WO2003004686A2

WO2003004686A2 - Fluorescence-based assay for the detection of specific nucleic acids using photon counting

Info

Publication number: WO2003004686A2
Application number: PCT/US2002/021353
Authority: WO
Inventors: Robert M. Dowben; Alford L. Marlin
Original assignee: Advanced Dna Technologies, Inc.
Priority date: 2001-07-03
Filing date: 2002-07-03
Publication date: 2003-01-16
Also published as: AU2002354805A1; WO2003004686A3

Abstract

The present assay is directed to a sensitive assay for detecting the presence of small amounts of a specific nThe present assay is directed to a sensitive assay for detecting the presence of small amounts of a specific nucleic acid sequence or sequences in a mixture of sample nucleic acids using photon counting, wherein the sample nucleic acids have not been amplified by polymerase chain reaction prior to assay or further separated from the mixture of sample nucleic acids once the mixture has been isolated from its original source. In one aspect, the present assay comprises binding a mixture of sample nucleic acids to a solid matrix; contacting the matrix-bound sample nucleic acids with a fluorescent-labeled nucleic acid probe; washing the matrix-bound sample nucleic acids under stringent conditions to remove any free or non-specifically bound fluorescent-labeled nucleic acid probe; removing the specifically bound fluorescent-labeled nucleic acid probe; and detecting the presence of the specifically bound fluorescent-labeled nucleic acid probe using photon counting, wherein the presence of fluorescent-labeled probe is indicative of the presence of a target nucleic acid or nucleic acids in the biological sample. In another aspect, the assay includes a polypeptide-tagged nucleic acid probe and a fluorescent-labeled antibody that is specific for the polypeptide tag of the nucleic acid probe, wherein the fluorescent-labeled antibody is detected using photon counting and indicative of the presence of a target nucleic acid or nucleic acids in the biological sample.

Description

FLUORESCENCE-BASED ASSAY FOR THE DETECTION OF SPECIFIC NUCLEIC ACIDS USING PHOTON COUNTING

BACKGROUND OF THE INVENTION The determination of the presence of a specific DNA or RNA target nucleic acid sequence or segment is of great importance in the medical and environmental monitoring fields. Unfortunately, few detection methods are suitable for routine diagnostic use either in the clinical laboratory or in the field setting. Many assays are not sufficiently rapid, inexpensive, simple or robust for routine application. The detection of the presence of a DNA or RNA sequence in a sample can rapidly and unambiguously identify genetic defects, oncogenic events and bacterial, viral or parasitic agents of concern. Nucleic acid detection methods typically used in research laboratories, such as Southern and Northern blotting techniques, are labor-intensive and time-consuming. Southern blotting requires that sample DNA be cleaved with one or more restriction enzyme, size-separated by gel electrophoresis and transferred from the separation gel to a nitrocellulose filter. DNA detection is then typically accomplished by adding a radiolabeled complementary nucleic acid hybridization probe, followed by several washing steps and then detecting the DNA segment bound by the hybridization probe by exposing the nitrocellulose filter to X-ray film or a phosphoimaging screen.

Other nucleic acid detection methods typically require enzymatic amplification of a target nucleic acid prior to detection. For example, polymerase chain reaction (PCR), the most common of these techniques, uses Tag DNA polymerase to rapidly (i.e., in a few hours or less) amplify a specific DNA in a mixture of nucleic acids. This amplification step permits the detection limiting amounts of a specific DNA in a shorter period of time than with blotting techniques. Furthermore, PCR may be combined with reverse transcription to permit the indirect detection of a specific RNA. However, PCR is highly susceptible to contamination and suffers from variations in amplification efficiency not fully understood at this time. [Bej, A.K. et al., Crit. Rev. Biochem. Biophys. 25:301-334 (1991); Peccoud, J. et al, Biopys. J. 18:913-918 (1990); Taranger, J. et al, Pediatr. Infect. Dis. 13:936- 937 (1994); Wil e, W.W. et al, Clin. Chem. 42:622-623 (1995).] Furthermore, DNA detection following PCR is typically accomplished by size-separation gel electrophoresis and then staining with the fluorescent DNA stain, ethidium bromide. Moreover, DNA detection based upon ethidium bromide fluorescence in separation gels is poorly quantitative. Other amplification technologies employed include that shown by Urdea et al.

(European Patent Application Pub. No. 317,077). A general assay scheme is disclosed, known as the branched DNA (bDNA) assay, in which the signal generated by labeled probes is amplified through the use of nucleic acid multimers. These multimers are branched polynucleotides that are constructed to have a segment that hybridizes specifically to a sample nucleic acid or to a nucleic acid (branched or linear) that is bound to the sample and iterations of a second segment that hybridizes specifically to the labeled probe. The theory behind the bDNA assay is that the multimers used therein will provide a large number of sites for labeled probe attachment and, thereby, provide more label for signal detection. However, when several commercially available assays for the detection of hepatitis B virus (HBV)

DNA, including a bDNA assay, were compared, all of the assays tested had poor accuracy and/or sensitivity. (See Zaaijer et al, J. Clin. Microbiol. 32:2088-2091 (1994).) For example, although one commercially- available bDNA HBV assay was able to detect 2.5 x 10⁶ genomes per ml of control HBV DNA, the results of a dilution series as reported by the bDNA assay were two times higher than calculated.

Similarly, a commercially-available liquid hybridization assay for HBV DNA also gave poor results. Specifically, the liquid hybridization assay could detect only 2.5 x 10⁷ genomes per ml of control HBV DNA and the results of a dilution series as reported by the assay were 17 times higher than calculated. Other assays have been developed more recently which use fluorescent- labeled probes and photon counting for the detection of specific nucleic acids. Although these assays claim to achieve greater accuracy and sensitivity over conventional methods, the majority of these assays have not been tested on a mixed population of nucleic acids. [Perkins, et al, Science 1994, 264,822-826; Larson, et al, Phys. Rev. E 1997, 55, 1794-1797; Castro, et al, Anal. Chem. 1993, 65, 849-852;

Goodwin, et al, Nucleic Acids Res. 1993, 21, 803-806; Castro, et al, Anal. Chem. 1995, 67, 3181-3186; Haab, et al, Anal Chem. 1995, 67, 3253-3260; Oehlenschlager, et al, Proc. Natl Acad. Sci. USA, 93, 12811-12816.] Those assays that have been tested on a mixed population of nucleic acids typically require the use of several probes or other complicated means for nucleic acid detection. For example, Castro (Anal Chem. 69:3915-3920 (1997)) discloses single-molecule detection of specific nucleic acids in unamplified genomic DNA using photon counting. The method consists of using two nucleic acid probes complementary to different sites on a target DNA sequence. Castro's method requires that two fluorescent-labeled probes be hybridized in close proximity to one another on a single DNA molecule before detection of label is counted as positive for a specific DNA. Thus, coincident detection of both dyes provided the necessary specificity to detect an unamplified, single-copy target DNA molecule in a homogeneous assay. However, because two probes must bind to the target DNA, it is possible that Castro's system would be prone to reporting false negatives. Thus, given the shortcomings of current methods for the detection of specific nucleic acids, a need exists for a nucleic acid detection assay that is rapid, accurate and sensitive (i.e., can detect limiting amounts of a specific DNA sequence).

SUMMARY OF THE INVENTION

The present invention is directed to a sensitive assay for detecting the presence of small amounts of a specific nucleic acid sequence or sequences in a mixture of unamplified sample nucleic acids. The present assay is more efficient than conventional nucleic acid assays because the assay does not include any further separation of the mixture of sample nucleic acids once the mixture has been isolated from its original source, and because the assay does not include any nucleic acid amplification step. In addition, the present assay is more sensitive than conventional nucleic acid assays in detecting small amounts of specific nucleic acids because the assay uses fluorescent-labeled nucleic acid probes or polypeptide-tagged nucleic acid probes in combination with fluorescent-labeled antibodies, and photon counting to indirectly detect specific nucleic acid sequences. In particular, one aspect of the present assay is directed to an assay for detecting a specific nucleic acid using photon counting comprising: (a) isolating a mixture of nucleic acids from a biological sample under denaturing conditions;

(b) binding the mixture of sample nucleic acids to a solid matrix;

(c) contacting the matrix-bound sample nucleic acids under hybridizing conditions with a fluorescent-labeled nucleic acid probe or probes, the fluorescent-labeled nucleic acid probe or probes being complementary for a target nucleic acid or nucleic acids;

(d) washing the matrix-bound sample nucleic acids under stringent conditions to remove the fluorescent-labeled nucleic acid probe or probes that are not bound or are non-specifically bound to the matrix-bound sample nucleic acids;

(e) removing the fluorescent-labeled nucleic acid probe or probes that are specifically bound to the matrix-bound nucleic acids under denaturing conditions; and (f) detecting the presence of the fluorescent-labeled nucleic acid probe or probes using photon counting, where the presence of fluorescent- labeled nucleic acid probe or probes is indicative of the presence of the target nucleic acid or nucleic acids in the biological sample, wherein the sample nucleic acids have not been amplified by polymerase chain reaction subsequent to step (a).

In another aspect, the present assay is directed to an assay for detecting a specific nucleic acid using photon counting comprising:

(a) isolating a mixture of nucleic acids from a biological sample under denaturing conditions; (b) binding the mixture of sample nucleic acids to a solid matrix;

(c) contacting the matrix-bound sample nucleic acids under hybridizing conditions with a polypeptide-tagged nucleic acid probe or probes, the polypeptide-tagged nucleic acid probe or probes being complementary for a target nucleic acid or nucleic acids; (d) washing the matrix-bound sample nucleic acids under stringent conditions to remove the polypeptide-tagged nucleic acid probe or probes that are not bound or are non-specifically bound to the matrix-bound sample nucleic acids;

(e) contacting the polypeptide-tagged nucleic acid probe or probes with a fluorescent-labeled antibody or antibodies having a specificity for at least one polypeptide tag of the polypeptide-tagged nucleic acid probe or probes;

(f) washing the matrix-bound sample nucleic acids to remove fluorescent-labeled antibody or antibodies that are not bound or are non- specifically bound to the polypeptide-tagged probe or probes; (g) removing the fluorescent-labeled antibody or antibodies that are specifically bound to the polypeptide-tagged probe or probes; and

(h) detecting the presence of the fluorescent-labeled antibody or antibodies using photon counting, where the presence of fluorescent-labeled antibody or antibodies is indicative of the presence of the target nucleic acid or nucleic acids in the biological sample, wherein the sample nucleic acids have not been amplified by polymerase chain reaction subsequent to step (a).

DETAILED DESCRIPTION OF THE INVENTION A novel assay has been developed, which reduces one or more of the drawbacks of current assays for the detection of specific nucleic acids and provides quicker or more accurate results. The present assay is more rapid than most nucleic acid assays because it eliminates several of the manually-intensive steps or amplification steps typically found in other nucleic acid assays. By eliminating these steps, the present assay includes fewer steps in which nucleic acids may be lost or become contaminated, and in which ambiguities may be introduced through amplification, thereby making the present assay more accurate than conventional assays. The present assay is also more accurate than conventional methods because the assay detects labeled probe or antibody which has been separated from a probe- sample nucleic acid duplex prior to analysis. It is believed that detecting labeled probe or antibody free from a probe-sample nucleic acid duplex is much more sensitive and accurate than current processes which detect labeled probe in probe- sample nucleic acid duplexes. Processes which detect labeled probe in probe-sample nucleic acid duplexes are inherently more susceptible to "swamping'V'quenching" effects because the label is concentrated in one area and individual label molecules cannot be distinguished. Thus, the present assay is less susceptible to "swamping'V'quenching" effects because label is not concentrated in one area during detection. The present assay is also more sensitive than current methods because it uses photon counting for label detection. Photon counting is more sensitive than conventional spectrophotometric and fluorimetric techniques, and has been shown to permit the detection of single molecules of specific nucleic acids in unamplified gDNA. (See, e.g., Castro et al, Anal. Chem. 69:3915-3920 (1997).) Other advantages of the present assay will be appreciated by those skilled in the art upon reading the following detailed description.

Definitions The practice of the present assay can employ, unless otherwise indicated, conventional methods of molecular biology and recombinant DNA techniques within the skill of the art. Such techniques are explained fully in the literature. See, e.g., Sambrook, et al, Molecular Cloning: A Laboratory Manual (2nd Edition, 1989); DNA Cloning: A Practical Approach, Vols. I & II (D. Glover, ed.); Oligonucleotide Synthesis (N. Gait, ed., 1984); Nucleic Acid Hybridization (B. Hames & S. Higgins, eds., 1985); Transcription and Translation (B. Hames & S. Higgins, eds., 1984); Perbal, A Practical Guide to Molecular Cloning (1984); Fundamental Virology, 2nd Edition, Vols. I & II (B. N. Fields and D. M. Knipe, eds.); the series, Methods In Enzymology (Academic Press, Inc.); Methods in Enzymology (1987) 154 and 155 (Wu and Grossman, and Wu, eds., respectively); Mayer & Walker, eds. (1987),

Lrrmunochemical Methods In Cell And Molecular Biology (Academic Press, London); and Handbook Of Experimental Immunology, Vols. I-IV (Weir and Blackwell, eds., 1986).

As used herein, a "biological sample" refers to a sample of tissue or fluid isolated from an individual or animal, including but not limited to, blood, plasma, serum, fecal matter, urine, bone marrow, bile, spinal fluid, lymph fluid, samples of the skin, external secretions of the skin, respiratory, intestinal, and genitourinary tracts, tears, saliva, milk, blood cells, organs, biopsies, and also samples of in vitro cell culture constituents including, for example, conditioned media resulting from the growth of cells and tissues in culture medium, e.g., recombinant cells, and cell components. Biological samples contemplated for use in the present assay also include biological fluids or solids isolated from plants, food stuffs and environmental materials, such as soil samples or water supplies.

As used herein, "sample nucleic acid" refers to a nucleic acid isolated from a biological sample. Nucleic acids comprising sample nucleic acids include DNAs, such as genomic DNA (gDNA) and mitochondrial DNA (mtDNA); and RNAs, such as messenger RNA (rnRNA). Sample nucleic acids used in the present assay may be isolated and prepared for hybridization by a variety of molecular biology techniques known to those skilled in the art, including but not limited to proteinase K/SDS, chaotropic salts, etc. Thus, the sample nucleic acid is provided in single-stranded form for analysis. Where the sequence is naturally present in single-stranded form, denaturation will not be required. However, where the sequence is present in double- stranded form, the sequence will be denatured. Denaturation can be carried out by various techniques known to those skilled in the art, such as acids, alkali (generally from about 0.05 to 0.2M hydroxide), formamide, salts, heat, or combinations thereof. It may be advantageous to reverse transcribe mRNAs into complementary DNAs (cDNAs) to prevent degradation of sample RNA due to environmental factors, such as the presence of RNases, etc. Methods for reverse transcription of mRNAs are known in the art. It may also be of advantage to decrease the average size of the sample nucleic acids by enzymatic, physical or chemical means, e.g., with restriction enzymes, sonication, chemical degradation (for example, with metal ions), etc. The fragments may be as small as 0.1 kb, usually being at least about 0.5 kb and may be 1 kb or higher.

As used herein, "solid matrix" refers to a solid substrate such as nitrocellulose (e.g., in membrane or microtiter well form); polyvinylchloride (e.g., sheets or microtiter wells); polystyrene latex (e.g., beads or microtiter plates); polyvinylidine fluoride; diazotized paper; nylon membranes; activated beads, magnetically responsive beads, and the like. When particles are used, they can be of a size in the range of about 0.4 to about 200 microns, or in the range of about 0.8 to about 4.0 microns. The particles can be made from any convenient material, such as latex or glass. Microtiter plates and nitrocellulose or nylon membranes are preferred solid matrices. The sample nucleic acids can be stably attached to the solid matrix through functional groups by known procedures. For example, the nucleic acid can be bound directly to the solid matrix, such as in a "dot blot" or a "slot blot." Alternatively, the solid matrix can be first reacted with a solid phase component (e.g., one or more common chemicals) to facilitate binding of the sample nucleic acids to the solid matrix. Such molecules and methods of coupling these components to a solid matrix are well known to those of ordinary skill in the art. As used herein, "denaturing conditions" refers to those conditions known to skilled artisans which produce the denaturation of a double-stranded nucleic acid and/or prevent secondary structure in or rehybridization of a single-stranded nucleic acid. Denaturing conditions can include the use of acids, alkali (generally from about 0.05 to 0.2M hydroxide), formamide, salts, heat, or combinations thereof to effect denaturation.

As used herein, "nucleic acid probe" refers to a single-stranded nucleic acid that is complementary to (specific for) at least a portion of a target nucleic acid sequence. Nucleic acid probes can be oligonucleotide sequences, intermediate and full length single-stranded DNA sequences. Nucleic acid probes can be prepared by chemical synthesis or from natural or recombinant sources, such as cDNA libraries, using techniques known in the art. It will be appreciated that the binding sequences need not have perfect complementarity to provide homoduplexes. In many situations, heteroduplexes will suffice where fewer than about 10% of the bases are mismatches, ignoring loops of five or more nucleotides. Accordingly, as used herein the terms "complementary" and "specific for" indicate a degree of complementarity sufficient to provide a stable duplex structure.

As used herein, a "polypeptide-tagged" nucleic acid probe refers to a nucleic acid probe having an oligopeptide (for example, a poly-L-lysine stretch), polypeptide or protein attached to either the 3' end or the 5' end, or both. As used herein, "label" refers to a fluorescent molecule which is capable of exhibiting fluorescence in a detectable range, such that the fluorescence emission will always be red-shifted in the spectrum with regard to the excitation wavelength. It is desirable that the fluorescent labels used in the present assay have: high absorbance; high fluorescence quantum yield; resistance to photobleaching; minimal change of fluorescent properties with changes in the polarity of solvent or local environment; longer fluorescent lifetime. Suitable dyes for use as labels in the present method are modified to contain a chemically reactive group so that they can be covalently linked to substrates of interest. Classes of fluorescent labels that are suitable for use in the present assay include Xanthene dyes (Fluorescein and the rhodamines are members of this class); coumarin dyes; anthroquinone dyes; carbocyanine and related dyes; phthalocyanine dyes; pyrene dyes; and lanthanides. Sulfonamides of 1- hydroxypyrene-3,6,8-trisulfonic acid are preferred fluorescent labels. Lanthanides, particularly europium and terbium are also preferred labels.

It should be noted that lanthanides cannot be directly excited by light — the electron excited is not on an outer shell but rather in an internal shell and commonly involves a D-F transformation. Therefore, lanthanides must be excited by fluorescence energy transfer. The lanthanides are not soluble and are solubilized by binding to chelating agents. There are two ways to employ lanthanides. First, by using a chelating agent with a chemically reactive group that is intrinsically fluorescent such as certain phthalocyanines. The chemically reactive phthalocyanine can be coupled to a poly-L-lysine chain on probe DNA. Alternatively, the lanthanide can be solubilized by the use of non-fluorescent chelating agents with a chemically reactive group. These can be coupled to a poly-L-lysine chain on the probe DNA.¹ Then another fluorescent compound must be used to excite the lanthanide by energy transfer. One strategy is to use the antibody that combines selectively with double stranded DNA containing a fluorescent label for excitation. Another strategy is to use a fluorescent label such as Pico-green that binds and intercalates with double stranded

DNA but not with single stranded DNA. The donor fluorescent dye and lanthanide must be spatially close to each other, less than about 10 microns distant.

As used herein, "stringent conditions" refers to conditions in which the nucleic acid probe will not form duplexes with nucleic acid sequences wherein greater than about 10% of the bases are non-complementary. The stringency of the wash medium can be controlled by temperature, salt concentration, the solvent system, etc. (See Sambrook, et al., Molecular Cloning: A Laboratory Manual (2nd Edition, 1989).) Thus, depending upon the length and nature of the sequence of interest, the stringency can be varied according to known practices.

As used herein, an "antibody" refers to a protein consisting of one or more polypeptides substantially encoded by immunoglobulin genes or fragments thereof. The recognized immunoglobulin genes include the kappa, lambda, alpha, gamma, delta, epsilon and mu constant region genes, as well as the myriad immunoglobulin variable region genes. Light chains are classified as either kappa or lambda. Heavy chains are classified as gamma, mu, alpha, delta, or epsilon, which in turn define the immunoglobulin classes IgG, IgM, IgA, IgD and IgE, respectively. The basic immunoglobulin (antibody) structural unit is known to comprise a tetramer. Each tetramer is composed of two identical pairs of polypeptide chains, each pair having one "light" (about 25 kD) and one "heavy" chain (about 50-70 kD). The N-terminus of each chain defines a variable region of about 100 to 110 or more amino acids primarily responsible for antigen recognition. The terms variable light chain (V_L) and variable heavy chain (V_H) refer to these light and heavy chains respectively.

Antibodies can exist as intact immunoglobulins or as a number of well characterized fragments produced by digestion with various peptidases. Thus, for example, pepsin digests an antibody below the disulfide linkages in the hinge region to produce F(ab)'₂, a dimer of Fab which itself is a light chain joined to VH-Q_H by a disulfide bond. The F(ab)'₂ may be reduced under mild conditions to break the disulfide linkage in the hinge region thereby converting the F(ab)'₂ dimer into an Fab' monomer. The Fab' monomer is essentially an Fab with part of the hinge region. (See, Fundamental Immunology, W. E. Paul, ed., Raven Press, N.Y. (1993) for a more detailed description of other antibody fragments.) While various antibody fragments are defined in terms of the digestion of an intact antibody, one skilled in the art will appreciate that such Fab' fragments may be synthesized de novo either chemically or by utilizing recombinant DNA methodology. Thus, the term antibody, as used herein also includes antibody fragments either produced by the modification of whole antibodies or synthesized de novo using recombinant DNA methodologies. The phrase "having specificity for", when referring to an antibody refers to a binding reaction which is determinative of the presence of a antigen in the presence of a heterogeneous population of other biologies. Thus, under designated assay conditions, the specified antibodies bind to a particular antigen and do not bind in a significant amount to other biologies present in the reaction. Specific binding to an antigen under such conditions requires an antibody that is selected for its specificity for a particular antigen. (See Harlow and Lane Antibodies, A Laboratory Manual, Cold Spring Harbor Publications, New York (1988), for a description of immunoassay formats and conditions that can be used to determine specific immunoreactivity.)

A wide variety of antibodies is suitable for use in the present assays, depending on the antigen of interest. The antigen that a given antibody is specific for is attached as a "polypeptide tag" to a probe.

All publications, patents and patent applications cited herein, whether supra or infra, are hereby incorporated by reference in their entirety.

Modes of Carrying Out the Invention In one aspect, the present assay is directed to an assay for detecting a specific nucleic acid using photon counting comprising:

(a) isolating a mixture of nucleic acids from a biological sample under denaturing conditions;

(b) binding the mixture of sample nucleic acids to a solid matrix; (c) contacting the matrix-bound sample nucleic acids under hybridizing conditions with a fluorescent-labeled nucleic acid probe or probes, the fluorescent-labeled nucleic acid probe or probes being complementary for a target nucleic acid or nucleic acids;

(e) removing the fluorescent-labeled nucleic acid probe or probes that are specifically bound to the matrix-bound nucleic acids under denaturing conditions; and

(f) detecting the presence of the fluorescent-labeled nucleic acid probe or probes using photon counting, where the presence of fluorescent- labeled nucleic acid probe or probes is indicative of the presence of the target nucleic acid or nucleic acids in the biological sample, wherein the sample nucleic acids have not been amplified by polymerase chain reaction subsequent to step (a). In another aspect, the present assay is directed to an assay for detecting a specific nucleic acid using photon counting comprising:

(b) binding the mixture of sample nucleic acids to a solid matrix; (c) contacting the matrix-bound sample nucleic acids under hybridizing conditions with a polypeptide-tagged nucleic acid probe or probes, the polypeptide-tagged nucleic acid probe or probes being complementary for a target nucleic acid or nucleic acids;

(d) washing the matrix-bound sample nucleic acids under stringent conditions to remove the polypeptide-tagged nucleic acid probe or probes that are not bound or are non-specifically bound to the matrix-bound sample nucleic acids;

(h) detecting the presence of the fluorescent-labeled antibody or antibodies using photon counting, where the presence of fluorescent-labeled antibody or antibodies is indicative of the presence of the target nucleic acid or nucleic acids in the biological sample, wherein the sample nucleic acids have not been amplified by polymerase chain reaction subsequent to step (a). The present assay is a rapid, sensitive and accurate assay for detecting specific known nucleic acid sequences. The present assay is more rapid than conventional assays for detecting nucleic acids because the assay does not include several of the manually-intensive steps and/or amplification steps typically found in other nucleic acid assays. The present assay is also more accurate than conventional assays because the assay involves separating a labeled probe or antibody from a probe-sample nucleic acid duplex prior to analysis. It is believed that detecting labeled probe free from the probe-sample nucleic acid duplex is much more sensitive and accurate than current processes which detect labeled probe in probe-sample nucleic acid duplexes and, therefore, are inherently more susceptible to "swamping'V'quenching" effects due to label concentration/co-localization. The present assay is also more sensitive than current methods because it uses photon counting, which is more sensitive than conventional spectrophotometric and fluorimetric techniques.

The advantages offered by the present assay make it especially suited for use in the clinical setting, where rapidity, accuracy and sensitivity commonly are crucial.

A further advantage of the present assay is that the assay may be performed in microtiter plates and several of its steps may be automated, thereby saving costs in labor and reagents.

It is contemplated that the present assay may be used to detect target nucleic acids that are indicative of a wide variety of pathogens, including but not limited to viruses, prions, bacteria, protozoans, helminths and the like. As indicated supra, the target nucleic acids may be detected in samples obtained from human or animal blood, sputum, urine, feces, spinal fluid, etc. Of particular interest are target nucleic acids indicative of human immunodeficiency virus (HTV), hepatitis A virus (HVA), hepatitis B virus (HBV), hepatitis C virus (HCV), herpes simplex virus (HSV), cytomegalovirus (CMV), human papilloma virus (HPV), human herpes virus (HHV), Chlamydia trachomatis, Neiseria meningitidis, Neiseria gonorrhoeae, Mycobacterium tuberculosis, and Plasmodium. A wide variety of other pathogens and target nucleic acids for each can readily be selected by a person skilled in the art for a given application.

It is further contemplated that the present assay be used to determine the number of infectious organisms present in a particular volume of patient tissue or fluid, where such a determination is critical to choosing a proper course of patient treatment. For example, the present assay may be used to determine the viral load in a patient infected with HIV or HCV. Similarly, the present assay may be used to detect genetic sequences associated with antibiotic and/or drug resistance in order to better modify the treatment of patients infected with various microorganisms or undergoing certain chemotherapies.

The present assay is also especially suited for a variety of non-clinical uses. For example, the present assay can be used to detect bacterial DNAs in recombinant pharmaceuticals (such as insulin, bovine growth hormone), recombinant vaccines (such as hepatitis A vaccine) and other recombinantly prepared products for which the

FDA and WHO recommend that the final product contain less than 100 pg host cell DNA per dose. Other non-clinical uses include testing for the presence of pathogens, such as Salmonella and Eschericia coli, in water and food supplies. The present assay is further suited for testing for the presence of genetically-engineered or modified plants or animals. Such testing would be useful for monitoring the presence or propagation of recombinant genes into the environment. The present assay will further find use in forensic screening and other forensic testing. Other uses for the present assay will be recognized by those skilled in the art.

Accordingly, nucleic acid probes intended for use in the present assay to detect specific target nucleic acid sequences include, for example, the pHE63 probe for HBV detection (as disclosed in U.S. Patent No. 5,614,362); nucleic acid probes specific for all or a portion of the gGl and gG2 genes for HSV detection (as disclosed in McGeoch et al, J. Mol Biol 181:1-13 (1985); nucleic acid probes specific for all or a portion of the VP16 gene for HSV-1 and HSV-2 detection (as disclosed in Campbell et al., J. Mol. Biol. 180:1 (1984); the GCP probes for N. gonorrhoeae detection (as disclosed in U.S. Patent No. 5,614,362); the TEM-1 and TEM-1 NH probes for tetracycline resistance in a variety of bacteria (as disclosed in U.S. Patent No. 5,614,362). In addition, a wide variety of nucleic acid probes which may be used in the present assay are currently available from commercial sources, including Molecular Probes, Eugene, OR).

It is contemplated that the target nucleic acid will be indirectly detected and measured by monitoring the electromagnetic energy emitted from a label that is bound to a nucleic acid probe or probes that are specific for the target nucleic acid or, in the alternative, a label that is bound to an antibody that is specific for the polypeptide tag of a polypeptide-tagged nucleic acid probe or probes that are specific for the target nucleic acid. Labeled nucleic acid probe can be separated from a sample nucleic acid- nucleic acid probe duplex by simple denaturation. Alternatively, labeled antibody can be removed for detection from a nucleic acid probe to which it is bound by several methods, including a 10% methanol wash.

"Electromagnetic energy" is used herein to mean any form of energy emitted by the label that contains both an electronic and magnetic component, and includes light in the form of photons. The mechanism of emission is based upon relaxation of the label from an excited state to some other state of lower energy with concurrent emission of energy in the form of light. "Excited state" refers to a transitional energy state of the label which has higher energy than a ground state, and which may be a vibrational, rotational, electronic or some other excited state. The ground state of the label is defined as the state of lowest energy possible for the label at a given set of conditions such as temperature and pressure. Electromagnetic energy in the form of light, more specifically, in the form of a photon or multiple photons, is then detected and measured using an optical detector.

The label to be detected is initially in its ground state. The label is then excited from the ground state to an excited state by adding energy, which may be electrical, thermal, or chemical energy, light with a particular wavelength, or some other form of energy. Subsequently, the label relaxes back to the ground state and emits energy. By measuring the amount of energy emitted, the amount of label can be detected and measured. In one embodiment, fluorescence is used to detect the label. Light in the form of photons of a particular wavelength is added to the label, thereby causing the label to emit light in the form of photons of a particular wavelength, which are subsequently detected and measured. In one embodiment, light is added to the label by means of a laser. A laser is used here to mean any light source that emits coherent and pulsed light of a particular wavelength with a given repetition rate. "Coherent" is used herein to mean light in the form of photons that have a finite range of wavelengths. The finite range of wavelengths may be 10 nm, alternatively 5 nm, alternatively 2 nm, or alternatively 1 or less than 1 nm. "Pulsed" is used herein to mean a repetitive finite duration of time under which the sample is exposed to the light source. The pulse duration is provided as the full duration at half maximum of the total light intensity and is about 10 nanoseconds, alternatively about 1 nanosecond, alternatively about 0.5 nanoseconds, or alternatively about 0.1 nanoseconds. "Repetition" is used herein to mean the frequency of pulses to which the sample is exposed, and is about 10 megaHertz, alternatively about 1 megaHertz, alternatively about 0.5 megaHertz, alternatively about 0.1 megaHertz. In another embodiment, a solid-state diode laser is used as the light source. The output is light with wavelength about 600 nm, alternatively about 500 nm, alternatively about 455 nm, and alternatively about 400 nm. Alternatively, the label may be detected by phosphorescence, wherein light of a particular wavelength is added to the label to cause the label to emit light in the form of a photon with a particular wavelength which can be detected and measured. In a preferred embodiment, fluorescence is used to detect the label and light is emitted using a laser.

In one aspect, the detector is a photodiode detector. The photodiode detector may be made of a semiconductor material or any other material capable of transforming light energy into an electrical signal. In another aspect, the detector is a photomultiplier tube. The photomultiplier tube has a cathode coated with a photosensitive material made of semiconductor or any other material capable of emitting an electron under an applied voltage when a photon impacts its surface. In yet another aspect, the detector is a photoconductive sensor. The photoconductive sensor is made of any material whose electrical resistance decreases with increasing incident light. It is understood to one skilled in the art that the semiconductor material is made of one or any combination of silicon, doped silicon, arsenide, doped arsenide, gallium arsenide, indium, doped indium, gallium indium phosphide, indium gallium arsenide phosphide or any other material that gives an n-type, p-type, or pn-junction type semiconductor. Detectors that are preferred: photomultiplier tubes; photo diodes in the avalanche mode; microchannel plate phototubes. Exciting light sources that are preferred: tunable nitrogen laser or other tunable lasers; light emitting diodes; diode lasers. It is contemplated in the invention that fluorescence detection of the label is highly sensitive. To maximize sensitivity in fluorescence detection in the invention, essentially all emitted photons are detected and measured by the detector. In one embodiment, reflective surfaces are placed around the sample to reflect light from all angles to the detector. The reflective surfaces include minOrs or any other material capable of efficiently reflecting light. The mirrors are arranged so that detection of emitted photons is possible from at least about 180 degrees around the sample, alternatively from at least about 270 degrees around the sample, and alternatively from about 360 degrees around the sample. The sensitivity is improved by maximizing the signal to noise ratio. "Noise" is used herein to mean any light emitted from a substance in the sample not including the product. "Signal to noise ratio" is the ratio of light emitted from the product to light emitted from other substances in the sample. The ratio is maximized when light emitted from the product is detected only after all the light emitted from substances in the sample other than the product has substantially decreased. In one embodiment, the detector is gated for around 50 picoseconds, alternatively for around 100 picoseconds, alternatively for around 1 nanosecond, alternatively for around 5 nanoseconds, alternatively for around 10 nanoseconds, alternatively for around 30 nanoseconds. "Gated" is used herein to mean the length of time light emitted from the sample is blocked from reaching the detector. To control the time at which the gate is opened, a computer is connected to the light source and to the gate. The computer controls the timing so that the gate opens some given length of time after the light source adds light to a solution containing the label. The label has a longer fluorescent half-life other materials present in the solution. The label is chosen so that its fluorescent half-life is at least around 1 nanosecond, alternatively at least around 5 nanoseconds, alternatively at least around 10 nanoseconds, alternatively at least around 20 nanoseconds, alternatively at least around 30 nanoseconds, and alternatively at least around 50 nanoseconds. By using fluorescence detection, the limits of sensitivity of the present assay are contemplated to be about 50 molecules of label; more preferably, the lower limit is about 40 molecules of label; more preferably, about 20 molecules of label; more preferably about 10 molecules of label; more preferably, about 5 molecules of label; more preferably, about 2 molecules of label; and, most preferably, about 1 molecule of label.

In the present assay, it is intended that amount of label detected is proportional to the amount of target nucleic acid present in the original mixture of sample nucleic acids. It is also intended that standard curves be prepared with known amounts of labeled probe or antibody so that linear regression, or some other statistical analysis, may be performed in order to assess the amount of nucleic acid probe that was specifically bound to the target nucleic acid prior to label detection. It is contemplated that the amount of nucleic acid probe that was specifically bound to the target nucleic acid prior to label detection is directly proportional to the amount of target nucleic acid in the mixture of sample nucleic acids. Alternatively, it is contemplated that standard curves may be prepared using known amounts of the target nucleic acid. In this embodiment, the amount of labeled probe or antibody used in the assay will remain constant, and amount of labeled probe or antibody detected will be proportional to the amount of target nucleic acid in the mixture of sample nucleic acids.

The present invention, in one embodiment, provides for an orderly arrangement of polynucleic acid sequences affixed to a medium which allows for the matching of known and unknown DNA samples based on standard nucleic acid base- pairing rules. It is also intended that the current invention utilize arrays of oligonucleotides selected to be complementary to predetermined subsequences of the gene or genes whose expression levels are to be detected. The oligonucleotide is modified with a functional group to allow it to be attached to a reactive group on a solid medium. For example, amine-modified oligonucleotides can be covalently linked to an activated carboxylate group or succinimidyl ester or biotin-modified oligonucleotides can be captured by immobilized streptavidin. Standard blotting membranes can be created by hand or robotics can be used to deposit the nucleic acid sample. In the fields of molecular biology and microbiology it has long been common in the art to make replicate arrays of biological agents to facilitate parallel testing. For example, the use of sterile velvet cloths and a piston-ring apparatus has long been used to make replicate agar plates of bacterial and yeast colonies on many plates, each containing a different growth medium, as a way of rapidly screening a large number of independent colonies for different growth phenotypes (Lederberg and Lederberg, J. Bacteriol. 63:399, 1952). Likewise, 96-well microtiter plates have long been used to store, in an organized fashion, large numbers of cell lines and virus isolates representing recombinant DNA libraries or monoclonal antibody cell lines.

The following examples of the invention are offered by way of illustration and not by way of limitation. Those skilled in the art will appreciate other aspects and embodiments of the present assay not disclosed supra or infra.

Experimental

Example 1 -Preparation of Pyrene-Labeled DNA Probes

Custom-synthesized DNA was obtained from NBI/Genovus Inc. (Plymouth, MN; Lot

#055310), which has the following sequence:

5'ACC TCA CCATAG TGC ACTCAG GCA AGC CATTCTCTG CTG GGG GGAATTGATGAATCTAGCTAG CTGGGTGGGTAA 3'

The probe was labeled at its 5' end with either biotin or poly-L-lysine. To fluorescently label the probe, 1.0 mg of 8-hydroxypyrene-l,3,6-trisulfonic acid

(Eastman Kodak, Rochester, NY) was dissolved in 200 μL dry 1,3 dimethyl-3,4,5,6- tetrahydro-2(lH)-pyrimidinone (DMPU; Sigma Chemical Co., St. Louis, MO, D-

7398, Lot #69F3728). 166 μg of the amino-tagged probe was dissolved in 0.5 mL

DMPU. 0.25 mg of 8-hydroxypyrene-l,3,6-trisulfonic acid previously prepared in DMPU were added to the DNA (6:1 ratio, 10X molar excess). The reaction pH was raised to >8.0 with 10 μL of N,N diisopropylethylamine (Sigma Chemical Co., D-

3887, Lot #92H3511). The reaction was allowed to proceed for 15 hours at room temperature. The pH of the reaction mixture was subsequently raised to >10.0 with about 800 μL of 10% KOH and 500 μL of H₂O was added. 1 mL of 2X SSC was then added to the reaction mixture. The reaction mixture was then dialyzed against

2X SSC using Slide- A-Lyzer ® dialysis cassettes (Pierce Chemical Co., Rockford,

IL) until the fluorescence of the dialysis buffer was reduced to background levels (about 72 hours). 166 μg of conjugated DNA was then recovered in 3.5 mL SSC. 1 mL of the resulting conjugate solution gave about 65,000 fluorescence intensity units (FIU) in a manual flow, particle image analyzer (FPIA) instrument, where F1U equals the vertical intensity plus two times the horizontal intensity minus the intensity of a blank.

Example 2- Detection of Pyrene-Labeled cDNA Probes Released From Probe-DNA Duplexes using Standard Fluorimetry

Mock experimental DNA was obtained from NBI/Genovus Inc. (Plymouth, MN, Lot

# 44630 ssDNA that was complementary to the probe served as a positive control in these experiments. The DNA was diluted to a concentration of 0.4 μg/μL in 0.4 M NaOH, 10 mM EDTA. 2.0 μg of the resultant denatured DNA was blotted onto ten marked areas of Zeta Probe GT membrane (Biorad, Hercules, CA). Herring testes DNA was prepared in the same manner and 2.0 μg was blotted onto the Zeta Probe

GT membrane to serve as a negative control. The membranes were air dried and then soaked in 0.4 M NaOH, 10 mM EDTA for 5 minutes. The membrane was then washed three times with 2X SSC, placed into prehybridization buffer (0.5 M NaH₂PO₄, 7.0% SDS, pH 7.2), and then heated at 60 °C for 10 minutes. The prehybridized membrane was then placed into 5.0 mL of prehybridization buffer containing 30 μg of pyrene-labeled cDNA and hybridized at 60 °C overnight. The hybridization solution was removed and the membrane washed three times with wash buffer (40 mM Na₂PO₄, 5% SDS, pH 7.2), and then three times with distilled, deionized H₂O. The membrane was then cut into squares, each containing an individual DNA sample, and the membrane squares were then placed into test tubes.

1.5 ml of 80% methanol/2% KOH were then added to each sample and the samples were vortexed to facilitate the release of the labeled probe DNA from the sample DNA-probe DNA duplexes. The releasing solution was then read on a manual FPIA instrument using standard fluorimetric techniques. The positive control sample gave a fluorescence intensity of approximately 14,550 FTU compared with the negative control samples, which had gave a fluorescence intensity of 4,900 FIU. Thus, these data demonstrate a three-fold higher fluorescence in the positive control samples versus the negative control samples. As shown herein, the present assay and the pyrene dyes used therein are highly sensitive.

Example 3- Detection of Pyrene-Labeled cDNA Probes Released From Probe-DNA Duplexes By Photon Counting

In order to further enhance the sensitivity of the assay system shown in Example 2, photon counting is used to detect label. The assay is performed as described in

Example 2 with the exception that the fluorescence of the labeled DNA probe released from the sample DNA-probe DNA duplexes is measured as follows. The released probe is transferred to a 5mm x 5mm cuvette and placed into a fluorimeter. The sample holder is configured so that mirrors with greater than 95% reflectivity are placed around the sample. The mirrors surround the cuvette so that all emitted photons are reflected in the direction of the detector. The sample is the irradiated using a solid-state diode laser with 455 nm light with 0.5 nanosecond fwhm pulse width and a repetition rate of 0.5 megaHz. Light emitted from the sample is detected using a photomultiplier. The cathode is coated with gallium indium phosphide and the photomultiplier has a gain of around 100,000 to 1,000,000 with an internal voltage from cathode to anode of around 100 to 300 Volts. The timing of the "turn on" for the laser light source and the "open" for the detector gate is controlled by computer. With light incident on the sample at 455 nm, the emitted light is gated so that the detector begins collecting signal after 20 nanoseconds. Light emitted from the sample is measured only at wavelengths greater than 455 nm. Light is detected for about 50 nanoseconds after the gate is opened. This gating allows for sensitive detection in the photon range.

Claims

WHAT IS CLAIMED IS:

1. An assay for detecting a specific nucleic acid using photon counting comprising: (a) isolating a mixture of nucleic acids from a biological sample under denaturing conditions;

(b) binding the mixture of sample nucleic acids to a solid matrix;

(f) detecting the presence of the fluorescent-labeled nucleic acid probe or probes using photon counting, where the presence of fluorescent- labeled nucleic acid probe or probes is indicative of the presence of the target nucleic acid or nucleic acids in the biological sample, wherein the sample nucleic acids have not been amplified by polymerase chain reaction subsequent to step (a).

2. The assay of claim 1, wherein the biological sample is a human tissue.

3. The assay of claim 2, wherein the human tissue is blood.

4. The assay of claim 1, wherein the sample nucleic acid is a DNA.

5. The assay of claim 1, wherein the sample nucleic acid is an RNA.

6. The assay of claim 5, wherein the RNA is reverse transcribed into a cDNA following isolation from the biological sample.

7. The assay of claim 1, wherein the solid matrix is nitrocellulose.

8. The assay of claim 1, wherein the nucleic acid probe is specific for a nucleic acid that is indicative of the presence of an infectious agent.

9. The assay of claim 8, wherein the nucleic acid probe is specific for a nucleic acid that is indicative of HCV infection.

10. The assay of claim 1, wherein the nucleic acid probe is specific for a nucleic acid that is indicative of antibiotic or drug resistance.

11. The assay of claim 10, wherein the nucleic acid probe is specific for a nucleic acid that is indicative of tetracycline resistance.

12. The assay of claim 1, wherein the fluorescent label is a pyrene derivative.

13. The assay of claim 12, wherein the fluorescent label is 1- acetoxypyrene-3,6,8-trisulfonic acid.

14. An assay for detecting a specific nucleic acid using photon counting comprising:

(b) binding the mixture of sample nucleic acids to a solid matrix;

(c) contacting the matrix-bound sample nucleic acids under hybridizing conditions with a polypeptide-tagged nucleic acid probe or probes, the polypeptide-tagged nucleic acid probe or probes being complementary for a target nucleic acid or nucleic acids; (d) washing the matrix-bound sample nucleic acids under stringent conditions to remove the polypeptide-tagged nucleic acid probe or probes that are not bound or are non-specifically bound to the matrix-bound sample nucleic acids; (e) contacting the polypeptide-tagged nucleic acid probe or probes with a fluorescent-labeled antibody or antibodies having a specificity for at least one polypeptide tag of the polypeptide-tagged nucleic acid probe or probes;

(f) washing the matrix-bound sample nucleic acids to remove fluorescent-labeled antibody or antibodies that are not bound or are non- specifically bound to the polypeptide-tagged probe or probes;

(g) removing the fluorescent-labeled antibody or antibodies that are specifically bound to the polypeptide-tagged probe or probes; and

15. The assay of claim 14, wherein the biological sample is a human tissue.

16. The assay of claim 15, wherein the human tissue is blood.

17. The assay of claim 14, wherein the sample nucleic acid is a DNA.

18. The assay of claim 14, wherein the sample nucleic acid is an RNA.

19. The assay of claim 18, wherein the RNA is reverse transcribed into a cDNA following isolation from the biological sample.

20. The assay of claim 14, wherein the solid matrix is nitrocellulose.

21. The assay of claim 14, wherein the nucleic acid probe is specific for a nucleic acid that is indicative of the presence of an infectious agent.

22. The assay of claim 21, wherein the nucleic acid probe is specific for a nucleic acid that is indicative of HCV infection.

23. The assay of claim 14, wherein the nucleic acid probe is specific for a nucleic acid that is indicative of antibiotic or drug resistance.

24. The assay of claim 23, wherein the nucleic acid probe is specific for a nucleic acid that is indicative of tetracycline resistance.

25. The assay of claim 14, wherein the protein tag is digoxygenin.

26. The assay of claim 14, wherein the fluorescent-labeled antibody is specific for digoxygenin.

27. The assay of claim 14, wherein the fluorescent label is a pyrene derivative.

28. The assay of claim 27, wherein the fluorescent label is 1- acetoxypyrene-3 ,6,8-trisulfonic acid.