i.e., direct gene expression) in recombinant cells of the present invention, including in bacterial, fungal, endoparasite, arthropod, other animal, and plant cells. Preferred expression vectors of the present invention can direct gene expression in bacterial, yeast, plant and mammalian cells, and more preferably in the cell types disclosed herein.

In particular, expression vectors of the present invention contain regulatory sequences such as transcription control sequences, translation control sequences, origins of replication, and other regulatory sequences that are compatible with the recombinant cell and that control the expression of polynucleotide molecules of the present invention. In particular, recombinant molecules of the present invention include transcription control sequences. Transcription control sequences are sequences which control the initiation, elongation, and termination of transcription. Particularly important transcription control sequences are those which control transcription initiation, such as promoter, enhancer, operator and repressor sequences. Suitable transcription control sequences include any transcription control sequence that can function in at least one of the recombinant cells of the present invention. Recombinant molecules of the present invention may also (a) contain secretory signals (i.e., signal segment nucleic acid sequences) to enable an expressed polypeptide of the present invention to be secreted from the cell that produces the polypeptide and/or (b) contain fusion sequences which lead to the expression of nucleic acid molecules of the present invention as fusion proteins. Examples of suitable signal segments include any signal segment capable of directing the secretion of a protein of the present invention. Preferred signal segments include, but are not limited to, tissue plasminogen activator (t-PA), interferon, interleukin, growth hormone, histocompatibility and viral envelope glycoprotein signal segments, as well as natural signal sequences. In addition, a nucleic acid molecule of the present invention can be joined to a fusion segment that directs the encoded protein to the proteosome, such as a ubiquitin fusion segment. Recombinant molecules may also include intervening and/or untranslated sequences surrounding and/or within the nucleic acid sequences of nucleic acid molecules of the present invention. Host Cells

Another embodiment of the present invention includes a recombinant cell comprising a host cell transformed with one or more recombinant molecules of the present invention. Transformation of a polynucleotide molecule into a cell can be accomplished by any method by which a polynucleotide molecule can be inserted into the cell. Transformation techniques include, but are not limited to, transfection, electroporation, micro injection, lipofection, adsorption, and protoplast fusion. A recombinant cell may remain unicellular or may grow into a tissue, organ or a multicellular organism. Transformed polynucleotide molecules of the present invention can remain extrachromosomal or can integrate into one or more sites within a chromosome of the transformed (i.e., recombinant) cell in such a manner that their ability to be expressed is retained.

Suitable host cells to transform include any cell that can be transformed with a polynucleotide of the present invention. Host cells of the present invention either can be endogenously (i.e., naturally) capable of producing proteins of the present invention or can be capable of producing such proteins after being transformed with at least one polynucleotide molecule of the present invention. Host cells of the present invention can be any cell capable of producing at least one protein of the present invention, and include bacterial, fungal (including yeast), parasite, arthropod, animal and plant cells. Preferred host cells include bacterial, mycobacterial, yeast, arthropod and mammalian cells. More preferred host cells include Salmonella, Escherichia, Bacillus, Listeria, Saccharomyces, Spodoptera, Mycobacteria, Trichoplusia, BHK (baby hamster kidney) cells, MDCK cells (normal dog kidney cell line for canine herpesvirus cultivation), CRFK cells (normal cat kidney cell line for feline herpesvirus cultivation), CV-1 cells (African monkey kidney cell line used, for example, to culture raccoon poxvirus), COS (e.g., COS-7) cells, and Vero cells. Particularly preferred host cells are E. coli, including E. coli K-12 derivatives; Salmonella typhi; Salmonella typhimurium, including attenuated strains; Spodoptera frugiperda; Trichoplusia ni; BHK cells; MDCK cells; CRFK cells; CV-1 cells; COS cells; Vero cells; and non-tumorigenic mouse myoblast G8 cells (e.g., ATCC CRL 1246). Additional appropriate mammalian cell hosts include other kidney cell lines, other fibroblast cell lines (e.g., human, murine or chicken embryo fibroblast cell lines), myeloma cell lines, Chinese hamster ovary cells, mouse NTH/3 T3 cells, LMTK cells and/or HeLa cells.

Recombinant DNA technologies can be used to improve expression of a transformed polynucleotide molecule by manipulating, for example, the number of copies of the polynucleotide molecule within a host cell, the efficiency with which those polynucleotide molecules are transcribed, the efficiency with which the resultant transcripts are translated, and the efficiency of post-translational modifications. Recombinant techniques useful for increasing the expression of polynucleotide molecules of the present invention include, but are not limited to, operatively linking polynucleotide molecules to high-copy number plasmids, integration of the polynucleotide molecule into one or more host cell chromosomes, addition of vector stability sequences to plasmids, substitutions or modifications of transcription control signals (e.g., promoters, operators, enhancers), substitutions or modifications of translational control signals (e.g., ribosome binding sites, Shine-Dalgarno sequences), modification of polynucleotide molecules of the present invention to correspond to the codon usage of the host cell, and the deletion of sequences that destabilize transcripts.

Agonists and Antagonists - Assays and Molecules

The β subunit AMP kinase related polypeptides may be employed in a screening process for compounds which activate (agonists) or inhibit activation (antagonists) the ability of the polypeptide to bind to an oligosaccharide.

One method for screening for antagonists involves mixing an epitope tagged version of the polypeptide with an oligosaccharide and measuring their binding to each other in the presence or absence of the putative antagonist. This binding assay may be in the form of an ELISA plate assay. There are other binding formats known to those of skill in the art, including coprecipitation, centrifugation and surface plasmon resonance.

Examples of potential antagonists include antibodies, oligosaccharides and derivatives thereof, or in some cases peptides which bind to the oligosaccharide binding domain of the beta subunit of AMP kinase related polypeptides. Preferably, the antagonist does not adversely affect the kinase activity of AMP kinase.

A potential antagonist is a small molecule which binds to the oligosaccharide binding domain of the beta subunit of AMP kinase, making it inaccessible to an oligosaccharide. Examples of small molecules include, but are not limited to, small peptides or peptide-like molecules. The small molecules may mimic the structure to the oligosaccharide binding domain of the beta subunit of AMP kinase and bind to an oligosaccharide, preventing it from associating with AMP kinase.

In general, agonists or antagonists which can be used to regulate oligosaccharide binding to AMP kinase are employed for therapeutic and prophylactic purposes for such diseases or disorders as those detailed hereinbefore, among others. The agonists or antagonists which can be used to regulate oligosaccharide binding to AMP kinase can act indirectly on the oligosaccharide binding domain. More specifically, as outlined above, AMPK is a heterotrimer comprising the α, β and γ subunits. The present invention also envisages the situation where an agonist or antagonist acts through the α and/or γ subunits, altering the structure of the β subunit when bound to the other subunits, and affecting oligosaccharide binding to the β subunit.

Phage Libraries for Drug Screening Phage libraries can be constructed which when infected into host E. coli produce random peptide sequences of approximately 10 to 15 amino acids. Specifically, the phage library can be mixed in low dilutions with permissive E. coli in low melting point LB agar which is then poured on top of LB agar plates. After incubating the plates at 37°C for a period of time, small clear plaques in a lawn of E. coli will form which represents active phage growth and lysis of the E. coli. A representative of these phages can be absorbed to nylon filters by placing dry filters onto the agar plates. The filters can be marked for orientation, removed, and placed in washing solutions to block any remaining absorbent sites. The filters can then be placed in a solution containing, for example, a radioactive of a beta subunit of AMP kinase, or a mutant and/or fragment thereof (e.g., a polypeptide having an amino acid sequence comprising SEQ ID NO:l). After a specified incubation period, the filters can be thoroughly washed and developed for autoradiography. Plagues containing the phage that bind to the radioactive polypeptide are then isolated. These phages can be further cloned and then retested for their ability to bind to the of a beta subunit of AMP kinase, or a mutant and/or fragment thereof as before. Once the phages have been purified, the binding sequence contained within the phage can be determined by standard DNA sequencing techniques. Once the DNA sequence is known, synthetic peptides can be generated which represents these sequences. These synthetic peptides can then be examined to determine if they modulate oligosaccharide binding to a beta subunit of AMP kinase, or a mutant and/or fragment thereof.

The effective peptide(s) can be synthesized in large quantities for use in in vivo models and eventually in humans to modulate AMP kinase activity. It should be emphasized that synthetic peptide production is relatively non-labor intensive, easily manufactured, quality controlled and thus, large quantities of the desired product can be produced rather cheaply. Protein-Structure Based Design of Agonists and Antagonists

The three-dimensional structure of a crystal comprising a beta subunit of AMP kinase, or a mutant and/or fragment thereof which binds an oligosaccharide can be used to identify antagonists or agonists through the use of computer modeling using a docking program such as GRAM, DOCK, or AUTODOCK (Dunbrack et al., 1997). This procedure can include computer fitting of potential ligands to AMP kinase to ascertain how well the shape and the chemical structure of the potential ligand will complement or interfere with oligosaccharide binding. Computer programs can also be employed to estimate the attraction, repulsion, and steric hindrance of the ligand to the oligosaccharide binding site. Generally the tighter the fit (e.g., the lower the steric hindrance, and/or the greater the attractive force) the more potent the potential drug will be since these properties are consistent with a tighter binding constant. Furthermore, the more specificity in the design of a potential drug the more likely that the drug will not interfere with other properties of the beta subunit of AMP kinase, such as the kinase activity per se. This will minimize potential side-effects due to unwanted interactions with other proteins.

Initially a potential compound could be obtained, for example, by screening a random peptide library produced by a recombinant bacteriophage as described above, or a chemical library. A compound selected in this manner could be then be systematically modified by computer modeling programs until one or more promising potential compounds are identified.

Such computer modeling allows the selection of a finite number of rational chemical modifications, as opposed to the countless number of essentially random chemical modifications that could be made, and of which any one might lead to a useful drug. Each chemical modification requires additional chemical steps, which while being reasonable for the synthesis of a finite number of compounds, quickly becomes overwhelming if all possible modifications needed to be synthesized. Thus through the use of the three-dimensional structure disclosed herein and computer modeling, a large number of these compounds can be rapidly screened on the computer monitor screen, and a few likely candidates can be determined without the laborious synthesis of untold numbers of compounds.

The prospective drug (agonist or antagonist) can be placed into any standard binding assay to test its effect on the ability of an oligosaccharide to bind a beta subunit of AMP kinase, or a mutant and/or fragment thereof. For all of the drug screening assays described herein further refinements to the structure of the drug will generally be necessary and can be made by the successive iterations of any and/or all of the steps provided by the particular drug screening assay.

Gene therapy

The polynucleotides, polypeptides, agonists and antagonists that are polypeptides may be employed in accordance with the present invention by expression of such polypeptides in treatment modalities often referred to as "gene therapy". In particular, mutant beta subunit AMP kinase which cannot bind an oligosaccharide but maintain kinase activity may be employed in gene therapy techniques for the treatment of disease. Thus, for example, cells from a patient may be engineered with a polynucleotide, such as a DNA or RNA, to encode a polypeptide ex vivo. The engineered cells can then be provided to a patient to be treated with the polypeptide. In this embodiment, cells may be engineered ex vivo, for example, by the use of a retroviral plasmid vector containing RNA encoding a polypeptide of the present invention can be used to transform stem cells or differentiated stem cells. Such methods are well-known in the art and their use in the present invention will be apparent from the teachings herein.

Further, cells may be engineered in vivo for expression of a polypeptide in vivo by procedures known in the art. For example, a polynucleotide of the invention may be engineered for expression in a replication defective retroviral vector or adenoviral vector or other vector (e.g., poxvirus vectors). The expression construct may then be isolated. A packaging cell is transduced with a plasmid vector containing RNA encoding a polypeptide of the present invention, such that the packaging cell now produces infectious viral particles containing the gene of interest. These producer cells may be administered to a patient for engineering cells in vivo and expression of the polypeptide in vivo. These and other methods for administering a polypeptide of the present invention should be apparent to those skilled in the art from the teachings of the present invention. Retroviruses from which the retroviral plasmid vectors hereinabove-mentioned may be derived include, but are not limited to, Moloney Murine Leukemia Virus, Spleen Necrosis Virus, Rous Sarcoma Virus, Harvey Sarcoma Virus, Avian Leukosis Virus, Gibbon Ape Leukemia Virus, Human Immunodeficiency Virus, Adenovirus, Myeloproliferative Sarcoma Virus, and Mammary Tumor Virus. In a preferred embodiment, the retroviral plasmid vector is derived from Moloney Murine Leukemia Virus. Such vectors will include one or more promoters for expressing the polypeptide. Suitable promoters which may be employed include, but are not limited to, the retroviral LTR; the SV40 promoter; and the human cytomegalovirus (CMV) promoter. Cellular promoters such as eukaryotic cellular promoters including, but not limited to, the histone, RNA polymerase III, and β-actin promoters, can also be used. Additional viral promoters which may be employed include, but are not limited to, adenovirus promoters, thymidine kinase (TK) promoters, and B19 parvovirus promoters. The selection of a suitable promoter will be apparent to those skilled in the art from the teachings contained herein. The nucleic acid sequence encoding the polypeptide of the present invention will be placed under the control of a suitable promoter. Suitable promoters which may be employed include, but are not limited to, adenoviral promoters, such as the adenoviral major late promoter; or heterologous promoters, such as the cytomegalovirus (CMV) promoter; the respiratory syncytial virus (RSV) promoter; inducible promoters, such as the MMT promoter, the metallothionein promoter; heat shock promoters; the albumin promoter; the ApoAI promoter; human globin promoters; viral thymidine kinase promoters, such as the Herpes Simplex thymidine kinase promoter; retroviral LTRs (including the modified retroviral LTRs herein above described); the β-actin promoter; and human growth hormone promoters. The promoter may also be the native promoter which controls the gene encoding the polypeptide.

The retroviral plasmid vector is employed to transduce packaging cell lines to form producer cell lines. Examples of packaging cells which may be transfected include, but are not limited to, the PE501, PA317, Y-2, Y-AM, PA12, T19-14X, VT- 19-17-H2, YCRE, YCRJP, GP+E-86, GP+envAml2, and DAN cell lines as described by Miller (1990). The vector may be transduced into the packaging cells through any means known in the art. Such means include, but are not limited to, electroporation, the use of liposomes, and CaPO₄ precipitation. In one alternative, the retroviral plasmid vector may be encapsulated into a liposome, or coupled to a lipid, and then administered to a host. The producer cell line will generate infectious retroviral vector particles, which include the nucleic acid sequence(s) encoding the polypeptides. Such retroviral vector particles may then be employed to transduce eukaryotic cells, either in vitro or in vivo. The transduced eukaryotic cells will express the nucleic acid sequence(s) encoding the polypeptide. Eukaryotic cells which may be transduced include, but are not limited to, embryonic stem cells, embryonic carcinoma cells, as well as hematopoietic stem cells, hepatocytes, fibroblasts, myoblasts, keratinocytes, endothelial cells, and bronchial epithelial cells.

Genetic therapies in accordance with the present invention may involve a transient (temporary) presence of the gene therapy polynucleotide in the patient or the permanent introduction of a polynucleotide into the patient.

Genetic therapies, like the direct administration of agents discussed above, in accordance with the present invention may be used alone or in conjunction with other therapeutic modalities.

Compositions and Administration

Compositions of the present invention comprise an acceptable carrier. Typically, the carrier will also be considered as a "pharmaceutically acceptable carrier", meaning that it is suitable to be administered to an animal, preferably a human. Suitable carriers include isotonic saline solutions, for example phosphate-buffered saline.

The composition of the invention may be administered by direct injection. The composition may be formulated for, as examples, parenteral, intramuscular, intravenous, subcutaneous, intraocular, oral or transdermal administration. Typically, each protein (for example) may be administered at a dose of from 0.01 to 30 mg/kg body weight, preferably from 0.1 to 10 mg/kg, more preferably from 0.1 to 1 mg/kg body weight. The routes of administration and dosages described are intended only as a guide since a skilled practitioner will be able to determine readily the optimum route of administration and dosage for any particular, compound, animal and condition.

Polynucleotides/vectors encoding polypeptide components may be administered directly as a naked nucleic acid construct, preferably further comprising flanking sequences homologous to the host cell genome. When the polynucleotides/vectors are administered as a naked nucleic acid, the amount of nucleic acid administered may typically be in the range of from 1 μg to 10 mg, preferably from 100 μg to 1 mg. Uptake of naked nucleic acid constructs by mammalian cells is enhanced by several known transfection techniques for example those including the use of transfection agents. Example of these agents include cationic agents (for example calcium phosphate and DEAE-dextran) and lipofectants (for example lipofectam™ and transfectam™). Typically, nucleic acid constructs are mixed with the transfection agent to produce a composition. One embodiment of the present invention is a controlled release formulation that is capable of slowly releasing a composition of the present invention into an animal. As used herein, a controlled release formulation comprises a composition of the present invention in a controlled release vehicle. Suitable controlled release vehicles include, but are not limited to, biocompatible polymers, other polymeric matrices, capsules, microcapsules, microparticles, bolus preparations, osmotic pumps, diffusion devices, liposomes, lipospheres, and transdermal delivery systems. Preferred controlled release formulations are biodegradable (i.e., bioerodible).

Examples:

Cloning of OBD into pProEX HT Since the β subunit of AMP kinase is phosphorylated and protein phosphorylation is commonly used to modify the function of proteins the inventors inspected the predicted secondary structure of the β subunit in proximity to the phosphorylation sites. Using bio-informatics structure prediction programs, JPRED analysis (http://jura.ebi.ac.uk:8888/submit.html), it was found that the β subunit was predicted to contain secondary structural elements (Figure 1). In particular it was found that the sequence contained within residues Asp43 to Pro 183 was predicted to contain multiple β strands. The cDNA encoding the β subunit fragment encompassing residues Asp43-Prol83 was prepared by PCR and cloned.

PCR primers were synthesized corresponding to the N- and C-terminal sequences of AMPK βl (42-183). The sequence of the sense primer was GACGCCGACATCTTCCAC (SEQ ID NO:25), and the sequence of the antisense primer was GGGGGAACTGGACAGCTC (SEQ ID NO:26). EcoRI sites were added to the 5'-ends of these primers and stop codon was included in the antisense primer. The fragment was created by PCR using the above primers, pBKCMV/AMPK β 1 as the template and Platinum Pfx DNA polymerase (Invitrogen). The PCR reaction included an initial 95°C denaturation / 5 minutes followed by 25 cycles of 95°C / 40 seconds, 55°C / 40 seconds and 72°C / 1 minute, and a final extension time of 10 minutes at 72°C. The resulting product was excised, gene cleaned (Qiaex), digested sequentially with EcoRI, ligated into similarly digested pProEX HT vector and transformed into DH5 alpha cells. Transformants were analysed by restriction analysis and positive clones sequenced by the Big Dye method.

Limited Proteolysis

The resultant AMPK βl (42-183) fragment was grown at 37°C in BL21 cells until OD600 = 0.6 and protein expression was induced with 1 mM IPTG for 3 hours /

37°C. Cells were harvested following centrifugation and lysed in PBS (137 mM NaCl, 2.7 mM KC1 and 10 mM Phosphate buffer, pH7.4) containing 500 mM added NaCl in an Emulsiflex-C5 High Pressure Homogeniser (Avestin). Lysates were clarified by centrifugation at 48,000g / 30 min / 4°C and chromatographed on Ni-Agarose. Nonspecific proteins were removed by washing the Ni-Agarose with PBS containing 500 mM added NaCl and 20 mM imidazole. The AMPK βl (42-183) fragment was eluted with PBS containing 500 mM added NaCl and 300 mM imidazole, precipitated with 60% (NLLi) ₂SO₄ for 30 min / 4°C and the resulting precipitate collected by centrifugation. The protein pellet was resuspended in 2 ml 50 mM Tris pH 8.5, desalted on a PD-10 gel filtration column, pooled and stored at -20°C until required. Tris-tricine gel electrophoresis (16.5%) was used to analyse the purification of the AMPK βl (42-183) fragment.

Chymotrypsin

180μl (containing approximately 50 μg), purified AMPK βl (42-183) fragment was digested with lOμg/ml sequencing grade Chymotrypsin (Roche) in the presence of 10 mM CaCl at 25°C. 20μl aliquots were removed at the following time points; 0,1,2,5,10,20,30,45,60 and 75 minutes and analysed by Tris-tricine gel electrophoresis (16.5%). A protease resistant fragment approximately 12 kDa in size resulted after 60 minutes. To identify the proteolytic fragment, 180μl purified AMPK βl (42-183) fragment was digested with lOμg/ml sequencing grade Chymotrypsin (Roche) in the presence of 10 mM CaCl₂ at 25°C / 60 minutes. The entire sample was chromatographed on a C18 column on the SMART system at 40μl/min flow rate with a 0-40%) CH₃CN gradient / 60 min and 40μl fractions were collected. Fractions were analysed by Tris-tricine gel electrophoresis (16.5%), electrospray and Maldi-TOF mass spectrometry and N-terminal Edman sequencing.

Chymotrypsin generated a fragment corresponding to βl (64-163) resulting from cleavage on the COOH side of Trp63 and Phe 163 respectively.

Endoproteinase Asp-N 180μl (containing approximately 50 μg), purified AMPK βl (42-183) fragment was digested with lOμg/ml sequencing grade Endoproteinase Asp-N at 37°C. 20μl aliquots were removed at the following time points; 0,1,2,5,10,20,30,45,60 and 75 minutes and analysed by Tris-tricine gel electrophoresis (16.5%). A protease resistant fragment approximately 12 kDa in size resulted after 10 minutes. To identify the proteolytic fragment, ISOμl purified AMPK βl (42-183) fragment was digested with lOμg/ml sequencing grade Endoproteinase Asp-N (Roche) in the presence of 10 mM CaCl₂ at 25°C / 10 minutes. The entire sample was chromatographed on a C18 column on the SMART system at 40μl min flow rate with a 0-40% CH₃CN gradient / 60 min and 40μl fractions were collected. Fractions were analysed by Tris-tricine gel electrophoresis (16.5%), electrospray and Maldi-TOF mass spectrometry and N- terminal sequencing.

Endoproteinase AspN generated a fragment corresponding to βl (66-158) resulting from cleavage on the NH -terminal side of Asp66 and Aspl59.

Endoproteinase Lys-C 180μl (containing approximately 50 μg), purified AMPK βl (42-183) fragment was digested with lOμg/ml sequencing grade Endoproteinase Lys-C in the presence of 1 mM EDTA at 37°C. 20μl aliquots were removed at the following time points; 0,1,2,5,10,20,30,45 and 75 minutes and analysed by Tris-tricine gel electrophoresis (16.5%). A protease resistant fragment approximately 12 kDa in size resulted after 10 minutes. To identify the proteolytic fragment, 180μl purified AMPK βl (42-183) fragment was digested with lOμg/ml sequencing grade Endoproteinase Lys-C (Roche) in the presence of 10 mM CaCl₂ at 25°C / 10 minutes. The entire sample was chromatographed on a C18 column on the SMART system at 40μl/min flow rate with a 0-40% CH₃CN gradient / 60 min and 40μl fractions were collected. Fractions were analysed by Tris-tricine gel electrophoresis (16.5%), electrospray and Maldi-TOF mass spectrometry and N-terminal sequencing.

Endoproteinase LysC generated a fragment corresponding to βl (73-172) resulting from cleavage on the COOH side of Lys72 and Lysl72.

Re-Engineering OBD

The close proximity of the protease cleavage sites, 64, 66, 73 and 158, 163, 172 indicated that the βl fragment comprising residues 68 to 163 encompasses a protease resistant structure consistent with this sequence representing a protein domain. PCR primers were synthesized corresponding to the N- and C-terminal sequences of AMPK βl (68-163). The sequence of the sense primer was AGGTGAATGAGAAA (SEQ ID NO:27), and the sequence of the antisense primer was TCAAAATACTTCAAAGTCAGT (SEQ ID NO:28). EcoRI and Xhol sites were added to the 5 -ends of these primers and stop codon was included in the antisense primer. The fragment was created by PCR using the above primers, pBKCMV/AMPK βl as the template and Platinum Pfx DNA polymerase (Invitrogen). The PCR reaction included an initial 94°C denaturation / 2 minutes followed by 30 cycles of 94°C / 15 seconds, 55°C / 30 seconds and 68°C / 2 minutes. The resulting product was excised, gene cleaned (Qiaex), digested sequentially with EcoRI and Xhol, ligated into similarly digested pProEX HT or pcDNA3.1 and transformed into DH5 alpha cells. Transformants were analysed by restriction analysis and positive clones sequenced by the Big Dye method. The AMPK βl (68-163) fragment was expressed in bacteria as a His6 tagged fusion protein containing a TEV protease cleavage site (SEQ ID NO: 29).

Expression and purification of AMPK βl (68-163)

The resultant AMPK βl (68-163) fragment was grown at 37°C in BL21 cells until OD600 = 0.6 and protein expression was induced with 1 mM IPTG for 3 hours / 37°C. Cells were harvested following centrifugation and lysed in PBS, 500 mM NaCl in an Avestin cell crusher. Lysates were clarified by centrifugation at 48,000g / 30 min / 4°C and chromatographed on Ni-Agarose. Non-specific proteins were removed by washing the Ni-Agarose with PBS / 500 mM NaCl / 20 mM imidazole. The AMPK βl (42-183) fragment was eluted with PBS / 500 mM NaCl / 300 mM imidazole, precipitated with 60% (NH )₂SO₄ for 30 min / 4°C and the resulting precipitate collected by centrifugation. The protein pellet was resuspended in 2 ml 50 mM Tris pH 8.0 / 150 mM NaCl, desalted on a PD-10 gel filtration column, pooled and digested with the His₆-tagged-TEV protease (Invitrogen) overnight / room temperature with mixing. TEV cleavage was confirmed by Tris-tricine gel electrophoresis analysis before chromatographing by Ni-Agarose. This step bound the His-TEV together with the cleaved His-tag from the N-terminus of the AMPK βl (68-163) fragment, whilst allowing the cleaved product to be collected in the flow through fraction. This fraction containing the AMPK βl (68-163) fragment was concentrated in Centricon-lOs (Millipore) to a volume of 4 ml before further purifying on an SI 00 gel filtration column equilibrated in 50 mM Hepes pH7.0. Fractions were analysed by Tris-tricine gel electrophoresis (Figure 3) and appropriate fractions were pooled and stored in aliquots at -70°C until required.

The resultant AMPK βl (68-163) fragment was subjected to N-terminal sequencing and was found to include the amino acids, GAMDPEF (SEQ ID NO: 30), that consisted of part of the ProEx's multi-cloning site. The protein's concentration was determined by measuring the absorbance at 280nm and utilizing the theoretical extinction coefficient of AMPK βl (68-163), this being approximately 0.55 for a 1 mg/ml solution. Glycogen-binding experiment

The AMPK βl (68-163) fragment was subject to extensive BLAST searching (http://www.ncbi.nlm.nih.gov). A low level of identity was detected with starch binding proteins and yeast glycogen branching enzyme (Figure 2). Accordingly, the fragment was analysed to determine whether it could bind glycogen.

25 μg of the purified AMPK βl (68-163) fragment was incubated with 0.5% glycogen fraction IX (Sigma) in a total volume of 1 ml in PBS / 0.1% NP-40 for 60 minutes at 4°C, followed by centrifugation at 200,000g / 60 minutes / 4°C. The supernatant was discarded and the pellet briefly washed with 500μl PBS. The pellet was resuspended in gel electrophoresis sample buffer containing 10 mM DTT, boiled and analysed by Tris-tricine gel electrophoresis (16.5%).

A dose response with increasing concentrations of AMPK βl (68-163) fragment showed that the amount of binding reached saturation at approximately 65 μg per ml

(Figure 4). Accordingly, the AMPK βl (68-163) fragment was unexpectedly found to bind to an oligosaccharide. Accordingly it was termed AMPK βlOBD (abbreviation for oligosaccharide binding domain).

Inhibition of glycogen-binding by β-cyclodextrin

A characteristic of starch binding proteins is that they can bind glycogen and β cyclodextran can inhibit the binding to starch.

The AMPK βl OBD binding to glycogen was repeated as above, though increasing concentrations of either β-cyclodextrin or sulfo-β-cyclodextrin (Captisol) were added to each tube.

The AMPK βl OBD binding to glycogen was inhibited by increasing concentrations of β cyclodextran (Figure 5) with half maximal inhibition occurring at approximately 1.5 mM β cyclodextran.

Specificity of OBD- glycogen-binding

To determine the specificity of the AMPK βl OBD glycogen-binding assay, 20μg of AMPK βl OBD, 20μg of purified maltose-binding protein or 20μg of bovine serum albumin was incubated on its own or in the presence of 0.5% glycogen +/- β- cyclodextrin in PBS / 0.1% NP-40 for 60 minutes at 4°C. Samples were centrifuged at 200,000g / 60 minutes / 4°C. The supernatant was discarded and the pellet briefly washed with 500μl PBS. The pellet was resuspended in gel electrophoresis sample buffer containing 10 mM DTT, boiled and analysed by Tris-tricine gel electrophoresis (16.5%). BSA did not bind to glycogen, MBP bound glycogen but binding was not inhibited by β cyclodextran up to 10 mM (Figure 6).

Inhibition of AMPK by sulfo-β-cyclodextrin AMPK was purified to homogeneity from rat liver as previously described

(Michell et al. 1996). The AMPK (lOng/μl) was incubated with increasing concentrations (2 - 4 mM) of sulfo-β-cyclodextrin in a buffer containing 50 mM Hepes pH 7.5, 150 mM aCl and 0.1 % NP-40, for 60 minutes at 4°C with mixing. Duplicate aliquots (20 μl) were taken and the AMPK was assayed using the SAMS peptide substrate, HMRSAMSGLHLVKRR-amide. The reactions were stopped by withdrawing 30μl aliquots and applying to P81 papers.

The AMPK alpha (1-312) was expressed in bacteria with an N-terminal MBP tag and a C-terminal Histidine tag. This fusion protein was purified by Ni-Agarose chromatography, eluted and phosphorylated with purified CAMKIK, resulting in an active AMPK alpha (1-312). This protein was incubated with increasing concentrations (2 - 4 mM) of sulfo-β-cyclodextrin in a buffer containing 50 mM Hepes pH 7.5, 150 mM NaCl and 0.1 % NP-40, for 60 minutes at 4°C with mixing. Duplicate aliquots (20μl) were taken and the AMPK alpha (1-312) was assayed using the SAMS peptide substrate, HMRSAMSGLHLVKRR-amide ( SEQ ID NO:31). The reactions were stopped by withdrawing 30μl aliquots and applying to P81 papers.

The results are provided in Figure 7 and show that AMP kinase activity is essentially abolished in the presence of 3mM sulfo-β-cyclodextrin.

Comparison of the AMPK OBD with other proteins As stated above, a low level of identity was detected between the AMPK OBD and starch binding proteins and the yeast glycogen branching enzyme (Figure 2). The starch binding proteins showing weak sequence identity to AMPK βl OBD were starch branching enzyme I (CAA56319), glucoamylase SBD (A.niger, 1KUM, 1ACO, 1KUL), Beta-Amylase (Bacillus Cereus, 1CQY) and Alpha-amylase (1CXE). The OBD of rat βl AMPK shares 20.4% amino acid identity glucoamylase and 20.8% amino acid identity with alpha amylase.

The amylase family of starch degrading enzymes include glucoamylase, alpha and beta amylase and starch-branching enzymes. They consist of an N-terminal catalytic domain and a C-terminal starch-binding domain (SBD). The SBD varies in length from 100 - 130 amino acids depending on the enzyme. Several SBD structures have been described to date. They all have a well defined β-sheet structure consisting of eight β-strands. SBD contain two putative starch-binding sites as shown by titration and structural studies with maltose or β-cyclodextrin, a cyclic analogue of starch. The binding sites are at one end of the SBD but on opposite surfaces. Many residues are implicated in binding. Binding site 1 is small and rigid with two conserved tryptophan residues,

Trp543 and Trp590 (see Figure 8), forming a well-exposed surface that is well placed to interact with the carbohydrate. Binding site 2 is more flexible and longer and undergoes a change in binding and important residues include Tyr527 and Tyr 556 and those residues immediately around them. A model of binding has been suggested in which binding site 1 acts as the initial starch binding site and binding site 2 adopts the appropriate binding conformation to a second starch strand that is directed into the enzyme's active site for subsequent degradation.

The AMPK βl OBD when aligned to the glucoamylase SBD (see Figure 8) appears to contain at least binding site 1 since these residues are completely conserved. Binding site2 residues however are not conserved.

Figure 8B shows the relationship between and AMPK oligosaccharide-binding domain, PPP1R4 (a regulatory protein that binds to a phosphatase, and is known to bind to glycogen) and GS (glycogen synthase, also known to bind to glycogen). It appears that the conservation is not as high as with the above-mentioned starch-binding domain. This suggests that the AMPK oligosaccharide-binding domain is a new type of oligosaccharide-binding domain family compared those already described.

Figure 9 provides a comparison of the AMPK βl OBD sequence within the β/gal83 family members. It can be seen that above mentioned putative binding site 1 is conserved in all known family members. The information in Figure 9 has been used to develop a consensus sequence for the oligosaccharide binding domain of the β subunit of mammalian AMP kinases (SEQ ID NO: 5) (Figure 10). Further, this information has been used to develop a consensus sequence for the oligosaccharide binding domain of the β subunit of members of the AMP kinase protein family (SEQ ID NO: 6).

The activity of purified active AMPK is not inhibited by glycogen

0.5μg purified rat liver AMPK, that had been desalted into 50 mM Tris.HCL pH7.5, 0.2% Triton X-100 and 10% glycerol was incubated with or without 3% bovine liver glycogen Type IX, that has been dissolved in water, in a total volume of 0.2 ml also containing PBS, 0.2% TX-100 for 15 minutes / 4°C on a rotating wheel. This was followed by a 2hr spin in the T100 ultracentrifuge for two hours / 90,000 g / 4°C. The supernatant was removed to another tube and the resulting pellet resuspended to a final volume of 0.2 ml. Both fractions were assayed for AMPK activity.

AMPK was expressed in bacteria as a GST fusion protein from a polycistronic αiβiγi expression plasmid (data not shown) and was incubated with crude L6 cell lysate (containing AMPK kinase) and increasing concentrations of glycogen (Sigma, type IX) in AMPK-kinase assay buffer (data not shown) for 30 minutes at 30°C. The effect of glycogen on AMPK activity was then measured using the AMPK SAMS peptide assay.

Active rat liver AMPK (αiβiγi binds glycogen but the AMPK activity is not altered by glycogen (Figure 11: Panel A). The effect of glycogen on AMPK activation by L6 muscle cell extract AMPK kinase (that phosphorylates AMPK, Thrl72) was tested. AMPK activation by AMPKK was enhanced in a dose dependent manner by glycogen up to 350 % with 3 mM glycogen (Figure 11 : Panel B).

These results indicate that glycogen does not directly inhibit AMPK or its activation and that the correlation between high glycogen levels and impaired activation of AMPK observed in human and animal muscle is due to other factors. These observations are also consistent with data from McArdle's patients who have normal activation of AMPK despite high levels of muscle glycogen due to phosphorylase deficiency (data not shown).

The oligosaccharide binding domain causes AMPK to colocalize with glycogen phosphorylase qcDNA corresponding to glycogen phosphorylase (GP) was obtained by PCR using the murine EST, accession number BC012961, with the primers encoding the N-terminal 4 residues, Met-Ser-Arg-Pro (where Met is residue 1) and the antisense for the C- terminal four residues Asp-Glu-Lys-Ile (where Ile is residue 842). The obtained cDNA sequence was cloned into the Sacl / Sail sites of the pDS RED2-Nlvector (Clontech) and confirmed by sequencing. COS-7 cells in 6 well plates were transiently co- transfected, using Fugene (Roche), with 50 ng GP-ρdsRED2-Nl and AMPK βl- pEGFP cDNA and incubated for 24 hours at 37°C. Cells were fixed with 4 % fomaldehyde for 15 minutes, permeabilized in PBS / 0.5 % Tween 20 and 150 mM glycine for 15 minutes and the nuclei were stained with Hoescht (Molecular Probes). GP and AMPK bl expression was detected by fluorescence using an Olympus inverted microscope and images were captured using a Spot camera.

The AMPK β subunit colocalizes with GP to glycogen bodies. The subcellular localization of the AMPK βl subunit was investigated by transiently expressing an AMPK βl-GFP (green fluorescent protein) construct in COS-7 cells together with glycogen phosphorylase (GP) tagged to the red variant of GFP (green fluorescent protein). AMPK βl-GFP co-labelled glycogen bodies together with GP (data not shown), demonstrating that AMPK localizes to glycogen. The glycogen bodies were similar in size and shape to those observed when laforin was over expressed (data not shown). Laforin is a dual-specificity phosphatase encoded by the EPM2A gene that contains a glycogen-binding domain that is more closely related to the starch-binding domain.

Mutations in the oligosaccharide binding domain block binding to glycogen β-OBD mutants were made by the site-directed mutagenesis method according to the manufacturer's instructions (Stratagene) by using the β-OBD (68-163) / pProEX HT construct as a template, with the following primers:

W100G:CTGGATCCTTCAACAACGGGAGCAAATTGCCCC (SEQ ID NO: 32), GGGGCAATTTGCTCCCGTTGTTGAAGGATCCAG (SEQ ID NO: 33) SI 08 A: GCAAATTGCCCCTCACTAGAGCTCAAAACAACTTCGTAGCC (SEQ ID NO: 34),

GGCTACGAAGTTGTTTTGAGCTCTAGTGAGGGGCAATTTGC (SEQ ID NO: 35) S108E; GCAAATTGCCCCTCACTAGAGAGCAAAACAACTTCGTAGCC (SEQ ID NO: 36), GGCTACGAAGTTGTTTTGCTCTCTAGTGAGGGGCAATTTGC (SEQ ID NO: 37) K126Q:GAGAGCATCAGTACCAGTTCTTTGTGGATG (SEQ ID NO: 38), CATCCACAAAGAACTGGTACTGGTACTCTC (SEQ ID NO: 39) W133L:CTTTGTGGATGGCCAGTTGACCCACGATCCTTCC (SEQ ID NO: 40), GGAAGGATCGTGGGTCAACTGGCCATCCACAAAG (SEQ ID NO: 41) G147R:GTAACCAGCCAGGTTCGCACAGTTAACAACATC (SEQ ID NO: 42), GATGTTGTTAACTGTGCGAAGCTGGCTGGTTAC (SEQ ID NO: 43). Positive clones were verified by sequencing.

5μg purified β-OBD, wild type and mutants, were incubated with 0.5 % glycogen. Initial, unbound (supernatant) . and glycogen-bound (pellet) fractions were analysed by Tris-tricine gel electrophoresis and western blotting with an affinity- purified antibody that was raised against AMPK β (residues 101-126 of SEQ ID NO:7). The β-OBD point mutations W100G and K126Q completely abolished β-OBD glycogen binding whereas the W133L mutation only partially inhibited binding (Figure 12). Mutation of the AMPK β autophosphorylation site, S108 contained within the β- OBD (Figure 12) to either alanine or glutamic acid did not significantly affect glycogen binding. In yeast the dominant GAL83-2000 mutation, G235R suppresses glucose inhibition of the Snflp transcriptional activator substrate, Snfl -interacting protein 4 (Sip4) (details not shown). Since the equivalent G147R mutation in β-OBD partially inhibits glycogen binding (Figure 12) this suggests the GAL83-2000 mutation may inhibit Sip4 recruitment to glycogen. Arg at position 147 would be expected to distort the glycogen-binding site by electrostatic repulsion of Lys- 126 in a β-OBD model structure (details not shown).

Crystallization of the β-OBD Crystallization The hanging drop method of protein crystallisation has been employed, although other methods are available if necessary. In the hanging drop method, multi-well tissue culture plates are covered with a vacuum grease-sealed coverslip. Typically, the drop contains 2-10 μl of protein solution that is generally mixed with an equal volume of reservoir solution. The drop is suspended over 0.7 ml of precipitant solution. There is a wide range of crystallisation screens available, including the Hampton screens I and II. Other techniques such as the Incomplete Factorial Approach and reverse screening will also be used when necessary. Once initial crystals are obtained, fine-tuning of the initial crystallisation conditions (pH, precipitant etc.), micro- and macro-seeding are methods used to increase the size of the crystal. If a protein proves difficult to crystallise, the aggregated state of the protein solution will be tested using analytical gel chromatography. In the case of aggregation, the solution conditions will be modified appropriately to produce a monodisperse sample.

Data collection All in-house X-ray measurements are made using a Rikagu RU-200 rotating anode generator as an X-ray source. Data are collected using a MARresearch Imaging plate detector. Where necessary, crystals will be flash frozen prior to data collection using cryogenic instrumentation, in order to reduce the effects of X-ray induced radiation damage. For more intense and wavelength-tunable X-ray sources, we will use the synchrotron facilities in the United States. The three-dimensional diffraction data will be processed and analysed using the HKL program suite and the CCP4 suite.

Molecular replacement

In this method, the phase problem is solved using the structure of a known protein (the search model) to determine the orientation and position of the unknown protein (he experimental model) in the unit cell. Molecular replacement packages are available within the CCP4 suite and CNS. This is because the structures of these ligands are already known, and hence will aid in solving the phase problem.

Multiple isomorphoas replacement (MIR) In this method, crystals are soaked in a variety of heavy atom solutions and further X-ray data collected. The specific binding of heavy atoms to crystals enables the phases to be derived. The initial major heavy atom sites will be located via Patterson methods (plus, where necessary, direct methods), minor sites (and other derivatives) will then be determined by a cross-phase analysis. Heavy atom sites will then be refined, and phases calculated using the CCP4 suite of programs (or SHARP). In addition the technique of Multiwavelength Anomalous Dispersion (MAD) will be pursued if a derivative is obtained.

Model building Model building is performed with an Indigo Silicon Graphics (SGI) workstations, using the tools within the software package 'O'.

Refinement of structures

Once a model has been built, whether partially or completely, the structure can be refined to improve the accuracy of the model. Refinement will proceed using CNS or REFMAC (CCP4 package).

Structure validation and analysis

The validity of the structures will be tested by such programs as PROCHECK, OOPS, 3D-PROFILE and WHATCHECK. There is a multitude of software packages available (MOLSCRIPT, RIBBONS, Midas Plus, PROMOTE?, GRASP, programs within CCP4) to display and analyse the structure. Where applicable, structural homologues to the newly-solved protein domains can be searched and checked using the DALI server.

Crystal

As an example, crystals of the β-OBD has been grown in the presence of 30% PEG 5000 and cyclodextrin in 0.1 M MES buffer ranging from pH 6.5-7.0. The crystals diffracted to 2.2-2.A with a PI space group and cell dimensions of 43.7A, 44.7A, 50.45A (data not shown). Molecular modelling

A model of β-OBD structure was made using the N-terminal domains of E. coli branching enzyme (PDB entry 1MX7) residues 117-223, glycosyltrehalose trehalohydrolase from Sulfo lobus solfataricus residues 1-88 (PDB entry 1EH9) and Pseudomonas isoamylase residues 1-163 (PDB entry 1BF2). (data not shown). The pattern of structurally important residues comprising the hydrophobic core of the β- sandwich structure was noted. Guided by the structural alignment, the sequence of β- OBD (72-155) was added (data not shown) and the model was constructed based on that alignment using the program O. The quality of the model (Figure 13) was checked by calculating the 3D profile through the Verify3D-structure evaluation server (details not shown). The model was considered to of good quality since the 3D-1D score never fell below 0.

It will be appreciated by persons skilled in the art that numerous variations and/or modifications may be made to the invention as shown in the specific embodiments without departing from the spirit or scope of the invention as broadly described. The present embodiments are, therefore, to be considered in all respects as illustrative and not restrictive.

All publications discussed above are incorporated herein in their entirety. Any discussion of documents, acts, materials, devices, articles or the like which has been included in the present specification is solely for the purpose of providing a context for the present invention. It is not to be taken as an admission that any or all of these matters form part of the prior art base or were common general knowledge in the field relevant to the present invention as it existed before the priority date of each claim of this application.

References

Atkinson DE. (1970) Adv Enzyme Regul 9:207-19.

Carling D, et al. (1994) J Biol Chem 269:11442-8. Cheung PC, et al. (2000) Biochem J 346:659-69.

Crute BE, et al. (1998) J Biol Chem 273:35347-54.

Cuff JA, et al. (1998) Bioinformatics,14:892-893.

Davies SP, et al. (1994) Eur JBiochem 223:351-7.

Dunbrack, RLJr, et al. (1997) Folding and Design, 2:R27-42. Gollob MH, et al. (2001) N Engl J Med 344: 1823-31.

Hamilton SR, et al. (2001) FEBS Lett 500:163-8.

Hawley SA, et al. (1996) J Biol Chem 271:27879-87.

Haygood, M.G (1993) Biotechniques 15:1084-1089.

Kluijtmans LA, et al. (1996) J Clin Invest 98:285-9. Michell, BJ, et al. (1996) J Biol Chem 271, 28445-28450.

Miller, A, (1990) Human Gene Therapy 1:5-14.

Mitchelhill KL et al. (1994) J Biol Chem 269:2361-4.

Needleman, S.B. and Wunsch, CD. (1970) J Mol Biol 48:443-453.

Sprang SR, et al. (1991) Science 254:1367-71. Stapleton D, et al. (1994) J Biol Chem 269:29343-6.

Stapleton D, et al. (1996) J Biol Chem 271 :611-4.

Yeh LA et al. (1980) J Biol Chem 255:2308-14.

Claims

CLAIMS:

1. A method of screening for a compound that modulates the binding of an oligosaccharide to a beta subunit of AMP kinase, the method comprising; a) exposing a candidate compound to an oligosaccharide and a polypeptide comprising a beta subunit of AMP kinase, or a mutant and/or fragment thereof which binds an oligosaccharide; and b) assessing the ability of the candidate compound to modulate binding of the polypeptide to the oligosaccharide.

2. A method of screening for a compound that modulates the binding of an oligosaccharide to a beta subunit of AMP kinase, the method comprising; a) obtaining a set of atomic coordinates defining the three-dimensional structure of a crystal of a polypeptide comprising a beta subunit of AMP kinase, or a mutant and/or fragment thereof which binds an oligosaccharide; b) selecting a candidate compound by performing rational drug design with the atomic coordinates obtained in step a), wherein said selecting is performed in conjunction with computer modeling; and c) assessing the ability of the candidate compound to modulate binding of the polypeptide to the oligosaccharide.

3. The method of claim 1 or claim 2, wherein the oligosaccharide is detectably labeled.

4. The method according to any one of claims 1 to 3, wherein the polypeptide is present as a heterotrimer further comprising the alpha and gamma subunits of AMP kinase.

5. A crystal of a beta subunit of AMP kinase, or a mutant and/or fragment thereof which binds an oligosaccharide.

6. A method of drug design comprising using the structural coordinates of a crystal according to claim 5 to computationally evaluate a compound for its ability to associate with the oligosaccharide binding domain of the beta subunit of AMP kinase.

7. The method according to any one of claims 1 to 6, wherein the polypeptide comprises a sequence selected from the group consisting of: i) a sequence shown in SEQ ID NO: 1, ii) a sequence shown in SEQ ID NO: 2, iii) a sequence shown in SEQ ID NO: 3, iv) a sequence shown in SEQ ID NO: 4, v) a sequence from a region corresponding to any one of i) to iv) of an AMP kinase beta polypeptide, vi) a sequence which is at least 50% identical to any one of i) to v), vii) a sequence shown in SEQ ID NO: 5, viii) a sequence shown in SEQ ID NO: 6, and ix) a fragment of any one of i) to viii) which binds an oligosaccharide.

8. The method according to any one of claims 1 to 7, wherein the oligosaccharide is a homopolymer of glucose.

9. The method of claim 8, wherein the oligosaccharide is selected from the group consisting of glycogen, starch, amylose, amylopectin and dextran.

10. A compound identified by a method according to any one of claims 1 to 4 or 6 to 9.

11. A method of treating or preventing a condition associated with AMP kinase activity, the method comprising administering to the subject a compound according to claim 10.

12. A method of diagnosing a disease associated with AMP kinase activity, the method comprising obtaining a nucleic acid sample from a subject and characterising the gene sequence encoding the oligosaccharide binding domain of the beta subunit of AMP kinase.

13. A system for identifying an oligosaccharide in a sample, the system comprising a polypeptide which is a beta subunit of AMP kinase, or a mutant and/or fragment thereof which binds an oligosaccharide, and means for detecting an oligosaccharide bound to the polypeptide.

14. A substantially purified polypeptide which binds to an oligosaccharide, the polypeptide comprising a sequence selected from the group consisting of: i) a sequence shown in SEQ ID NO: 1, ii) a sequence shown in SEQ ID NO: , iii) a sequence shown in SEQ ID NO: 3, iv) a sequence shown in SEQ ID NO: 4, v) a sequence from a region corresponding to any one of i) to iv) of an AMP kinase beta polypeptide, vi) a sequence which is at least 50% identical to any one of i) to v), vii) a sequence shown in SEQ ID NO: 5, viii) a sequence shown in SEQ ID NO: , and ix) a fragment of any one of i) to viii) which binds an oligosaccharide, wherein the polypeptide does not comprise a full length sequence of an AMP kinase beta subunit.

15. The polypeptide of claim 14 which comprises a sequence which is at least 80% identical to any one of i) to v).

16. The polypeptide of claim 14 which comprises a sequence which is at least 90% identical to any one of i) to v).

17. The polypeptide according to any one of claims 14 to 16 which is less than about 200 amino acids in length.

18. A fusion protein comprising a beta subunit of AMP kinase, or a mutant and/or fragment thereof which binds an oligosaccharide, fused to at least one other polypeptide sequence.

19. An isolated polynucleotide encoding a polypeptide according to any one of claim 14 to 17.

20. An isolated polynucleotide encoding a fusion protein according to claim 18.

21. A vector comprising a polynucleotide according to claim 19 or claim 20.

22. The vector of claim 21 which is an expression vector.

23. A host cell comprising a vector according to claim 21 or claim 22.

24. A process for preparing a polypeptide according to any one of claims 14 to 17, 5 the process comprising cultivating a host cell transformed or transfected with a vector according to claim 22 under conditions providing for expression of the polynucleotide encoding the polypeptide, and recovering the expressed polypeptide.

25. A composition comprising a polypeptide according to any one of claims 14 to 10 17 and an acceptable carrier.

26. A composition comprising a vector according to claim 21 or claim 22 and an acceptable carrier.

15 27. A method of generating a sequence provided as SEQ ID NO:l, the method comprising exposing rat βl subunit of AMP kinase to multiple proteases.

28. The method of claim 27, wherein the multiple proteases are chymotrypsin, endoproteinase Asp-N, and endoproteinase Lys-C.

20

29. A method of stimulating phosphorylation of AMP kinase, the method comprising exposing the AMP kinase to an agonist which binds the oligosaccharide binding domain of the AMP kinase, and an enzyme capable of phosphorylating AMP kinase.

25

30. The method of claim 29, wherein the agonist is an oligosaccharide.