WO2001077164A2 - Diagnosis of diseases associated with apoptosis by means of assessing the methylation status of genes associated with apoptosis - Google Patents

Diagnosis of diseases associated with apoptosis by means of assessing the methylation status of genes associated with apoptosis Download PDF

Info

Publication number
WO2001077164A2
WO2001077164A2 PCT/EP2001/003969 EP0103969W WO0177164A2 WO 2001077164 A2 WO2001077164 A2 WO 2001077164A2 EP 0103969 W EP0103969 W EP 0103969W WO 0177164 A2 WO0177164 A2 WO 0177164A2
Authority
WO
WIPO (PCT)
Prior art keywords
dna
recited
apoptosis
genes
sequences
Prior art date
Application number
PCT/EP2001/003969
Other languages
French (fr)
Other versions
WO2001077164A3 (en
WO2001077164A8 (en
Inventor
Alexander Olek
Christian Piepenbrock
Kurt Berlin
Original Assignee
Epigenomics Ag
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority claimed from DE10019058A external-priority patent/DE10019058A1/en
Priority claimed from DE10032529A external-priority patent/DE10032529A1/en
Application filed by Epigenomics Ag filed Critical Epigenomics Ag
Priority to EP01953936A priority Critical patent/EP1274865B1/en
Priority to JP2001575634A priority patent/JP2003531589A/en
Priority to DE60126593T priority patent/DE60126593T2/en
Priority to AU2001276330A priority patent/AU2001276330B2/en
Priority to AU7633001A priority patent/AU7633001A/en
Publication of WO2001077164A2 publication Critical patent/WO2001077164A2/en
Publication of WO2001077164A8 publication Critical patent/WO2001077164A8/en
Publication of WO2001077164A3 publication Critical patent/WO2001077164A3/en

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P11/00Drugs for disorders of the respiratory system
    • A61P11/06Antiasthmatics
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P13/00Drugs for disorders of the urinary system
    • A61P13/12Drugs for disorders of the urinary system of the kidneys
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P29/00Non-central analgesic, antipyretic or antiinflammatory agents, e.g. antirheumatic agents; Non-steroidal antiinflammatory drugs [NSAID]
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00Antineoplastic agents
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P7/00Drugs for disorders of the blood or the extracellular fluid
    • A61P7/04Antihaemorrhagics; Procoagulants; Haemostatic agents; Antifibrinolytic agents
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P9/00Drugs for disorders of the cardiovascular system
    • A61P9/10Drugs for disorders of the cardiovascular system for treating ischaemic or atherosclerotic diseases, e.g. antianginal drugs, coronary vasodilators, drugs for myocardial infarction, retinopathy, cerebrovascula insufficiency, renal arteriosclerosis
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/46Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
    • C07K14/47Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
    • C07K14/4701Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals not used
    • C07K14/4702Regulators; Modulating activity
    • C07K14/4703Inhibitors; Suppressors
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/82Translation products from oncogenes
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • C12Q1/6886Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00Oligonucleotides characterized by their use
    • C12Q2600/154Methylation markers
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00Oligonucleotides characterized by their use
    • C12Q2600/156Polymorphic or mutational markers

Definitions

  • the present invention relates to nucleic acids, oligonucleotides, PNA-oligomers and to a method for the diagnosis and/or therapy of diseases which have a connection with the genetic and/or epigenetic parameters of genes associated with apoptosis and, in particular, with the methylation status thereof.
  • Apoptosis takes place in response to a variety of stimuli that trigger biochemical pathways that result in a characteristic set of processes leading to cell death.
  • the stimuli that trigger apoptosis can include the levels of essential growth factors, treatment with glucocorticoids, irradiation, and activation of certain receptors. These trigger a variety of biochemical pathways.
  • the 'classical' pathway comprises of a ligand-receptor interaction which triggers the activation of a protease. This leads to the release of cytochrome C from mitochondria. This in turn activates a series of proteases, whose actions culminate in the destruction of cellular structures.
  • a common pathway involves activation of caspase-8 by oligomerization at an activated surface receptor.
  • Caspase-8 cleaves Bid, which triggers release of cytochrome c from mitochondria.
  • the cytochrome c causes Apaf-1 to oligomerize with caspase-9.
  • the activated caspase-9 cleaves procaspase-3, whose two subunits then form the active protease. This cleaves various targets that lead to cell death.
  • Cell death by apoptosis is characterised by processes in which the cell becomes more compact, blebbing occurs at the membranes, chroma- tin becomes condensed, and DNA is fragmented.
  • apoptosis The correct control of apoptosis is probably essential to all higher organisms.
  • Elegans 131 of the 1090 cells die at defined points of the lifecycle of the organism.
  • the importance of apoptosis has been proved using knockout mouse models.
  • apoptosis pathways have been implicated in a variety of diseases including neurodegenerative diseases, ageing and cancer:
  • Methylation based therapies could have considerable advantages over current methods of treatment such as chemotherapy, surgery and radiotherapy. They may even, as demonstrated by Soengas et al, provide a means of treating tumors resistant to conventional therapies.
  • experiments with Min mice have shown that inhibition of DNA methylation can suppress tumor initiation (Laird et. al. 'Suppression of intestinal neoplasia by DNA hypomethylation' Cell 81; 197-205 1995).
  • DNA methylation analysis may provide novel means for tumor diagnosis as suggested by Rosas et. al.
  • 5-methylcytosine is the most frequent covalent base modification in the DNA of eukaryotic cells. It plays a role, for example, in the regulation of the transcription, in genetic imprinting, and in tumorigenesis. Therefore, the identification of 5-methylcytosine as a component of genetic information is of considerable interest. However, 5-methylcytosine positions cannot be identified by sequencing since 5-methylcytosine has the same base pairing behavior as cytosine. Moreover, the epigenetic information carried by 5-methylcytosine is completely lost during PCR amplification.
  • a relatively new and currently the most frequently used method for analyzing DNA for 5- methylcytosine is based upon the specific reaction of bisulfite with cytosine which, upon subsequent alkaline hydrolysis, is converted to uracil which corresponds to thymidine in its base pairing behavior.
  • 5-methylcytosine remains unmodified under these conditions. Consequently, the original DNA is converted in such a manner that methylcytosine, which originally could not be distinguished from cytosine by its hybridization behavior, can now be detected as the only remaining cytosine using "normal" molecular biological techniques, for example, by amplification and hybridization or sequencing. All of these techniques are based on base pairing which can now be fully exploited.
  • the prior art is defined by a method which encloses the DNA to be analyzed in an agarose matrix, thus preventing the diffusion and renaturation of the DNA (bisulfite only reacts with single-stranded DNA), and which replaces all precipitation and purification steps with fast dialysis (Olek A, Oswald J, Walter J. A modified and improved method for bisulphite based cytosine methylation analysis. Nucleic Acids Res. 1996 Dec 15;24(24):5064-6). Using this method, it is possible to analyze individual cells, which illustrates the potential of the method.
  • Fluorescently labeled probes are often used for the scanning of immobilized DNA arrays.
  • the simple attachment of Cy3 and Cy5 dyes to the 5'-OH of the specific probe are particularly suitable for fluorescence labels.
  • the detection of the fluorescence of the hybridized probes may be carried out, for example via a confocal microscope.
  • Cy3 and Cy5 dyes besides many others, are commercially available.
  • Matrix Assisted Laser Desorption Ionization Mass Spectrometry MALDI-TOF is a very efficient development for the analysis of biomolecules (Karas M, Hillenkamp F. Laser desorption ionization of proteins with molecular masses exceeding 10,000 daltons. Anal Chem. 1988 Oct 15;60(20):2299-301).
  • An analyte is embedded in a light-absorbing matrix.
  • the matrix is evaporated by a short laser pulse thus transporting the analyte molecule into the vapor phase in an unfragmented manner.
  • the analyte is ionized by collisions with matrix molecules.
  • An applied voltage accelerates the ions into a field-free flight tube. Due to their different masses, the ions are accelerated at different rates. Smaller ions reach the detector sooner than bigger ones.
  • MALDI-TOF spectrometry is excellently suited to the analysis of peptides and proteins.
  • the analysis of nucleic acids is somewhat more difficult (Gut I G, Beck S. DNA and Matrix Assisted Laser Desorption Ionization Mass Spectrometry. Current Innovations and Future Trends. 1995, 1; 147-57).
  • the sensitivity to nucleic acids is approximately 100 times worse than to peptides and decreases disproportionally with increasing fragment size.
  • the ionization process via the matrix is considerably less efficient.
  • the selection of the matrix plays an eminently important role.
  • Genomic DNA is obtained from DNA of cell, tissue or other test samples using standard methods. This standard methodology is found in references such as Fritsch and Maniatis eds., Molecular Cloning: A Laboratory Manual, 1989.
  • the object of the present invention is to provide the chemically modified DNA of genes associated with apoptosis, as well as oligonucleotides and/or PNA-oligomers for detecting cytosine methylations, as well as a method which is particularly suitable for the diagnosis and/or therapy of genetic and epigenetic parameters of genes associated with apoptosis.
  • the present invention is based on the discovery that genetic and epigenetic parameters and, in particular, the cytosine methylation pattern of genes associated with apoptosis are particularly suitable for the diagnosis and/or therapy of diseases associated with apoptosis.
  • nucleic acid containing a sequence of at least 18 bases in length of the chemically pretreated DNA of genes associated with apoptosis according to one of Seq. ID No.l through Seq. ID No.78 and sequences complementary thereto and/or a sequence of a chemically pretreated DNA of genes according to table 1 and sequences complementary thereto.
  • table 1 after the listed gene designations, the respective data bank numbers (accession numbers) are specified which define the appertaining gene sequences as unique.
  • GenBank was used as the underlying data bank, which is located at the National Institute of Health, internet address www.ncbi.nlm.nih.gov.
  • the chemically modified nucleic acid could heretofore not be connected with the ascertainment of genetic and epigenetic parameters.
  • the object of the present invention is further achieved by an oligonucleotide or oligomer for detecting the cytosine methylation state in chemically pretreated DNA, containing at least one base sequence having a length of at least 13 nucleotides which hybridizes to a chemically pretreated DNA of genes associated with apoptosis according to Seq. ID No.l through Seq. ID No.78 and sequences complementary thereto and/or a sequence of a chemically pretreated DNA of genes according to table 1 and sequences complementary thereto.
  • the oligomer probes according to the present invention constitute important and effective tools which, for the first time, make it possible to ascertain the genetic and epigenetic parameters of genes associated with apoptosis.
  • the base sequence of the oligomers preferably contains at least one CpG dinucleotide.
  • the probes may also exist in the form of a PNA (peptide nucleic acid) which has particularly preferred pairing properties.
  • PNA peptide nucleic acid
  • Particularly preferred are ohgonucleotides according to the present invention in which the cytosine of the CpG dinucleotide is the 5th - 9th nucleotide from the 5 '-end of the 13-mer; in the case of PNA-oligomers, it is preferred for the cytosine of the CpG dinucleotide to be the 4th - 6th nucleotide from the 5 '-end of the 9- mer.
  • the oligomers according to the present invention are normally used in so called “sets" which contain at least one oligomer for each of the CpG dinucleotides of the sequences of Seq. ID No.l through Seq. ID No.78 and sequences complementary thereto and/or a sequence of a chemically pretreated DNA of genes according to table 1 and sequences complementary thereto.
  • sets which contain at least one oligomer for each of the CpG dinucleotides from one of Seq. ID No.l through Seq. ID No.78 and sequences complementary thereto and/or a sequence of a chemically pretreated DNA of genes according to table 1 and sequences complementary thereto.
  • the present invention makes available a set of at least two oligonucleotides which can be used as so-called "primer oligonucleotides" for amplifying DNA sequences of one of Seq. ID No.l through Seq. ID No.78 and sequences complementary thereto and/or a sequence of a chemically pretreated DNA of genes according to table 1 and sequences complementary thereto, or segments thereof.
  • At least one oligonucleotide is bound to a solid phase.
  • the present invention moreover relates to a set of at least 10 n (oligonucleotides and/or PNA- oligomers) used for detecting the cytosine methylation state in chemically pretreated genomic DNA (Seq. ID No.l through Seq. ID No.78 and sequences complementary thereto and/or a sequence of a chemically pretreated DNA of genes according to table 1 and sequences complementary thereto).
  • These probes enable diagnosis and/or therapy of genetic and epigenetic parameters of genes associated with apoptosis.
  • the set of oligomers may also be used for detecting single nucleotide polymorphisms (SNPs) in the chemically pretreated DNA of genes associated with apoptosis according to one of Seq. ID No.l through Seq. ID No.78 and sequences complementary thereto and/or a sequence of a chemically pretreated DNA of genes according to table 1 and sequences complementary thereto.
  • SNPs single nucleotide polymorphisms
  • an arrangement of different oligonucleotides and/or PNA-oligomers made available by the present invention is present in a manner that it is likewise bound to a solid phase.
  • This array of different oligo- nucleotide- and/or PNA-oligomer sequences can be characterized in that it is arranged on the solid phase in the form of a rectangular or hexagonal lattice.
  • the solid phase surface is preferably composed of silicon, glass, polystyrene, aluminum, steel, iron, copper, nickel, silver, or gold.
  • nitrocellulose as well as plastics such as nylon which can exist in the form of pellets or also as resin matrices are possible as well.
  • a further subject matter of the present invention is a method for manufacturing an array fixed to a carrier material for analysis in connection with diseases associated with apoptosis in which method at least one oligomer according to the present invention is coupled to a solid phase.
  • Methods for manufacturing such arrays are known, for example, from US Patent 5,744,305 by means of solid-phase chemistry and photolabile protecting groups.
  • a further subject matter of the present invention relates to a DNA chip for the analysis of diseases associated with apoptosis which contains at least one nucleic acid according to the present invention.
  • DNA chips are known, for example, for US Patent 5,837,832.
  • kits which may be composed, for example, of a bisulfite-containing reagent, a set of primer oligonucleotides containing at least two oligonucleotides whose sequences in each case correspond or are complementary to an 18 base long segment of the base sequences specified in the appendix (Seq. ID No.l through Seq. ID No.78 and sequences complementary thereto and/or a sequence of a chemically pretreated DNA of genes according to table 1 and sequences complementary thereto), oligonucleotides and/or PNA-oligomers as well as instructions for carrying out and evaluating the described method.
  • a bisulfite-containing reagent a set of primer oligonucleotides containing at least two oligonucleotides whose sequences in each case correspond or are complementary to an 18 base long segment of the base sequences specified in the appendix (Seq. ID No.l through Seq. ID No.78 and sequences complementary thereto and/or a sequence of
  • kits along the lines of the present invention can also contain only part of the aforementioned components.
  • the present invention also makes available a method for ascertaining genetic and/or epigenetic parameters of genes associated with the cycle cell by analyzing cytosine methylations and single nucleotide polymorphisms, including the following steps:
  • a genomic DNA sample is chemically treated in such a manner that cytosine bases which are unmethylated at the 5 '-position are converted to uracil, thymine, or another base which is dissimilar to cytosine in terms of hybridization behavior. This will be understood as 'chemical pretreatment' hereinafter.
  • the genomic DNA to be analyzed is preferably obtained form usual sources of DNA such as cells or cell components, for example, cell lines, biopsies, blood, sputum, stool, urine, cerebral-spinal fluid, tissue embedded in paraffin such as tissue from eyes, intestine, kidney, brain, heart, prostate, lung, breast or liver, histologic object slides, or combinations thereof.
  • sources of DNA such as cells or cell components, for example, cell lines, biopsies, blood, sputum, stool, urine, cerebral-spinal fluid, tissue embedded in paraffin such as tissue from eyes, intestine, kidney, brain, heart, prostate, lung, breast or liver, histologic object slides, or combinations thereof.
  • the above described treatment of genomic DNA is preferably carried out with bisulfite (hydrogen sulfite, disulfite) and subsequent alkaline hydrolysis which results in a conversion of non-methylated cytosine nucleobases to uracil or to another base which is dissimilar to cytosine in terms of base pairing behavior.
  • Fragments of the chemically pretreated DNA are amplified, using sets of primer oligonucleotides according to the present invention, and a, preferably heat-stable polymerase. Because of statistical and practical considerations, preferably more than ten different fragments having a length of 100 - 2000 base pairs are amplified.
  • the amplification of several DNA segments can be carried out simultaneously in one and the same reaction vessel. Usually, the amplification is carried out by means of a polymerase chain reaction (PCR).
  • PCR polymerase chain reaction
  • the set of primer oligonucleotides includes at least two olignonucleotides whose sequences are each reverse complementary or identical to an at least 18 base-pair long segment of the base sequences specified in the appendix (Seq. ID No.l through Seq. ID No.78 and sequences complementary thereto and/or a sequence of a chemically pretreated DNA of genes according to table 1 and sequences complementary thereto).
  • the primer oligonucleotides are preferably characterized in that they do not contain any CpG dinucleotides. According to the present invention, it is preferred that at least one primer oligonucleotide is bonded to a solid phase during amplification.
  • the different oligonucleotide and/or PNA- oligomer sequences can be arranged on a plane solid phase in the form of a rectangular or hexagonal lattice, the solid phase surface preferably being composed of silicon, glass, polystyrene, aluminum, steel, iron, copper, nickel, silver, or gold, it being possible for other materials such as nitrocellulose or plastics to be used as well.
  • the fragments obtained by means of the amplification can carry a directly or indirectly detectable label.
  • the detection may be carried out and visualized by means of matrix assisted laser desorption/ionization mass spectrometry (MALDI) or using electron spray mass spectrometry (ESI).
  • MALDI matrix assisted laser desorption/ionization mass spectrometry
  • ESI electron spray mass spectrometry
  • the amplificates obtained in the second step of the method are subsequently hybridized to an array or a set of oligonucleotides and/or PNA probes.
  • the hybridization takes place in the manner described in the following.
  • the set of probes used during the hybridization is preferably composed of at least 10 oligonucleotides or PNA-oligomers.
  • the amplificates serve as probes which hybridize to oligonucleotides previously bonded to a solid phase. The non-hybridized fragments are subsequently removed.
  • Said oligonucleotides contain at least one base sequence having a length of 13 nucleotides which is reverse complementary or identical to a segment of the base sequences specified in the appendix, the segment containing at least one CpG dinucleotide.
  • the cytosine of the CpG dinucleotide is the 5th to 9th nucleotide from the 5 '-end of the 13-mer.
  • One oligonucleotide exists for each CpG dinucleotide.
  • Said PNA-oligomers contain at least one base sequence having a length of 9 nucleotides which is reverse complementary or identical to a segment of the base sequences specified in the appendix, the segment containing at least one CpG dinucleotide.
  • the cytosine of the CpG dinucleotide is the 4th to 6th nucleotide seen from the 5 '-end of the 9-mer.
  • One oligonucleotide exists for each CpG dinucleotide.
  • the non-hybridized amplificates are removed.
  • the hybridized amplificates are detected.
  • labels attached to the amplificates are identifiable at each position of the solid phase at which an oligonucleotide sequence is located.
  • the labels of the amplificates are fluorescence labels, radionuclides, or detachable molecule fragments having a typical mass which can be detected in a mass spectrometer.
  • the mass spectrometer is preferred for the detection of the amplificates, fragments of the amplificates or of probes which are complementary to the amplificates, it being possible for the detection to be carried out and visualized by means of matrix assisted laser desorption/ionization mass spectrometry (MALDI) or using electron spray mass spectrometry (ESI).
  • MALDI matrix assisted laser desorption/ionization mass spectrometry
  • ESI electron spray mass spectrometry
  • the produced fragments may have a single positive or negative net charge for better detecta- bility in the mass spectrometer.
  • the aforementioned method is preferably used for ascertaining genetic and/or epigenetic parameters of genes associated with apoptosis.
  • the oligomers according to the present invention or arrays thereof as well as a kit according to the present invention are intended to be used for the diagnosis and or therapy of diseases associated with apoptosis by analyzing methylation patterns of genes associated with apoptosis.
  • the method is preferably used for the diagnosis and/or therapy of important genetic and/or epigenetic parameters within genes associated with apoptosis.
  • the method according to the present invention is used, for example, for the diagnosis and/or therapy of HIV infection, Bloom syndrome, cardiopathy,aging, neurodegenerative disorders, Herpes simplex virus infection, renal ischemia, amyotrophic lateral sclerosis, solid tumors and cancers.
  • the nucleic acids according to the present invention of Seq. ID No.l through Seq. ID No.78 and sequences complementary thereto and/or a sequence of a chemically pretreated DNA of genes according to table 1 and sequences complementary thereto can be used for the diagnosis and/or therapy of genetic and/or epigenetic parameters of genes associated with apoptosis.
  • the present invention moreover relates to a method for manufacturing a diagnostic agent and/or therapeutic agent for the diagnosis and/or therapy of diseases associated with apoptosis by analyzing methylation patterns of genes associated with apoptosis, the diagnostic agent and/or therapeutic agent being characterized in that at least one nucleic acid according to the present invention is used for manufacturing it, possibly together with suitable additives and auxiliary agents.
  • a further subject matter of the present invention relates to a diagnostic agent and/or therapeutic agent for diseases associated with apoptosis by analyzing methylation patterns of genes associated with apoptosis, the diagnostic agent and/or therapeutic agent containing at least one nucleic acid according to the present invention, possibly together with suitable additives and auxiliary agents.
  • the present invention moreover relates to the diagnosis and/or prognosis of events which are disadvantageous to patients or individuals in which important genetic and/or epigenetic parameters within genes associated with apoptosis said parameters obtained by means of the present invention may be compared to another set of genetic and/or epigenetic parameters, the differences serving as the basis for a diagnosis and/or prognosis of events which are disadvantageous to patients or individuals.
  • hybridization is to be understood as a bond of an oligonucleotide to a completely complementary sequence along the lines of the Watson- Crick base pairings in the sample DNA, forming a duplex structure.
  • stringent hybridization conditions are those conditions in which a hybridization is carried out at 60°C in 2.5 x SSC buffer, followed by several washing steps at 37°C in a low buffer concentration, and remains stable.
  • mutants denotes all DNA sequences which are complementary to a DNA sequence, and which hybridize to the reference sequence under stringent conditions and have an activity similar to the corresponding polypeptide according to the present invention.
  • genetic parameters are mutations and polymorphisms of genes associated with apoptosis and sequences further required for their regulation. To be designated as mutations are, in particular, insertions, deletions, point mutations, inversions and polymorphisms and, particularly preferred, SNPs (single nucleotide polymorphisms).
  • epigenetic parameters are, in particular, cytosine methylations and further chemical modifications of DNA bases of genes associated with apoptosis and sequences further required for their regulation.
  • Further epigenetic parameters include, for example, the acetylation of histones which, however, cannot be directly analyzed using the described method but which, in turn, correlates with the DNA methylation.
  • Figure 1 shows the hybridisation of fluorescent labelled amplificates to a surface bound olignonucleotide.
  • Sample I being from healthy tissue and sample II being from pilocytic as- trocytoma (tumor) tissue.
  • Flourescence at a spot shows hybridisation of the amplificate to the olignonucleotide.
  • Hybridisation to a CG olignonucleotide denotes methylation at the cytosine position being analysed
  • hybridisation to a TG olignonucleotide denotes no methylation at the cytosine position being analysed.
  • Sequences having odd sequence numbers exhibit in each case sequences of the chemically pretreated genomic DNAs of different genes associated with apoptosis.
  • Sequences having even sequence numbers exhibit in each case the sequences of the chemically pretreated genomic DNAs of genes associated with apoptosis which are complementary to the preceeding sequences (e.g., the complementary sequence to Seq. ID No.l is Seq. ID No.2, the complementary sequence to Seq. ID No.3 is Seq. ID No.4, etc.)
  • Sequence ID Nos. 75 to 78 show the sequences of oligonucleotides used in Example 1.
  • the following example relates to a fragment of a gene associated with apoptosis, in this case, death-associated protein 1 (DAPK1) in which a specific CG-position is analyzed for its methylation status.
  • DAPK1 death-associated protein 1
  • Example 1 Methylation analysis in the gene DAPK1 associated with apoptosis.
  • the following example relates to a fragment of the gene DAPK1 in which a specific CG- position is to be analyzed for methylation.
  • a genomic sequence is treated using bisulfite (hydrogen sulfite, disulfite) in such a manner that all cytosines which are not methylated at the 5-position of the base are modified in such a manner that a different base is substituted with regard to the base pairing behavior while the cytosines methylated at the 5-position remain unchanged.
  • bisulfite hydrogen sulfite, disulfite
  • the treated DNA sample is diluted with water or an aqueous solution.
  • the DNA is subsequently desulfonated (10-30 min, 90-100 °C) at an alkaline pH value.
  • the DNA sample is amplified in a polymerase chain reaction, preferably using a heat-resistant DNA polymerase.
  • cytosines of the gene DAPK1 are analyzed.
  • a defined fragment having a length of 465 bp is amplified with the specific primer oligonucleotides ATTAATATTATGTAAAGTGA (Sequence ID No. 75) and CTTACAACCATTCACCCACA (Sequence ID No. 76).
  • This amplificate serves as a sample which hybridizes to an oligonucleotide previously bonded to a solid phase, forming a duplex structure, for example GTTATATCGTGGAGGATA (Sequence ID No.
  • the cytosine to be detected being located at position 135 of the amplificate.
  • the detection of the hybridization product is based on Cy3 and Cy5 flourescently labeled primer oligonucleotides which have been used for the amplification.
  • a hybridization reaction of the amplified DNA with the oli- gonucleotide takes place only if a methylated cytosine was present at this location in the bi- sulfite-treated DNA.
  • the methylation status of the specific cytosine to be analyzed is inferred from the hybridization product.
  • a sample of the amplificate is further hybridized to another oligonucleotide previously bonded to a solid phase.
  • Said olignonucleotide is identical to the oligonucleotide previously used to analyze the methylation status of the sample, with the exception of the position in question.
  • said oligonucleotide comprises a thymine base as opposed to a cytosine base i.e GTTATATTGTGGAGGATA (Sequence ID No. 78). Therefore, the hybridisation reaction only takes place if an unmethylated cytosine was present at the position to be analysed.
  • the procedure was carried out on cell samples from 2 patients, sample I being from normal healthy tissue and sample II being from a pilocytic astrocytoma tumor sample.
  • sample I contained a mixture of both methylated and unmethylated cells at position of the amplificate whereas sample II contained only methylated cells at position 135 of the amplificate.
  • methylation patterns In order to relate the methylation patterns to one of the diseases associated with apoptosis, it is initially required to analyze the DNA methylation patterns of a group of diseased and of a group of healthy patients. These analyses are carried out, for example, analogously to Example 1. The results obtained in this manner are stored in a database and the CpG dinucleotides which are methylated differently between the two groups are identified. This can be carried out by determining individual CpG methylation rates as can be done, for example, in a relatively imprecise manner, by sequencing or else, in a very precise manner, by a methylation- sensitive "primer extension reaction". It is also possible for the entire methylation status to be analyzed simultaneously, and for the patterns to be compared, for example, by clustering analyses which can be carried out, for example, by a computer.
  • Example 2 can be carried out, for example, for the following diseases: HIV infection, Bloom syndrome, cardiopathy,aging, neurodegenerative disorders, Herpes simplex virus infection, renal ischemia, amyotrophic lateral sclerosis, solid tumors and cancers.

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • General Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Genetics & Genomics (AREA)
  • Zoology (AREA)
  • Medicinal Chemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biophysics (AREA)
  • Molecular Biology (AREA)
  • Wood Science & Technology (AREA)
  • Analytical Chemistry (AREA)
  • Biochemistry (AREA)
  • Pathology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Immunology (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Animal Behavior & Ethology (AREA)
  • Veterinary Medicine (AREA)
  • Public Health (AREA)
  • Microbiology (AREA)
  • Oncology (AREA)
  • Physics & Mathematics (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Biotechnology (AREA)
  • General Engineering & Computer Science (AREA)
  • Toxicology (AREA)
  • Hospice & Palliative Care (AREA)
  • Urology & Nephrology (AREA)
  • Pulmonology (AREA)
  • Pain & Pain Management (AREA)
  • Cardiology (AREA)
  • Rheumatology (AREA)
  • Heart & Thoracic Surgery (AREA)
  • Diabetes (AREA)

Abstract

The present invention relates to the chemically modified genomic sequences of genes associated with apoptosis, to oligonucleotides and/or PNA-oligomers for detecting the cytosine methylation state of genes associated with apoptosis which are directed against the sequence, as well as to a method for ascertaining genetic and/or epigenetic parameters of genes associated with apoptosis.

Description

Diagnosis of Diseases Associated with apoptosis
Field of the Invention
The levels of observation that have been well studied by the methodological developments of recent years in molecular biology, are the genes themselves, the translation of these genes into RNA, and the resulting proteins. The question of which gene is switched on at which point in the course of the development of an individual, and how the activation and inhibition of specific genes in specific cells and tissues are controlled is correlatable to the degree and character of the methylation of the genes or of the genome. In this respect, pathogenic conditions may manifest themselves in a changed methylation pattern of individual genes or of the genome.
The present invention relates to nucleic acids, oligonucleotides, PNA-oligomers and to a method for the diagnosis and/or therapy of diseases which have a connection with the genetic and/or epigenetic parameters of genes associated with apoptosis and, in particular, with the methylation status thereof.
Prior Art
During embryogenesis, tissue turnover or metamorphosis, multi cellular eukaryotic organisms retain the ability to eliminate unwanted cells. This form of programmed cell death is termed 'apoptosis'. Apoptosis takes place in response to a variety of stimuli that trigger biochemical pathways that result in a characteristic set of processes leading to cell death.
The stimuli that trigger apoptosis can include the levels of essential growth factors, treatment with glucocorticoids, irradiation, and activation of certain receptors. These trigger a variety of biochemical pathways. The 'classical' pathway comprises of a ligand-receptor interaction which triggers the activation of a protease. This leads to the release of cytochrome C from mitochondria. This in turn activates a series of proteases, whose actions culminate in the destruction of cellular structures.
For example, a common pathway involves activation of caspase-8 by oligomerization at an activated surface receptor. Caspase-8 cleaves Bid, which triggers release of cytochrome c from mitochondria. The cytochrome c causes Apaf-1 to oligomerize with caspase-9. The activated caspase-9 cleaves procaspase-3, whose two subunits then form the active protease. This cleaves various targets that lead to cell death. Cell death by apoptosis is characterised by processes in which the cell becomes more compact, blebbing occurs at the membranes, chroma- tin becomes condensed, and DNA is fragmented.
The correct control of apoptosis is probably essential to all higher organisms. For example, in the model organism C. Elegans 131 of the 1090 cells die at defined points of the lifecycle of the organism. In vertebrates, the importance of apoptosis has been proved using knockout mouse models. In humans, apoptosis pathways have been implicated in a variety of diseases including neurodegenerative diseases, ageing and cancer:
- HIV infection; Badley et. al. "Mechanisms of HIV-associated lymphocyte apoptosis" BloodNol. 96; 2951-2964 (2000).
- Bloom Syndrome; Bischof et. al. 'Selective cleavage of BLM, the Bloom syndrome protein, during apoptotic cell death.' J Biol Chem 2001 Jan 11.
- Cardiomyopathy; Narula et. al. "Apoptosis in heart failure: release of cytochrome c from mitochondria and activation of caspase-3 in human cardiomyopathy" Proc Natl Acad Sci U S A.;96:8144-8149 (1999).
- Familial Alzheimers; Simian et. al. Presenilin-1 P264L Knock-In Mutation: Differential Effects on Aβ Production, Amyloid Deposition, and Neuronal Vulnerability The Journal of Neuroscience, 20(23):8717-8726 (1999).
- Aging; Schindowski et. al. 'Age-related changes of apoptotic cell death in human lymphocytes.' Neurobiol Aging 2000 Sep-Oct;21(5):661-70.
- Herpes simplex virus infection; Perng et. al. "Virus-Induced Neuronal Apoptosis Blocked by the Herpes Simplex Virus Latency-Associated Transcript" Science 287: 1500-1503 (2000). - Renal ischemia; Yuexian et. al. "Downregulation of the calpain inhibitor protein cal- pastatin by caspases during renal ischemia-reperfusion" Am. J. Physiol. 279: 509-517.
- Amyotrophic lateral sclerosis; Li et. al. "Functional Role of Caspase-1 and Caspase-3 in an ALS Transgenic Mouse Model" Science 288 (5464); 335-339 (2000).
- Breast cancer; Sierra et. al. 'Bcl-2 with loss of apoptosis allows accumulation of genetic alterations: a pathway to metastatic progression in human breast cancer.' Int J Cancer. 2000 Mar 20;89(2): 142-7.
The complexities of the pathways leading to apoptosis allow for many mechanisms by which it can be diverted. In addition to genomic mutations, the epigenetic control of genes has been implicated in disruptions to apoptosis pathways. The epigenetic parameter that has been best characterised, DNA methylation, has been implicated as a key factor in the resistance of tumors to chemotherapy. It has been shown (Soengas et al "Inactivation of the apoptosis effector Apaf-1 in malignant melanoma" Nature 409; 207-211;2001) that in malignant melanomas disruptions in the apoptosis pathway could be attributed to silencing of the Apaf-1 gene.
The identification of methylation of apoptosis genes as a factor in tumor malignancy opens up the possibility of creating alternative methods of treatment. Methylation based therapies could have considerable advantages over current methods of treatment such as chemotherapy, surgery and radiotherapy. They may even, as demonstrated by Soengas et al, provide a means of treating tumors resistant to conventional therapies. In addition to the development of methylation specific therapies, experiments with Min mice have shown that inhibition of DNA methylation can suppress tumor initiation (Laird et. al. 'Suppression of intestinal neoplasia by DNA hypomethylation' Cell 81; 197-205 1995). Furthermore, DNA methylation analysis may provide novel means for tumor diagnosis as suggested by Rosas et. al. 'Promoter hypermeth- ylation patterns of pi 6, 06-methylguanine-DNA-methyltransferase, and death-associated protein kinase in tumors and saliva of head and neck cancer patients.' Cancer Res 2001 Feb l;61(3):939-42.
5-methylcytosine is the most frequent covalent base modification in the DNA of eukaryotic cells. It plays a role, for example, in the regulation of the transcription, in genetic imprinting, and in tumorigenesis. Therefore, the identification of 5-methylcytosine as a component of genetic information is of considerable interest. However, 5-methylcytosine positions cannot be identified by sequencing since 5-methylcytosine has the same base pairing behavior as cytosine. Moreover, the epigenetic information carried by 5-methylcytosine is completely lost during PCR amplification.
A relatively new and currently the most frequently used method for analyzing DNA for 5- methylcytosine is based upon the specific reaction of bisulfite with cytosine which, upon subsequent alkaline hydrolysis, is converted to uracil which corresponds to thymidine in its base pairing behavior. However, 5-methylcytosine remains unmodified under these conditions. Consequently, the original DNA is converted in such a manner that methylcytosine, which originally could not be distinguished from cytosine by its hybridization behavior, can now be detected as the only remaining cytosine using "normal" molecular biological techniques, for example, by amplification and hybridization or sequencing. All of these techniques are based on base pairing which can now be fully exploited. In terms of sensitivity, the prior art is defined by a method which encloses the DNA to be analyzed in an agarose matrix, thus preventing the diffusion and renaturation of the DNA (bisulfite only reacts with single-stranded DNA), and which replaces all precipitation and purification steps with fast dialysis (Olek A, Oswald J, Walter J. A modified and improved method for bisulphite based cytosine methylation analysis. Nucleic Acids Res. 1996 Dec 15;24(24):5064-6). Using this method, it is possible to analyze individual cells, which illustrates the potential of the method. However, currently only individual regions of a length of up to approximately 3000 base pairs are analyzed, a global analysis of cells for thousands of possible methylation events is not possible. However, this method cannot reliably analyze very small fragments from small sample quantities either. These are lost through the matrix in spite of the diffusion protection.
An overview of the further known methods of detecting 5-methylcytosine may be gathered from the following review article: Rein, T., DePamphilis, M. L., Zorbas, H., Nucleic Acids Res. 1998, 26, 2255.
To date, barring few exceptions (e.g., Zeschnigk M, Lich C, Buiting K, Doerfler W, Horsthemke B. A single-tube PCR test for the diagnosis of Angelman and Prader-Willi syndrome based on allelic methylation differences at the SNRPN locus. Eur J Hum Genet. 1997 Mar-Apr;5(2):94-8) the bisulfite technique is only used in research. Always, however, short, specific fragments of a known gene are amplified subsequent to a bisulfite treatment and either completely sequenced (Olek A, Walter J. The pre-implantation ontogeny of the HI 9 methylation imprint. Nat Genet. 1997 Nov;17(3):275-6) or individual cytosine positions are detected by a primer extension reaction (Gonzalgo ML, Jones PA. Rapid quantitation of methylation differences at specific sites using methylation-sensitive single nucleotide primer extension (Ms-SNuPE). Nucleic Acids Res. 1997 Jun 15;25(12):2529-31, WO 95/00669) or by enzymatic digestion (Xiong Z, Laird PW. COBRA: a sensitive and quantitative DNA methylation assay. Nucleic Acids Res. 1997 Jun 15;25(12):2532-4). In addition, detection by hybridization has also been described (Olek et al., WO 99/28498).
Further publications dealing with the use of the bisulfite technique for methylation detection in individual genes are: Grigg G, Clark S. Sequencing 5-methylcytosine residues in genomic DNA. Bioessays. 1994 Jun;16(6):431-6, 431; Zeschnigk M, Schmitz B, Dittrich B, Buiting K, Horsthemke B, Doerfler W. Imprinted segments in the human genome: different DNA methylation patterns in the Prader-Willi/Angelman syndrome region as determined by the genomic sequencing method. Hum Mol Genet. 1997 Mar;6(3):387-95; Feil R, Charlton J, Bird AP, Walter J, Reik W. Methylation analysis on individual chromosomes: improved protocol for bisulphite genomic sequencing. Nucleic Acids Res. 1994 Feb 25;22(4):695-6; Martin V, Ribieras S, Song- Wang X, Rio MC, Dante R. Genomic sequencing indicates a correlation between DNA hypomethylation in the 5' region of the pS2 gene and its expression in human breast cancer cell lines. Gene. 1995 May 19;157(l-2):261-4; WO 97/46705, WO 95/15373 and WO 97/45560.
An overview of the Prior Art in oligomer array manufacturing can be gathered from a special edition of Nature Genetics (Nature Genetics Supplement, Volume 21, January 1999), published in January 1999, and from the literature cited therein.
Fluorescently labeled probes are often used for the scanning of immobilized DNA arrays. The simple attachment of Cy3 and Cy5 dyes to the 5'-OH of the specific probe are particularly suitable for fluorescence labels. The detection of the fluorescence of the hybridized probes may be carried out, for example via a confocal microscope. Cy3 and Cy5 dyes, besides many others, are commercially available. Matrix Assisted Laser Desorption Ionization Mass Spectrometry (MALDI-TOF) is a very efficient development for the analysis of biomolecules (Karas M, Hillenkamp F. Laser desorption ionization of proteins with molecular masses exceeding 10,000 daltons. Anal Chem. 1988 Oct 15;60(20):2299-301). An analyte is embedded in a light-absorbing matrix. The matrix is evaporated by a short laser pulse thus transporting the analyte molecule into the vapor phase in an unfragmented manner. The analyte is ionized by collisions with matrix molecules. An applied voltage accelerates the ions into a field-free flight tube. Due to their different masses, the ions are accelerated at different rates. Smaller ions reach the detector sooner than bigger ones.
MALDI-TOF spectrometry is excellently suited to the analysis of peptides and proteins. The analysis of nucleic acids is somewhat more difficult (Gut I G, Beck S. DNA and Matrix Assisted Laser Desorption Ionization Mass Spectrometry. Current Innovations and Future Trends. 1995, 1; 147-57). The sensitivity to nucleic acids is approximately 100 times worse than to peptides and decreases disproportionally with increasing fragment size. For nucleic acids having a multiply negatively charged backbone, the ionization process via the matrix is considerably less efficient. In MALDI-TOF spectrometry, the selection of the matrix plays an eminently important role. For the desorption of peptides, several very efficient matrixes have been found which produce a very fine crystallization. There are now several responsive matrixes for DNA, however, the difference in sensitivity has not been reduced. The difference in sensitivity can be reduced by chemically modifying the DNA in such a manner that it becomes more similar to a peptide. Phosphorothioate nucleic acids in which the usual phosphates of the backbone are substituted with thiophosphates can be converted into a charge- neutral DNA using simple alkylation chemistry (Gut IG, Beck S. A procedure for selective DNA alkylation and detection by mass spectrometry. Nucleic Acids Res. 1995 Apr 25;23(8):1367-73). The coupling of a charge tag to this modified DNA results in an increase in sensitivity to the same level as that found for peptides. A further advantage of charge tagging is the increased stability of the analysis against impurities which make the detection of unmodified substrates considerably more difficult. Genomic DNA is obtained from DNA of cell, tissue or other test samples using standard methods. This standard methodology is found in references such as Fritsch and Maniatis eds., Molecular Cloning: A Laboratory Manual, 1989.
Description
The object of the present invention is to provide the chemically modified DNA of genes associated with apoptosis, as well as oligonucleotides and/or PNA-oligomers for detecting cytosine methylations, as well as a method which is particularly suitable for the diagnosis and/or therapy of genetic and epigenetic parameters of genes associated with apoptosis. The present invention is based on the discovery that genetic and epigenetic parameters and, in particular, the cytosine methylation pattern of genes associated with apoptosis are particularly suitable for the diagnosis and/or therapy of diseases associated with apoptosis.
This objective is achieved according to the present invention using a nucleic acid containing a sequence of at least 18 bases in length of the chemically pretreated DNA of genes associated with apoptosis according to one of Seq. ID No.l through Seq. ID No.78 and sequences complementary thereto and/or a sequence of a chemically pretreated DNA of genes according to table 1 and sequences complementary thereto. In the table, after the listed gene designations, the respective data bank numbers (accession numbers) are specified which define the appertaining gene sequences as unique. GenBank was used as the underlying data bank, which is located at the National Institute of Health, internet address www.ncbi.nlm.nih.gov.
The chemically modified nucleic acid could heretofore not be connected with the ascertainment of genetic and epigenetic parameters.
The object of the present invention is further achieved by an oligonucleotide or oligomer for detecting the cytosine methylation state in chemically pretreated DNA, containing at least one base sequence having a length of at least 13 nucleotides which hybridizes to a chemically pretreated DNA of genes associated with apoptosis according to Seq. ID No.l through Seq. ID No.78 and sequences complementary thereto and/or a sequence of a chemically pretreated DNA of genes according to table 1 and sequences complementary thereto. The oligomer probes according to the present invention constitute important and effective tools which, for the first time, make it possible to ascertain the genetic and epigenetic parameters of genes associated with apoptosis. The base sequence of the oligomers preferably contains at least one CpG dinucleotide. The probes may also exist in the form of a PNA (peptide nucleic acid) which has particularly preferred pairing properties. Particularly preferred are ohgonucleotides according to the present invention in which the cytosine of the CpG dinucleotide is the 5th - 9th nucleotide from the 5 '-end of the 13-mer; in the case of PNA-oligomers, it is preferred for the cytosine of the CpG dinucleotide to be the 4th - 6th nucleotide from the 5 '-end of the 9- mer.
The oligomers according to the present invention are normally used in so called "sets" which contain at least one oligomer for each of the CpG dinucleotides of the sequences of Seq. ID No.l through Seq. ID No.78 and sequences complementary thereto and/or a sequence of a chemically pretreated DNA of genes according to table 1 and sequences complementary thereto. Preferred is a set which contains at least one oligomer for each of the CpG dinucleotides from one of Seq. ID No.l through Seq. ID No.78 and sequences complementary thereto and/or a sequence of a chemically pretreated DNA of genes according to table 1 and sequences complementary thereto.
Moreover, the present invention makes available a set of at least two oligonucleotides which can be used as so-called "primer oligonucleotides" for amplifying DNA sequences of one of Seq. ID No.l through Seq. ID No.78 and sequences complementary thereto and/or a sequence of a chemically pretreated DNA of genes according to table 1 and sequences complementary thereto, or segments thereof.
In the case of the sets of oligonucleotides according to the present invention, it is preferred that at least one oligonucleotide is bound to a solid phase.
The present invention moreover relates to a set of at least 10 n (oligonucleotides and/or PNA- oligomers) used for detecting the cytosine methylation state in chemically pretreated genomic DNA (Seq. ID No.l through Seq. ID No.78 and sequences complementary thereto and/or a sequence of a chemically pretreated DNA of genes according to table 1 and sequences complementary thereto). These probes enable diagnosis and/or therapy of genetic and epigenetic parameters of genes associated with apoptosis. The set of oligomers may also be used for detecting single nucleotide polymorphisms (SNPs) in the chemically pretreated DNA of genes associated with apoptosis according to one of Seq. ID No.l through Seq. ID No.78 and sequences complementary thereto and/or a sequence of a chemically pretreated DNA of genes according to table 1 and sequences complementary thereto.
According to the present invention, it is preferred that an arrangement of different oligonucleotides and/or PNA-oligomers (a so-called "array") made available by the present invention is present in a manner that it is likewise bound to a solid phase. This array of different oligo- nucleotide- and/or PNA-oligomer sequences can be characterized in that it is arranged on the solid phase in the form of a rectangular or hexagonal lattice. The solid phase surface is preferably composed of silicon, glass, polystyrene, aluminum, steel, iron, copper, nickel, silver, or gold. However, nitrocellulose as well as plastics such as nylon which can exist in the form of pellets or also as resin matrices are possible as well.
Therefore, a further subject matter of the present invention is a method for manufacturing an array fixed to a carrier material for analysis in connection with diseases associated with apoptosis in which method at least one oligomer according to the present invention is coupled to a solid phase. Methods for manufacturing such arrays are known, for example, from US Patent 5,744,305 by means of solid-phase chemistry and photolabile protecting groups.
A further subject matter of the present invention relates to a DNA chip for the analysis of diseases associated with apoptosis which contains at least one nucleic acid according to the present invention. DNA chips are known, for example, for US Patent 5,837,832.
Moreover, a subject matter of the present invention is a kit which may be composed, for example, of a bisulfite-containing reagent, a set of primer oligonucleotides containing at least two oligonucleotides whose sequences in each case correspond or are complementary to an 18 base long segment of the base sequences specified in the appendix (Seq. ID No.l through Seq. ID No.78 and sequences complementary thereto and/or a sequence of a chemically pretreated DNA of genes according to table 1 and sequences complementary thereto), oligonucleotides and/or PNA-oligomers as well as instructions for carrying out and evaluating the described method. However, a kit along the lines of the present invention can also contain only part of the aforementioned components. The present invention also makes available a method for ascertaining genetic and/or epigenetic parameters of genes associated with the cycle cell by analyzing cytosine methylations and single nucleotide polymorphisms, including the following steps:
In the first step of the method, a genomic DNA sample is chemically treated in such a manner that cytosine bases which are unmethylated at the 5 '-position are converted to uracil, thymine, or another base which is dissimilar to cytosine in terms of hybridization behavior. This will be understood as 'chemical pretreatment' hereinafter.
The genomic DNA to be analyzed is preferably obtained form usual sources of DNA such as cells or cell components, for example, cell lines, biopsies, blood, sputum, stool, urine, cerebral-spinal fluid, tissue embedded in paraffin such as tissue from eyes, intestine, kidney, brain, heart, prostate, lung, breast or liver, histologic object slides, or combinations thereof.
The above described treatment of genomic DNA is preferably carried out with bisulfite (hydrogen sulfite, disulfite) and subsequent alkaline hydrolysis which results in a conversion of non-methylated cytosine nucleobases to uracil or to another base which is dissimilar to cytosine in terms of base pairing behavior.
Fragments of the chemically pretreated DNA are amplified, using sets of primer oligonucleotides according to the present invention, and a, preferably heat-stable polymerase. Because of statistical and practical considerations, preferably more than ten different fragments having a length of 100 - 2000 base pairs are amplified. The amplification of several DNA segments can be carried out simultaneously in one and the same reaction vessel. Usually, the amplification is carried out by means of a polymerase chain reaction (PCR).
In a preferred embodiment of the method, the set of primer oligonucleotides includes at least two olignonucleotides whose sequences are each reverse complementary or identical to an at least 18 base-pair long segment of the base sequences specified in the appendix (Seq. ID No.l through Seq. ID No.78 and sequences complementary thereto and/or a sequence of a chemically pretreated DNA of genes according to table 1 and sequences complementary thereto). The primer oligonucleotides are preferably characterized in that they do not contain any CpG dinucleotides. According to the present invention, it is preferred that at least one primer oligonucleotide is bonded to a solid phase during amplification. The different oligonucleotide and/or PNA- oligomer sequences can be arranged on a plane solid phase in the form of a rectangular or hexagonal lattice, the solid phase surface preferably being composed of silicon, glass, polystyrene, aluminum, steel, iron, copper, nickel, silver, or gold, it being possible for other materials such as nitrocellulose or plastics to be used as well.
The fragments obtained by means of the amplification can carry a directly or indirectly detectable label. Preferred are labels in the form of fluorescence labels, radionuclides, or detachable molecule fragments having a typical mass which can be detected in a mass spectrometer, it being preferred that the fragments that are produced have a single positive or negative net charge for better detectability in the mass spectrometer. The detection may be carried out and visualized by means of matrix assisted laser desorption/ionization mass spectrometry (MALDI) or using electron spray mass spectrometry (ESI).
The amplificates obtained in the second step of the method are subsequently hybridized to an array or a set of oligonucleotides and/or PNA probes. In this context, the hybridization takes place in the manner described in the following. The set of probes used during the hybridization is preferably composed of at least 10 oligonucleotides or PNA-oligomers. In the process, the amplificates serve as probes which hybridize to oligonucleotides previously bonded to a solid phase. The non-hybridized fragments are subsequently removed. Said oligonucleotides contain at least one base sequence having a length of 13 nucleotides which is reverse complementary or identical to a segment of the base sequences specified in the appendix, the segment containing at least one CpG dinucleotide. The cytosine of the CpG dinucleotide is the 5th to 9th nucleotide from the 5 '-end of the 13-mer. One oligonucleotide exists for each CpG dinucleotide. Said PNA-oligomers contain at least one base sequence having a length of 9 nucleotides which is reverse complementary or identical to a segment of the base sequences specified in the appendix, the segment containing at least one CpG dinucleotide. The cytosine of the CpG dinucleotide is the 4th to 6th nucleotide seen from the 5 '-end of the 9-mer. One oligonucleotide exists for each CpG dinucleotide.
In the fourth step of the method, the non-hybridized amplificates are removed. In the final step of the method, the hybridized amplificates are detected. In this context, it is preferred that labels attached to the amplificates are identifiable at each position of the solid phase at which an oligonucleotide sequence is located.
According to the present invention, it is preferred that the labels of the amplificates are fluorescence labels, radionuclides, or detachable molecule fragments having a typical mass which can be detected in a mass spectrometer. The mass spectrometer is preferred for the detection of the amplificates, fragments of the amplificates or of probes which are complementary to the amplificates, it being possible for the detection to be carried out and visualized by means of matrix assisted laser desorption/ionization mass spectrometry (MALDI) or using electron spray mass spectrometry (ESI).
The produced fragments may have a single positive or negative net charge for better detecta- bility in the mass spectrometer. The aforementioned method is preferably used for ascertaining genetic and/or epigenetic parameters of genes associated with apoptosis.
The oligomers according to the present invention or arrays thereof as well as a kit according to the present invention are intended to be used for the diagnosis and or therapy of diseases associated with apoptosis by analyzing methylation patterns of genes associated with apoptosis. According to the present invention, the method is preferably used for the diagnosis and/or therapy of important genetic and/or epigenetic parameters within genes associated with apoptosis.
The method according to the present invention is used, for example, for the diagnosis and/or therapy of HIV infection, Bloom syndrome, cardiopathy,aging, neurodegenerative disorders, Herpes simplex virus infection, renal ischemia, amyotrophic lateral sclerosis, solid tumors and cancers.
The nucleic acids according to the present invention of Seq. ID No.l through Seq. ID No.78 and sequences complementary thereto and/or a sequence of a chemically pretreated DNA of genes according to table 1 and sequences complementary thereto can be used for the diagnosis and/or therapy of genetic and/or epigenetic parameters of genes associated with apoptosis. The present invention moreover relates to a method for manufacturing a diagnostic agent and/or therapeutic agent for the diagnosis and/or therapy of diseases associated with apoptosis by analyzing methylation patterns of genes associated with apoptosis, the diagnostic agent and/or therapeutic agent being characterized in that at least one nucleic acid according to the present invention is used for manufacturing it, possibly together with suitable additives and auxiliary agents.
A further subject matter of the present invention relates to a diagnostic agent and/or therapeutic agent for diseases associated with apoptosis by analyzing methylation patterns of genes associated with apoptosis, the diagnostic agent and/or therapeutic agent containing at least one nucleic acid according to the present invention, possibly together with suitable additives and auxiliary agents.
The present invention moreover relates to the diagnosis and/or prognosis of events which are disadvantageous to patients or individuals in which important genetic and/or epigenetic parameters within genes associated with apoptosis said parameters obtained by means of the present invention may be compared to another set of genetic and/or epigenetic parameters, the differences serving as the basis for a diagnosis and/or prognosis of events which are disadvantageous to patients or individuals.
In the context of the present invention the term "hybridization" is to be understood as a bond of an oligonucleotide to a completely complementary sequence along the lines of the Watson- Crick base pairings in the sample DNA, forming a duplex structure. To be understood by "stringent hybridization conditions" are those conditions in which a hybridization is carried out at 60°C in 2.5 x SSC buffer, followed by several washing steps at 37°C in a low buffer concentration, and remains stable.
The term "functional variants" denotes all DNA sequences which are complementary to a DNA sequence, and which hybridize to the reference sequence under stringent conditions and have an activity similar to the corresponding polypeptide according to the present invention. In the context of the present invention, "genetic parameters" are mutations and polymorphisms of genes associated with apoptosis and sequences further required for their regulation. To be designated as mutations are, in particular, insertions, deletions, point mutations, inversions and polymorphisms and, particularly preferred, SNPs (single nucleotide polymorphisms).
In the context of the present invention, "epigenetic parameters" are, in particular, cytosine methylations and further chemical modifications of DNA bases of genes associated with apoptosis and sequences further required for their regulation. Further epigenetic parameters include, for example, the acetylation of histones which, however, cannot be directly analyzed using the described method but which, in turn, correlates with the DNA methylation.
In the following, the present invention will be explained in greater detail on the basis of the sequences and examples with reference to the accompanying figure without being limited thereto.
Figure 1
Figure 1 shows the hybridisation of fluorescent labelled amplificates to a surface bound olignonucleotide. Sample I being from healthy tissue and sample II being from pilocytic as- trocytoma (tumor) tissue. Flourescence at a spot shows hybridisation of the amplificate to the olignonucleotide. Hybridisation to a CG olignonucleotide denotes methylation at the cytosine position being analysed, hybridisation to a TG olignonucleotide denotes no methylation at the cytosine position being analysed.
Sequence ID Nos. 1 to 74
Sequences having odd sequence numbers (e.g., Seq. ID No. 1, 3, 5, ...) exhibit in each case sequences of the chemically pretreated genomic DNAs of different genes associated with apoptosis. Sequences having even sequence numbers (e.g., Seq. ID No. 2, 4, 6, ...) exhibit in each case the sequences of the chemically pretreated genomic DNAs of genes associated with apoptosis which are complementary to the preceeding sequences (e.g., the complementary sequence to Seq. ID No.l is Seq. ID No.2, the complementary sequence to Seq. ID No.3 is Seq. ID No.4, etc.) Sequence ID Nos. 75 to 78
Sequence ID Nos. 75 to 78 show the sequences of oligonucleotides used in Example 1.
The following example relates to a fragment of a gene associated with apoptosis, in this case, death-associated protein 1 (DAPK1) in which a specific CG-position is analyzed for its methylation status.
Example 1: Methylation analysis in the gene DAPK1 associated with apoptosis.
The following example relates to a fragment of the gene DAPK1 in which a specific CG- position is to be analyzed for methylation.
In the first step, a genomic sequence is treated using bisulfite (hydrogen sulfite, disulfite) in such a manner that all cytosines which are not methylated at the 5-position of the base are modified in such a manner that a different base is substituted with regard to the base pairing behavior while the cytosines methylated at the 5-position remain unchanged.
If bisulfite solution is used for the reaction, then an addition takes place at the non-methylated cytosine bases. Moreover, a denaturating reagent or solvent as well as a radical interceptor must be present. A subsequent alkaline hydrolysis then gives rise to the conversion of non- methylated cytosine nucleobases to uracil. The chemically converted DNA (sequence ID Nos. 73 and 74) is then used for the detection of methylated cytosines. In the second method step, the treated DNA sample is diluted with water or an aqueous solution. Preferably, the DNA is subsequently desulfonated (10-30 min, 90-100 °C) at an alkaline pH value. In the third step of the method, the DNA sample is amplified in a polymerase chain reaction, preferably using a heat-resistant DNA polymerase. In the present case, cytosines of the gene DAPK1 are analyzed. To this end, a defined fragment having a length of 465 bp is amplified with the specific primer oligonucleotides ATTAATATTATGTAAAGTGA (Sequence ID No. 75) and CTTACAACCATTCACCCACA (Sequence ID No. 76). This amplificate serves as a sample which hybridizes to an oligonucleotide previously bonded to a solid phase, forming a duplex structure, for example GTTATATCGTGGAGGATA (Sequence ID No. 77), the cytosine to be detected being located at position 135 of the amplificate. The detection of the hybridization product is based on Cy3 and Cy5 flourescently labeled primer oligonucleotides which have been used for the amplification. A hybridization reaction of the amplified DNA with the oli- gonucleotide takes place only if a methylated cytosine was present at this location in the bi- sulfite-treated DNA. Thus, the methylation status of the specific cytosine to be analyzed is inferred from the hybridization product.
In order to verify the methylation status of the position, a sample of the amplificate is further hybridized to another oligonucleotide previously bonded to a solid phase. Said olignonucleotide is identical to the oligonucleotide previously used to analyze the methylation status of the sample, with the exception of the position in question. At the position to be analysed said oligonucleotide comprises a thymine base as opposed to a cytosine base i.e GTTATATTGTGGAGGATA (Sequence ID No. 78). Therefore, the hybridisation reaction only takes place if an unmethylated cytosine was present at the position to be analysed. The procedure was carried out on cell samples from 2 patients, sample I being from normal healthy tissue and sample II being from a pilocytic astrocytoma tumor sample.
From the results (see Figure 1) it can be seen that the sample I contained a mixture of both methylated and unmethylated cells at position of the amplificate whereas sample II contained only methylated cells at position 135 of the amplificate.
Example 2: Diagnosis of diseases associated with apoptosis
In order to relate the methylation patterns to one of the diseases associated with apoptosis, it is initially required to analyze the DNA methylation patterns of a group of diseased and of a group of healthy patients. These analyses are carried out, for example, analogously to Example 1. The results obtained in this manner are stored in a database and the CpG dinucleotides which are methylated differently between the two groups are identified. This can be carried out by determining individual CpG methylation rates as can be done, for example, in a relatively imprecise manner, by sequencing or else, in a very precise manner, by a methylation- sensitive "primer extension reaction". It is also possible for the entire methylation status to be analyzed simultaneously, and for the patterns to be compared, for example, by clustering analyses which can be carried out, for example, by a computer.
Subsequently, it is possible to allocate the examined patients to a specific therapy group and to treat these patients selectively with an individualized therapy. Example 2 can be carried out, for example, for the following diseases: HIV infection, Bloom syndrome, cardiopathy,aging, neurodegenerative disorders, Herpes simplex virus infection, renal ischemia, amyotrophic lateral sclerosis, solid tumors and cancers.
Figure imgf000018_0001

Claims

Claims
1. A nucleic acid comprising a sequence at least 18 bases in length of a segment of the chemically pretreated DNA of genes associated with apoptosis according to one of the sequences taken from the group comprising Seq. ID No.l to Seq. ID No.74 and sequences complementary thereto.
2. A nucleic acid comprising a sequence at least 18 base pairs in length of a segment of the chemically pretreated DNA of genes associated with apoptosis according to one of the sequences according to one of the genes TNFRSF6 (NM_000043), BCL2 (NM_000633), BCL2L1 (NM 001191), BCL2L2 (NM_004050), BNIP3 (NM_004052), CASP3 (NM_004346), CASP7 (NM_001227), PDCD1 (NM_005018), SFRP5 (NM_003015), STK17A (NM_004760), REQ (NM_006268) and sequences complementary thereto.
3. An oligomer, in particular an oligonucleotide or peptide nucleic acid (PNA)-oligomer, said oligomer comprising in each case at least one base sequence having a length of at least 9 nucleotides which hybridizes to or is identical to a chemically pretreated DNA of genes associated with apoptosis according to one of the Seq ID Nos 1 to 74 according to claim 1 or to a chemically pretreated DNA of genes according to claim 2 and sequences complementary thereto.
4. The oligomer as recited in Claim 3; wherein the base sequence includes at least one CpG dinucleotide.
5. The oligomer as recited in Claim 3;characterized in that the cytosine of the CpG dinucleotide is located approximately in the middle third of the oligomer.
6. A set of oligomers, comprising at least two oligomers according to any of claims 3 to 5.
7. A set of oligomers as recited in Claim 6, comprising oligomers for detecting the methylation state of all CpG dinucleotides within one of the sequences according to Seq. ID Nos. 1 through 74 according to claim 1 or a chemically pretreated DNA of genes according to claim 2, and sequences complementary thereto.
8. A set of at least two oligonucleotides as recited in Claim 3, which can be used as primer oligonucleotides for the amplification of DNA sequences of one of Seq. ID 1 through Seq. ID 74 and sequences complementary thereto and/or sequences of a chemically pretreated DNA of genes according to claim 2, and sequences complementary thereto and segments thereof.
9. A set of oligonucleotides as recited in Claim 8, characterized in that at least one oligonucleotide is bound to a solid phase.
10. Use of a set of oligomer probes comprising at least ten of the oligomers according to any of claims 6 through 9 for detecting the cytosine methylation state and/or single nucleotide polymorphisms (SNPs) in a chemically pretreated genomic DNA according to claim 1 or a chemically pretreated DNA of genes according to claim 2.
11. A method for manufacturing an arrangement of different oligomers (array) fixed to a carrier material for analyzing diseases associated with the methylation state of the CpG dinu- cleotides of one of the Seq. ID 1 through Seq. ID 74 and sequences complementary thereto and/or chemically pretreated DNA of genes according to claim 2, wherein at least one oligomer according to any of the claims 3 through 5 is coupled to a solid phase.
12. An arrangement of different oligomers (array) obtainable according to claim 11.
13. An array of different oligonucleotide- and/or PNA-oligomer sequences as recited in Claim 12, characterized in that these are arranged on a plane solid phase in the form of a rectangular or hexagonal lattice.
14. The array as recited in any of the Claims 12 or 13, characterized in that the solid phase surface is composed of silicon, glass, polystyrene, aluminum, steel, iron, copper, nickel, silver, or gold.
15. A DNA- and/or PNA-array for analyzing diseases associated with the methylation state of genes, comprising at least one nucleic acid according to one of the preceding claims.
16. A method for ascertaining genetic and/or epigenetic parameters for the diagnosis and/or therapy of existing diseases or the predisposition to specific diseases by analyzing cytosine methylations, characterized in that the following steps are carried out:
a) in a genomic DNA sample, cytosine bases which are unmethylated at the 5-position are converted, by chemical treatment, to uracil or another base which is dissimilar to cytosine in terms of hybridization behavior;
b) fragments of the chemically pretreated genomic DNA are amplified using sets of primer oligonucleotides according to Claim 8 or 9 and a polymerase, the amplificates carrying a detectable label;
c) Amplificates are hybridized to a set of oligonucleotides and/or PNA probes according to the Claims 6 and 7, or else to an array according to one of the Claims 12 through 15;
d) the hybridized amplificates are subsequently detected.
17. The method as recited in Claim 16, characterized in that the chemical treatment is carried out by means of a solution of a bisulfite, hydrogen sulfite or disulfite.
18. The method as recited in one of the Claims 16 or 17, characterized in that more than ten different fragments having a length of 100 - 2000 base pairs are amplified.
19. The method as recited in one of the Claims 16 through 18, characterized in that the amplification of several DNA segments is carried out in one reaction vessel.
20. The method as recited in one of the Claims 16 through 19, characterized in that the polymerase is a heat-resistant DNA polymerase.
21. The method as recited in Claim 20, characterized in that the amplification is carried out by means of the polymerase chain reaction (PCR).
22. The method as recited in one of the Claims 16 through 21, characterized in that the labels of the amplificates are fluorescence labels.
23. The method as recited in one of the Claims 16 through 21, characterized in that the labels of the amplificates are radionuclides.
24. The method as recited in one of the Claims 16 through 21, characterized in that the labels of the amplificates are detachable molecule fragments having a typical mass which are detected in a mass spectrometer.
25. The method as recited in one of the Claims 16 through 21, characterized in that the amplificates or fragments of the amplificates are detected in the mass spectrometer.
26. The method as recited in one of the Claims 24 and/or 25, characterized in that the produced fragments have a single positive or negative net charge for better detectability in the mass spectrometer
27. The method as recited in one of the Claims 24 through 26, characterized in that detection is carried out and visualized by means of matrix assisted laser desorption ionization mass spectrometry (MALDI) or using electron spray mass spectrometry (ESI).
28. The method as recited in one of the Claims 16 through 27, characterized in that the genomic DNA is obtained from cells or cellular components which contain DNA, sources of DNA comprising, for example, cell lines, biopsies, blood, sputum, stool, urine, cerebral-spinal fluid, tissue embedded in paraffin such as tissue from eyes, intestine, kidney, brain, heart, prostate, lung, breast or liver, histologic object slides, and all possible combinations thereof.
29. A kit comprising a bisulfite (= disulfite, hydrogen sulfite) reagent as well as oligonucleotides and/or PNA-oligomers according to one of the Claims 3 through 5.
30. The use of a nucleic acid according to Claims 1 or 2, of an oligonucleotide or PNA- oligomer according to one of the Claims 3 through 5, of a kit according to Claim 29, of an array according to one of the Claims 12 through 15, of a set of oligonucleotides according to one of claims 6 through 9 for the diagnosis of HTV infection, Bloom syndrome, cardiopa- thy,aging, neurodegenerative disorders, Herpes simplex virus infection, renal ischemia, amyotrophic lateral sclerosis, solid tumors and cancers.
31. The use of a nucleic acid according to Claims 1 or 2, of an oligonucleotide or PNA- oligomer according to one of Claims 3 through 5, of a kit according to Claim 29, of an array according to one of the Claims 12 through 15, of a set of oligonucleotides according to one of calims 6 through 9 for the therapy of HIV infection, Bloom syndrome, cardiopathy, aging, neurodegenerative disorders, Herpes simplex virus infection, renal ischemia, amyotrophic lateral sclerosis, solid tumors and cancers.
32. A kit, comprising a bisulfite (= disulfite, hydrogen sulfite) reagent as well as oligonucleotides and/or PNA-oligomers according to one of claims 3 through 5.
PCT/EP2001/003969 2000-04-06 2001-04-06 Diagnosis of diseases associated with apoptosis by means of assessing the methylation status of genes associated with apoptosis WO2001077164A2 (en)

Priority Applications (5)

Application Number Priority Date Filing Date Title
EP01953936A EP1274865B1 (en) 2000-04-06 2001-04-06 Diagnosis of diseases associated with apoptosis by means of assessing the methylation status of genes associated with apoptosis
JP2001575634A JP2003531589A (en) 2000-04-06 2001-04-06 Diagnosis of diseases associated with apoptosis
DE60126593T DE60126593T2 (en) 2000-04-06 2001-04-06 DIAGNOSIS OF DISEASES ASSOCIATED WITH APOPTOSIS BY MEANS OF DETERMINATION OF THE METHYLATION STATE OF APOPTOSIS-ASSOCIATED GENES
AU2001276330A AU2001276330B2 (en) 2000-04-06 2001-04-06 Diagnosis of diseases associated with apoptosis
AU7633001A AU7633001A (en) 2000-04-06 2001-04-06 Diagnosis of diseases associated with apoptosis

Applications Claiming Priority (8)

Application Number Priority Date Filing Date Title
DE10019058A DE10019058A1 (en) 2000-04-06 2000-04-06 Designing primers and probes for analyzing diseases associated with cytosine methylation state e.g. arthritis, cancer, aging, arteriosclerosis comprising fragments of chemically modified genes associated with cell cycle
DE10019058.8 2000-04-06
DE10019173 2000-04-07
DE10019173.8 2000-04-07
DE10032529.7 2000-06-30
DE10032529A DE10032529A1 (en) 2000-06-30 2000-06-30 Diagnosis of major genetic parameters within the Major Histocompatibility Complex (MHC)
DE10043826.1 2000-09-01
DE10043826 2000-09-01

Publications (3)

Publication Number Publication Date
WO2001077164A2 true WO2001077164A2 (en) 2001-10-18
WO2001077164A8 WO2001077164A8 (en) 2002-03-21
WO2001077164A3 WO2001077164A3 (en) 2002-06-20

Family

ID=27437807

Family Applications (8)

Application Number Title Priority Date Filing Date
PCT/EP2001/003970 WO2001077376A2 (en) 2000-04-06 2001-04-06 Diagnosis of diseases associated with metastasis
PCT/EP2001/003969 WO2001077164A2 (en) 2000-04-06 2001-04-06 Diagnosis of diseases associated with apoptosis by means of assessing the methylation status of genes associated with apoptosis
PCT/EP2001/003971 WO2001077377A2 (en) 2000-04-06 2001-04-06 Diagnosis of diseases associated with dna replication by assessing dna methylation
PCT/EP2001/004016 WO2001076451A2 (en) 2000-04-06 2001-04-06 Diagnosis of diseases associated with metabolism
PCT/EP2001/003972 WO2001081622A2 (en) 2000-04-06 2001-04-06 Diagnosis of diseases associated with dna repair
PCT/EP2001/003968 WO2001077375A2 (en) 2000-04-06 2001-04-06 Diagnosis of diseases associated with gene regulation
PCT/EP2001/004015 WO2001077378A2 (en) 2000-04-06 2001-04-06 Diagnosis of diseases associated with dna adducts
PCT/EP2001/003973 WO2001092565A2 (en) 2000-04-06 2001-04-06 Diagnosis of diseases associated dna transcription by means of assessing the methylation status of genes associated with dna transcription

Family Applications Before (1)

Application Number Title Priority Date Filing Date
PCT/EP2001/003970 WO2001077376A2 (en) 2000-04-06 2001-04-06 Diagnosis of diseases associated with metastasis

Family Applications After (6)

Application Number Title Priority Date Filing Date
PCT/EP2001/003971 WO2001077377A2 (en) 2000-04-06 2001-04-06 Diagnosis of diseases associated with dna replication by assessing dna methylation
PCT/EP2001/004016 WO2001076451A2 (en) 2000-04-06 2001-04-06 Diagnosis of diseases associated with metabolism
PCT/EP2001/003972 WO2001081622A2 (en) 2000-04-06 2001-04-06 Diagnosis of diseases associated with dna repair
PCT/EP2001/003968 WO2001077375A2 (en) 2000-04-06 2001-04-06 Diagnosis of diseases associated with gene regulation
PCT/EP2001/004015 WO2001077378A2 (en) 2000-04-06 2001-04-06 Diagnosis of diseases associated with dna adducts
PCT/EP2001/003973 WO2001092565A2 (en) 2000-04-06 2001-04-06 Diagnosis of diseases associated dna transcription by means of assessing the methylation status of genes associated with dna transcription

Country Status (7)

Country Link
US (7) US20040067491A1 (en)
EP (9) EP1370685A2 (en)
JP (3) JP2004508807A (en)
AT (1) ATE353975T1 (en)
AU (9) AU2001276331A1 (en)
DE (1) DE60126593T2 (en)
WO (8) WO2001077376A2 (en)

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US7195870B2 (en) 2000-04-06 2007-03-27 Epigenomics Ag Diagnosis of diseases associated with gene regulation
US7381808B2 (en) 2001-06-14 2008-06-03 Epigenomics Ag Method and nucleic acids for the differentiation of prostate tumors
EP2519260A2 (en) * 2009-12-31 2012-11-07 Deutsches Krebsforschungszentrum Novel modulators of trail signalling

Families Citing this family (76)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6780982B2 (en) * 1996-07-12 2004-08-24 Third Wave Technologies, Inc. Charge tags and the separation of nucleic acid molecules
US6818404B2 (en) 1997-10-23 2004-11-16 Exact Sciences Corporation Methods for detecting hypermethylated nucleic acid in heterogeneous biological samples
US8076063B2 (en) 2000-02-07 2011-12-13 Illumina, Inc. Multiplexed methylation detection methods
US7582420B2 (en) 2001-07-12 2009-09-01 Illumina, Inc. Multiplex nucleic acid reactions
US7955794B2 (en) 2000-09-21 2011-06-07 Illumina, Inc. Multiplex nucleic acid reactions
EP1292331A2 (en) * 2000-06-07 2003-03-19 Biosynexus Incorporated Immunostimulatory rna/dna hybrid molecules
AU2001289617A1 (en) * 2000-06-30 2002-01-08 Epigenomics Ag Diagnosis of diseases associated with signal transduction
AUPR142500A0 (en) * 2000-11-13 2000-12-07 Human Genetic Signatures Pty Ltd A peptide nucleic acid-based assay for the detection of specific nucleic acid sequences
AU2002342004A1 (en) 2001-10-05 2003-04-22 Case Western Reserve University Methods and compositions for detecting colon cancers
JP2003144172A (en) * 2001-11-16 2003-05-20 Nisshinbo Ind Inc Oligonucleotide-immobilized board for detecting methylation
US20110151438A9 (en) 2001-11-19 2011-06-23 Affymetrix, Inc. Methods of Analysis of Methylation
DE10161625A1 (en) * 2001-12-14 2003-07-10 Epigenomics Ag Methods and nucleic acids for the analysis of a pulmonary cell division disorder
JP2005518822A (en) * 2002-03-07 2005-06-30 ザ ジョンズ ホプキンス ユニバーシティー スクール オブ メディシン Genome screening of epigenetic silenced cancer-related genes
EP1344832A1 (en) * 2002-03-15 2003-09-17 Epigenomics AG Methods and nucleic acids for the analysis of methylation within the gene melastatin
WO2003083107A1 (en) * 2002-03-25 2003-10-09 The Board Of Trustees Of The University Of Arkansas Cpg retrieval of dna from formalin-fixed pathology specimen for promoter methylation analysis
US7807803B2 (en) 2002-07-03 2010-10-05 Coley Pharmaceutical Group, Inc. Nucleic acid compositions for stimulating immune responses
US20040053880A1 (en) 2002-07-03 2004-03-18 Coley Pharmaceutical Group, Inc. Nucleic acid compositions for stimulating immune responses
SG167667A1 (en) * 2002-07-03 2011-01-28 Coley Pharm Group Inc Nucleic acid compositions for stimulating immune responses
CA2500255A1 (en) 2002-10-01 2004-04-29 Epigenomics Ag Method and nucleic acids for the treatment of breast cell proliferative disorders
ATE462017T1 (en) * 2002-12-02 2010-04-15 Illumina Cambridge Ltd DETERMINATION OF METHYLATION OF NUCLEIC ACID SEQUENCES
DE10304219B3 (en) * 2003-01-30 2004-08-19 Epigenomics Ag Method for the detection of cytosine methylation patterns with high sensitivity
US20050266409A1 (en) * 2003-02-04 2005-12-01 Wyeth Compositions and methods for diagnosing, preventing, and treating cancers
US20050009059A1 (en) * 2003-05-07 2005-01-13 Affymetrix, Inc. Analysis of methylation status using oligonucleotide arrays
US7799525B2 (en) 2003-06-17 2010-09-21 Human Genetic Signatures Pty Ltd. Methods for genome amplification
US8415100B2 (en) 2003-08-14 2013-04-09 Case Western Reserve University Methods and compositions for detecting gastrointestinal and other cancers
EP1660683B1 (en) * 2003-08-14 2017-04-19 Case Western Reserve University Methods and compositions for detecting colon cancers
DE10338308B4 (en) 2003-08-15 2006-10-19 Epigenomics Ag Method for the detection of cytosine methylations in DNA
WO2005024053A1 (en) 2003-09-04 2005-03-17 Human Genetic Signatures Pty Ltd Nucleic acid detection assay
AU2004281299B2 (en) * 2003-10-20 2010-11-18 St Vincent's Hospital Sydney Limited Assessment of disease risk by quantitative determination of epimutation in normal tissues
AU2004295712B2 (en) * 2003-12-01 2011-05-19 Epigenomics Ag Methods and nucleic acids for the analysis of gene expression associated with the development of prostate cell proliferative disorders
EP1561821B1 (en) 2003-12-11 2011-02-16 Epigenomics AG Prognostic markers for prediction of treatment response and/or survival of breast cell proliferative disorder patients
CA2496997A1 (en) * 2004-02-13 2005-08-13 Affymetrix, Inc. Analysis of methylation status using nucleic acid arrays
US8168777B2 (en) 2004-04-29 2012-05-01 Human Genetic Signatures Pty. Ltd. Bisulphite reagent treatment of nucleic acid
WO2006026828A1 (en) 2004-09-10 2006-03-16 Human Genetic Signatures Pty Ltd Amplification blocker comprising intercalating nucleic acids (tna) containing intercalating pseudonucleotides (ipn)
KR20060026595A (en) 2004-09-21 2006-03-24 (주)지노믹트리 Method for detecting methylaion of promoter using restriction enzyme and dna chip
KR100617649B1 (en) * 2004-09-24 2006-09-04 (주)지노믹트리 Composition For Cancer diagnosis Containing Methylated Promoters of Colon Cancer Specific Expression-decreased Genes and Use Thereof
NZ555620A (en) 2004-12-03 2008-08-29 Human Genetic Signatures Pty Methods for simplifying microbial nucleic acids by chemical modification of cytosines
US20060134650A1 (en) * 2004-12-21 2006-06-22 Illumina, Inc. Methylation-sensitive restriction enzyme endonuclease method of whole genome methylation analysis
WO2006088978A1 (en) 2005-02-16 2006-08-24 Epigenomics, Inc. Method for determining the methylation pattern of a polynucleic acid
DK1871912T3 (en) 2005-04-15 2012-05-14 Epigenomics Ag Method for determining DNA methylation in blood or urine samples
WO2006111586A2 (en) * 2005-04-20 2006-10-26 Proyecto De Biomedicina Cima, S.L. Method for the in vitro determination of the degree of methylation of the line-1 promoter
AU2006251866B2 (en) 2005-05-26 2007-11-29 Human Genetic Signatures Pty Ltd Isothermal strand displacement amplification using primers containing a non-regular base
US20060292585A1 (en) * 2005-06-24 2006-12-28 Affymetrix, Inc. Analysis of methylation using nucleic acid arrays
US8343738B2 (en) 2005-09-14 2013-01-01 Human Genetic Signatures Pty. Ltd. Assay for screening for potential cervical cancer
BRPI0706511A2 (en) 2006-01-11 2011-03-29 Genomic Health Inc gene expression markers for colorectal cancer prognosis
US7465544B2 (en) * 2006-01-11 2008-12-16 Wisconsin Alumni Research Foundation Synthetic cofactor analogs of S-adenosylmethionine as ligatable probes of biological methylation and methods for their use
US20070243161A1 (en) * 2006-02-28 2007-10-18 Sven Olek Epigenetic modification of the loci for CAMTA1 and/or FOXP3 as a marker for cancer treatment
US7901882B2 (en) 2006-03-31 2011-03-08 Affymetrix, Inc. Analysis of methylation using nucleic acid arrays
US20090104615A1 (en) * 2006-05-02 2009-04-23 Keith Malcolm Godfrey Phenotype prediction
US8084734B2 (en) * 2006-05-26 2011-12-27 The George Washington University Laser desorption ionization and peptide sequencing on laser induced silicon microcolumn arrays
WO2008096146A1 (en) 2007-02-07 2008-08-14 Solexa Limited Preparation of templates for methylation analysis
EP2215257A4 (en) * 2007-10-23 2010-12-01 Clinical Genomics Pty Ltd A method of diagnosing neoplasms - ii
EP2215250B1 (en) 2007-11-27 2013-02-27 Human Genetic Signatures Pty Ltd Enzymes for amplification and copying bisulphite modified nucleic acids
US9670546B2 (en) 2008-07-15 2017-06-06 Epigenomics Ag Methods and nucleic acids for analyses of cell proliferative disorders
WO2010048337A2 (en) 2008-10-22 2010-04-29 Illumina, Inc. Preservation of information related to genomic dna methylation
US8110796B2 (en) 2009-01-17 2012-02-07 The George Washington University Nanophotonic production, modulation and switching of ions by silicon microcolumn arrays
US9490113B2 (en) * 2009-04-07 2016-11-08 The George Washington University Tailored nanopost arrays (NAPA) for laser desorption ionization in mass spectrometry
WO2010127322A1 (en) 2009-05-01 2010-11-04 Genomic Health Inc. Gene expression profile algorithm and test for likelihood of recurrence of colorectal cancer and response to chemotherapy
WO2011025852A1 (en) 2009-08-28 2011-03-03 Cellular Dynamics International, Inc. Identifying genetic variation in affected tissues
US10519505B2 (en) 2011-04-28 2019-12-31 Harry Ostrer Genomic signatures of metastasis in prostate cancer
WO2012162139A1 (en) 2011-05-20 2012-11-29 The Regents Of The University Of California Method to estimate age of individual based on epigenetic markers in biological sample
CN103874766B (en) 2011-09-07 2017-07-18 人类遗传标记控股有限公司 Molecular Detection is determined
JP6056092B2 (en) * 2012-02-29 2017-01-11 シスメックス株式会社 Method for determining the presence or absence of cancer cells derived from hepatocellular carcinoma, marker for determination and kit
US9732390B2 (en) 2012-09-20 2017-08-15 The Chinese University Of Hong Kong Non-invasive determination of methylome of fetus or tumor from plasma
US10706957B2 (en) 2012-09-20 2020-07-07 The Chinese University Of Hong Kong Non-invasive determination of methylome of tumor from plasma
KR101302173B1 (en) 2012-12-07 2013-08-30 이화여자대학교 산학협력단 Composition for diagnosing alzheimer's disease using methylation status of hmox1 gene and method for diagnosing alzheimer's disease using the same
US20140274757A1 (en) 2013-03-14 2014-09-18 Marie K. Kirby Differential Methylation Level of CpG Loci That Are Determinative of a Biochemical Reoccurrence of Prostate Cancer
SG11201608403TA (en) * 2014-04-28 2016-11-29 Sigma Aldrich Co Llc Epigenetic modification of mammalian genomes using targeted endonucleases
US20220049305A1 (en) * 2018-09-14 2022-02-17 Gen Shinozaki Systems and methods for detection of delirium risk using epigenetic markers
CN111217900A (en) * 2018-11-27 2020-06-02 上海交通大学 Transcription regulation factor for angiogenesis and application thereof
JP7320067B2 (en) 2019-01-18 2023-08-02 ザ リージェンツ オブ ザ ユニバーシティ オブ カリフォルニア DNA methylation measurements for mammals based on conserved loci
US20240110244A1 (en) 2019-10-14 2024-04-04 Gencurix Inc. Composition for diagnosing liver cancer by using cpg methylation changes in specific genes, and use thereof
KR102637032B1 (en) 2020-01-28 2024-02-15 주식회사 젠큐릭스 Composition for diagnosing bladder cancer using CpG methylation status of specific gene and uses thereof
WO2021206467A1 (en) 2020-04-08 2021-10-14 주식회사 젠큐릭스 Composition for diagnosing colorectal cancer, rectal cancer, or colorectal adenoma using cpg methylation change of glrb gene, and use thereof
CN111500702B (en) * 2020-04-26 2021-04-20 江苏大学附属医院 Application of cg00843506 site methylation of RPN1 gene in diagnosing asthma
WO2023175019A1 (en) 2022-03-15 2023-09-21 Genknowme S.A. Method determining the difference between the biological age and the chronological age of a subject

Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5744305A (en) * 1989-06-07 1998-04-28 Affymetrix, Inc. Arrays of materials attached to a substrate
WO1999028498A2 (en) * 1997-11-27 1999-06-10 Epigenomics Gmbh Method for producing complex dna methylation fingerprints
WO1999029898A2 (en) * 1997-12-05 1999-06-17 MAX-PLANCK-Gesellschaft zur Förderung der Wissenschaften e.V. Method for identifying nucleic acids by means of matrix-assisted laser desorption/ionisation mass spectrometry
WO2001068912A2 (en) * 2000-03-15 2001-09-20 Epigenomics Ag Diagnosis of diseases associated with tumor suppressor genes and oncogenes
WO2001077376A2 (en) * 2000-04-06 2001-10-18 Epigenomics Ag Diagnosis of diseases associated with metastasis

Family Cites Families (22)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5474796A (en) * 1991-09-04 1995-12-12 Protogene Laboratories, Inc. Method and apparatus for conducting an array of chemical reactions on a support surface
SE501439C2 (en) 1993-06-22 1995-02-13 Pharmacia Lkb Biotech Method and apparatus for analyzing polynucleotide sequences
US5837832A (en) 1993-06-25 1998-11-17 Affymetrix, Inc. Arrays of nucleic acid probes on biological chips
JPH09507121A (en) * 1993-10-26 1997-07-22 アフィマックス テクノロジーズ ナームロゼ ベノートスハップ Nucleic acid probe array on biological chip
US6184211B1 (en) 1993-11-30 2001-02-06 Methylgene Inc. Inhibition of DNA methyltransferase
US5858661A (en) * 1995-05-16 1999-01-12 Ramot-University Authority For Applied Research And Industrial Development Ataxia-telangiectasia gene and its genomic organization
US5871917A (en) 1996-05-31 1999-02-16 North Shore University Hospital Research Corp. Identification of differentially methylated and mutated nucleic acids
US6017704A (en) 1996-06-03 2000-01-25 The Johns Hopkins University School Of Medicine Method of detection of methylated nucleic acid using agents which modify unmethylated cytosine and distinguishing modified methylated and non-methylated nucleic acids
US6251594B1 (en) * 1997-06-09 2001-06-26 Usc/Norris Comprehensive Cancer Ctr. Cancer diagnostic method based upon DNA methylation differences
DE19750172C1 (en) * 1997-11-12 1998-10-01 Deutsches Krebsforsch DNA with promoter activity
AU5128999A (en) * 1998-07-24 2000-02-14 Yeda Research And Development Co. Ltd. Prevention of metastasis with 5-aza-2'-deoxycytidine
DE19905082C1 (en) * 1999-01-29 2000-05-18 Epigenomics Gmbh Identification of methylation patterns of cytosine in genome DNA comprises chemical treatment to produce different base pairing behavior between cytosine and 5-methylcytosine
US6331393B1 (en) * 1999-05-14 2001-12-18 University Of Southern California Process for high-throughput DNA methylation analysis
US6783933B1 (en) * 1999-09-15 2004-08-31 The Johns Hopkins University School Of Medicine CACNA1G polynucleotide, polypeptide and methods of use therefor
US7332275B2 (en) * 1999-10-13 2008-02-19 Sequenom, Inc. Methods for detecting methylated nucleotides
AU2001289617A1 (en) 2000-06-30 2002-01-08 Epigenomics Ag Diagnosis of diseases associated with signal transduction
DE10037769A1 (en) 2000-08-03 2002-02-21 Epigenomics Gmbh Diagnosis of diseases associated with CD24
US6812339B1 (en) * 2000-09-08 2004-11-02 Applera Corporation Polymorphisms in known genes associated with human disease, methods of detection and uses thereof
DE10054974A1 (en) 2000-11-06 2002-06-06 Epigenomics Ag Diagnosis of diseases associated with Cdk4
DE10054972A1 (en) 2000-11-06 2002-06-06 Epigenomics Ag Diagnosis of diseases associated with humus
DE10128508A1 (en) * 2001-06-14 2003-02-06 Epigenomics Ag Methods and nucleic acids for the differentiation of prostate tumors
EP1502222A2 (en) * 2001-07-02 2005-02-02 Epigenomics AG A distributed system for epigenetic based prediction of complex phenotypes

Patent Citations (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5744305A (en) * 1989-06-07 1998-04-28 Affymetrix, Inc. Arrays of materials attached to a substrate
WO1999028498A2 (en) * 1997-11-27 1999-06-10 Epigenomics Gmbh Method for producing complex dna methylation fingerprints
WO1999029898A2 (en) * 1997-12-05 1999-06-17 MAX-PLANCK-Gesellschaft zur Förderung der Wissenschaften e.V. Method for identifying nucleic acids by means of matrix-assisted laser desorption/ionisation mass spectrometry
WO2001068912A2 (en) * 2000-03-15 2001-09-20 Epigenomics Ag Diagnosis of diseases associated with tumor suppressor genes and oncogenes
WO2001068911A2 (en) * 2000-03-15 2001-09-20 Epigenomics Ag Diagnosis of diseases associated with the cell cycle
WO2001077376A2 (en) * 2000-04-06 2001-10-18 Epigenomics Ag Diagnosis of diseases associated with metastasis

Non-Patent Citations (6)

* Cited by examiner, † Cited by third party
Title
ALLAN LA ET AL.: "The p21WAFi1/CIP1 promoter is methylated in Rat- cells: stable restoration of p53-dependent p21WAF1/CIP1 expression after transfection of a genomic clone containing the p21WAF1/CIP1 gene." MOLECULAR AND CELLULAR BIOLOGY, vol. 20, no. 4, February 2000 (2000-02), pages 1291-1298, XP001026537 *
DATABASE EMBL [Online] EBI; 11 December 1993 (1993-12-11) DEISS LP ET AL.: "DAP-kinase" retrieved from HTTP://WWW.EBI.AC.UK/CGI-BIN/EMBLFETCH Database accession no. X76104 XP002187216 -& DEISS LP ET AL: "Identification of a novel serine/threonine kinase and a novel 15-kD protein as potential mediators of the gamma interferon-induced cell death." GENES & DEVELOPMENT, vol. 9, 1995, pages 15-30, XP002102392 *
DATABASE GENBANK [Online] NCBI; 6 March 1995 (1995-03-06) ITHO N ET AL: "Human Fas antigen (fas) mRNA, complete cds" retrieved from HTTP://WWW.NCBI.NLM.NIH.GOV/ Database accession no. M67454 XP002187215 & ITHO N ET AL.: "The polypetide encoded by the cDNA for human cell surface antigen FAS can mediate apoptosis." CELL, vol. 66, no. 2, 1991, pages 233-243, *
KATZENELLENBOGEN RA ET AL.: "Hypermethylation of the DAP-Kinase CpG island is a common alteration in B-cell malignancies." NEOPLASIA, vol. 93, no. 12, June 1999 (1999-06), pages 4347-4353, XP002187214 *
SALVATORE P ET AL.: "High resolution analysis of the galectin-1 gene promoter region in expressing and nonexpressing tissues." FEBS LETTERS, vol. 421, no. 2, 1998, pages 152-158, XP004261737 *
UEKI T ET AL.: "Hypermethylation of multiple genes in pancreatic adenocarcinoma." CANCER RESAERCH, vol. 60, no. 7, 1 April 2000 (2000-04-01), pages 1835-1839, XP001026187 *

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US7195870B2 (en) 2000-04-06 2007-03-27 Epigenomics Ag Diagnosis of diseases associated with gene regulation
US7381808B2 (en) 2001-06-14 2008-06-03 Epigenomics Ag Method and nucleic acids for the differentiation of prostate tumors
EP2519260A2 (en) * 2009-12-31 2012-11-07 Deutsches Krebsforschungszentrum Novel modulators of trail signalling

Also Published As

Publication number Publication date
WO2001077375A3 (en) 2002-06-27
WO2001077377A3 (en) 2002-07-11
US20030162194A1 (en) 2003-08-28
WO2001092565A8 (en) 2002-05-30
WO2001077375A8 (en) 2002-10-24
DE60126593T2 (en) 2007-10-31
EP1268857A2 (en) 2003-01-02
WO2001092565A2 (en) 2001-12-06
US20040076956A1 (en) 2004-04-22
WO2001077378A2 (en) 2001-10-18
WO2001077378A3 (en) 2002-10-17
WO2001081622A3 (en) 2003-09-04
WO2001081622A2 (en) 2001-11-01
WO2001076451A2 (en) 2001-10-18
AU2001278420A1 (en) 2001-11-07
EP2014776A2 (en) 2009-01-14
WO2001077164A3 (en) 2002-06-20
EP1360319A2 (en) 2003-11-12
EP1278893A2 (en) 2003-01-29
EP1274865A2 (en) 2003-01-15
WO2001077375A2 (en) 2001-10-18
WO2001077376A3 (en) 2002-08-08
ATE353975T1 (en) 2007-03-15
DE60126593D1 (en) 2007-03-29
EP2014776A3 (en) 2009-04-01
WO2001077377A8 (en) 2002-02-28
US7195870B2 (en) 2007-03-27
AU2001276330B2 (en) 2006-08-31
AU2001276331A1 (en) 2001-10-23
AU2001275663A1 (en) 2001-10-23
US20030148326A1 (en) 2003-08-07
AU2001289600A1 (en) 2001-12-11
AU2001277487A1 (en) 2001-10-23
EP1272670A2 (en) 2003-01-08
WO2001077376A2 (en) 2001-10-18
WO2001092565A3 (en) 2002-09-06
AU2001254788A1 (en) 2001-10-23
WO2001076451A3 (en) 2003-09-04
AU2001254794A1 (en) 2001-10-23
JP2003531589A (en) 2003-10-28
WO2001076451A9 (en) 2002-08-08
WO2001077164A8 (en) 2002-03-21
WO2001081622A8 (en) 2002-05-16
US20050282157A1 (en) 2005-12-22
JP2004508807A (en) 2004-03-25
WO2001077376A8 (en) 2002-03-21
EP1274866A2 (en) 2003-01-15
EP1268861A2 (en) 2003-01-02
US20030148327A1 (en) 2003-08-07
EP1274865B1 (en) 2007-02-14
EP1370685A2 (en) 2003-12-17
US20040067491A1 (en) 2004-04-08
WO2001077377A2 (en) 2001-10-18
AU7633001A (en) 2001-10-23
US20030082609A1 (en) 2003-05-01
JP2003534780A (en) 2003-11-25

Similar Documents

Publication Publication Date Title
EP1274865B1 (en) Diagnosis of diseases associated with apoptosis by means of assessing the methylation status of genes associated with apoptosis
AU2001276330A1 (en) Diagnosis of diseases associated with apoptosis
US20040029123A1 (en) Diagnosis of diseases associated with the cell cycle
EP1676927A2 (en) Diagnosis of diseases associated with development by means of assessing their methylation status
AU2006213968A1 (en) Diagnosis of diseases associated with DNA replication
AU2006225250A1 (en) Diagnosis of diseases associated with metastasis
AU2006203475A1 (en) Diagnosis of Diseases Associated with Gene Regulation

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A2

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CN CO CR CU CZ DE DK DM DZ EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG US UZ VN YU ZA ZW

AL Designated countries for regional patents

Kind code of ref document: A2

Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE TR BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
DFPE Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101)
AK Designated states

Kind code of ref document: C1

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CN CO CR CU CZ DE DK DM DZ EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG US UZ VN YU ZA ZW

AL Designated countries for regional patents

Kind code of ref document: C1

Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE TR BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG

CFP Corrected version of a pamphlet front page
CR1 Correction of entry in section i

Free format text: PAT. BUL. 42/2001 UNDER "PUBLISHED", ADD "SEQUENCE LISTING PART OF DESCRIPTION PUBLISHED SEPARATELYIN ELECTRONIC FORM AND AVAILABLE UPON REQUEST FROM THE INTERNATIONAL BUREAU."

AK Designated states

Kind code of ref document: A3

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CN CO CR CU CZ DE DK DM DZ EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG US UZ VN YU ZA ZW

AL Designated countries for regional patents

Kind code of ref document: A3

Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE TR BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG

WWE Wipo information: entry into national phase

Ref document number: 2001953936

Country of ref document: EP

ENP Entry into the national phase

Ref country code: JP

Ref document number: 2001 575634

Kind code of ref document: A

Format of ref document f/p: F

WWE Wipo information: entry into national phase

Ref document number: 2001276330

Country of ref document: AU

WWP Wipo information: published in national office

Ref document number: 2001953936

Country of ref document: EP

WWE Wipo information: entry into national phase

Ref document number: 10240452

Country of ref document: US

WWG Wipo information: grant in national office

Ref document number: 2001953936

Country of ref document: EP