WO2003008550A2

WO2003008550A2 - Synthesis of oligonucleotides on solid supports including non-reactive solid diluents

Info

Publication number: WO2003008550A2
Application number: PCT/US2002/022739
Authority: WO
Inventors: Max N. Moore; Achim Krotz; Mark Andrade; Anthony N. Scozzari
Original assignee: Isis Pharmaceuticals, Inc.
Priority date: 2001-07-17
Filing date: 2002-07-17
Publication date: 2003-01-30
Also published as: US6822088B2; WO2003008550A3; US20030032795A1; AU2002320591A1

Abstract

The present invention relates to methods for synthesizing an oligomeric compound on a solid support comprising contacting a solid support with a filling material to produce a mixture thereof; placing the mixture in a reaction vessel; and synthesizing the oligomeric compound. The present invention also relates to (a) reaction vessels for synthesizing oligomeric compounds comprising a solid support; and a filling material, (b) apparatuses for synthesizing oligomeric compounds comprising a reagent source, and a reaction vessel comprising a solid support; and a filling material, and (c) compositions comprising a solid support and a filling material mixed therewith.

Description

SYNTHESIS OF OLIGONUCLEOTIDES ON SOLID SUPPORT

CROSS-REFERENCE TO RELATED APPLICATIONS

This application claims benefit of Provisional Application Serial No. 60/306,023 filed July 17, 2001, the entirety of which is incorporated herein by reference.

FIELD OF THE INVENTION:

This invention relates to methods of synthesizing oligonucleotides and derivatives thereof on solid supports.

BACKGROUND OF THE INVENTION:

Oligonucleotides and derivatives thereof are typically prepared through solid phase

synthesis regimes performed on solid supports packed in flow-through reactors. Flow-

through reactors deliver solvent and reagent to solid supports at a required flow rate.

There is an inherent resistance, or back pressure, associated with delivering solvent and or

reagent to the solid support. The resistance can be caused by the solvent, the reagent lines,

and/or the solid support in the reactor. Back pressure is undesirable because it distorts

reaction conditions and makes synthesis techniques less efficient.

The back pressure caused by the solid support depends on the chemical composition of the support. Back pressure is also affected by the physical-chemical

characteristics of the support and the packing in the flow through reactor.

The required flow rate of solvents and reagents through a reaction vessel is assured

by pumps that overcome back pressure. As back pressure increases, more pumping power

is required and modifications to reaction conditions may be necessary. However, pumping

power requirements can limit reaction vessel's size or flow-through capacity, and the

quality of oligonucleotide synthesized can also be degraded by unfavorable pumping

characteristics.

In addition, as oligonucleotide synthesis progresses back pressure increases. If

steps are not taken to control the increase in back-pressure before allowed pressure

maxima are exceeded, the synthesis cycle has to be modified or otherwise the reaction

vessel could become "clogged". Such modifications can include adjusting the flow rate

through the reaction vessel or decreasing the size of the reactor.

Low flow rates and smaller reactors are undesirable because of the lower

concentration and yields of oligonucleotides that can be synthesized. Similarly, flowrate

adjustments during synthesis are undesirable because they are time consuming and may

result in inferior oligonucleotide products. Hence, methods which address these needs

have long been sought. This invention is directed to these, as well as other, important

ends.

SUMMARY OF THE INVENTION:

In some embodiments, the invention provides methods for synthesizing an

oligomeric compound on a solid support comprising contacting a solid support with a filling material to produce a mixture thereof; placing the mixture in a reaction vessel

suitable for use in solid phase synthesis; and synthesizing the oligomeric compound.

In further embodiments, the invention provides reaction vessels for synthesizing

oligomeric compounds comprising a solid support; and a filling material.

In further embodiments, the invention provides apparatuses for synthesizing

oligomeric compounds comprising a reagent source, and a reaction vessel, said reaction

vessel comprising a solid support; and a filling material.

In further embodiments, the invention provides compositions comprising a solid

support suitable for oligonucleotide synthesis and a filling material mixed therewith.

In some preferred embodiments of the foregoing methods, apparatuses and

compositions, the filling material is glass, preferably glass beads. In further preferred

embodiments of the foregoing methods, apparatuses and compositions, the filling material

is a polymer, preferably polymeric beads.

In some preferred embodiments of the methods of the invention, the contacting and

placing steps occur simultaneously in the reaction vessel. In further preferred

embodiments, the oligomeric compound is an oligonucletide, preferably synthesized using

phosphoramidite chemistry.

In some preferred embodiments, the filler material is glass, preferably glass beads,

and the solid support is a polymer or glass beads, preferably Primer™ 200 support,

Tentagel support or POROS support.

In some preferred embodiments, the methods of the invention are used to prepare

oligomeric compounds that are oligoncucleotides containing at least one phosphorothioate

internucleoside linkage. Detailed Description

The present invention provides methods of synthesizing oligonucleotides and

derivatives thereof by solid phase synthesis processes that use filling materials to reduce

back pressure. In some embodiments, filling materials are mixed with solid supports to

reduce back pressure caused by the packing of solid support in a flow through reactor.

The present invention enables oligonucleotide synthesis at higher scales, and at

flow rates necessary for the preparation of high quality oligonucleotides. The present

methods also significantly reduce, and preferably avoid, flowrate adjustments during

synthesis which are time consuming and may result in inferior oligonucleotide product.

Also in accordance with the present invention the use of filling materials lowers the back

pressure during detritylation and washing steps of synthesis. The use of filling materials in

accordance with the present invention also reduces the pressure increase caused by

oligomeric compound growth as the synthesis progresses.

As described herein back pressure is the resistance that is experienced by pumps

that provide solvent and reagent to a reaction vessel during solid phase synthesis

processes. While not wishing to be bound by any particualr theory, it is believed that back

pressure is caused in part by the packing of the solid support in the flow through reactor,

but can also be cause by, for example, the solvent, reagent lines, oligomeric compound

growth and/or solid support in the reactor. Back pressure increases as the synthesis

progresses.

As described herein filling materials are materials that can be added to solid phase

synthesis processes to reduce back pressure. Filling materials can be any inorganic or organic material that is compatible with the conditions of oligonucleotide synthesis, i.e,

materials that are substantially inert to the solvents and reagents of the synthesis.

Examples of such materials include inorganic materials such as glass and inorganic

polymers, organic polymeric materials. Representative examples of polymers that may be

used include TentaGel Support — an aminopolyethyleneglycol derivatized support (see,

e.g., Wright, et al, Tetrahedron Letters 1993, 34, 3373, hereby incorporated by reference

in its entirety) and Poros — a copolymer of polystyrene/ divinylbenzene.

In some preferred embodiments, the filling materials are glass. Types of glass that

may be used include controlled pore glass (CPG), and oxalyl-controlled pore glass (see,

e.g., Alul, et al, Nucleic Acids Research 1991, 19, 1527, hereby incorporated by reference

in its entirety). However, a wide variety of other glasses can be used i accordance with the

invention, as will be apparent to those of skill in the art. In accordance with the present

invention, filling materials can have any convenient shape that is amenable to the

reduction of back pressure. In some preferred embodiments, the filling material is glass

beads.

The filling material can be added to the solid support either in the reactor and

mixed therewith, or added to the solid support prior to placing the support in the reactor.

In some embodiments, the ratio of filler material to solid support, on a volume-

volume basis can be 1:99, 5:95, 10:90, 15:85, 20:80, 25:75, 30:70, 35:65, 40:60, 45:55,

50:50, 55:45, 60:40, 65:35, 70:30, 75:25, 80:20, 85:15, 90:10, 95:5, or 99:1.

As described herein "oligonucleotide" refers to an oligomer or polymer of

ribonucleic acid (RNA) or deoxyribonucleic acid (DNA) or mimetics thereof. This term

includes oligonucleotides composed of naturally-occurring nucleobases, sugars and covalent internucleoside, or backbone, linkages as well as oligonucleotides having non-

naturally-occurring portions which function similarly. Such modified or substituted

oligonucleotides are often preferred over native forms because of desirable properties such

as, for example, enhanced cellular uptake, enhanced affinity for nucleic acid target and

increased stability in the presence of nucleases.

The present invention is applicable to the preparation of oligonucleotides and

analogs thereof. In some embodiments, the methods described herein are used to produce

antisense oligonucleotides and other oligonucleotide mimetics such as are described

below.

The antisense compounds in accordance with this invention preferably comprise

from about 8 to about 50 nucleobases, i.e. from about 8 to about 50 linked nucleosides.

Preferred antisense compounds include antisense oligonucleotides. More preferred

antisense compounds include antisense oligonucleotides having from about 12 to about 30

nucleobases.

Antisense compounds include ribozymes, external guide sequence (EGS) oligonucleotides

(oligozymes), and other short catalytic RNAs or catalytic oligonucleotides which hybridize

to the target nucleic acid and modulate its expression.

A nucleoside is a base-sugar combination. In a preferred embodiment the base

portion of the nucleoside is a heterocyclic base. The two most common classes of

heterocyclic bases are purines and pyrimidines.

Nucleotides are nucleosides that further include a phosphate group covalently

linked to the sugar portion of the nucleoside. For those nucleosides that include a

pentofuranosyl sugar, the phosphate group can be linked to either the 2', 3' or 5' hydroxyl moiety of the sugar. When synthesizing oligonucleotides, the phosphate groups covalently

link adjacent nucleosides to one another to form a linear polymeric compound. In turn the

respective ends of this linear polymeric structure can be further joined to form a circular

structure, however, open linear structures are generally preferred. Within the

oligonucleotide structure, the phosphate groups are commonly referred to as forming the

internucleoside backbone of the oligonucleotide. The normal linkage or backbone of RNA

and DNA is a 3' to 5' phosphodiester linkage.

The methods of the present invention are employed for use in iterative solid phase

oligonucleotide synthetic regimes using any of the wide variety of chemistries known in

the art, including, for example, phosphodiester, phosphotriester, H-phosphonate,

phosphoramidite chemistries, and other solid phase techniques typically employed for

DNA and RNA synthesis. See, e.g., Protocols For Oligonucleotides And Analogs,

Agrawal, S., ed., Humana Press, Totowa, NJ, 1993, Crooke, Stanley, Lebleu, Bernard,

Antisense Research and Applications, CRC Press, 1993, and F.Eckstein, Oligonucleotides

and Analogues, A Practical Approach, Oxford University Press, 1991, and Blackburn,

G.M and Giat, M.J., Nucleic Acids in Chemistry and Biology, 2nd Edition, Oxford Univ.

Press New York 1996, each of which is hereby incorporated by reference in its entirety.

A discussion of various types of oligomeric compounds capable of being

synthesized by methods of the present invention, and some representative synthetic

synthetic chemistries, are described below.

In one embodiment of oligonucleotide synthesis, for example, a nucleoside is

anchored to a solid support which is functionalized with hydroxyl or amino residues.

Additional nucleosides are subsequently added in a step-wise fashion to form the desired linkages between the functional group of an incoming nucleoside, and a hydroxyl group of

the support bound nucleoside. Implicit to this step-wise assembly is the judicious choice

of suitable protecting groups. Such protecting groups serve to shield phosphorus moieties

of the nucleoside base portion of the growing oligomer until such time that it is cleaved

from the solid support.

When cleavage from the support is desired, the support-bound monomer or higher

order synthon is then treated to remove the protecting group from the free terminal end.

Typically, this is accomplished by treatment with acid. The solid support bound

monomer, or higher order oligomer, is then reacted with individual monomeric or higher

order building blocks (i.e., synthons) to form a compound which has a phosphite or

thiophosphite linkage.

Solid supports are substrates which are capable of serving as the solid phase in

solid phase synthetic methodologies, such as those described in Caruthers U.S. Patents

Nos. 4,415,732; 4,458,066; 4,500,707; 4,668,777; 4,973,679; and 5,132,418; and Koster

U.S. Patents Nos. 4,725,677 and Re. 34,069, which are hereby incorporated by reference in

its entirety. A linker is optionally positioned between the terminal nucleotide and the solid

support. Linkers are known in the art as short molecules which serve to connect a solid

support to functional groups (e.g., hydroxyl groups) of initial synthon molecules in solid

phase synthetic techniques. Suitable linkers are disclosed in, for example,

Oligonucleotides And Analogues A Practical Approach, Ekstein, F. Ed., IRL Press, N. Y,

1991, Chapter 1, pages 1-23, hereby incorporated by reference in its entirety.

Solid supports suitable fro use in the invention include those generally known in

the art to be suitable for use in solid phase methodologies, including, for example, glass sold as Primer™ 200 support, controlled pore glass (CPG), oxalyl-controlled pore glass

(see, e.g., Alul, et al, Nucleic Acids Research 1991, 19, 1527, hereby incorporated by

reference in its entirety), TentaGel Support — an aminopolyethyleneglycol derivatized

support (see, e.g., Wright, et al, Tetrahedron Letters 1993, 34, 3373, hereby incorporated

by reference in its entirety) and Poros ~ a copolymer of polystyrene/ divinylbenzene.

In another embodiment, the solid support is derivatized to provide an acid labile

trialkoxytrityl group, such as a trimethoxytrityl group (TMT). Without being bound by

theory, it is expected that the presence of the trialkoxytrityl protecting group will permit

initial detritylation under conditions commonly used on DNA synthesizers. For a faster

release of oligonucleotide material in solution with aqueous ammonia, a diglycoate linker

is optionally introduced onto the support.

In some preferred embodiments, the methods of the invention are amenable to

synthesis oligonucleotides with phosphorothioate backbones and oligonucleosides with

heteroatom backbones, and in particular -CH₂-NH-O-CH₂-, -CH₂-N(CH₃)-0-CH₂- [known

as a methylene (methylimino) or MMI backbone], -CH₂-O-N(CH₃)-CH₂-, -CH₂-N(CH₃)-

N(CH₃)-CH₂- and -0-N(CH₃)-CH₂-CH₂- [wherein the native phosphodiester backbone is

represented as -O-P-O-CH₂-] as described in U.S. patent 5,489,677 which is herein

incorporated by reference in its entirety, and the amide backbones as described in U.S.

patent 5,602,240 which is herein incorporated by reference in its entirety. Also preferred

are oligonucleotides having morpholino backbone structures as described in U.S. patent

5,034,506, which is herein incorporated by reference in its entirety.

In another preferred embodiment, synthetic solid phase synthesis processes utilizes

phosphoramidites as activated phosphate compounds as disclosed in U.S. Patent No. 6,121,437 which is herein incorporated by reference. In this technique, a phosphoramidite

monomer is reacted with a free hydroxyl on the growing oligomer chain to produce an

intermediate phosphite compound, which is subsequently oxidized to the P^v state using

standard methods. This technique is commonly used for the synthesis of several types of

linkages including phosphodiester, phosphorothioate, and phosphorodithioate linkages.

Typically, the first step in such a process is attachment of a first monomer or higher

order subunit containing a protected 5 '-hydroxyl to a solid support, usually through a

linker, using standard methods and procedures known in the art. The support-bound

monomer or higher order first synthon is then treated to remove the 5 '-protecting group, to

form a compound which has a phosphite or thiophosphite linkage. In preferred

embodiments, synthons are reacted under anhydrous conditions in the presence of an

activating agent such as, for example, lH-tetrazole, 5-(4-nitrophenyl)-lH-tetrazole, or

diisopropylamino tetrazolide.

In some preferred embodiments, phosphite or thiophosphite compounds containing

a linkage are oxidized or sulfurized to produce compounds having a different linkage.

Choice of oxidizing or sulfurizing agent will determine whether the linkage will be

oxidized or sulfurized to a phosphotriester, thiophosphotriester, or a dithiophosphotriester

linkage.

Treatment with an acid removes the 5'-hydroxyl protecting group, and thus

transforms the solid support bound oligomer into a further compound, which can then

participate in the next synthetic iteration; i.e., which can then be reacted with a further

compound. This process is repeated until an oligomer of desired length is produced. The completed oligomer is then cleaved from the solid support. The cleavage step

can precede or follow deprotection of protected functional groups. During cleavage, the

linkages between monomeric subunits are converted from phosphotriester,

thiophosphotriester, or dithiophosphotriester linkages to phosphodiester, phosphorothioate,

or phosphorodithioate linkages. This conversion is effected through the loss of an oxygen

or sulfur protecting group.

A wide variety of bases can be used to initiate the removal of the protecting groups

of the present invention. These include aqueous ammonium hydroxide, aqueous

methylamine, DBU (l,8-diazabicyclo[5.4.0]undec-7-ene) and carbonates containing

counterions such as lithium, potassium, sodium, and cesium. Most preferred is potassium

carbonate and ammonia. Removal of the protecting groups may be performed in a variety

of suitable solvents. These solvents include those known to be suitable for protecting

group removal in oligonucleotide synthesis. In the case of ammonia, water is the preferred

solvent, whereas when using carbonates, alcohols are preferred. Methanol is most

preferred. In certain preferred embodiments, conditions for removal of the oxygen or

sulfur protecting group also effect cleavage of the oligomeric compound from the solid

support.

The methods of the present invention are amenable to synthesis of any oligomeric

compound or any oligonucleotide capable of being synthesized by solid phase synthesis

processes. Specific examples of preferred oligomeric compound or oligonucleotide

capable of being synthesized by methods of this invention include oligonucleotides

containing modified backbones or non-natural internucleoside linkages. As described

herein, oligonucleotides having modified backbones include those that retain a phosphorus atom in the backbone and those that do not have a phosphorus atom in the backbone. As

described herein, modified oligonucleotides that do not have a phosphorus atom in their

internucleoside backbone can also be considered to be oligonucleosides.

Oligomers amendable to preparation by the methods of the invention include those

having modified oligonucleotide backbones including, for example, phosphorothioates,

chiral phosphorothioates, phosphorodithioates, phosphotriesters, aminoalkylphosphotri-

esters, methyl and other alkyl phosphonates including 3'-alkylene phosphonates, 5'-

alkylene phosphonates and chiral phosphonates, phosphinates, phosphoramidates

including 3 '-amino phosphoramidate and aminoalkylphosphoramidates,

thionophosphoramidates, thionoalkylphosphonates, thionoalkylphosphotriesters,

selenophosphates and boranophosphates having normal 3'-5' linkages, 2'-5' linked

analogs of these, and those having inverted polarity wherein one or more internucleotide

linkages is a 3' to 3', 5' to 5' or 2' to 2' linkage. In some embodiments oligonucleotides

having inverted polarity comprise a single 3' to 3' linkage at the 3'-most internucleotide

linkage i.e. a single inverted nucleoside residue which may be abasic (the nucleobase is

missing or has a hydroxyl group in place thereof). Various salts, mixed salts and free acid

forms are also included.

Representative United States patents that teach the preparation of the above

phosphorus-containing linkages include, for example, U.S. Patent Numbers: 3,687,808;

4,469,863; 4,476,301; 5,023,243; 5,177,196; 5,188,897; 5,264,423; 5,276,019; 5,278,302;

5,286,717; 5,321,131; 5,399,676; 5,405,939; 5,453,496; 5,455,233; 5,466,677; 5,476,925;

5,519,126; 5,536,821; 5,541,306; 5,550,111; 5,563,253; 5,571,799; 5,587,361; 5,194,599;

5,565,555; 5,527,899; 5,721,218; and 5,625,050, each of which is herein incorporated by reference in its entirety.

Preferred modified oligonucleotide backbones that do not include a

phosphorus atom therein have backbones that are formed by short chain alkyl or cycloalkyl

intemucleoside linkages, mixed heteroatom and alkyl or cycloalkyl intemucleoside

linkages, or one or more short chain heteroatomic or heterocyclic intemucleoside linkages.

These include those having morpholino linkages (formed in part from the sugar portion of

a nucleoside); siloxane backbones; sulfide, sulfoxide and sulfone backbones; formacetyl

and thioformacetyl backbones; methylene formacetyl and thioformacetyl backbones;

riboacetyl backbones; alkene containing backbones; sulfamate backbones; methyleneimino

and methylenehydrazino backbones; sulfonate and sulfonamide backbones; amide

backbones; and others having mixed N, O, S and CH₂ component parts.

Representative United States patents that teach the preparation of the above

oligonucleosides include, for example, U.S. Patent Numbers: 5,034,506; 5,166,315;

5,185,444; 5,214,134; 5,216,141; 5,235,033; 5,264,562; 5,264,564; 5,405,938; 5,434,257;

5,466,677; 5,470,967; 5,489,677; 5,541,307; 5,561,225; 5,596,086; 5,602,240; 5,610,289;

5,602,240; 5,608,046; 5,610,289; 5,618,704; 5,623,070; 5,663,312; 5,633,360; 5,677,437;

5,792,608; 5,646,269 and 5,677,439, each of which is herein incorporated by reference in

its entirety.

Modified oligonucleotides can be prepared using the method of the invention that

also can contain one or more substituted sugar moieties. Preferred oligonucleotides

comprise one of the following at the 2' position: OH; F; O-, S-, or N-alkyl; O-, S-, or N-

alkenyl; O-, S- or N-alkynyl; or O-alkyl-O-alkyl, wherein the alkyl, alkenyl and alkynyl

may be substituted or unsubstituted C, to C₁₀ alkyl or C₂ to C₁₀ alkenyl and alkynyl. Particularly preferred are O[(CH₂)_nO]_mCH₃, 0(CH₂)_nOCH₃, O(CH₂)_nNH₂, O(CH₂)_nCH₃,

0(CH₂)_nONH₂, and O(CH₂)_nON[(CH₂)_nCH₃)]₂, where n and m are from 1 to about 10.

Other preferred oligonucleotides comprise one of the following at the 2' position: C, to C₁₀

lower alkyl, substituted lower alkyl, alkenyl, alkynyl, alkaryl, aralkyl, O-alkaryl or O-

aralkyl, SH, SCH₃, OCN, Cl, Br, CN, CF₃, OCF₃, SOCH₃, SO₂CH₃, ONO₂, NO₂, N₃, NH₂,

heterocycloalkyl, heterocycloalkaryl, aminoalkylamino, polyalkylamino, substituted silyl,

an RNA cleaving group, a reporter group, an intercalator, a group for improving the

pharmacokinetic properties of an oligonucleotide, or a group for improving the

pharmacodynamic properties of an oligonucleotide, and other substituents having similar

properties. A preferred modification includes 2'-methoxyethoxy (2'-0-CH₂CH₂OCH₃, also

known as 2'-0-(2-methoxyethyl) or 2'-MOE) (Martin et al., Helv. Chim. Acta, 1995, 78,

486-504) i.e., an alkoxyalkoxy group. A further preferred modification includes 2'-

dimethylaminooxyethoxy, i.e., a 0(CH₂)₂ON(CH₃)₂ group, also known as 2'-DMAOE, as

described in examples herein, and 2'-dimethylaminoethoxyethoxy (also known in the art as

2'-0-dimethylaminoethoxyethyl or 2'-DMAEOE), i.e., 2'-O-CH₂-0-CH₂-N(CH₂)₂, also

described in examples herein.

A further preferred modification includes Locked Nucleic Acids (LNAs) in which

the 2'-hydroxyl group is linked to the 3' or 4' carbon atom of the sugar ring thereby

forming a bicyclic sugar moiety. The linkage is preferably a methelyne (-CH₂-)_n group

bridging the 2' oxygen atom and the 4' carbon atom wherein n is 1 or 2. LNAs and

preparation thereof are described in WO 98/39352 and WO 99/14226.

Other preferred modifications include 2'-methoxy (2'-O-CH₃), 2'-aminopropoxy (2'-

OCH₂CH₂CH₂NH₂), 2'-allyl (2'-CH₂-CH=CH₂), 2'-O-allyl (2'-0-CH₂-CH=CH₂) and 2'- fluoro (2'-F). The 2'-modification may be in the arabino (up) position or ribo (down)

position. A preferred 2'-arabino modification is 2'-F. Similar modifications may also be

made at other positions on the oligonucleotide, particularly the 3' position of the sugar on

the 3' terminal nucleotide or in 2'-5' linked oligonucleotides and the 5' position of 5'

terminal nucleotide. Oligonucleotides may also have sugar mimetics such as cyclobutyl

moieties in place of the pentofuranosyl sugar.

Representative United States patents that teach the preparation of such modified

sugar structures include, for example, U.S. Patent Numbers: 4,981,957; 5,118,800;

5,319,080; 5,359,044; 5,393,878; 5,446,137; 5,466,786; 5,514,785; 5,519,134; 5,567,811;

5,576,427; 5,591,722; 5,597,909; 5,610,300; 5,627,053; 5,639,873; 5,646,265; 5,658,873;

5,670,633; 5,792,747; and 5,700,920, each of which is herein incorporated by reference in

its entirety.

Oligonucleotides may also include nucleobase, often referred to simply as "base",

modifications or substitutions. As used herein, "unmodified" or "natural" nucleobases

include the purine bases adenine (A) and guanine (G), and the pyrimidine bases thymine

(T), cytosine (C) and uracil (U). Modified nucleobases include other synthetic and natural

nucleobases such as 5-methylcytosine (5-me-C), 5-hydroxymethyl cytosine, xanthine,

hypoxanthine, 2-aminoadenine, 6-methyl and other alkyl derivatives of adenine and

guanine, 2-propyl and other alkyl derivatives of adenine and guanine, 2-thiouracil, 2-

thiothymine and 2-thiocytosine, 5-halouracil and cytosine, 5-propynyl (-C°C-CH₃) uracil

and cytosine and other alkynyl derivatives of pyrimidine bases, 6-azo uracil, cytosine and

thymine, 5-uracil (pseudouracil), 4-thiouracil, 8-halo, 8-amino, 8-thiol, 8-thioalkyl, 8-

hydroxyl and other 8-substituted adenines and guanines, 5-halo particularly 5-bromo, 5- trifluoromethyl and other 5 -substituted uracils and cytosines, 7-methylguanine and 7-

methyladenine, 2-F-adenine, 2-amino-adenine, 8-azaguanine and 8-azaadenine, 7-

deazaguanine and 7-deazaadenine and 3-deazaguanine and 3-deazaadenine.

Further modified nucleobases include tricyclic pyrimidines such as phenoxazine

cytidine(lH-pyrimido[5,4-b][l,4]benzoxazin-2(3H)-one), phenothiazine cytidine (1H-

pyrimido[5,4-b][l,4]benzothiazin-2(3H)-one), G-clamps such as a substituted phenoxazine

cytidine (e.g. 9-(2-aminoethoxy)-H-pyrimido[5,4-b][l,4]benzoxazin-2(3H)-one), carbazole

cytidine (2H-pyrimido[4,5-b]indol-2-one), pyridoindole cytidine (H-

pyrido[3',2':4,5]pyrrolo[2,3-d]pyrimidin-2-one). Modified nucleobases may also include

those in which the purine or pyrimidine base is replaced with other heterocycles, for

example 7-deaza-adenine, 7-deazaguanosine, 2-aminopyridine and 2-pyridone.

Further nucleobases include those disclosed in United States Patent No. 3,687,808,

those disclosed in The Concise Encyclopedia Of Polymer Science And Engineering, pages

858-859, Kroschwitz, J.I., ed. John Wiley & Sons, 1990, those disclosed by Englisch et al.,

Angewandte Chemie, International Edition, 1991, 30, 613, and those disclosed by

Sanghvi, Y.S., Chapter 15, Antisense Research and Applications, pages 289-302, Crooke,

S.T. and Lebleu, B. , ed., CRC Press, 1993, each of which is herein incorporated by

reference in its entirety.

Certain of these nucleobases are particularly useful for increasing the binding

affinity of the oligomeric compounds of the invention. These include 5-substituted

pyrimidines, 6-azapyrimidines and N-2, N-6 and O-6 substituted purines, including 2-

aminopropyladenine, 5-propynyluracil and 5-propynylcytosine. 5-methylcytosine

substitutions have been shown to increase nucleic acid duplex stability by 0.6-1.2°C (Sanghvi, Y.S., Crooke, S.T. and Lebleu, B., eds., Antisense Research and Applications,

CRC Press, Boca Raton, 1993, pp. 276-278) and are presently preferred base substitutions,

even more particularly when combined with 2'-0-methoxyethyl sugar modifications.

Representative United States patents that teach the preparation of certain of the

above noted modified nucleobases as well as other modified nucleobases include, for

example, the above noted U.S. Patent No. 3,687,808, as well as U.S. Patent Numbers:

4,845,205; 5,130,302; 5,134,066; 5,175,273; 5,367,066; 5,432,272; 5,457,187; 5,459,255;

5,484,908; 5,502,177; 5,525,711; 5,552,540; 5,587,469; 5,594,121, 5,596,091; 5,614,617;

5,645,985; 5,830,653; 5,763,588; 6,005,096; and 5,681,941, each of which is herein

incorporated by reference in its entirety. Further, United States patent 5,750,692 also

teaches the preparation of certain of the above modified nucleobases and is herein

incorporated by reference in its entirety.

having any or all of the foregoing natural or modified nucleobases. Oligomers amendable

to preparation by the methods of the invention include those having one or more conjugate

groups thereon, i.e., chemically linked moieties that are thought to enhance the activity,

cellular distribution or cellular uptake of the oligonucleotide. The compounds of the

invention can include conjugate groups covalently bound to functional groups such as pri¬

mary or secondary hydroxyl groups, optionally bound through linking groups.

Conjugate groups of the invention include intercalators, reporter molecules,

polyamines, polyamides, polyethylene glycols, polyethers, groups that enhance the

pharmacodynamic properties of oligomers, and groups that enhance the pharmacokinetic

properties of oligomers. Typical conjugates groups include cholesterols, lipids, phospho- lipids, biotin, phenazine, folate, phenanthridine, anthraquinone, acridine, fluoresceins,

rhodamines, coumarins, and dyes. Groups that enhance the pharmacodynamic properties,

in the context of this invention, include groups that improve oligomer uptake, enhance

oligomer resistance to degradation, and/or strengthen sequence-specific hybridization with

RNA. Groups that enhance the pharmacokinetic properties, in the context of this

invention, include groups that improve oligomer uptake, distribution, metabolism or

excretion.

Representative conjugate groups are disclosed in International Patent Application

PCT/US92/09196, filed October 23, 1992 the entire disclosure of which is incorporated

herein by reference. Conjugate moieties include, for example, lipid moieties such as a

cholesterol moiety (Letsinger et al., Proc. Natl. Acad. Sci. USA, 1989, 86, 6553-6556),

cholic acid (Manoharan et al., Bioorg. Med. Chem. Let., 1994, 4, 1053-1060), a thioether,

e.g., hexyl-S-tritylthiol (Manoharan et al., Ann. N.Y. Acad. Sci., 1992, 660, 306-309;

Manoharan et al., Bioorg. Med. Chem. Let., 1993, 3, 2765-2770), a thiocholesterol

(Oberhauser et al., Nucl. Acids Res., 1992, 20, 533-538), an aliphatic chain, e.g.,

dodecandiol or undecyl residues (Saison-Behmoaras et al., EMBO J., 1991, 10, 1111-

1118; Kabanov et al., FEBS Lett., 1990, 259, 327-330; Svinarchuk et al., Biochimie, 1993,

75, 49-54), a phospholipid, e.g., di-hexadecyl-rac-glycerol or triethylammonium 1,2-di-O-

hexadecyl-rac-glycero-3-H-phosphonate (Manoharan et al., Tetrahedron Lett., 1995, 36,

3651-3654; Shea et al., Nucl. Acids Res., 1990, 18, 3777-3783), a polyamine or a

polyethylene glycol chain (Manoharan et al., Nucleosides & Nucleotides, 1995, 14, 969-

973), or adamantane acetic acid (Manoharan et al., Tetrahedron Lett., 1995, 36, 3651-

3654), a palmityl moiety (Mishra et al., Biochim. Biophys. Acta, 1995, 1264, 229-237), or an octadecylamine or hexylamino-carbonyl-oxycholesterol moiety (Crooke et al., J.

Pharmacol. Exp. Ther., 1996, 277, 923-937. Oligonucleotides of the invention may also

be conjugated to active drug substances, for example, aspirin, warfarin, phenylbutazone,

ibuprofen, suprofen, fenbufen, ketoprofen, (S)-(+)-pranoprofen, carprofen,

dansylsarcosine, 2,3,5-triiodobenzoic acid, flufenamic acid, folinic acid, a

benzothiadiazide, chlorothiazide, a diazepine, indomethicin, a barbiturate, a cephalosporin,

a sulfa drug, an antidiabetic, an antibacterial or an antibiotic. Oligonucleotide-drug

conjugates and their preparation are described in United States Patent Application

09/334,130 (filed June 15, 1999) which is incorporated herein by reference in its entirety.

Representative United States patents that teach the preparation of such

oligonucleotide conjugates include, for example, U.S. Patent Numbers: 4,828,979;

4,948,882; 5,218,105; 5,525,465; 5,541,313; 5,545,730; 5,552,538; 5,578,717, 5,580,731;

5,580,731; 5,591,584; 5,109,124; 5,118,802; 5,138,045; 5,414,077; 5,486,603; 5,512,439;

5,578,718; 5,608,046; 4,587,044; 4,605,735; 4,667,025; 4,762,779; 4,789,737; 4,824,941;

4,835,263; 4,876,335; 4,904,582; 4,958,013; 5,082,830; 5,112,963; 5,214,136; 5,082,830;

5,112,963; 5,214,136; 5,245,022; 5,254,469; 5,258,506; 5,262,536; 5,272,250; 5,292,873;

5,317,098; 5,371,241, 5,391,723; 5,416,203, 5,451,463; 5,510,475; 5,512,667; 5,514,785;

5,565,552; 5,567,810; 5,574,142; 5,585,481; 5,587,371; 5,595,726; 5,597,696; 5,599,923;

5,599,928 and 5,688,941 each of which is herein incorporated by reference in its entirety. Oligomers amendable to preparation by the methods of the invention include those having any number of modifications, including none, one, two, or more of the foregoing moidificaitons. Indeed, it is

not necessary for all positions in a given compound to be uniformly modified, and in fact

more than one of the aforementioned modifications may be incorporated in a single compound or even at a single nucleoside within an oligonucleotide. The present invention

also includes antisense compounds which are chimeric compounds. "Chimeric" antisense

compounds or "chimeras," in the context of this invention, are antisense compounds,

particularly oligonucleotides, which contain two or more chemically distinct regions, each

made up of at least one monomer unit, i.e., a nucleotide in the case of an oligonucleotide

compound. These oligonucleotides typically contain at least one region wherein the

oligonucleotide is modified so as to confer upon the oligonucleotide increased resistance to

nuclease degradation, increased cellular uptake, and/or increased binding affinity for the

target nucleic acid. An additional region of the oligonucleotide may serve as a substrate

for enzymes capable of cleaving RNA:DNA or RNA:RNA hybrids. By way of example,

RNase H is a cellular endonuclease which cleaves the RNA strand of an RNA:DNA

duplex. Activation of RNase H, therefore, results in cleavage of the RNA target, thereby

greatly enhancing the efficiency of oligonucleotide inhibition of gene expression.

Consequently, comparable results can often be obtained with shorter oligonucleotides

when chimeric oligonucleotides are used, compared to phosphorothioate

deoxyoligonucleotides hybridizing to the same target region. Cleavage of the RNA target

can be routinely detected by gel electrophoresis and, if necessary, associated nucleic acid

hybridization techniques known in the art.

Chimeric antisense compounds may be formed using the methods of the invention as composite structures of two or more oligonucleotides, modified oligonucleotides, oligonucleosides and/or oligonucleotide mimetics as described above. Such compounds have also been referred to in the art as hybrids or gapmers. Representative United States patents that teach the preparation of such hybrid structures include, but are not limited to, U.S.: 5,013,830; 5,149,797; 5,220,007; 5,256,775; 5,366,878; 5,403,711; 5,491,133; 5,565,350; 5,623,065; 5,652,355; 5,652,356; and 5,700,922, certain of which are commonly owned with the instant application, and each of which is herein incorporated by reference in its entirety.

The methods of the invention also are amenable to the preparaiton of other

oligonucleotide mimetics where both the sugar and the intemucleoside linkage, i.e., the

backbone, of the nucleotide units are replaced with novel groups. In such compounds, the

base units are maintained for hybridization with an appropriate nucleic acid target

compound. One such oligomeric compound, an oligonucleotide mimetic that has been

shown to have excellent hybridization properties, is referred to as a peptide nucleic acid

(PNA).

In PNA compounds, the sugar-backbone of an oligonucleotide is replaced with an

amide containing backbone, in particular an aminoethylglycine backbone. The

nucleobases are retained and are bound directly or indirectly to aza nitrogen atoms of the

amide portion of the backbone.

Representative United States patents that teach the preparation of PNA compounds

include, for example, U.S. Patent Numbers: 5,539,082; 5,714,331; and 5,719,262, each of

which is herein incorporated by reference in its entirety. Further teaching of PNA

compounds can be found in Nielsen et al., Science, 1991, 254, 1497-1500.

The following examples, which are not intended to be limiting, present certain

embodiments and advantages of the present invention.

EXAMPLES

Experiments were performed to determine the extent that filling materials reduce back

pressure during solid phase synthesis processes and also to determine that solid fillers

combined with a solid support could produce pressures equal to or better than system pressures when no solid support is present.

For each experiment a phosphorothioate deoxyribonucleotide 20-mer, [PS-d(5'-

TCCGTCATCGCTCCTCAGGG)], was synthesized on a ACTA Oligo Pilot synthesizer,

available from Amersham Pharmacia Biotech, on 1 mmol scale. In examples using a solid

support, a Primer Support 200 dG was used. Standard reagents and cycles were used

throughout the examples. Typical reagents include, for example, Cyanoethyl-N,N-

diisopropyl phosphoramides of protected deoxyribonucleosides, tetrazole, phenylacetyl

disulfide, dichloroacetic acid/toluene.

A reference solid phase synthesis was performed without filling material to

determine a reference system pressure. The solid support used for the reference

system was 23 ml of PRIMER 200 dG support suspended in acetonitrile and packed into

the column. The flow-rate for detritylation was 92 ml/min and the flow-rate for the

subsequent ACN wash was 120 ml/min. The system pressure was 7.3 bar for the

detritylation and 10.2 bar for the ACN wash.

Example 1

A phosphorothioate deoxyribonucleotide 20-mer was synthesized using

identical conditions as the reference system except that a filling material was mixed with

the solid support. In this example glass beads from Duke Scientific ranging in size from

10-95 microns were used as filling material. The volume of glass beads equaled the

volume of the solid support. The solid support and glass beads were suspended in

acetonitrile, mixed thoroughly and packed into the column.

The pressures for both detritylation and acetonitrile wash were recorded at each coupling step in Table 1 :

Figure 1 shows a graph of the pressures at each coupling. As shown in Figure 1,

the use of fill material mixed with a solid support lowers the back pressure during

detritylation and the subsequent acetonitrile wash. Figure 1 also shows that the increase in

back pressure caused by the progression of oligonucleotide synthesis is reduced. Trend

lines in Figure 1 were calculated using MS EXCEL available from Microsoft Corporation.

Several pressures recorded in the reference system, data points for the wash at couplings

13 and 14, exceeded the pressure maximum of 20 bars. These data points are not included in the trend line analysis.

Table 2 shows the results of the trend line analysis:

The data in Table 2 wascorrected for system pressure by subtracting 7.3 bar for the

detritylation step and 10.2 bar for the ACN wash. Table 3 shows the pressure obtained for

the portion of the total pressure that is due to the reaction column:

The results indicate that the use of a filler reduces the pressure caused by the

packing and the oligonucleotide attached to the packing while maintaining or improving

the yield and quality. The yield and quality of oligonucleotides in the synthesis using

filling material were comparable to the reference synthesis and within the variability typically observed. The back pressure for detritylation was lower for the reaction vessel

using filling material compared to the back pressure for the reaction vessel without filling

material. The back pressure for the wash was lower for the reactor using filling material

compared to the back pressure for the reactor without filling material. Furthermore, using

filling material reduces the pressure increase typically experienced over the course of

synthesis.

Example 2

An oligomer compound having a phosphorothioate backbone, is synthesized using

conventional solid phase synthesis techniques except that filling material is used as

described in Example 1. Back pressure is reduced as a result of using filling material with

a solid support.

Example 3

A chiral phosphorothioate is synthesized using conventional solid phase synthesis

techniques except that filling material is used as described in Example 1. Back pressure is

reduced as a result of using filling material with a solid support.

Example 4

A phosphotriester is synthesized using conventional solid phase synthesis

reduced as a result of using filling material with a solid support. Example 5

A aminoalkylphosphotriester is synthesized using conventional solid phase

synthesis techniques except that filling material is used as described in Example 1. Back

pressure is reduced as a result of using filling material with a solid support.

Example 6

A phosphoramidate, for example 3 '-amino phosphoramidate or

aminoalkylphosphoramidate, is synthesized using conventional solid phase synthesis

techniques for phosphoramidate preparation except that filling material is used as

a solid support.

Example 7

A thionophosphoramidate is synthesized using conventional solid phase synthesis

techniques for thionophosphoramidate preparation except that filling material is used as

a solid support.

Example 8

A peptide nucleic acid (PNA) is synthesized using conventional solid phase

pressure is reduced as a result of using filling material with a solid support.

Those skilled in the art will appreciate that numerous changes and modifications may be made to the preferred embodiments of the invention and that such changes and

modifications may be made without departing from the spirit of the invention. It is

therefore intended that the appended claims cover all such equivalent variations as fall

within the true spirit and scope of the invention.

It is intended that each of the patents, applicaitons and printed publications

described or referred to herein be incorporated by reference in their entirety.

Claims

What is claimed is:

1. A method for synthesizing an oligomeric compound on a solid support

comprising:

contacting a solid support with a filling material to produce a mixture thereof;

placing the mixture in a reaction vessel suitable for use in solid phase synthesis;

and synthesizing the oligomeric compound.

2. The method of claim 1 wherein the filling material is glass.

3. The method of claim 1 wherein the filling material is a polymer.

4. The method of claim 1 wherein the contacting and placing steps occur

simultaneously in the reaction vessel.

5. The method of claim 1 wherein the oligomeric compound is an

oligonucletide.

6. The method of claim 1 wherein said synthesis is performed using

phosphoramidite chemistry.

7. The method of claim 2 wherein the filler material is glass beads.

8. The method of claim 1 wherein the filler material is a polymer.

9. The method of claim 1 wherein the filler material is glass and the solid

support is a polymer or glass beads.

10. The method of claim 1 wherein the filler material is glass beads and the

solid support is Primer™ 200 support, Tentagel support or POROS support.

11. The method according to claim 1 wherein the oligomeric compound is an

oligoncucleotide containing at least one phosphorothioate intemucleoside linkage.

12. The method according to claim 1 wherein the oligomeric compound is an

13. A reaction vessel for synthesizing oligomeric compounds comprising:

a solid support; and

a filling material.

14. The reaction vessel of claim 13 wherein the filling material is glass.

15. The reaction vessel of claim 14 wherein the filling material is glass beads.

16 The reaction vessel of claim 13 wherein the filling material is a polymer.

17. The reaction vessel of claim 13 wherein the filler material is glass and the

solid support is a polymer or glass beads.

18. The reaction vessel of claim 13 wherein the filler material is glass beads

and the solid support is Primer™ 200 support, Tentagel support or POROS support.

19. An apparatus for synthesizing oligomeric compounds comprising:

a reagent source, and

a reaction vessel, said reaction vessel comprising:

a solid support; and

a filling material.

20. The apparatus of claim 19 wherein the filling material is glass.

21. The apparatus of claim 20 wherein the filling material is glass beads.

22. The apparatus of claim 19 wherein the filling material is a polymer.

23. The apparatus of claim 19 wherein the filler material is glass and the solid

support is a polymer or glass beads.

24. The apparatus of claim 19 wherein the filler material is glass beads and the solid support is Primer™ 200 support, Tentagel support or POROS support.

25. A composition comprising a solid support suitable for oligonucleotide

synthesis and a filling material mixed therewith.

26. The composition of claim 25 wherein the filling material is glass.

27. The composition of claim 26 wherein the filling material is glass beads.

28. The composition of claim 25 wherein the filling material is a polymer.

29. The composition of claim 25 wherein the filler material is glass and the

solid support is a polymer or glass beads.

30. The composition of claim 25 wherein the filler material is glass beads and

the solid support is Primer™ 200 support, Tentagel support or POROS support.