WO2002077271A2

WO2002077271A2 - Control plasmid and method for detecting mycoplasma contamination in biological material

Info

Publication number: WO2002077271A2
Application number: PCT/DE2002/001154
Authority: WO
Inventors: Dirk Vollenbroich; Christine Schramm
Original assignee: Minerva Biolabs Gmbh
Priority date: 2001-03-25
Filing date: 2002-03-25
Publication date: 2002-10-03
Also published as: WO2002077271A3; DE10291234D2; DE10115749A1

Abstract

The invention relates to a method for detecting mycoplasma in biological material, comprising the following steps: a) the mycoplasma are lysed in the biological material by heat treatment, b) the released mycoplasma DNA is introduced into a PCR, which uses specific primers that however recognise a segment, common to the representatives of the Mollicutes class, of the gene that codes for the 16S rRNA of mycoplasma and either c) a conventional, non-real time PCR is carried out or the reaction feed material is processed in a device for the real time PCR. The invention also relates to the control plasmid, containing primers that recognise a segment of the gene that codes for the 16S rRNA of the mycoplasma genome, said segment being specific to the species of the micro-organism class Mollicutes, but common to the individual species of the Mycoplasma genus, in addition to the majority of representatives of the genera Ureaplasma, Spiroplasma, and Acholeplasma and to an amplicon, which is located between the primers and comprises the oligonucleotide sequence 5' -cgccctactggccacctgtccaga.

Description

Control plasmid and method for the detection of mycoplasma contamination in biological material

The invention relates to a control plasmid and method for the detection of mycoplasma contamination in biological material.

Species of the genus Mycoplasma are in the microbiological classification between bacteria and viruses. Mycoplasma mainly causes diseases of the bronchial and urogenital tract in humans and animals. These include e.g. Mycoplasma pneumoniae, M. sali - vari um and M. orale (causative agent of atypical pneumonia), M. fermentans (frequent secondary infection in AIDS-

Patients) and M. geni talium and M. hominis (infection of the genitourinary area). Mycoplasma live as parasites on the nutrients and metabolites of their host cells. Mycoplasmas are therefore particularly feared in biotechnology as contamination germs in cell cultures, which represent an ideal habitat for mycoplasmas. In these cultures, human, animal or plant cells of a kind are grown with an abundance of nutrients under optimal living conditions, which are also optimal for the growth of mycoplasma.

According to the literature, every sixth cell culture or 4-92% of all cell cultures in a research laboratory are contaminated with mycoplasma (Hay RJ et al. (1989) Nature 339: 487-488; McGarrity et al. (1984) In vitro Cell. Dev Biol. 20: 1-18). The contamination occurs through the personnel, other contaminated cell lines or through animal products (eg Sera), which are required as medium additives. Cell cultures are increasingly used by the biopharmaceutical industry for the production of medicines and to a large extent in basic research. In addition, genetic engineering in conjunction with cell culture technology is increasingly making medications, such as the body's own active substances and vaccines, available. As with products traditionally obtained from blood, there is still a risk of infection being transmitted by these preparations.

The EU directives for placing pharmaceuticals for human and veterinary use on the market as well as the directives for the biotechnological production of biopharmaceuticals using cell cultures require contamination control on mycoplasma. Biological materials used in research and industry must also be free from mycoplasma contamination. The European Pharmacopeia (Supplement 2000, 2.6.7. Mycoplasmas) prescribes the proof of mycoplasma freedom from drugs and production cell cultures by the cultivation method in special media or on indicator cell lines in connection with the fluorescence method. In the research and non-pharmaceutical field, further regulations (ISO 9001, GLP / GMP, DIN ISO 17025) recommend or prescribe the regular testing of used biological materials using a suitable method.

The practical application of the cultivation method is disadvantageous in many ways:

a) Culture media are not offered by well-known large suppliers, but by smaller, mostly non-certified manufacturers in small batches. The test laboratory must operate individual and complex incoming goods inspections. b) In a pre-cultivation possible inhibitory influences of the sample material have to be determined. This attempt takes about 14 days. In most cases, the sample material must be diluted up to 50 times and the preliminary test must be repeated.

c) Many mycoplasma species require specific growth conditions. Three different media must be used for the cultivation of the six species prescribed in the European Pharmacopoeia. The detection of contaminations with mycoplasma species, which occur to a lesser extent, is often not possible due to the specificity of the media.

d) With an average duration of at least 6 weeks, the culture method is very time-consuming and unacceptable for many perishable biopharmaceuticals.

e) The cultures are evaluated optically for possible growth either by identifying colonies on agar plates using a magnifying glass, by evaluating the color of the culture medium in comparison with the positive and negative controls and the sample preparation, or microscopically in the case of the fluorescence method. In any case, the evaluation must be carried out by very experienced personnel.

The fluorescence method is known for the low detection limit of 10 ⁷ -10 ⁸ mycoplasma particles / ml. Due to the previously necessary cultivation of the sample material on indicator cells (preferably VERO cells), problems with inhibitory effects of the sample material on the cells are frequently observed. This detection method is also very time-consuming with a duration of around 14 days. Other methods for the detection of mycoplasma in biological agents use the ELISA technique. These methods have in common that antibodies, specifically against coat proteins of the individual mycoplasma species, are used. This significantly reduces the detection range to a few detectable species. For the species Mycoplasma alone, more than 120 representatives are already known, all of which must be regarded as potential contaminants. Furthermore, the ELISA technique with a detection limit of 10 ⁵ to 10 ⁶ mycoplasma particles / ml is not very sensitive.

It has been shown that, due to its high sensitivity and informative value, PCR methods represent a quick and effective replacement for the detection methods used to date, since this method also provides for direct and direct detection of the contaminants.

Literature on this is, for example, Ossewaarede et al., Application of Mycoplasma Group-Specific PCR for Monitoring Decontamination of Mycoplasma-Infected Chlamydia sp. Strains, Applied and Environmental Microbiology, 1996, vol. 62, 328-331; van Kuppeveld et al., Genus-Species-Specific Identification of Mycoplasmas by 16S rRNA Amplification, Applied and Environmental Microbiology, 1992,

Vol. 58, 2606-2615; van Kuppeveld et al, Detection of Mycolplasma Contamination in Cell Cultures by a Mycoplasma Group-Specific PCR, Applied and Environmental Microbiology, 1992, Vol. 58, 149-152; US-A 5,693,467 or US-A 5,491,062.

The general advantages of PCR over conventional techniques include:

• Significant time saving

• Improvement of sensitivity (<4 germs / ml) • Significant reduction of influences of the sample material on the test result

• Wide detection spectrum for the detection of "unusual" mycoplasma species as contaminants. • Independent of laboratory-specific specificities of PCR technology.

Each individual reaction can be inhibited by the individually examined sample matrices. The approach of the individual reactions is also prone to errors and can lead to false negative results, which can ultimately lead to incorrect therapy. Accordingly, the regulatory authorities are required to secure each individual test batch (In Vitro Diagnostics Directive 98/79 / EC of October 27, 1998, European Pharmacopoeia, Suppl. 2001, Section 2.6.21, Chapter 7.3.2). The individual reaction batches can only be safeguarded by an internal control, which must be designed in such a way that a signal is only obtained in the case of a favorable PCR, which can be easily distinguished from the signal of a positive test batch. The internal control must not influence the sensitivity of the test or other critical detection parameters.

PCR technology also harbors the risk of false positive results due to cross-contamination in laboratory operations. This risk can be largely countered by using real-time PCR, since both the reaction and the evaluation take place in a closed reaction system. A particular advantage of this system is the time saved by immediate computer-aided evaluation, as well as the possibilities for quantification. The object of the present invention is therefore to create a method for the detection of mycoplasma, which overcomes the disadvantages of the prior art. In particular, a control plasmid is to be made available which enables the internal control of the analysis.

The object is achieved by a control plasmid containing primers which recognize a section of the gene of the mycoplasma genome coding for the 16S rRNA coding for the 16S rRNA which is specific for the microorganism class Mollicutes, but for the individual species of the genus Mycoplasma and most representatives of the genera ureaplasma, spiroplasma and acholeplasma and an amplicon arranged between the primers and comprising the oligonucleotide sequence 5 '-cgccctactggccacctgtccaga.

Control plasmids according to the invention are characterized in that the primers contain the sequences 5'-ggagcaaacaggattagataccc and 3 '-caccatctgtcactctgttaacc (corresponds to 5' -ggttaacagagtgacagatggtg).

Control plasmids which are particularly preferred according to the invention are distinguished by the fact that they comprise the sequence 5'- ggagcaaacaggattagatacccagtctacgtgtttggagactgtgtacaaggc- gactggtgccccatctctgggggactatgttcggcccgcctacatcatcacgccc- tactgggcacggggggcgccggggcgccccgcgccc

The object is further achieved by a method for the detection of mycoplasma in biological materials, in which a) the mycoplasma in biological material is lysed by heat treatment, b) the released mycoplasma DNA is used in a PCR which uses specific primers, but one for the representatives of the class Mollicutes recognize universal section of the gene of mycoplasma coding for the 16S rRNA and

either c) perform a conventional, non-real-time PCR,

or d) a fluorescence-labeled oligonucleotide is used as a detection and quantification probe for the amplified mycoplasma DNA in the PCR reaction and e) the reaction mixture is processed in a device for real-time PCR

or f) adding a control plasmid according to the invention to the reaction mixture and g) carrying out a conventional, non-real-time PCR

or h) adding a control plasmid according to the invention to the reaction mixture and i) fluorescence-labeled oligonucleotides as detection and quantification probes for the amplicon of the control plasmid and the mycoplasma DNA and j) processing the reaction mixture in a device for real-time PCR.

It is preferred according to the invention that the mycoplasma particles contained in the biological sample are destroyed before the DNA extraction.

It is further preferred according to the invention that the biological material is used directly in the PCR. It is particularly preferred that a FAM-labeled probe with the sequence 5 '-acggggacccgcacaagtggtggagc or a TET-labeled probe with the sequence 5 "- cgccctactggccacctgtccaga is used as the fluorescence-labeled oligonucleotide.

It is further preferred according to the invention that the quantification is carried out by means of parallel analysis of a defined mycoplasma DNA standard.

The above-mentioned fluorescence-labeled oligonucleotides thus serve as a detection and quantification probe for the amplicons specific to the mycoplasma and control plasmid sequences. In addition to the fluorescence markers mentioned, others are also known to the person skilled in the art. The fluorescent dyes HEX, JOE, TAMRA and ROX are also suitable according to the invention.

This means that the method according to the invention is carried out in such a way that real-time PCR is used. So far this is not known.

On the other hand, the method just mentioned can also be carried out according to the invention by means of real-time PCR in such a way that a control plasmid according to the invention is added. Such a method is also not yet known.

In any case, it is preferred according to the invention that the biological material is used directly. It is further preferred according to the invention that the Mycoplasma particles contained in the biological sample are destroyed by a heat treatment before the PCR. It is also preferred that the extraction of the genomic DNA from the biological material is carried out by means of adsorption columns or by chemical extraction. It is also possible to use the sample material directly in the PCR.

The method according to the invention enables direct

Detection of the pathogen within 5 hours. The method according to the invention is distinguished by a high level of specificity and sensitivity compared to the conventional methods. As a result, even the smallest titers of contaminating mycoplasma can be reliably detected. A large number of the known mycoplasma species are equally reliably recognized. These properties are achieved by primers and a probe directed against the 16s rRNA coding gene of the mycoplasma genome.

By using real-time PCR, a wide dynamic and linear measuring range is available, which enables reliable quantitative results. The samples are significantly more stable than the antigen test. Prevention of false negative results by inhibitors of PCR, which can be contained in the sample material and which can be safely removed by DNA extraction during sample processing, is given.

The method according to the invention is essentially used in three work steps: sampling, e.g. from cell culture supernatants, culture media, virus suspensions or other biological agents or biotechnologically produced medicinal products, sample preparation by heat treatment and amplification of the mycoplasma DNA by PCR and detection of the amplified products.

2 μl of sample material separated from the supernatant and briefly centrifuged are used for each reaction. The PCR approach is used for real-time PCR lays, ie the reaction batch contains, in addition to the components customary for PCR, for. B. also ROX buffer as a reaction buffer, for example a FAM-labeled probe, UDG and a Taq polymerase commercially available especially for real-time PCR. The primers used in the test procedure described here define a DNA sequence of approximately 270 nucleosides in length within the 16s rRNA gene as the amplification region. The FAM-labeled probe in the reaction mixture binds to the amplicon and can be determined fluorometrically by measuring the fluorescence signal in relation to the quantification standard. In the case of a positive sample, at high concentrations of mycoplasma DNA in the sample material, an increase in the fluorescence signal can be seen well before that of the positive control. Weakly positive samples show an increase in the fluorescence signal in the area of the positive control.

The time of detection of a fluorescence signal can be directly corrected with the fluorescence signal of the positive control and a quantified DNA calibration standard and enables an exact statement about the concentration of mycoplasma DNA in the sample, which then depends on the concentration of mycoplasma particles in the Initial sample and ultimately can be traced back to the situation in the study material.

The reaction batch can be examined in more detail by agarose gel electrophoresis. For this purpose, 5 μl of the mixture are electrophoretically separated on a 1.5% agarose gel. A band with a size of 191 bp is only visible with positive samples and with the positive control.

The reaction batch can also be examined in more detail by carrying out a melting curve analysis. For this, fluorescein is added to the reaction mixture. Flu- orescein serves as an indicator for double-stranded DNA fragments. The reaction mixture is warmed continuously and the emitted fluorescence signal of the fluorescein is measured. When the melting temperature is reached, at which the double-stranded DNA fragments are divided into single strands, the fluorescence signal decreases. This melting temperature is specific for the amplicon according to its sequence and length and can only be measured with positive samples and with the positive control at 85 ° C.

By adding the control plasmid according to the invention it is also possible to rule out false negative results with certainty. For this purpose, a 2 μl aliquot of the mycoplasma DNA (25 pg / μl) is added to the reaction mixture together with the sample. The TET-labeled probe in the reaction mixture binds to the control amplicon and can be detected fluorimetically by measuring the fluorescence signal.

The accompanying figures explain the invention in more detail.

Figure la shows a schematic representation of the internal control DNA with a total size of 3.9 kb. The construct contains the primer sequences 5'VGM and 3'VGM, which are specific for a large number of mycoplasma species. A gene segment of the HTLV-I tax gene was cloned between the primer sequences. Figure lb shows schematically the attachment site of the VTP probe when using RealTime-PCR.

FIG. 2 shows the gel electrophoretic evaluation of the test for mycoplasma. If the internal control is used, a successful PCR is indicated by an amplification product with a size of 191 bp. The amplification of mycoplasma DNA in the sample material is indicated by an amplicon with a size of 270 bp. Both amplicons can be separated in a 1.5% agarose gel. Lane 1: 100 bp marker, Lane 2: positive test approach without using the internal control, Lane 3: negative test approach without internal control,

Lane 4: negative test approach with internal control, Lane 5: positive test approach with internal control

Figure 3 shows the detection diagnostics of Mycoplasma species using real-time PCR.

A: Cycles, open circles: FAM fluorescence signal of reaction mixture A without DNA (negative control), closed circles: FAM fluorescence signal of reaction mixture B with M. oral DNA (positive control), open squares: TET fluorescence signal of reaction mixture C with M. oral DNA and internal control DNA, closed squares: FAM signal of reaction mixture C

The following examples illustrate the invention:

example 1

Carrying out my oplasma detection with conventional PCR, also using the control plasmid

To detect mycoplasma, 100 μl of the sample material to be examined was transferred to a sterile reaction vessel and heated at 95 ° C. for 5 min. If necessary, the DNA contained in the samples was analyzed by standard methods, e.g. purified by DNA extraction (e.g. QIAamp DNA Blood Kit, Qiagen, Hilden) and any PCR inhibitors contained in the sample material. The

Amplification was carried out with the start primer 5'VGM and the end primer 3'VGM. The PCR mixture had a total volume of 50 μl and consisted of 2 to 5 μl of the sample material and 45 to 48 μl of the amplification buffer with 10 mM Tris-HCl, pH 8.5), 50 mM KC1, 3 mM MgCl ₂ , 50 μM dNTP's, 0.2 uM primer and 0.5 U DNA polymerase. Became optional 100 copies of the internal control plasmid VGMIKP were added to the individual reaction batches.

The amplification program of the thermal cycler was: 1 cycle at 94 ° C for 2 min, 55 ° C for 2 min, 72 ° C for 2 min and 34 cycles 94 ° C, 55 ° C for 1 min, 72 ° C for 1 min. Finally, the reaction mixture was incubated for 4 min at 72 ° C. The amplified products were electrophoretically separated in a 1.5% agarose gel and visualized with the Flue-O-Blue system using the Gel Star Nuclear Acid Gel Stains (Biozym, Hessisch-Oldendorf).

Example 2

Carrying out mycoplasma detection using real-time PCR, also using the control plasmid

To detect mycoplasma, 100 μl of the sample material to be examined was transferred to a sterile reaction vessel and heated at 95 ° C. for 5 minutes. Alternatively, the DNA contained therein can be purified by standard methods, for example by DNA extraction (for example QIAamp DNA Blood Kit, Qiagen, Hilden), and PCR inhibitors which may be present in the sample material can thereby be removed. The PCR mixture had a total volume of 25 μl and consisted of 5 μl of the sample material and 45 μl of the amplification buffer with 1 × ROX reaction buffer (TibMolBiol, Berlin), 2.5 mM MgCl ₂ , 100 μM dNTP's, where dTTP by dUTP was replaced, 4 μM per primer 5 NGM and 3 NGM, 300 nM of the FAM-labeled probe VGMTP and 1 U DΝA polymerase. 100 copies of the internal control plasmid VMPIKP and 300 nM of the TET-labeled probe VTP were added to individual reaction batches. The ABI Prism 7700 from Applied Biosystems was used as the real-time thermal cycler. The amplification program was: 1 cycle at 50 ° C for 2 min, 95 ° C for 2 min, and 40 cycles 95 ° C for 15 sec, 60 ° C for 1 min, 72 ° C for 1 min. The fluorescence measurement of the FAM and TET dyes was done once after each Cycle. The evaluation was carried out electronically by outputting the fluorescence curves for the individual samples at the end of the PCR.

Claims

claims

1. Control plasmid containing primers which recognize a species-specific for the microorganism class Mollicutes, but for the individual species of the genus Mycoplasma and most representatives of the genera Ureaplasma, Spiroplasma and Acholeplasma, universal section of the gene encoding the 16s rRNA of the Mycoplasma genome and an amplicon arranged between the primers, which contains the oligonucleotide sequence 5 '-cgccctactggccacctgtccaga u -.

2. Control plasmid according to claim 1, characterized in that the primers contain the sequences 5'- ggagcaaacaggattagataccc and 3'- caccatctgtcactctgttaacc.

3. Control plasmid according to claim 1, characterized in that it has the sequence 5 "- ggagcaaacaggattagatacccagtctacgtgtttggagactgtgta- caaggcgactggtgccccatctctgggggactatgttcggcccgccta- catcgtcacgccctactggccacgatggggcgggggcgcggcgc

4. Method for the detection of mycoplasma in biological materials, whereby one

a) the mycoplasma in biological material is lysed by heat treatment,

b) the released mycoplasma DNA is used in a PCR, which uses specific primers, but which is unique for the representatives of the class Mollicutes recognize a section of the gene encoding the 16S rRNA of mycoplasma and

either

c) carries out a conventional, non-real-time PCR,

or

d) a fluorescence-labeled oligonucleotide is used as a detection and quantification probe for the amplified mycoplasma DNA in the PCR reaction and e) the reaction mixture is processed in a device for real-time PCR

or

f) adding a control plasmid according to claim 1 to the reaction mixture and g) carrying out a conventional, non-real-time PCR

or

h) a control plasmid according to claim 1 is added to the reaction mixture and i) fluorescence-labeled oligonucleotides are added as detection and quantification probes for the amplicon of the control plasmid and the mycoplasma DNA and j) the reaction mixture is processed in a device for real-time PCR.

5. The method according to claim 4, characterized in that one destroys the Mycoplasma particles contained in the biological sample before the DNA extraction.

6. The method according to any one of claims 4 or 5, characterized in that the biological material is used directly in the PCR.

7. The method according to any one of claims 4 to 6, characterized in that a FAM-labeled probe with the sequence 5 '-acggggacccgcacaagtggtggagc or a TET-labeled probe with the sequence 5 - cgccctactggccacctgtccaga is used as the fluorescence-labeled oligonucleotide.

8. The method according to any one of claims 4 to 7, characterized in that one carries out the quantification by means of parallel analysis of a defined mycoplasma DNA standard.