WO2001051083A2 - Innate immunity-stimulating compositions of cpg and saponin and methods thereof - Google Patents

Abstract

Compositions comprising oligonucleotides comprising at least one unmethylated CpG dinucleotide and saponin and the use thereof for stimulating innate immunity and enhancing natural killer cell activity are disclosed.

Description

INNATE IMMUNITY-STIMULATING COMPOSITIONS OF CPG AND SAPONIN AND METHODS THEREOF

CROSS-REFERENCE TO RELATED APPLICATION

This U.S. Utility Patent Application claims priority from U.S. Provisional

Application No. 60/200,853, filed May 1, 2000, U.S. Provisional Application No.

60/175,840, filed January 13, 2000 and U.S. Utility Patent Application No.

09/369,941, filed August 6, 1999, which claims benefit of U.S. Provisional

Application No. 60/128,608, filed April 8, 1999, now abandoned, and U.S.

Provisional Application No. 60/095,913, filed August 10, 1998, now

abandoned.

FIELD OF THE INVENTION

The present invention is in the field of immune enhancers. The

compositions of the invention stimulate innate immunity.

BACKGROUND OF THE INVENTION

Adjuvant saponins have been identified and purified from an aqueous

extract of the bark of the South American tree, Quillaja saponaria Molina.

Among the 22 saponin peaks which were separable, the more predominant

purified saponins have been identified as QS-7, QS-17, QS-18, and QS-21, also

known as QA-7, QA-17, QA-18, and QA-21, respectively. These saponins have

been substantially purified by various methods including high pressure liquid

chromatography ("HPLC"), low pressure liquid silica chromatography, and hydrophilic interactive chromatography ("HILIC"). The substantially pure

saponins have been found to be useful as immune adjuvants when used with

vaccine antigens for enhancing immune responses to such antigens in

individuals. (Kensil, et al., U.S. Patent No. 5,057,540; Kensil, et al., /. Immunol.

148:2357 (1991); Marciani, et al, Vaccine 9:89 (1991).)

Recently, oligonucleotides containing the unmethylated cytosine-

guanine ("CpG") dinucleotide in a particular sequence context or motif have

been shown to be potent stimulators of several types of immune cells in vitro.

(Weiner, et al., Proc. Natl. Acad. Sci. 94:10833 (1997).) An oligonucleotide

comprising an unmethylated CpG motif within which is at least one

unmethylated CpG dinucleotide has been shown to activate the immune

system. CpG motifs can stimulate monocytes, macrophages, and dendritic cells

that can produce several cytokines, including the T helper 1 ("Th 1") cytokine

interleukin ("IL") 12. (Carson, et al., /. Exp. Med. 186:1621 (1997).) This effect

causes the induction of IFN-γ secretion by natural killer (NK) cells, which in

turn, activates macrophages and enhances immunoglobulin isotype switching

to IgG2a, a hallmark of T helper Type 1 cell immunity and differentiation.

(Chu, et al, /. Exp. Med. 186:1623 (1997).) Klinman, et al, have shown that a

DNA motif consisting of an unmethylated CpG dinucleotide flanked by two 5'

purines (GpA or ApA) and two 3' pyrimidines (TpC or TpT) optimally

stimulated B cells to produce IL-6 and IL-12, and stimulated CD4+ T cells to

produce IL-6 and IFN-γ both in vitro and in vivo. (Klinman, et al., Proc. Natl.

Acad. Sci., 93:2879 (1996).) Davis, et al., discovered that nucleic acids containing

at least one unmethylated CpG dinucleotide may affect the immune response of a subject (Davis, et al., WO 98/40100). Kensil, et al., previously showed that

a combination of QS-21 and CpG oligonucleotides have synergistic adjuvant

activity for antigen-specific responses when combined with a vaccine antigen

(Kensil, U.S.S.N. 09/369,941, the contents of which are fully incorporated by

reference herein).

Recently, it has been shown that CpG administration, in the absence of a

vaccine antigen, can protect a mouse against an otherwise lethal infection with

an intracellular bacteria, such as Listeria monocytogenes or Francisella tularensis, if

the CpG is administered between 2-3 days prior or no earlier than 2 weeks

prior to the infection. (Elkins, et al., /. Immunol. 162: 2991 (1999).). This result

suggests an activation of innate immunity. It has been hypothesized that CpG

motifs are a danger signal that activate protective innate immune defenses

(Krieg, et al., /. Immunol. 161: 2428 (1998)), in particular (NK) cell activity. CpG

motifs appear to stimulate natural killer cell activity through direct CpG

stimulation of natural killer cells or through natural killer-active cytokines

secreted by CpG-stimulated monocytes.

SUMMARY OF THE INVENTION

Since innate immunity plays an important role in the protective

response to infection with certain microbial agents and tumors, a need exists to

characterize other agents that may safely stimulate innate immunity. Such

agents may be potentially incorporated in future therapeutic agents.

Surprisingly, a combination of an oligonucleotide comprising at least one

unmethylated CpG dinucleotide and a saponin was found to be a powerful stimulator of natural killer cell activity compared to either compound alone.

NK cell activity was significantly higher for a composition comprising a CpG-

containing oligonucleotide /saponin combination compared to either the

saponin or the unmethylated CpG-containing oligonucleotide and represented

a positive synergistic effect. Further, the saponin alone was shown to induce a

higher natural killer cell response than the unmethylated CpG-containing

oligonucleotide. Further, both the saponin alone and the combination of

saponin/ a CpG-containing oligonucleotide induced an innate immunity that

enabled stronger protection against an infection than the CpG-containing

oligonucleotide. Together, these results establish that a composition

comprising saponin alone and a composition comprising an oligonucleotide

comprising at least one unmethylated CpG dinucleotide plus a saponin are

candidate compositions to induce innate immunity.

Accordingly, in a first aspect, the invention covers a composition

comprising: (a) a saponin; and (b) an oligonucleotide comprising at least one

unmethylated CpG dinucleotide. Preferably, the composition provides that the

saponin is derived from Quillaja saponaήa, and more preferably, the saponin is

chemically modified or comprises a substantially pure saponin. In a preferred

embodiment of the first aspect, the substantially pure saponin comprises QS-7,

QS-17, QS-18, or QS-21, and more preferably, the substantially pure saponin

comprises QS-21. In yet other preferred embodiments of the first aspect, the

composition is further directed to one in which the oligonucleotide is

chemically modified. More particularly, the oligonucleotide is modified with

at least one phosphorothioate internucleotide linkage. A preferred embodiment of the first aspect encompasses the composition wherein the

oligonucleotide comprises a CpG motif having the formula 5'X.CGX-3',

wherein at least one nucleotide separates consecutive CpGs, and wherein X. is

adenine, guanine, or thymine, and X₂ is cytosine, thymine, or adenine. More

preferably, the CpG motif comprises TCTCCCAGCGTGCGCC AT or

TCCATGACGTTCCTGACGTT or TCGTCGTTTTGTCGTTTTGTCGTT. The

composition, according to the first aspect of the invention, preferably increases

an innate immune response when administered to a mammal or a human. Still

another preferred embodiment is directed to the composition wherein the

composition enhances a natural killer cell response, preferably in a positive

synergistic manner.

In a second aspect, the invention is directed to a method for stimulating

innate immunity comprising administering an effective amount of a

composition comprising: (a) a saponin; and (b) an oligonucleotide comprising

at least one unmethylated CpG motif to an individual. Preferably, the method

provides that the saponin is derived from Quillaja saponaria, and more

preferably, the saponin is chemically modified or comprises a substantially

pure saponin. In a preferred embodiment of the second aspect, the

substantially pure saponin comprises QS-7, QS-17, QS-18, or QS-21, and more

preferably, the substantially pure saponin comprises QS-21. In yet other

preferred embodiments of the second aspect, the method is further directed to

one in which the oligonucleotide is chemically modified. More particularly, the

oligonucleotide is modified with at least one phosphorothioate internucieotide

linkage. A preferred embodiment of the second aspect encompasses the method wherein the oligonucleotide comprises a CpG motif having the

formula 5'X.CGX₂3', wherein at least one nucleotide separates consecutive

CpGs, and wherein X. is adenine, guanine, or thymine, and X₂ is cytosine,

thymine, or adenine. More preferably, the CpG motif comprises

TCTCCCAGCGTGCGCCAT or TCCATGACGTTCCTGACGTT or

TCGTCGTTTTGTCGTTTTGTCGTT. The method, according to this second

aspect of the invention, preferably further increases an innate immune

response when administered to a mammal or a human. Still another preferred

embodiment is directed to the method for further enhancing a natural killer cell

response, preferably in a positive synergistic manner.

A third aspect of the invention provides for methods for stimulating

innate immunity comprising administering an effective amount of a

composition comprising a saponin only to an individual. Preferably, the

method provides that the saponin is derived from Quillaja saγonaria, and more

preferably, the saponin is chemically modified or comprises a substantially

pure saponin. In a preferred embodiment of the third aspect, the substantially

pure saponin comprises QS-7, QS-17, QS-18, or QS-21, and more preferably, the

substantially pure saponin comprises QS-21. The method, according to the

third aspect of the invention, preferably further increases an innate immune

response when administered to a mammal or a human. Still another preferred

embodiment is directed to the method for further enhancing a natural killer cell

response. DESCRIPTION OF THE FIGURES

Figure 1 is a graphic representation showing the enhancement of the

natural killer cell response by QS-21 or by QS-21 /CpG oligodeoxynucleotide

(sequence 1826) combination, as evidenced by lysis of the NK-sensitive cell line

YAC-1.

Figure 2 is a graphic representation showing the optimal timing of

administration of QS-21 /CpG oligodeoxynucleotide (sequence 1826)

combination, as evidenced by lysis of the NK-sensitive cell line YAC-1.

Figure 3 is a graphic representation depicting the NK activating activity

of QS-21, QS-7, or CpG oligodeoxynucleotide (sequence 1826), as evidenced by

dose response curves for individual compounds for enhancing the NK cell

response against the NK-sensitive cell line YAC-1.

Figure 4 is a graphic representation depicting the NK activating activity

of various mixtures of QS-21, QS-7, and CpG oligodeoxynucleotides (sequences

1826 and 2006), as evidenced by lysis of the NK-sensitive cell line YAC-1.

Figure 5 is a graphic representation illustrating protection of Balb/c

mice against an intraperitoneal challenge with 10⁵ colonies of Listeria

monocytogenes after administration of various formulations three days prior to

challenge.

DESCRIPTION OF THE PREFERRED EMBODIMENTS

The term "saponin" as used herein includes glycosidic triterpenoid

compounds which produce foam in aqueous solution and have hemolytic

activity in most cases. The invention encompasses the saponin per se, as well as natural and pharmaceutically acceptable salts and pharmaceutically

acceptable derivatives. The term "saponin" also embodies biologically active

fragments thereof. The term "saponin" also encompasses chemically modified

saponins.

The saponins of the present invention may be obtained from the tree

Quillaja saponaria Molina. (Dalsgaard, Ada Veterinia Scandinavica, 69:1 (1978).)

A partially purified saponin enriched extract, prepared as described by

Dalsgaard, ("Quil-A") has adjuvant activity. Such an extract can be further

separated. Among the 22 saponin peaks which were separable, the more

predominant purified saponins have been identified as QS-7, QS-17, QS-18, and

QS-21, also known as QA-7, QA-17, QA-18, and QA-21, respectively. (Kensil, et

al., U.S. Patent No. 5,057,540.) These saponins have been substantially purified

by various methods including HPLC, low pressure liquid silica

chromatography, and HILIC.

"QS-21" designates the mixture of components QS-21-V1 and QS-21-V2

which appear as a single peak on reverse phase HPLC on Vydac C4 (5 μm

particle size, 300A pore, 4.6 mm ID x 25 cm length) in 40 mM acetic acid in

methanol/ water (58/42, v/v). The component fractions are referred to

specifically as QS-21-V1 and QS-21-V2 when describing experiments

performed on the further purified components.

The present invention may also employ chemically modified saponins.

According to Kensil, et al., U.S. Patent No. 5,443,829, the contents of which are

fully incorporated by reference herein, such chemically modified saponins can

be obtained in several ways. For example, the aldehyde group of either purified QS-17, QS-18, QS-21, or mixtures thereof, or purified fractions

obtainable from Quillaja saponaria Molina bark and comprising QS-17, QS-18,

and QS-21 can be reduced with a mild reducing agent, such as sodium or

lithium borohydride, to give the corresponding alcohol. Alternatively, the

aldehyde of QS-17, QS-18, and QS-21, mixtures thereof, or purified fractions

obtainable from Quillaja saponaria Molina bark and comprising QS-17, QS-18,

and QS-21 can be subjected to reductive amidation with a primary amine and a

reducing agent to give the corresponding amino derivative of QS-17, QS-18,

and QS-21. According to Kensil, et al, U.S. Patent No. 5,583,112, the contents of

which are fully incorporated by reference herein, the carboxyl group on the

glucuronic acid of saponins from Quillaja saponaria Molina can be conjugated to

a protein, a peptide, or a small molecule containing a primary amine.

According to Higuchi, et al., Phytochemistry 26:229 (1987)), saponins from

Quillaja saponaria may be deacylated by alkaline-catalyzed hydrolysis.

According to Marciani, et al., U.S. Patent No. 5,977,081, the contents of which

are fully incorporated by reference herein, the carboxyl group on the

glucuronic acid of nonacylated or deacylated saponins from Quillaja saponaria

may be conjugated to a lipid, fatty acid, polyethylene glycol, or terpene. Thus,

the present invention relates to a chemically modified saponin or a biologically

active fraction thereof obtainable from a crude Quillaja saponaria Molina extract.

Adjuvant-active saponins and adjuvant-inactive saponins fall within the scope

of the invention described herein provided that these saponins stimulate innate

immunity alone or in combination with a CpG dinucleotide. In other embodiments of the invention, the term "saponin" covers

mixtures of saponins. Preferably, the mixture of saponins comprises two or

more substantially pure saponins. More preferably, the two or more

substantially pure saponins are from Quillaja saponaria in doses that are

otherwise suboptimal for the individual saponins. In a particularly preferred

embodiment, the combination of saponins consists essentially of substantially

pure saponins QS-7and QS-21 or, in other particularly preferred embodiments,

QS-7 and QS-21-V1 or QS-7 and QS-21-V2.

Other embodiments of the invention encompasses saponins in

combination with excipients. Preferably, the saponin is QS-21 and the

excipients are selected from nonionic surfactants, polyvinyl pyrolidone, human

serum albumin, aluminum hydroxide, agents with anesthetic action, and

various unmodified and derivatized cyclodextrins. More preferably, in these

embodiments, the nonionic surfactants are selected from Polysorbate 20,

Polysorbate-40, Polysorbate-60, and Polysorbate-80. The polyvinyl pyrolidone

may preferably be Plasdone C15, a pharmaceutical grade of polyvinyl

pyrolidone. The agent having anesthetic action preferably is benzyl alcohol.

Preferred cyclodextrins are hydroxypropyl-β-cyclodextrin, hydroxypropyl-γ-

cyclodextrin, methyl-β-cyclodextrin.

The term "partially pure" means saponins partially separated from

compounds normally associated with the saponin in its natural state.

The term "substantially pure" means substantially free from compounds

normally associated with the saponin in its natural state and exhibiting

constant and reproducible chromatographic response, elution profiles, and biologic activity. The term "substantially pure" is not meant to exclude

artificial or synthetic mixtures of the saponin with other compounds.

The present invention may also employ saponins isolated from other

plant species, such as Gypsophila or Saponaria officinalis.

In one embodiment, the invention provides a method for stimulating an

immune response in a subject by administering a therapeutically effective

amount of saponin and oligonucleotide comprising at least one unmethylated

CpG dinucleotide. The term "nucleic acid" or "oligonucleotide" refers to a

polymeric form of nucleotides at least five bases in length. The nucleotides of

the invention can be deoxyribonucleotides, ribonucleotides, or modified forms

of either nucleotide. Generally, double-stranded molecules are more stable in

vivo, while single-stranded molecules have increased activity.

The nucleic acid molecule can include the use of phosphorothioate or

phosphorodithioate rather than phosphodiesterase linkages within the

backbone of the molecule, or methlyphosphorothioate terminal linkages

(Kriege, et al., Antisense and Nucl Acid Drug Dev 6:133 (1996); Bosggs, et al,

Antisense and Nucl Acid Drug Dev, 7:461 (1997). The phosphate backbone

modification can occur at the 5' end of the nucleic acid. The phosphate

backbone modification may occur at the 3' end of the nucleic acid, for example

at the last five nucleotides of the 3' end of the nucleic acid. Hutcherson, et al.,

reports in WO 95/26204 the nonsequence-specific immunostimulatory effect of

phosphorothioate modified oligonucleotides. Nontraditional bases such as

inosine and queosine, as well as acetyl-, thio - and similarly modified forms of

adenine, cytidine, guanine, thymine, and uridine can also be included, which are not as easily recognized by endogenous endonucleases. Other stabilized

nucleic acid molecules include: nonionic DNA analogs, such as alkyl- and aryl-

phosphonates (in which the charged oxygen moiety is alkylated). Nucleic acid

molecules which contain a diol, such as tetrahyleneglycol or hexaethleneglycol,

at either or both termini are also included. The term "oligonucleotide" includes

both single and double stranded forms of DNA.

A "CpG" or "CpG motif" refers to a nucleic acid having a cytosine

followed by a guanine linked by a phosphate bond. The term "methylated

CpG" refers to the methylation of the cytosine on the pyrimidine ring, usually

occurring the 5-position of the pyrimidine ring. The term "unmethylated CpG"

refers to the absence of methylation of the cytosine on the pyrimidine ring.

Methylation, partial removal, or removal of an unmethylated CpG motif in an

oligonucleotide of the invention is believed to reduce its effect. Methylation or

removal of all unmethylated CpG motifs in an oligonucleotide substantially

reduces its effect. The effect of methylation or removal of a CpG motif is

"substantial" if the effect is similar to that of an oligonucleotide that does not

contain a CpG motif. In a preferred embodiment, the CpG motif is an

unmethylated CpG dinucleotide.

Preferably the CpG oligonucleotide is in the range of about 5 to 40 bases

in size. For use in the instant invention, the nucleic acids can be synthesized de

novo using any of a number of procedures well known in the art. For example,

the b-cyanoethyl phosphoramidite method (Beaucage, et al., Tet. Let. 22: 1859

(1981); nucleoside H-phosphonate method (Garegg, et al., Tet. Let. 27: 4051,

(1986); Froehler, et al, Nucl. Acid. Res. 14:5399 (1986); Garegg, et al, Tet. Let. 27:4055 (1986); and Gaffney, et al., Tet. Let. 29:2619 (1998)). These chemistries

can be performed by a variety of automated oligonucleotide synthesizers

available in the market. Alternatively, CpG dinucleotides can be produced on

a large scale in plasmids, (see Sambrook, T., et al, Molecular Coning: A

Laboratory Manual, Cold Spring Harbor Laboratory Press, New York, 1989)

which after being administered to a subject are degraded into oligonucleotides.

Oligonucleotides can be prepared from existing nucleic acid sequences (e.g.,

genomic or cDNA) using known techniques, such as those employing

restriction enzymes, exonucleases or endocucleases.

For use in vivo, nucleic acids are preferably relatively resistant to

degradation (e.g., via endo-and exo-nucleases). Secondary structures, such as

stem loops, can stabilize nucleic acids against degradation. Alternatively,

nucleic acid stabilization can be accomplished via phosphate backbone

modifications. A preferred stabilized nucleic acid has at least a partial

phosphorothiate modified backbone. Phosphorothioates may be synthesized

using automated techniques employing either phosphoramidate or H-

phosphonate chemistries. Aryl- and alkyl-phosphonates can be made, e.g., as

described in Ts'O, et al., U.S. Patent No. 4,469,863; and alkylphosphotriesters

(in which the charged oxygen moiety is alkylated as described in Tullis, U.S.

Patent No. 5,023,243 and Tullis, EP 092574B1) can be prepared by automated

solid phase synthesis using commercially available reagents. Methods for

making other DNA backbone modifications and substitutions have been

described (Uhlmann, et al., Chem. Rev. 90: 544 (1990); Goodchild, Bioconjugate

Chem. 1: 165 (1990). For administration in vivo, nucleic acids may be associated with a

molecule that results in higher affinity binding to target cell (e.g., B-cell,

monocytic cell and natural killer (NK) cell) surfaces and /or increased cellular

uptake by target cells to form a "nucleic acid delivery complex." Nucleic acids

can be ionically or covalently associated with appropriate molecules using

techniques which are well known in the art. A variety of coupling or cross-

linking agents can be used, e.g., protein A, carbodiimide, and N-succinimidyl-3-

(2-pyridyldithio) propionate (SPDP). Nucleic acids can alternatively be

encapsulated in liposomes or virosomes using well-known techniques.

In preferred embodiments, the oligonucleotide containing the CpG motif

may be part of a monomer or part of a multimer. Alternatively, the CpG motif

may be a part of the sequence of a vector.

One embodiment of the invention covers the oligonucleotide which

contains a CpG motif having the formula 5'X.CGX₂3', wherein at least one

nucleotide separates consecutive CpGs, and wherein X, is adenine, guanine, or

thymine, and X₂ is cytosine, thymine, or adenine.

In another embodiment, the oligonucleotide sequences useful in the

methods of the invention are represented by the formula:

5'N.XCGX₂N₂3'

wherein at least one nucleotide separates consecutive CpGs; X_j is adenine,

guanine, or thymidine; X, is cytosine or thymine, N is any nucleotide and N_j +

N₂ is from about 0-26 bases. In a preferred embodiment, N. and N₂ do not

contain a CCGG quadmer or more than one CGG trimer; and the nucleic acid

sequence is from about 8-30 bases in length. However, nucleic acids of any size (even may kb long) can be used in the invention if CpGs are present, as larger

nucleic acids are degraded into oligonucleotides inside cells. Preferred

synthetic oligonucleotides do not include a CCGG quadmer or more than one

CCG or CGG trimer at or near the 5' or 3' terminals and/or the consensus

mitogenic CpG motif is not a palindrome. A "palindromic sequence" or

"palindrome" means an inverted repeat (i.e., a sequence such as

ABCDEEO'CΕ'A', in which A and A' are bases capable of forming the usual

Watson-Crick base pairs.

In still another embodiment, the method of the invention includes the

use of an oligonucleotide which contains a CpG motif represented by the

formula:

5^,N.X₁X₂CGX₃X₄N₂3'

wherein at least one nucleotide separates consecutive CpGs; X.X₂ is selected

from the group consisting of GpT, GpG, GpA, ApT and ApA; X₃X₄ is selected

from the group consisting of TpT or CpT; N is any nucleotide and N.+N₂ is

from about 0-26 bases. In a preferred embodiment, N. and N₂ do not contain a

CCGG quadmer or more than one CCG or CGG trimer. CpG

oligodeoxynucleotides are also preferably in the range of 8 to 30 bases in

length, but may be of any size (even many kb long) if sufficient motifs are

present, since such larger nucleic acids are degraded into oligonucleotides

inside of cells. Preferred synthetic oligonucleotides of this formula do not

include a CCGG quadmer or more than one CCG or CGG trimer at or near the

5' and/or 3' terminals and/or the consensus mitogenic CpG motif is not a

palindrome. Other CpG oligonucleotides can be assayed for efficacy using methods described herein.

In a preferred embodiment, the CpG motif comprises

TCTCCCAGCGTGCGCCAT (also known as "CpG sequence 1758") or

TCCATGACGTTCCTGACGTT (also known as "CpG sequence 1826") or

TCGTCGTTTTGTCGTTTTGTCGTT (also known as "CpG sequence 2006").

The oligonucleotides of the invention may be chemically modified in a

number of ways in order to stabilize the oligonucleotide against endogenous

endonucleases. According to Davis, et al., WO 98/40100, a prolonged effect

can be obtained using stabilized oligonucleotides, where the oligonucleotide

incorporates a phosphate backbone modification (e.g., a phosphorothioate or

phosphorodithioate modification). For example, the oligonucleotides may

contain other than phosphodiester internucieotide linkages between the 5' end

of one nucleotide and the 3' end of another nucleotide in which the other

linkage, the 5' nucleotide phosphate, has been replaced with any number of

non-traditional bases or chemical groups, such as phosphorothioate. More

particularly, the phosphate backbone modification occurs at the 5' end of the

nucleic acid for example, at the first two nucleotides of the 5' end of the nucleic

acid. Further, the phosphate backbone modification may occur at the 3'end of

the nucleic acid for example, at the last five nucleotides of the 3' end of the

nucleic acid. The oligonucleotide comprising at least one unmethylated CpG

dinucleotide may preferably be modified with at least one such

phosphorothioate internucieotide linkages.

Oligonucleotides with phosphorothioate linkages may be prepared

using methods well known in the field such as phosphoamidite (Agrawal, et al, Proc. Natl. Acad. Sci. 85:7079 (1988)) or H-phosphonate (Froehler, et al,

Tetrahedron Lett. 27:5575 (1986)). Examples of other modifying chemical groups

include alkylphosphonates, phosphorodithioates, alkylphosphorothioates,

phosphoroamidates, 2-O-methyls, carbamates, acetamidates,

carboxymethylesters, carbonates, and phosphate triesters. Oligonucleotides

with tbese linkages can be prepared according to know methods (Goodchild,

Chem. Rev. 90:543 (1990); Uhlmann, et al, Chem. Rev. 90:534 (1990); and

Agrawal, et al., Trends Biotechnol. 10:152 (1992)).

In a preferred embodiment of this aspect, the inventive compositions

activate the immune system. Certain preferred nucleic acids containing an

unmethylated CpG have a relatively high stimulation with regard to B cell,

monocyte, and/or NK cell responses. For example, as assayed by induction of

cytokines, proliferative responses, lytic responses, the stimulation of the

immune system may be determined.

Nucleic acids containing an unmethylated CpG can be effective in any

mammal, preferably a human. Different nucleic acids containing an

unmethylated CpG can cause optimal immune stimulation depending on the

mammalian species. Thus, an oligonucleotide causing optimal stimulation in

humans may not cause optimal stimulation in a mouse. One of skill in the art

can identify the optimal oligonucleotides useful for a particular mammalian

species of interest.

The term "innate immunity" as used herein refers to an immune

response that is independent of a specific vaccine antigen. Cellular

components involved in innate immune responses include monocytes, macrophages, natural killer cells, and polymorphonuclear cells, such as

neutrophils. The term "nonspecific immunostimulator" refers to compounds

that when administered to an individual or tested in vitro, increase the innate

immunity of that individual or test system. Preferably, such individuals are

mammals, and more preferably, the mammals are humans, however, the

invention is not intended to be so limiting. Any animal which may experience

the beneficial effects of the compositions of the invention are within the scope

of animals which may be treated according to the claimed invention. A

nonspecific immunostimulator may enhance the immune response of the

individual by increasing natural killer cell activity or cytokine production, such

as interleukin-12 (IL-12) or IFNγ.

The ability of a composition to enhance innate immunity may be

determined by a number of methods known to those of ordinary skill in the art.

For example, the increase in natural killer cell response in mice after

administration of a composition may be used as a criterion for stimulation of

innate immunity. Briefly, one such method involves injecting Balb/c mice at

days 1 and 2 with a test composition. Splenocytes harvested from the mice on

day 3 can be tested for a natural killer cell lytic activity against a natural killer

cell sensitive-cell line, such as YAC-1 cells. An additional method of

determining innate immunity is to administer a test composition to a suitable

species such as Balb/c mice. These mice can be challenged with an infectious

agent, e.g., a bacterium such as Listeria monocytogenes after the administration of

the test compound. The ability of the test compound to stimulate the innate

immune response can be tested, for example, by measuring protection against infection with the infectious agent. For example, as described herein, three

days after the challenge with Listeria, the spleens can be removed and tested for

colony forming units of Listeria per gram as a measure of the protective benefit

of the composition.

In a first aspect of the invention, a composition comprising a saponin

and an oligonucleotide comprising at least one unmethylated CpG dinucleotide

may be administered. More preferably, such a composition may increase the

innate immune response in an individual or a test system to which the

composition is administered. Preferably, the saponin is a saponin from Quillaja

saponaria Molina. More preferably, the saponin is a partially pure or

substantially pure saponin from Quillaja saponaria Molina. Preferably, the

partially pure saponin may comprise QS-7, QS-17, QS-18, and/or QS-21 and

may comprise other saponins. Preferably, the substantially pure saponin is QS-

7, QS-17, QS-18, or QS-21. Most preferably, the substantially pure saponin is

QS-21. Alternatively, the composition may comprise more than one saponin

with the oligonucleotide comprising at least one unmethylated CpG

dinucleotide.

In a further preferred embodiment of this first aspect, the saponin may

cover a chemically modified saponin or a biologically active fraction thereof

obtainable from a crude Quillaja saponaria Molina extract, wherein the

chemically modified saponin or biologically active fraction thereof comprises at

least one of QS-17, QS-18, QS-21, QS-21-V1, and QS-21-V2. The oligonucleotide

comprising at least one unmethylated CpG dinucleotide is preferably a monomer or multimer. Another preferred embodiment of the CpG motif is as

a part of the sequence of a vector.

Yet another embodiment of this first aspect is directed to the

oligonucleotide comprising at least one unmethylated CpG dinucleotide,

wherein the oligonucleotide is modified. The particular modification may

comprise at least one phosphorothioate internucieotide linkage. Further, the

oligonucleotide having at least one unmethylated CpG dinucleotide may

comprise a CpG motif having the formula 5'X.CGX₂3', wherein at least one

nucleotide separates consecutive CpGs, and wherein X. is adenine, guanine, or

thymine, and X₂ is cytosine, thymine, or adenine. The CpG motif may

preferentially be TCTCCCAGCGTGCGCC AT or

TCCATGACGTTCCTGACGTT, or TCGTCGTTTTGTCGTTTTGTCGTT .

The term "composition" herein refers to a composition capable of

stimulating an innate immune response. A composition, according to the

invention, would produce innate immunity against disease in individuals. A

composition comprising a saponin and an oligonucleotide comprising at least

one unmethylated CpG dinucleotide of the present invention may be

administered to an individual to enhance the immune response prior to or after

exposure to a pathogen or tumor. Preferably, the composition stimulates

innate immunity. More preferably, the composition enhances a protective

natural killer cell response.

The composition of the invention comprising both saponin and CpG-

containing oligonucleotide may enhance the immune response, e.g., the innate

immune response, in a positive synergistic manner. In one embodiment, the innate immune response is natural killer cell response. The term "positive

synergistic effect" and "positive synergistic manner" mean the enhancement by

the inventive composition, e.g., a saponin plus a CpG-containing

oligonucleotide, on immune response to a level that is greater than the addition

of the response to the components used individually. The synergistic effect of

the composition of oligonucleotide plus saponin described herein may be

shown as an increase in the maximum expected immune response, e.g, the NK

cell response, over the addition of the response caused by the oligonucleotide

alone and the response caused by the saponin alone.

In a second aspect, the invention is directed to a method for increasing

the innate immune response in an individual or a test system comprising

administering an effective amount of a composition comprising a saponin with

or without an oligonucleotide comprising at least one unmethylated CpG

dinucleotide. Preferably, the saponin is a saponin from Quillaja saponaria

Molina. More preferably, the saponin is a partially pure or a substantially pure

saponin from Quillaja saponaria Molina. The method may also embody a

composition comprising more than one substantially pure saponin and an

oligonucleotide comprising at least one unmethylated CpG dinucleotide. The

substantially pure saponin is preferably QS-7, QS-17, QS-18, or QS-21. Most

preferably, the substantially pure saponin is QS-21. In a further preferred

embodiment, the saponin may cover a chemically modified saponin or a

biologically active fraction thereof obtainable from a crude Quillaja saponaria

Molina extract. In a preferred embodiment of the method, the oligonucleotide

containing at least one CpG motif is preferably a monomer or a multimer. Another preferred embodiment of the method includes the CpG motif as a part

of the sequence of a vector. Yet another embodiment is directed to the method

wherein the oligonucleotide comprises at least one unmethylated CpG

dinucleotide, and wherein furthermore the oligonucleotide may be chemically

modified to stabilize the oligonucleotide against endogenous endonucleases.

The modification may comprise at least one phosphorothioate internucieotide

linkage. Further, the method may be directed, in part, to the oligonucleotide

having at least one unmethylated CpG dinucleotide comprising a CpG motif

having the formula 5'X.CGX₂3', wherein at least one nucleotide separates

consecutive CpGs, and wherein X. is adenine, guanine, or thymine, and X₂ is

cytosine, thymine, or adenine. In another preferred method, the unmethylated

CpG motif is TCTCCCAGCGTGCGCCAT, TCCATGACGTTCCTGACGTT, or

TCGTCGTTTTGTCGTTTTGTCGTT.

A third aspect of the invention provides for methods for stimulating

innate immunity comprising administering an effective amount of a

composition comprising a saponin to an individual. Preferably, the method

provides that the saponin is derived from Quillaja saponaria, and more

preferably, the saponin is chemically modified or comprises a substantially

pure saponin. In a preferred embodiment of the third aspect, the substantially

pure saponin comprises QS-7, QS-17, QS-18, or QS-21, and more preferably, the

substantially pure saponin comprises QS-21. The method, according to the

third aspect of the invention, preferably further increases an innate immune

response when administered to a mammal or a human. Still another preferred embodiment is directed to the method for further enhancing a natural killer cell

response.

Further, numerous infectious diseases and cancers are suitable for

prevention or treatment by the enhanced innate immune response. Viral

diseases that can be treated or prevented by the methods of the present

invention include, but are not limited to, those caused by hepatitis type A,

hepatitis type B, hepatitis type C, feline leukemia virus, feline

immunodeficiency virus, influenza, varicella, adenovirus, herpes simplex type

I (HSV-I), herpes simplex type II (HSV-II), rinderpest, vhinovirus, echovirus,

rotavirus, respiratory syncytial virus, papilloma virus, papova virus,

cytomegalovirus, echinovirus, arbovirus, huntavirus, coxsachie virus, mumps

virus, measles virus, rubella virus, polio virus, human immunodeficiency virus

type I (HΓV-I), human immunodeficiency virus type II (HIV-II), rabies virus,

and hoof and mouth virus.

Bacterial diseases than can be treated or prevented by methods of the

present inventions are caused by bacteria including, but not limited to,

mycobacteria rickettsia, mycoplasma, neisseria, legionella, Yersinia, Helobacter

pylori, Staphylococcus aureus, anthrax, diphtheria, Escherichia coli, Lyme disease,

Listeria monocytogenes, pneumococcus, Francisella tularensis, Salmonella, or

tuberculosis.

Protozoal diseases that can be treated or prevented by the methods of

the present invention are caused by protozoa including, but not limited to,

leishmania, kokzidioa, trypanosoma, Plasmodium and Babeosis bovis. Parasitic diseases that can be treated or prevented by the methods of the

present invention are caused by parasites including, but not limited to,

chlamydia and rickettsia. Other pathogens not listed above may be suitable for

treatment by the enhanced innate immune response. In addition, cancers may

be suitable for treatment by the enhanced innate immune response. Cancers

that can be treated or prevented by the methods of the present invention

include, but not limited to, human sarcomas and carcinomas, e.g.,

fibrosarcoma, myxosarcoma, liposarcoma, chondrosarcoma, osteogenic

sarcoma, chordoma, angiosarcoma, endotheliosarcoma, lymphangiosarcoma,

lymphangioendotheliosarcoma, synovioma, mesothelioma, Ewing's tumor,

leiomyosarcoma, rhabdomyosarcoma, colon carcinoma, pancreatic cancer,

breast cancer, ovarian cancer, prostate cancer, squamous cell carcinoma, basal

cell carcinoma, adenocarcinoma, sweat gland carcinoma, sebaceous gland

carcinoma, papillary carcinoma, papillary adenocarcinomas,

cystadenocarcinoma, medullary carcinoma, bronchogenic carcinoma, renal cell

carcinoma, hepatoma, bile duct carcinoma, choriocarcinoma, seminoma,

embryonal carcinoma, Wilms' tumor, cervical cancer, testicular tumor, lung

carcinoma, small cell lung carcinoma, bladder carcinoma, epithelial carcinoma,

glioma, astrocytoma, medulloblastoma, craniopharyngioma, ependymoma,

pinealoma, hemangioblastoma, acoustic neuroma, oligodendroglioma,

meningioma, melanoma, neuroblastoma, retinoblastoma; leukemias, e.g., acute

lymphocytic leukemia and acute myelocytic leukemia (myeloblastic,

promyelocytic, myelomonocytic, monocytic and erythroleukemia); chronic

leukemia (chronic myelocytic (granulocytic) leukemia and chronic lymphocytic leukemia); and polycythemia vera, lymphoma (Hodgkin's disease and non

Hodgkin's disease), multiple myeloma, Waldenstrobm's macroglobulinemia,

and heavy chain disease.

In a specific embodiment the cancer is metastatic. In another specific

embodiment, the patient having a cancer is immunosuppressed by reason of

having undergone anticancer therapy (e.g., chemotherapy radiation) prior to

administration of the compositions of the invention. In another specific

embodiment, the cancer is a tumor.

The saponins and oligonucleotides comprising at least one

unmethylated CpG dinucleotide (also referred to herein as "active

compounds") of the invention can be incorporated into pharmaceutical

compositions suitable for administration. Such compositions typically

comprise a saponin and an oligonucleotide comprising at least one

unmethylated CpG dinucleotide and a pharmaceutically acceptable carrier. As

used herein the language "pharmaceutically acceptable carrier" is intended to

include any and all solvents, dispersion media, coatings, antibacterial and

antifungal agent, isotonic and absorption delaying agents, and the like,

compatible with pharmaceutical administration. The use of such media and

agents for pharmaceutically active substances is well known in the art. Except

insofar as any conventional media or agent is incompatible with the active

compound, use thereof in the compositions is contemplated. Supplementary

active compounds can also be incorporated into the compositions.

A pharmaceutical composition of the invention is formulated to be

compatible with its intended route of administration. Examples of routes of administration include parenteral, e.g., intravenous, intradermal, subcutaneous,

oral (e.g., inhalation), transdermal (topical), transmucosal, and rectal

administration. Solutions or suspensions used for parenteral, intradermal, or

subcutaneous application can include the following components: a sterile

diluent such as water for injection, saline solution, fixed oils, polyethylene

glycols, glycerine, propylene glycol or other synthetic solvents; antibacterial

agents such as benzyl alcohol or methyl parabens; antioxidants such as ascorbic

acid or sodium bisulfite; chelating agents such as ethylenediaminetetraacetic

acid; buffers such as acetates, citrates or phosphates and agents for the

adjustment of tonicity such as sodium chloride or dextrose. pH can be adjusted

with acids or bases, such as hydrocholoric acid or sodium hydroxide. The

parenteral preparation can be enclosed in ampoules, disposable syringes or

multiple dose vials made of glass or plastic.

Pharmaceutical compositions suitable for injectable use include sterile

aqueous solutions (where water soluble) or dispersions and sterile powders for

the extemporaneous preparation of sterile injectable solutions or dispersion.

For intravenous administration, suitable carriers include physiological saline,

bacteriostatic water, Cremophor EL™ (BASF, Parsippany, NJ) or phosphate

buffered saline (PBS). In all cases, the composition must be sterile and should

be fluid to the extent that easy syringbility exists. It must be stable under the

conditions of manufacture and storage and must be preserved against the

contaminating action of microorganisms such as bacteria and fungi. The

carrier also can be a solvent or dispersion medium containing, for example,

sterile water, salt solutions (such as Ringer's solution or saline), alcohols, gelatin, talc, viscous paraffin, fatty acid asters, hydroxymethylcellulose,

polyvinyl pyrolidone, calcium carbonate, carbohydrates such as lactose,

sucrose, dextrose, mannose, albumin, starch, cellulose, silica gel, polyethylene

glycol (PEG), dried skim milk, rice flour, magnesium stearate, and the like, and

suitable mixtures thereof. The proper fluidity can be maintained, for example,

by the use of a coating such as lecithin, by the maintenance of the required

particle size in the case of dispersion and by the use of surfactants. Prevention

of the action of microorganisms can be achieved by various antibacterial and

antifungal agents, for example, paragens, chlorobutanol, phenol, ascorbic acid,

thimerosal, and the like. In many cases, it will be preferable to include isotonic

agents, for example, sugars, polyalcohols such as manitol, sorbitol, sodium

chloride in the composition. Prolonged absorption of the injectable

compositions can be brought about by including in the composition an agent

which delays absorption, for example, aluminum monostearate and gelatin.

Sterile injectable solutions can be prepared by incorporating the active

compound in the required amount in an appropriate solvent with one or a

combination of ingredients enumerated above, as required, followed by filtered

sterilization. Generally, dispersions are prepared by incorporating the active

compound into a sterile vehicle which contains a basic dispersion medium and

the required other ingredients from those enumerated above. In the case of

sterile powders for the preparation of sterile injectable solutions, the preferred

methods of preparation are vacuum drying and freeze-drying which yields a

powder of the active ingredient plus any additional desired ingredient from a

previously sterile-filtered solution thereof. Oral compositions generally include an inert diluent or an edible carrier.

They can be enclosed in gelatin capsules or compressed into tablets. For the

purpose of oral therapeutic administration, the active compound can be

incorporated with excipients and used in the form of tablets, troches, or

capsules. Oral compositions can also be prepared using a fluid carrier for use

as a mouthwash, wherein the compound in the fluid carrier is applied orally

and swished and expectorated or swallowed. Pharmaceutically compatible

binding agents, and /or adjuvant materials can be included as part of the

composition. The tablets, pills, capsules, troches and the like can contain any of

the following ingredients, or compounds of a similar nature: a binder such as

microcrystalline cellulose, gum tragacanth or gelatin; an excipient such as

starch or lactose, a disintegrating agent such as alginic acid, Primogel, or corn

starch; a lubricant such as magnesium stearate or Sterotes; a glidant such as

colloidal silicon dioxide; a sweetening agent such as sucrose or saccharin; or a

flavoring agent such as peppermint, methyl salicylate, or orange flavoring.

For administration by inhalation, the compounds are delivered in the

form of an aerosol spray from pressured container or dispenser which contains

a suitable propellant, e.g., a gas such as carbon dioxide, or a nebulizer.

Systemic administration can also be by transmucosal or transdermal

means. For transmucosal or transdermal administration, penetrants

appropriate to the barrier to be permeated are used in the formulation. Such

penetrants are generally known in the art, and include, for example, for

transmucosal administration, detergents, bile salts, and fusidic acid derivatives.

Transmucosal administration can be accomplished through the use of nasal sprays or suppositories. For transdermal administration, the active compounds

are formulated into ointments, salves, gels, or creams as generally known in the

art.

The compounds can also be prepared in the form of suppositories (e.g.

with conventional suppository bases such as cocoa butter and other glycerides)

or retention enemas for rectal delivery.

In one embodiment, the active compounds are prepared with carriers

that will protect the compound against rapid elimination from the body, such

as a controlled release formulation, including implants and microencapsulated

delivery systems. Biodegradable, biocompatible polymers can be used, such as

ethylene vinyl acetate, polyanhydrides, polyglycolic acid, collagen,

polyorthoesters, and polyactic acid. Methods for preparation of such

formulations will be apparent to those skilled in the art. The materials can also

be obtained commercially from Alza Corporation and Nova Pharmaceuticals,

Inc.. Liposomal suspensions (including liposomes targeted to infected cells

with monoclonal antibodies to viral antigens) can also be used as

pharmaceutically acceptable carriers. These can be prepared according to

methods known to those skilled in the art, for example, as described in

Eppstein, et al, U.S. Patent No. 4,522,811.

It is especially advantageous to formulate oral or parenteral

compositions in dosage unit form for ease of administration and uniformity of

dosage. Dosage unit form as used herein refers to physically discrete units

suited as unitary dosages for the subject to be treated; each unit containing a

predetermined quantity of active compound calculated to produce the desired therapeutic effect in association with the required pharmaceutical carrier. The

specification for the dosage unit forms of the invention are dictated by and

directly dependent on the unique characteristics of the active compound and

the particular therapeutic effect to be achieved, and the limitation inherent in

the art of compounding such an active compound for the treatment of

individuals.

Toxicity and therapeutic efficacy of such compounds can be determined

by standard pharmaceutical procedures in cell cultures or experimental

animals, e.g., for determining the LD50 (the dose lethal to 50% of the

population) and the ED50 (the dose therapeutically effective in 50% of the

population). The dose ratio between toxic and therapeutic effects is the

therapeutic index and it can be expressed as the ratio LD50/ED50.

Compounds which exhibit large therapeutic indices are preferred.

The data obtained from the cell culture assays and animal studies can be

used in formulating a range of dosage for use in humans. The dosage of such

compounds lies preferably within a range of circulating concentrations that

include the ED50 with little or no toxicity. The dosage may vary within this

range depending upon the dosage form employed and the route of

administration utilized. For any compound used in the method of the

invention, the therapeutically effective dose can be estimated initially from

assays and animal models described herein. Such information can be used to

more accurately determine useful doses in humans.

The skilled artisan will appreciate that certain factors may influence the

dosage required to effectively treat a subject, including, but not limited to, the severity of the disease or disorder, previous treatments, the general health

and/or age of the subject, and other diseases present. Moreover, treatment of a

subject with a therapeutically effective amount of a composition can include a

single treatment, or preferably, can include a series of treatments. The initial

dose may be followed up with a booster dosage after a period of about 2 days

to 2 weeks to maintain the innate immunity. Further booster dosages may also

be administered.

The effective compositions of the present invention may be employed in

such forms as capsules, liquid solutions, suspensions or elixirs for oral

administration, or sterile liquid forms such as solutions or suspensions. Any

inert acceptable carrier may preferably be used or any such acceptable carrier

in which the compositions of the present invention have suitable solubility

properties for use of the present invention.

Methods of administration will vary in accordance with the type of

disorder and disease sought to be controlled or eradicated. The dosage of the

composition will be dependent on a number of factors, including the route of

administration. A person of ordinary skill in the art may easily and readily

titrate the dosage for an enhanced immune response.

The actual effective amounts of compounds can vary according to the

specific composition being utilized, the mode of administration, and the age,

weight, and condition of the individual. As used herein, an effective amount of

the drug is an amount which elicits or boosts an innate immune response.

Dosages for a particular individual may be determined by a person of ordinary

skill in the art using conventional considerations, e.g., by a means of appropriate, conventional pharmacological protocol.

The invention also provides kits for carrying out the therapeutic

regimens of the invention. Such kits comprise in one or more containers

therapeutically or prophylactically effective amounts of the compositions in a

pharmaceutically acceptable form. The composition in a vial of a kit of the

invention may be in the form of a pharmaceutically acceptable solution, e.g., in

combination with sterile saline, dextrose solution, or buffered solution, or other

pharmaceutically acceptable sterile fluid. Alternatively, the composition may

be lyophilized or desiccated; in the instance, the kit optionally further

comprises in a container a pharmaceutically acceptable solution (e.g., saline,

dextrose solution, etc.), preferably sterile, to reconstitute the composition to

form a solution for injection purposes.

In another embodiment, a kit of the invention further comprises a needle

or syringe, preferably packaged in sterile form, for injecting the composition,

and/or a packaged alcohol pad. Instructions are optionally included for

administration of the composition by a clinician or by a patient.

Various cytokines, antibiotics, and other bioactive agents also may be co-

administered with the compositions described herein. For example, various

known cytokines, i.e., interleukin-lα (IL-l ), interleukin-lβ (IL-lβ), interleukin-

2 (IL-2), interleukin-3 (IL-3), interleukin-4 (IL-4), interleukin-5 (IL-5),

interleukin-6 (IL-6), interleukin-7 (IL-7, interleukin-8 (IL-8), interleukin-9 (IL-9),

interleukin-10 (IL-10), inter leukin- 11 (IL-11), IL-12, interferon-α (INFα),

interferon-β (INFβ), interferon-γ (INFγ), tumor necrosis factor a, tumor

necrosis factor β (TNFβ), granulocyte colony stimulating factor (G-CSF), granulocyte/macrophage colony stimulating factor (GM-CSF), and

transforming growth factor β (TGF-β) may be co-administered with the

composition in order to maximize the physiological response. However, it is

anticipated that other but as yet undiscovered cytokines may be effective in the

invention. In addition, conventional antibiotics may be co-administered wit

the compositions. The choice of suitable antibiotics will, however, be

dependent upon the disease in question.

The following examples are meant to be illustrative and not limiting in

any way.

EXAMPLES

A well-established animal model was used to assess whether different

formulations of CpG oligodeoxynucleotide and QS-21 together or alone could

function as stimulators of innate immunity. In brief, experiments were set up

to compare QS-21 to a recently reported immunostimulatory CpG motif. An

immunostimulatory CpG sequence (e.g., 1826), reported to serve as an adjuvant

in mice, was selected. One experiment evaluated whether the CpG motif alone,

QS-21 alone, or the CpG/QS-21 combination may serve to increase innate

immunity by activation of natural killer cells.

The experiments were performed using materials from the following

suppliers: QS-21 and QS-7 (Aquila Biopharmaceuticals); CpG

oligodeoxynucleotides included the phosphorothiate-modified sequences 1826

TCCATGACGTTCCTGACGTT and 2006 TCGTCGTTTTGTCGTTTTGTCGTT (Life Technologies (Gibco)), murine recombinant IL-12 (Pharmingen), andYAC-

1 cells (ATCC), a natural killer cell-sensitive target line.

Example 1 Natural Killer Cell Activity Induced by QS-21 and CpG /QS-21

Assessment of natural killer cell activity was carried out by an

adaptation of a published method (Hashimoto et al., /. Immunol. 163: 583

(1999)). Balb/c mice (4 per group, female, 8-10 weeks of age) were

administered one of five different candidate compositions at days 1 and 2. The

compositions evaluated were (1) saline (negative control), (2) 10 ug QS-21, (3)

10 ug CpG (sequence 1826), (4) 0.5 ug murine IL-12 (positive control for NK cell

activation), and (5) a combination of 10 ug QS-21 and 10 ug CpG in 0.2 ml

saline. All test compositions were administered subcutaneously except for

murine IL-12, which was administered intraperitoneally. Splenocytes were

removed from the mice at day 3 for use as effector cells in the natural killer cell

assay. Such cells were immediately used in a standard ⁵¹Cr release lysis assay.

YAC-1 cells (loaded with ⁵¹Cr) were used as target cells. The lysis of this NK

cell-sensitive line is indicative of NK cell activation in the splenocyte

population.

The results, as shown in the graphic representation of Figure 1, indicate

that minimal lysis (less than 20% at 100:1 effector to target ratio) was observed

after the administration of saline. CpG alone slightly enhanced the NK cell

activity. Surprisingly, QS-21 alone induced an NK cell response that was

higher than CpG and that was nearly equivalent to the positive control, murine IL-12. Still more surprisingly, the combination of QS-21 and CpG induced the

strongest NK cell response.

Example 2

Time Dependence of Natural Killer Cell

Activity Induced by QS-21 and CpG /QS-21

The time dependence of the administration of CpG /QS-21 on natural

killer cell activation was investigated. Balb/c mice (5 per group, female, 8-10

weeks of age) were administered a mixture of 10 ug QS-21 and 10 ug CpG

sequence 1826 in a total volume of 0.2 ml by subcutaneous route seven days

before (-7 d), three days before (-3 d), two days before (-2 d), and one day

before (-1 d) assay of natural killer cell activity. Splenocytes were removed

from the mice at day 0 for use as effector cells in the natural killer cell assay.

YAC-1 cells (loaded with ⁵¹Cr) were used as target cells. Natural killer cell lysis

was apparent if the formulation of QS-21 /CpG was administered one, two, or

three days prior to the assay, but not if the formulation was administered seven

days prior to the assay (Figure 2). This confirms the transient nature of the

natural killer cell activity.

Example 3 Dose Response of QS-21, QS-7, and CpG Sequence 1826

Balb/c mice (5 per group, female, 8-10 weeks of age) were administered

individually QS-7, QS-21, or CpG sequence 1826 at three different dose levels

(3, 10, 30 ug) to determine a dose response curve for these individual

compounds. The compositions evaluated were (1) saline (negative control), (2)

3 ug QS-21, (3) 10 ug QS-21, (4) 30 ug QS-21, (5) 3 ug QS-7, (6) 10 ug QS-7, (7) 30 ug QS-7, (8) 3 ug sequence CpG 1826, (9) 10 ug CpG sequence 1826, and (10) 30

ug CpG sequence 1826. All test compositions were administered

subcutaneously at day 1 and day 2. Splenocytes were removed from the mice

at day 3 for use as effector cells in the natural killer cell assay. YAC-1 cells

(loaded with ⁵¹Cr) were used as target cells.

The results, as shown in the graphic representation of Figure 3, confirm

that QS-21, QS-7, and CpG sequence 1826 enhance NK activity in a dose

dependent fashion. The NK cell activity induced by QS-21 or CpG sequence

1826 was higher than that induced by QS-7 at an equivalent dose. This

experiment confirmed that NK activity could be induced by another saponin.

Example 4 NK Activity Induced by QS-21 and /or QS-7 and CpGs Sequences 1826 and 2006

This experiment evaluated the natural killer cell stimulating activity

induced by various formulations: (1) QS-21 (10 ug), (2) QS-7 (10 ug), (3) CpG

sequence 1826 (10 ug), (4) CpG sequence 2006 (10 ug), (5) QS-21 (10 ug) + CpG

sequence 1826 (10 ug), (6) QS-21 (10 ug) + CpG 2006 (10 ug), (7) QS-7 (10 ug) +

CpG sequence 1826 (10 ug), (8) QS-7 (10 ug) + CpG sequence 2006 (10 ug), (9)

QS-7 (10 ug) and QS-21 (10 ug) and (10) saline. Balb/c mice (5 per group,

female, 8-10 weeks of age) were administered the above formulations by

subcutaneous route on day 1 and day 2. Splenocytes were removed from the

mice at day 3 for use as effector cells in the natural killer cell assay. YAC-1 cells

(loaded with ⁵¹Cr) were used as target cells. As evident in the graphic representation of Figure 4, the results show

that the three formulations inducing the strongest response are QS-21 /CpG

sequence 1826, QS-21 /CpG sequence 2006, and QS-7/CpG sequence 1826. This

indicates that mixtures of alternate CpG (sequence 2006) with QS-21 also lead

to a heightened NK cell response; likewise mixtures of alternate saponins (QS-

7) with CpG can also lead to a heightened NK cell response.

Example 5

Protection of Mice from Listeria Monocytogenes by

Administration of Formulations that Enhance Innate Immunity

Another method of demonstration of enhanced innate immunity is in an

in vivo challenge model. The protective benefit of formulations of QS-21 or QS-

21 /CpG was demonstrated in a Listeria monocytogenes challenge model in

Balb/c mice. Immunity to Listeria monocytogenes can be mediated by innate

immunity and is believed to rely on cytokines produced by natural killer cells

(Harty, et al., Curr. Opin. Immunol 8:526) (1996)). Hence, this challenge model

was used as a demonstration of the benefit of enhanced innate immunity raised

by administration of the inventive compositions.

Balb/c mice (5 per group, female, 8-10 weeks of age) were administered

the following formulations on day 0: Group 1: saline, subcutaneous route.

Group 2: 10 ug QS-21 and 10 ug of CpG sequence 1826, subcutaneous route.

Group 3: 10 ug QS-21, subcutaneous route. Group 4: 10 ug CpG sequence

1826, subcutaneous route. Group 5: 0.5 ug recombinant murine IL-12,

intraperitoneal route. A total volume of 0.2 ml was administered. On day 3,

mice were challenged by the intraperitoneal route with 10⁵ colonies of Listeria monocytogenes strain 10403s. Spleens were removed at 96 hours after challenge,

homogenized, and then cultured in serial 10-fold dilutions overnight on agar

plates. Listeria monocytogenes colonies were counted, the number of organisms

per spleen determined, and then the geometric mean and standard error were

determined for each group. A two-tailed, paired student's t-test of the loglO

colonies /spleen was used to show statistical significance.

Figure 5 is a graphic representation showing the results of the challenge.

The group with the highest spleen colony count was the group receiving saline

(control group). All other groups had lower mean colony counts in spleen.

The lowest colony counts were in the CpG + QS-21 group and in the QS-21

group, both of which reached statistical significance (p<0. 05). This suggests

that these two formulations raise an innate immunity that is protective against

a challenge with a bacterium.

The invention now being fully described, it will be apparent to one of

ordinary skill in the art that many changes and modifications can be made

thereto without departing from the spirit or scope of the invention as set forth

below.

Claims

We claim:

1. A composition comprising:

(a) a saponin; and

(b) an oligonucleotide comprising at least one unmethylated CpG

dinucleotide.

2. The composition as claimed in claim 1, wherein the saponin is

derived from Quillaja saponaria.

3. The composition as claimed in claim 2, wherein the saponin is

chemically modified.

4. The composition as claimed in claim 2, wherein the saponin

comprises a substantially pure saponin.

5. The composition as claimed in claim 4, wherein the substantially

pure saponin comprises QS-7, QS-17, QS-18, or QS-21.

6. The composition as claimed in claim 5, wherein the substantially

pure saponin comprises QS-21.

7. The composition as claimed in claim 1, wherein the

oligonucleotide is chemically modified.

8. The composition as claimed in claim 7, wherein the

oligonucleotide is modified with at least one phosphorothioate internucieotide

linkage.

9. The composition as claimed in claim 1, wherein the

oligonucleotide comprises a CpG motif having the formula 5'X.CGX₂3',

wherein at least one nucleotide separates consecutive CpGs, and wherein X. is

adenine, guanine, or thymine, and X₂ is cytosine, thymine, or adenine.

10. The composition as claimed in claim 9, wherein the CpG motif

comprises TCCATGACGTTCCTGACGTT or

TCGTCGTTTTGTCGTTTTGTCGTT.

11. The composition as claimed in claim 1, wherein the composition

increases an innate immune response when administered to a mammal.

12. The composition as claimed in claim 1, wherein the composition

increases an innate immune response when administered to a human.

13. The composition as claimed in claim 1, wherein the composition

increases an innate immune response when administered to a mammal other

than a human.

14. The composition as claimed in claim 11, wherein the composition

further enhances a natural killer cell response.

15. The composition as claimed in claim 14, wherein the composition

further enhances a natural killer cell response in a positive synergistic manner.

16. A method for stimulating innate immunity comprising

administering an effective amount of a composition comprising:

(a) a saponin; and

(b) an oligonucleotide comprising at least one unmethylated CpG

motif to an individual.

17. The method as claimed in claim 16, wherein the saponin is

derived from Quillaja saponaria.

18. The method as claimed in claim 16, wherein the saponin is

chemically modified.

19. The method as claimed in claim 17, wherein the saponin

comprises a substantially pure saponin.

20. The method as claimed in claim 19, wherein the substantially

pure saponin comprises QS-7, QS-17, QS-18, or QS-21.

21. The method as claimed in claim 20, wherein the substantially

pure saponin comprises QS-21.

22. The method as claimed in claim 16, wherein the oligonucleotide is

chemically modified.

23. The method as claimed in claim 22, wherein the oligonucleotide is

modified with at least one phosphorothioate internucieotide linkage.

24. The method as claimed in claim 16, wherein the oligonucleotide

comprises a CpG motif having the formula 5'X.CGX₂3', wherein at least one

nucleotide separates consecutive CpGs, and wherein X_j is adenine, guanine, or

thymine, and X₂ is cytosine, thymine, or adenine.

25. The method as claimed in claim 24, wherein the CpG motif

comprises TCCATGACGTTCCTGACGTT or

TCGTCGTTTTGTCGTTTTGTCGTT.

26. The method as claimed in claim 16, wherein the composition

stimulates an innate immune response when administered to a mammal.

27. The method as claimed in claim 16, wherein the composition

stimulates an innate immune response when administered to a human.

28. The method as claimed in claim 16, wherein the composition

stimulates an innate immune response when administered to a mammal other

than a human.

29. The method as claimed in claim 16, wherein the method further

enhances a natural killer cell response.

30. The method as claimed in claim 16, wherein the method further

enhances a natural killer cell response in a positive synergistic manner.

31. A method for stimulating innate immunity comprising

administering an effective amount of a composition comprising a saponin to an

individual.

32. The method as claimed in claim 31, wherein the saponin is

derived from Quillaja saponaria.

33. The method as claimed in claim 32, wherein the saponin is

modified.

34. The method as claimed in claim 32, wherein the saponin

comprises a substantially pure saponin.

35. The method as claimed in claim 34, wherein the substantially

pure saponin comprises QS-7, QS-17, QS-18, or QS-21.

36. The method as claimed in claim 35, wherein the substantially

pure saponin comprises QS-21.

37. The method as claimed in claim 32, wherein the composition

stimulates an innate immune response when administered to a mammal.

38. The method as claimed in claim 32, wherein the composition

stimulates an innate immune response when administered to a human.

39. The method as claimed in claim 32, wherein the composition

stimulates an innate immune response when administered to a mammal other

than a human.

40. The method as claimed in claim 32, wherein the method further

enhances a natural killer cell response.

41. The method as claimed in claim 40, wherein the method further

enhances a natural killer cell response in a positive synergistic manner.

42. The composition as claimed in claim 12, wherein the composition

further enhances a natural killer cell response.

43. The composition as claimed in claim 13, wherein the composition

further enhances a natural killer cell response.