WO2001004296A1 - Rbp1 polypeptides and uses thereof - Google Patents

Abstract

The invention features methods for modulating cell proliferation, methods for identifying compounds that modulate cell proliferation, and methods for determining whether a patient has a cell proliferation disease. The invention also features pharmaceutical compositions that include RBP1 polypeptides or nucleic acids, and uses thereof.

Description

RBP1 POFYPEPTIDES AND USES THEREOF Background of the Invention The invention relates to the regulation of gene transcription and cell proliferation.

Control of gene expression by the E2F family of transcription factors plays an important role in the cell cycle and growth arrest, as E2F regulates expression of a number of genes required for DNA synthesis and cell cycle progression. E2F appears to be a major target of the retinoblastoma (RB) family of growth suppressors, pRB, pl30 and pl07, that bind to and inhibit E2F. Interactions between the E2F and RB families are cell cycle-dependent. pRB-E2F complexes are found throughout the cell cycle and in growth-arrested cells, and inhibition of E2F activity appears to be regulated at least in part by phosphorylation of pRB by cyclin-dependent protein kinases (Cdk). pl07-E2F complexes are found largely in late Gl and S-phase, and also may regulate cell cycle progression. pl30-E2F complexes are prominent in growth-arrested cells; in this context, the complexes have been shown to lack Cdk2 and cyclins.

Summary of the Invention In a first aspect, the invention features a method for modulating (e.g., decreasing) proliferation of a cell. The method includes contacting the cell with an RBP1 polypeptide that modulates proliferation of the cell. In one preferred embodiment, contacting is achieved by expressing in the cell a nucleic acid molecule encoding the RBP1 polypeptide. In a second aspect, the invention features another method for modulating

(e.g., decreasing) proliferation of a cell. The method includes contacting the cell with a compound that modulates RBP1 biological activity or expression. In a third aspect, the invention features a method for identifying a compound that modulates cell proliferation. The method generally includes contacting a cell with a candidate compound and monitoring the level of expression of an RBPl polypeptide, wherein a change in the level of expression in response to the candidate compound, relative to a level of expression in a cell not contacted with the candidate compound, identifies the compound as a compound that modulates cell proliferation.

In a fourth aspect, the invention features another method for identifying a compound that modulates cell proliferation. The method includes: (a) providing an RBPl polypeptide having biological activity, (b) contacting the polypeptide with a candidate compound, and (c) monitoring the level of the biological activity of the RBPl polypeptide, wherein a change in the level of biological activity in response to the candidate compound, relative to a level of biological activity of an RBPl polypeptide not contacted with the candidate compound, identifies the compound as a compound that modulates cell proliferation. The RBPl polypeptide can be in a cell or in a cell-free system. In a fifth aspect, the invention features a method for determining whether a first mammal (e.g., a human patient) has a cell proliferation disease or increased likelihood of developing the disease. The method includes measuring the level of expression of an RBPl polypeptide in a sample from the mammal, wherein an increase in the level of expression of the RBPl polypeptide, relative to a matched sample from a second mammal (e.g., an unaffected person) indicates that the first mammal has the cell proliferation disease or increased likelihood of developing the disease. In preferred embodiments, the expression is measured by assaying the amount of RBPl polypeptide or RBPl RNA in the sample.

In a sixth aspect, the invention features another method for determining whether a first mammal (e.g., a human patient) has a cell proliferation disease or an increased likelihood of developing the disease. The method includes measuring the level of RBPl biological activity in a sample from the mammal, wherein an alteration in the level of the biological activity, relative to a level of RBPl biological activity in a matched sample from a second mammal (e.g., an unaffected person), indicates that the first mammal has the disease or increased likelihood of developing the disease.

In one preferred embodiments of the invention, the RBPl biological activity is binding of the RBPl polypeptide to an HDAC or to a protein (e.g., SAP30, SinA, or SinB) that is part of a protein complex containing an HDAC. Preferably, binding of the RBPl polypeptide to the HDAC or the protein does not require the presence of an RB family member. In other preferred embodiments, the biological activity is binding of the RBPl polypeptide to an E2F protein or is repression of E2F-mediated transcription. Preferably, the repression of E2F-mediated transcription does not require the presence of an HDAC protein. In particularly preferred embodiments of the invention, the cell is from a mammal (e.g., a human or a rodent) or in a mammal.

In a seventh aspect, the invention features a method of repressing transcription in a cell. The method includes introducing into the cell a polypeptide having: (i) a repressor domain from RBPl, and (ii) a DNA binding domain. In one preferred embodiment, this is achieved by expressing in the cell a nucleic acid molecule encoding the repressor domain from RBPl and the DNA binding domain.

In an eighth aspect, the invention features a polypeptide that includes: (i) a repressor domain from RBPl, and (ii) a DNA binding domain. Preferably, the repressor domain includes amino acids 241-452 or amino acids 1167-1257 of SEQ ID NO: 4.

In a ninth aspect, the invention features a nucleic acid molecule encoding a polypeptide having: (i) a repressor domain from RBPl, and (ii) a DNA binding domain. In a tenth aspect, the invention features a composition that includes a substantially purified RBPl polypeptide formulated in a physiologically acceptable carrier.

In an eleventh aspect, the invention features composition that includes a substantially purified antibody that specifically binds an RBPl polypeptide formulated in a physiologically acceptable carrier.

In a twelfth aspect, the invention features a kit for diagnosing a mammal (e.g., a human) with a cell proliferation disease or an increased likelihood of developing the disease. The kit includes a substantially pure antibody that specifically binds an RBPl polypeptide. Preferably, the kit also includes a means for detecting the binding of the antibody to the RBPl polypeptide.

By "interact" or "bind" is meant that two polypeptides can transitorily bind, either directly or indirectly, to each other. Indirect binding can take place, for example, through the formation of a multi-protein complex. For example, HDACs are known to be part of a multi-protein complex that also includes, e.g., SAP30, SinA, and SinB (Pazin and Kadonaga, Cell 89:325-328, 1997). The interaction is dependent on inherent properties of the two polypeptides, and specifically excludes non-specific (e.g., strictly Brownian) contact. Preferably, this interaction can be disrupted or prevented by alteration in the primary, secondary, or tertiary structure of one or both of the polypeptides.

By a "transcriptional repressor domain" is meant a polypeptide domain that retains its transcriptional repressor function when the domain is transferred to a heterologous protein. Preferably, the heterologous protein contains nuclear localization and DNA-binding domains. By "RBP 1 biological activity" is meant (i) RBP 1 binding to an HDAC protein or a protein complex containing an HDAC, (ii) repression of E2F transcriptional activity, and (iii) arrest or decrease of cell cycle progression. In addition to RBPl, other, related, polypeptides are highly likely to have similar biological activities as RBPl, and, thus, are considered to be part of the invention. These polypeptides include ARID domain-containing polypeptides, such as the ones described herein, and the polypeptide fragment of GenBank accession number AAD41239 (PID g5257005). By "E2F" or "E2F protein" is meant a protein having E2F transcriptional activity. Preferred E2F proteins include E2F-1, E2F-2, E2F-3, E2F-4, and E2F- 5.

By "RB family member" is meant the tumor suppressors pRb, pi 30, and pl07. By an "HDAC" is meant any histone deacetylase protein. Preferred

HDACs are HDAC-1, HDAC-2, and HDAC-3.

By a "substantially purified" protein or antibody is meant a protein or antibody that has been separated from components that naturally accompany it. Typically, the protein is substantially purified when it is at least 60%, by weight, free from the proteins and naturally-occurring organic molecules with which it is naturally associated. Preferably, the preparation is at least 75%, more preferably at least 90%, and most preferably at least 99%, by weight, a polypeptide of the invention. A substantially purified protein of the invention may be obtained, for example, by extraction from a natural source (for example, a virus), by expression of a recombinant nucleic acid encoding such a protein, or by chemically synthesizing the protein. Purity can be measured by any appropriate method, for example, column chromatography, polyacrylamide gel electrophoresis, or by HPLC analysis.

A protein is substantially free of naturally associated components when it is separated from those contaminants which accompany it in its natural state. Thus, a protein which is chemically synthesized or produced in a cellular system different from the cell from which it naturally originates will be substantially free from its naturally associated components. Accordingly, substantially purified polypeptides include those derived from eukaryotic organisms but synthesized in E. coli or other prokaryotes.

By "compound" or "candidate compound" is meant a chemical, be it naturally-occurring or artificially-derived, that is assayed for its ability to modulate an alteration in reporter gene activity or protein levels, by employing one of the assay methods described herein. Test compounds may include, for example, peptides, polypeptides, synthesized organic molecules, naturally occurring organic molecules, nucleic acid molecules, and components thereof. By "assaying" is meant analyzing the effect of a treatment, be it chemical or physical, administered to whole animals or cells derived therefrom. The material being analyzed may be an animal, a cell, a lysate or extract derived from a cell, or a molecule derived from a cell. The analysis may be, for example, for the purpose of detecting altered gene expression, altered RNA stability, altered protein stability, altered protein levels, or altered protein biological activity. The means for analyzing may include, for example, antibody labeling, immunoprecipitation, phosphorylation assays, and methods known to those skilled in the art for detecting nucleic acids and polypeptides.

By "modulating" is meant changing, either by decrease or increase, biological activity. By "a decrease" is meant a lowering in the level of biological activity, as measured by a lowering of (i) RBPl protein, as measured by ELISA, (ii) RBPl transcriptional repression of E2F-dependent transcription, as measured, for example, by reporter gene assay (/ cZ/β-galactosidase, green fluorescent protein, luciferase, etc.), (iii) RBPl mRNA levels, as measured by PCR relative to an internal control, for example, a "housekeeping" gene product such as β-actin or glyceraldehyde 3-phosphate dehydrogenase (GAPDH), (iv) the amount of HDACs (or any other protein that is part of a protein complex that contains an HDAC) that interact with RBPl, (v) the amount of E2F protein that interacts with RBPl, and (vi) RBPl -mediated cell cycle arrest. In all cases, the lowering is preferably by 20%, more preferably by 40%, and even more preferably by 70%.

By an "increase" is meant a rise in the level of biological activity, as measured by an increase of: (i) RBPl protein, as measured by ELISA, (ii) RBPl transcriptional repression of E2F-dependent transcription, as measured, for example, by reporter gene assay (/αcZ/β -galactosidase, green fluorescent protein, luciferase, etc.), (iii) RBPl mRNA levels, as measured by PCR relative to an internal control, for example, a "housekeeping" gene product such as β- actin or glyceraldehyde 3-phosphate dehydrogenase (GAPDH), (iv) the amount of HDACs (or any other protein that is part of a protein complex that contains an HDAC) that interact with RBPl, (v) the amount of E2F protein that interacts with RBPl, and (vi) RBPl -mediated cell cycle arrest. Preferably, the increase is by 5% or more, more preferably by 15% or more, even more preferably by 2- fold, and most preferably by at least 3 -fold.

By "promoter" is meant a minimal sequence sufficient to direct transcription. Also included in the invention are those regulatory elements that are sufficient to render promoter-dependent gene expression controllable for cell type-specific, tissue-specific, temporal-specific, or inducible by external signals or agents; such elements may be located in the 5' or 3' or intron sequence regions of the native gene.

By "operably linked" is meant that a gene and a promoter are connected in such a way as to permit gene expression when the appropriate molecules (e.g., transcriptional activator proteins) are bound to the promoter. By "pharmaceutically acceptable" is meant that a carrier is substantially non-toxic to the treated mammal and retains the therapeutic properties of the compound with which it is administered. One exemplary pharmaceutically acceptable carrier is physiological saline solution. Other physiologically acceptable carriers and their formulations are known to one skilled in the art and described, for example, in Remington: The Science and Practice of Pharmacy, (19th ed.) ed. A.R. Gennaro, 1995, Mack Publishing Company, Easton, PA. By a "matched" sample is meant one derived from the same or similar cells or tissue, from an organism of the same species, to which it is being compared.

Other features and advantages of the invention will be apparent from the following description of the preferred embodiments thereof.

Description of the Drawings

Fig. 1 is a photograph of a autoradiograph showing analysis of E2F complexes by EMS A. Components of the E2F complexes were identified by antibody "supershift" experiments as described herein. Lane 1 : asynchronously growing cells; lanes 2 to 4: extracts from asynchronously growing cells incubated in the presence anti-pRB serum (lane 2), anti-pl07 serum SD9 (lane 3), or anti-pl30 serum C-20 (lane 4); lane 5: serum-starved cells; lanes 6 to 8: extracts from serum-starved cells incubated in the presence of anti-pRB (lane 6), anti-pl07 (lane 7) or anti-pl30 (lane 8) sera; lanes 9 to 12: asynchronously growing cells (lane 9), serum-starved cells (lane 10), or extracts from serum-starved cells incubated in the presence of anti-pl30 antibody (lane 11) or anti-RBPl serum (lane 12); lanes 9 A to 12 A: the same samples as in lanes 9 to 12 analyzed using a polyacrylamide:bis-acrylamide ratio of 19: 1. The positions of pl30-E2F, and pRB- containing E2F complexes (RB) and those of "supershifted" complexes (*pl30-E2F and *RB) are as indicated. Figs. 2 A and 2B are schematic illustrations showing the effect of RBPl on E2F-dependent transcription. Human C33A cells were transiently transfected with E2Fl-Luc(Wt) (Fig. 2 A), which contains firefly luciferase linked to an E2F-1 specific promoter, or E2Fl-Luc(mE2F) (Fig. 2B), which contained mutated E2F recognition sites. They were also co-transfected with increasing amount (from 1 μg - 4 μg) of plasmids pCMVRBPl-HA (human RBP 126), pCMVRBPlΔLCE-HA (a deletion mutant lacking RBPl residues 921-1056 including the Leu-X-Cys-X-Glu binding site), and, in some cases, plasmids expressing human pRB, pl30, or the product of the 12S Ad5 E1A mRNA subcloned into pcDNA3 (Invitrogen, Carlsbad, CA) and expressed under the cytomegalovirus (CMV) promoter. Cells were harvested at 40 hours post-transfection and luciferase activity was measured as previously described (Weintraub et al., Nature 375:812-815, 1995). Results are presented as a percentage of that obtained with reporter plasmid alone. Fig. 2C is a schematic illustration showing the effects of RBPl (Wt) and RBPl(ΔLCE) on pRB and pi 30 repressed E2Fl(Wt) promoter. Cells were transfected as in Fig. 2 A. Additional samples were assayed by co-transfecting plasmids expressing pRB or p 130 with increasing amount of plasmids pCM VRBP 1 -HA expressing RBPl(Wt) or pCMVRBPlΔLCE-HA expressing RBPl(ΔLCE) mutant. Measured luciferase activities are presented as a percentage of that obtained with reporter plasmid alone and are plotted against amount of pCMVRBPl-HA or pCMVRBPl(ΔLCE) plasmids transfected. Fig. 3 A is a schematic illustration showing inhibition of colony formation by RBPl. CV-1 cells were transfected with plasmids expressing neo and either wild- type RBPl or a truncated form of RBPl that lacks the LXCXE-RB binding motif. Cells were grown under drug selection for two weeks. Colonies were then counted and the calculated averages were compared with the number of colonies obtained with cells expressing neo alone

(pcDNA3). Fig. 3B is a series of photographs showing morphology of colonies resulting from the experiment described in Fig. 3A.

Fig. 4A is a schematic illustration showing repression of Gal4-dependent transcription by RBPl . Fig. 4B is a schematic illustration showing RBPl deletion mutants and a summary of CAT activity as a percent of control.

Figs. 5 A and 5B are a series of photographs showing interactions of pRB and pi 07 with histone deacetylases. The locations of hypophosphorylated species of pRB and pi 07 are as indicated.

Figs. 6A - 6D show in vivo interaction of the small 'pocket' of pRB with histone deacetylases. cDNAs encoding Gal4DBD fused with the 'pocket' of pRB and those encoding Flag-tagged HDAC1, HDAC2, or HDAC3 were overexpressed in H1299 (Fig. 6A). Anti-Gal4DBD antibody was used to immunoprecipitate Gal4-tagged overexpressed proteins and co-immunoprecipitation of HDACs was then detected by western blotting. WC - whole cell extracts; IP - anti-Gal4 immunoprecipitated proteins. Binding studies similar to those described in Fig. 6A were also performed in 293T cells (Fig. 6B) and 293 cells (Fig. 6C). A modified binding experiment similar to that described above was performed in HI 299 cells by incubating cell extracts with increasing amounts (0 to 20 μg) of El A protein (first exon containing the LXCXE motif) fused to GST (GST-El A) (Fig. 6D). The positions of migration of Flag-tagged HDAC1 (open arrows), HDAC2 (closed arrow) and HDAC3 (arrowhead) are as indicated. Figs. 7A - 7E are a series of photographs showing in vivo interaction of

RBPl with histone deacetylases. Binding studies similar to those described in Fig. 6 were performed in H1299 cells (Fig. 7A) or 293T cells (Fig. 7B) using Gal4-RBP1 instead of Gal4-pRB. Binding studies were also performed in 293T cells transfected with the RBPl -HA construct and Gal4-HDAC1, Gal4-HDAC2, and Gal4-HDAC3 constructs (Fig. 7C). Coimmunoprecipitation studies similar were done in both HI 299 and 293T cells. In addition to the antisera described, antibody against pRB, pl30, pl07, and the HA-epitope were also used (Fig. 7D). A binding study was also done using the Gal4-RBP1- ΔLCE and RBP1-ΔLCE-HA mutants, each of which lacks the LXCXE 'pocket' -binding motif (Fig. 7E). The positions of migration of Flag-tagged HDACl (open arrows), HDAC2 (closed arrow) and HDAC3 (arrowhead) are as indicated. Figs. 8 A - 8D are a series of schematic illustrations showing mapping of transcriptional repression domains in RBPl and the effect of trichostatin A (TSA) on RBPl repression activity. CAT assays were performed in CHO cells using G5TKCAT as reporter. A summary of repression results obtained in experiments described in Fig. 8A are shown at the left of Fig. 8B. The effect of TSA on repression is shown in Fig. 8C. Repression assays were carried out as in Fig. 8A, except that some cells were incubated with 330 nM TSA for 24 hours prior to harvesting and the G5MLPCAT reporter was assayed instead of the G5TKCAT reporter. Fig. 8D shows a similar experiment to that described in Fig. 8C, except performed using a reporter construct consisting of the E2F-1 promoter linked to a cDNA encoding luciferase and either RBP 1 , RBP 1 -ΔLCE, the 'pocket' of pRB, or an inactive pRB 'pocket'- mRB(C706F) mutant.

Fig. 9 is a schematic illustration showing mapping of specific binding of HDAC3 to RBPl. Binding studies were performed in 293T cells using either Gal4-Rl, Gal4-R2(1314-C)/(1263-C), Gal4 alone, Gal4-RBPl(wt), Gal4-ARID, Gal4-ΔR1 , or Gal4-Δ93C(Δ-R2).

Detailed Description of the Invention We have discovered that RBPl, a known pRB pocket-binding protein, possesses transcriptional repression activity and associates with pl30-E2F and pRB-E2F complexes specifically during growth arrest. Overexpression of RBPl both inhibited E2F-dependent gene expression and suppressed cell growth. Thus, we believe that repression of E2F-dependent transcription by RBPl via RB family members plays a central role in inducing growth arrest. We have also discovered that RBPl interacts with histone deacetylases (HDACs). Unlike pRB-histone deacetylase interactions, however, 'pocket' -binding El A protein and large T antigen do not affect interactions between RBPl and any of the histone deacetylases. It was previously thought that HDACl or HDAC2 interacted directly with the RB pocket via degenerate IXCXE motifs, but this model does not account for interactions of HDAC3, which lacks such sequence. Our data indicated that binding of HDAC3 to RB family members also requires the pocket, suggesting that such interactions may be indirect and rely on a pocket-binding protein, such as RBPl . Our results show RBPl 's functional importance in the RB family-mediated repression of E2F-dependent transcription, by linking histone deacetylases to the pockets of RB family proteins.

We have also identified two repressor domains in RBPl. One of these domains is HDAC-dependent, while the other is HDAC-independent. Thus, we have found for the first time that RBPl is a key member of the

RB-E2F complex, serving in part as a link between RB and HDACs, but also serving a second, HDAC-independent, function. This discovery allows for the development of drugs that modulate or mimic RBP 1 biological activity or that modulate its expression. These drugs have use in the treatment of disorders characterized by abnormal proliferation or cell death.

Production of RBPl polypeptide

For protein expression, eukaryotic and prokaryotic expression systems may be generated in which RBPl gene sequences are introduced into a plasmid or other vector, which is then used to transform living cells. Constructs in which the RBPl cDNAs containing the entire open reading frames inserted in the correct orientation into an expression plasmid may be used for protein expression. Alternatively, portions of the RBPl gene sequences, including wild-type or mutant RBPl sequences, may be inserted. Prokaryotic and eukaryotic expression systems allow various important functional domains of the RBPl proteins to be recovered as fusion proteins and then used for binding, structural and functional studies and also for the generation of appropriate antibodies. Since RBPl protein expression may induce cell cycle arrest in some cell types, it may be desirable to express the protein under the control of an inducible promoter.

Typical expression vectors contain promoters that direct the synthesis of large amounts of mRNA corresponding to the inserted RBPl nucleic acid in the plasmid bearing cells. They may also include eukaryotic or prokaryotic origin of replication sequences allowing for their autonomous replication within the host organism, sequences that encode genetic traits that allow vector-containing cells to be selected for in the presence of otherwise toxic drugs, and sequences that increase the efficiency with which the synthesized mRNA is translated. Stable long-term vectors may be maintained as freely replicating entities by using regulatory elements of, for example, viruses (e.g., the OriP sequences from the Epstein Barr Virus genome). Cell lines may also be produced which have integrated the vector into the genomic DNA, and in this manner the gene product is produced on a continuous basis. Expression of foreign sequences in bacteria, such as Escherichia coli, requires the insertion of the RBPl nucleic acid sequence into a bacterial expression vector. This plasmid vector contains several elements required for the propagation of the plasmid in bacteria, and expression of inserted DNA of the plasmid by the plasmid-carrying bacteria. Propagation of only plasmid- bearing bacteria is achieved by introducing in the plasmid selectable marker- encoding sequences that allow plasmid-bearing bacteria to grow in the presence of otherwise toxic drugs. The plasmid also bears a transcriptional promoter capable of producing large amounts of mRNA from the cloned gene. Such promoters may or may not be inducible promoters, which initiate transcription upon induction. The plasmid also preferably contains a polylinker to simplify insertion of the gene in the correct orientation within the vector. In a simple E. coli expression vector utilizing the lac promoter, the expression vector plasmid contains a fragment of the E. coli chromosome containing the lac promoter and the neighboring lacZ gene. In the presence of the lactose analog IPTG, RNA polymerase normally transcribes the lacZ gene, producing lacZ mRNA, which is translated into the encoded protein, β-galactosidase. The lacZ gene can be cut out of the expression vector with restriction endonucleases and replaced by a RBPl gene sequence, or fragment, fusion, or mutant thereof. When this resulting plasmid is transfected into E. coli, addition of IPTG and subsequent transcription from the lac promoter produces RBPl mRNA, which is translated into a RBPl polypeptide.

Once the appropriate expression vectors containing a RBPl gene, or fragment, fusion, or mutant thereof, are constructed, they are introduced into an appropriate host cell by transformation techniques including, for example, calcium phosphate transfection, DEAE-dextran transfection, electroporation, microinjection, protoplast fusion, and liposome-mediated transfection, as described herein. The host cells that are transfected with the vectors of this invention may include (but are not limited to) E. coli, Pseudomonas, Bacillus subtilus, or other bacilli, other bacteria, yeast, fungi, insect (using, for example, baculoviral vectors for expression), mouse or other animal or human tissue cells. Mammalian cells can also be used to express the RBPl protein using a vaccinia virus expression system described in Ausubel et al., 1997, Current Protocols in Molecular Biology, Wiley Interscience, New York.

In vitro expression of RBPl proteins, fusions, polypeptide fragments, or mutants encoded by cloned DNA is also possible using the T7 late-promoter expression system. This system depends on the regulated expression of T7 RNA polymerase which is an enzyme encoded in the DNA of bacteriophage T7. The T7 RNA polymerase transcribes DNA beginning within a specific 23- bp promoter sequence called the T7 late promoter. Copies of the T7 late promoter are located at several sites on the T7 genome, but none is present in E. coli chromosomal DNA. As a result, in T7 infected cells, T7 RNA polymerase catalyzes transcription of viral genes but not of is. coli genes. In this expression system recombinant E. coli cells are first engineered to carry the gene encoding T7 RNA polymerase next to the lac promoter. In the presence of IPTG, these cells transcribe the T7 polymerase gene at a high rate and synthesize abundant amounts of T7 RNA polymerase. These cells are then transformed with plasmid vectors that carry a copy of the T7 late promoter protein. When IPTG is added to the culture medium containing these transformed E. coli cells, large amounts of T7 RNA polymerase are produced. The polymerase then binds to the T7 late promoter on the plasmid expression vectors, catalyzing transcription of the inserted cDNA at a high rate. Since each E. coli cell contains many copies of the expression vector, large amounts of mRNA corresponding to the cloned cDNA can be produced in this system and the resulting protein can be radioactively labeled. Plasmid vectors containing late promoters and the corresponding RNA polymerases from related bacteriophages such as T3, T5, and SP6 may also be used for in vitro production of proteins from cloned DNA. E. coli can also be used for expression using an M13 phage such as mGPI-2. Furthermore, vectors that contain phage lambda regulatory sequences, or vectors that direct the expression of fusion proteins, for example, a maltose- binding protein fusion protein or a glutathione-S-transferase fusion protein, also may be used for expression in E. coli.

Eukaryotic expression systems permit appropriate post-translational modifications to expressed proteins. Transient transfection of a eukaryotic expression plasmid allows the transient production of a RBPl polypeptide by a transfected host cell. RBPl proteins may also be produced by a stably- transfected mammalian cell line. A number of vectors suitable for stable transfection of mammalian cells are available to the public (e.g., see Pouwels et al., Cloning Vectors: A Laboratory Manual, 1985, Supp. 1987 and VectorDB at URL address http://vectordb.atcg.com/), as are methods for constructing such cell lines (see e.g., Ausubel et al., supra). In one example, cDNA encoding a RBPl protein, fusion, mutant, or polypeptide fragment is cloned into an expression vector that includes the dihydrofolate reductase (DHFR) gene. Integration of the plasmid and, therefore, integration of the RBPl -encoding gene into the host cell chromosome is selected for by inclusion of 0.01-300 μM methotrexate in the cell culture medium (as described, Ausubel et al., supra). This dominant selection can be accomplished in most cell types. Recombinant protein expression can be increased by DHFR-mediated amplification of the transfected gene. Methods for selecting cell lines bearing gene amplifications are described in Ausubel et al., supra. These methods generally involve extended culture in medium containing gradually increasing levels of methotrexate. The most commonly used DHFR-containing expression vectors are pCVSEII-DHFR and pAdD26SV(A) (described in Ausubel et al., supra). The host cells described above or, preferably, a DHFR-deficient CHO cell line (e.g., CHO DHFR^' cells, ATCC Accession No. CRL 9096) are among those most preferred for DHFR selection of a stably- transfected cell line or DHFR- mediated gene amplification.

Eukaryotic cell expression of RBPl proteins allows the production of large amounts of normal and mutant proteins for isolation and purification, and the use of cells expressing RBPl proteins as a functional assay system for antibodies generated against the protein. Eukaryotic cells expressing RBPl proteins may also be used to test the effectiveness of pharmacological agents on RBPl biological activity, or as means by which to study RBPl proteins as components of a transcriptional regulatory complex. Expression of RBPl proteins, fusions, mutants, and polypeptide fragments in eukaryotic cells also enables the study of the function of the normal complete protein, specific portions of the protein, or of naturally occurring polymorphisms and artificially produced mutated proteins. The RBPl DNA sequences can be altered using procedures known in the art, such as restriction endonuclease digestion, DNA polymerase fill-in, exonuclease deletion, terminal deoxynucleotide transferase extension, ligation of synthetic or cloned DNA sequences and site-directed sequence alteration using specific oligonucleotides together with PCR. Another preferred eukaryotic expression system is the baculovirus system using, for example, the vector pBacPAK9, which is available from Clontech (Palo Alto, CA). If desired, this system may be used in conjunction with other protein expression techniques, for example, the myc tag approach described by Evan et al. (Mol. Cell Biol. 5:3610-3616, 1985). Once the recombinant protein is expressed, it can be isolated from the expressing cells by cell lysis followed by protein purification techniques, such as affinity chromatography. In this example, an anti-RBPl antibody can be attached to a column and used to isolate the recombinant RBPl proteins. Lysis and fractionation of RBPl protein-harboring cells prior to affinity chromatography may be performed by standard methods (see, e.g., Ausubel et al., supra). Once isolated, the recombinant protein can, if desired, be purified further by e.g., by high performance liquid chromatography (HPLC; e.g., see Fisher, Laboratory Techniques Tn Biochemistry And Molecular Biology, Work and Burdon, Eds., Elsevier, 1980). Polypeptides of the invention, particularly short RBPl fragments and longer fragments of the N-terminus and C-terminus of the RBPl protein, can also be produced by chemical synthesis (e.g., by the methods described in Solid Phase Peptide Synthesis, 2nd ed., 1984, The Pierce Chemical Co., Rockford, IL). These general techniques of polypeptide expression and purification can also be used to produce and isolate useful RBPl polypeptide fragments or analogs, as described herein.

Those skilled in the art of molecular biology will understand that a wide variety of expression systems may be used to produce the recombinant RBP 1 proteins. The precise host cell used is not critical to the invention. The RBPl proteins may be produced in a prokaryotic host (e.g., E. coli) or in a eukaryotic host (e.g., S. cerevisiae, insect cells such as Sf9 cells, or mammalian cells such as COS-1, NIH 3T3, or HeLa cells). These cells are commercially available from, for example, the American Type Culture Collection, Rockville, MD (see also F. Ausubel et al., supra). The method of transformation and the choice of expression vehicle (e.g., expression vector) will depend on the host system selected. Transformation and transfection methods are described, e.g., in Ausubel et al., supra, and expression vehicles may be chosen from those provided, e.g., in Pouwels et al., supra.

Testing for the presence of RBPl biological activity

Identification of both biologically active and mutant forms of RBPl allows the study of RBPl biological activity in regulation of cell proliferation. For example, administration of an RBPl protein, or a polypeptide fragment thereof, can be used to inhibit E2F-regulated gene expression, as measured by cell-based and cell-free assays known in the art and described herein. An inhibitory amount of an RBPl reagent (e.g., a compound that reduces the biological function of RBPl, and thus may promote cell proliferation, such as an RBPl neutralizing antibody or antisense RBPl nucleic acid, an RBPl nucleic acid encoding a dominant-negative form of the RBPl protein, or a compound which decreases RBPl gene expression) may be similarly assessed. Such assays may be carried out in a cell which either expresses endogenous RBP1 or a cell to which is introduced a heterologous amount of an RBPl polypeptide or in a cell-free assay. Preferably, the cell is capable of undergoing RBPl -mediated cell cycle arrest. RBPl biological activity or inhibition thereof may be assessed in these RBPl expressing cells, whereby such RBPl -inducing or -inhibiting activity is evaluated based upon the level of RBPl biological activity.

One preferred RBPl biological activity is binding of RBPl to an HDAC. It is understood that the binding may not be through direct contact between RBPl and the HDAC, but may require additional proteins. Binding of RBPl to an HDAC, or any other protein that is part of a protein complex that contains an HDAC (e.g., SAP30, SinA, or SinB) can be measured using any of a number of standard methods known to those in the art, such as the methods described herein.

Another preferred RBPl biological activity is binding of RBPl to an E2F protein. As described for the RBPl -HDAC interaction, the binding of RBPl to an E2F protein may require additional proteins.

A related RBPl biological activity is repression of E2F transcriptional activity by RBPl . It is likely that the repression domains of RBPl are sites in which proteins bind to RBPl and repress E2F transcriptional activity. E2F transcriptional activity can be measured, for example, using the methods described herein.

In another embodiment, RBPl biological activity is slowing of the cell cycle or cell cycle arrest. There are numerous cell cycle assays known in the art, including those described herein; any of these may be used in measuring RBPl -mediated cell cycle regulation.

Identification of molecules that modulate RBPl biological activity

Methods of observing changes in RBPl biological activity, such as the ones described above, are exploited in high-throughput assays for the purpose of identifying compounds that modulate mutant or wild- type RBPl transcriptional activity. Compounds that mime RBPl activity also may be identified by such assays. Furthermore, compounds that modulate transcription of the RBPl gene itself may be identified; in some cases, it may be desirable to increase or decrease RBPl protein levels by such an approach. Such identified compounds may have utility as therapeutic agents in the treatment of cell proliferation disease.

In general, novel drugs that modulate or mime RBPl biological activity or expression are identified from large libraries of both natural product or synthetic (or semi-synthetic) extracts or chemical libraries according to methods known in the art. Those skilled in the field of drug discovery and development will understand that the precise source of test extracts or compounds is not critical to the screening procedure(s) of the invention. Accordingly, virtually any number of chemical extracts or compounds can be screened using the exemplary methods described herein. Examples of such extracts or compounds include, but are not limited to, plant-, fungal-, prokaryotic- or animal-based extracts, fermentation broths, and synthetic compounds, as well as modification of existing compounds. Numerous methods are also available for generating random or directed synthesis (e.g., semi-synthesis or total synthesis) of any number of chemical compounds, including, but not limited to, saccharide-, lipid-, peptide-, and nucleic acid- based compounds. Synthetic compound libraries are commercially available from Brandon Associates (Merrimack, NH) and Aldrich Chemical (Milwaukee, WI). Alternatively, libraries of natural compounds in the form of bacterial, fungal, plant, and animal extracts are commercially available from a number of sources, including Biotics (Sussex, UK), Xenova (Slough, UK), Harbor Branch Oceangraphics Institute (Ft. Pierce, FL), and PharmaMar, U.S.A. (Cambridge, MA). In addition, natural and synthetically produced libraries are produced, if desired, according to methods known in the art, e.g., by standard extraction and fractionation methods. Furthermore, if desired, any library or compound is readily modified using standard chemical, physical, or biochemical methods. In addition, those skilled in the art of drug discovery and development readily understand that methods for dereplication (e.g., taxonomic dereplication, biological dereplication, and chemical dereplication, or any combination thereof) or the elimination of replicates or repeats of materials already known for their therapeutic activities for cell proliferation diseases should be employed whenever possible.

When a crude extract is found to modulate RBPl biological activity, further fractionation of the positive lead extract is necessary to isolate chemical constituents responsible for the observed effect. Thus, the goal of the extraction, fractionation, and purification process is the careful characterization and identification of a chemical entity within the crude extract that modulates or mimes RBPl biological activity or expression. The same assays described herein for the detection of activities in mixtures of compounds can be used to purify the active component and to test derivatives thereof. Methods of fractionation and purification of such heterogenous extracts are known in the art. If desired, compounds shown to be useful agents for treatment are chemically modified according to methods known in the art. Compounds identified as being of therapeutic value may be subsequently analyzed using a standard animal or culture model for a cell proliferative disease known in the art. The effect of candidate compounds on RBP 1 -mediated regulation of cell growth or survival may be measured at the level of translation by using the general approach described above with standard protein detection techniques, such as Western blotting or immunoprecipitation with an RBPl -specific antibody (for example, the RBPl -specific antibody described herein).

Compounds that modulate the level of RBPl may be purified, or substantially purified, or may be one component of a mixture of compounds such as an extract or supernatant obtained from cells (Ausubel et al., supra). In an assay of a mixture of compounds, RBPl expression is measured in cells administered progressively smaller subsets of the compound pool (e.g., produced by standard purification techniques such as HPLC or FPLC) until a single compound or minimal number of effective compounds is demonstrated to modulate RBPl expression. Compounds may also be screened for their ability to modulate RBPl biological activity. In this approach, the degree of RBPl biological activity in the presence of a candidate compound is compared to the degree of biological activity in its absence, under equivalent conditions. Again, the screen may begin with a pool of candidate compounds, from which one or more useful modulator compounds are isolated in a step- wise fashion. Biological activity may be measured by any standard assay, for example, those described herein. Another method for detecting compounds that modulate the activity of RBPl is to screen for compounds that bind to RBPl. These compounds may be detected by adapting interaction trap expression systems known in the art. These systems detect protein interactions using a transcriptional activation assay and are generally described by Gyuris et al. (Cell 75:791-803, 1993) and Field et al., (Nature 340:245-246, 1989), and are commercially available from Clontech (Palo Alto, CA). Alternatively, compounds that bind to RBPl can be isolated by column chromatography. In this assay, candidate compounds or extracts are passed through a column containing immobilized RBP 1. After washing to remove nonspecific proteins, the compounds bound to RBPl are eluted, collected, and identified. Using similar assays, compounds that interfere with RBPl binding to pRB family members or HDACs can also be identified.

Compounds or molecules that modulate RBPl biological activity may include peptide and non-peptide molecules such as those present in cell extracts, mammalian serum, or growth medium in which mammalian cells have been cultured.

Therapeutic uses

A molecule that decreases RBPl expression or biological activity is considered useful in the invention; such a molecule may be used, for example, as a therapeutic to increase cell proliferation in an arrested cell (e.g., a neuron). There is a tight association between cell proliferation and cell death. In some cases, a cell that receives a signal to proliferate will instead undergo apoptosis, presumably because the proliferation is inappropriate. Hence, depending on the context, a molecule that decreases RBPl expression or biological activity may result in increased proliferation or, alternatively, cell death. Differentiating between these two outcomes in the appropriate context may readily be done using standard assays known to those skilled in the art.

A molecule that increases RBPl expression or biological activity is particularly useful in the invention. Such a molecule may be used to decrease cellular proliferation. This would be advantageous in the treatment of neoplasms or other cell proliferative diseases.

To add an RBPl polypeptide to cells in order to modulate cell proliferation or apoptosis, it is preferable to obtain pure RBPl protein from cultured cell systems that can express the protein. Delivery of the protein to the affected tissue can then be accomplished using appropriate packaging or administrating systems. Alternatively, small molecule analogs may be used and administered to act as RBPl agonists or antagonists and in this manner produce a desired physiological effect. Methods for finding such molecules are provided herein.

Gene therapy is another potential therapeutic approach in which normal copies of the RBPl gene or nucleic acid encoding RBPl sense or antisense RNA is introduced into cells. The gene must be delivered to those cells in a form in which it can be taken up and encode for sufficient protein to provide effective function.

Transducing retroviral, adenoviral, and human immunodeficiency viral (HIV) vectors can be used for somatic cell gene therapy especially because of their high efficiency of infection and stable integration and expression (see, for example, Cayouette and Gravel, Hum. Gene Ther., 8:423-430, 1997; Kido et al. Curr. Eye Res., 15:833-844, 1996; Bloomer et al., J. Virol., 71:6641-6649, 1997; Naldini et al., Science 272:263-267, 1996; Miyoshi et al., Proc. Natl. Acad. Sci. USA, 94: 10319-10323, 1997). For example, the full length RBPl nucleic acid, or portions thereof, can be cloned into a retroviral vector and driven from its endogenous promoter or from the retroviral long terminal repeat or from a promoter specific for the target cell type of interest (such as neurons). Other viral vectors which can be used include adenovirus, adeno-associated virus, vaccinia virus, bovine papilloma virus, or a herpes virus, such as Epstein- Barr Virus. Gene transfer could also be achieved using non-viral means requiring infection in vitro. This would include calcium phosphate, DEAE dextran, electroporation, and protoplast fusion. Liposomes may also be potentially beneficial for delivery of DNA into a cell. Although these methods are available, many of these are of lower efficiency. Transplantation of normal genes into the affected cells of a patient can also be useful therapy. In this procedure, a normal RBPl gene is transferred into a cultivatable cell type, either exogenously or endogenously to the patient. These cells are then injected into the targeted tissue(s). In the constructs described, RBPl cDNA expression can be directed from any suitable promoter (e.g., the human cytomegalovirus (CMV), simian virus 40 (SV40), or metallothionein promoters), and regulated by any appropriate mammalian regulatory element. For example, if desired, enhancers known to preferentially direct gene expression in tumor cells may be used to direct RBPl expression. The enhancers used could include, without limitation, those that are characterized as tissue- or cell-specific in their expression. Alternatively, if a RBPl genomic clone is used as a therapeutic construct (for example, following isolation by hybridization with the RBPl cDNA described above), regulation may be mediated by the cognate regulatory sequences or, if desired, by regulatory sequences derived from a heterologous source, including any of the promoters or regulatory elements described above.

Antisense based strategies may be employed to explore RBPl gene function and as a basis for therapeutic drug design. The principle is based on the hypothesis that sequence-specific suppression of gene expression can be achieved by intracellular hybridization between mRNA and a complementary antisense species. The formation of a hybrid RNA duplex may then interfere with the processing/transport/translation and/or stability of the target RBPl mRNA. Antisense strategies may use a variety of approaches including the use of antisense oligonucleotides and injection of antisense RNA. Antisense effects can be induced by control (sense) sequences, however, the extent of phenotypic changes are highly variable. Phenotypic effects induced by antisense effects are based on changes in criteria such as protein levels, protein activity measurement, and target mRNA levels. For example, RBPl gene therapy may also be accomplished by direct administration of antisense RBPl mRNA to a cell in which proliferation is desired. The antisense RBPl mRNA may be produced and isolated by any standard technique, but is most readily produced by in vitro transcription using an antisense RBPl cDNA under the control of a high efficiency promoter (e.g., the T7 promoter). Administration of antisense RBPl mRNA to cells can be carried out by any of the methods for direct nucleic acid administration described above. An alternative strategy for inhibiting RBPl function using gene therapy involves intracellular expression of an anti-RBPl antibody or a portion of an anti-RBPl antibody. For example, a nucleic acid (or fragment thereof) encoding a monoclonal antibody that specifically binds to RBPl and inhibits its biological activity may be placed under the transcriptional control of a cell type-specific gene regulatory sequence.

Another therapeutic approach within the invention involves administration of a recombinant RBPl polypeptide (e.g, the one described herein), either directly to the site of a potential or actual cell proliferation event (for example, by injection) or systemically (for example, by any conventional recombinant protein administration technique). The dosage of RBPl depends on a number of factors, including the size and health of the individual patient, but, generally, between 0.1 mg and 100 mg inclusive are administered per day to an adult in any pharmaceutically acceptable formulation.

Administration of RBP1 Polypeptides, RBPl Genes, or Modulators of RBPl Synthesis or Function

An RBPl protein, gene, or modulator of RBPl may be administered within a pharmaceutically-acceptable diluent, carrier, or excipient, in unit dosage form. Conventional pharmaceutical practice may be employed to provide suitable formulations or compositions to administer activating RBPl antibodies or compounds that activate or mimic RBPl biological activity to patients suffering from a cell proliferation disease. Administration may begin before the patient is symptomatic. Methods well known in the art for making formulations are found, for example, in Remington: The Science and Practice of Pharmacy (supra). Formulations for parenteral administration may, for example, contain excipients, sterile water, or saline, polyalkylene glycols such as polyethylene glycol, oils of vegetable origin, or hydrogenated napthalenes. Biocompatible, biodegradable lactide polymer, lactide/glycolide copolymer, or polyoxyethylene-polyoxypropylene copolymers may be used to control the release of the compounds. Other potentially useful parenteral delivery systems for RBPl modulatory compounds include ethyl ene-vinyl acetate copolymer particles, osmotic pumps, implantable infusion systems, and liposomes. Formulations for inhalation may contain excipients, for example, lactose, or may be aqueous solutions containing, for example, polyoxyethylene-9-lauryl ether, glycocholate and deoxycholate, or may be oily solutions for administration in the form of nasal drops, or as a gel.

Gene Regulation The transcriptional repressor domains described herein can be used to repress expression of any gene by targeting them to the regulatory region of that gene; the presence of the repressor domain will block transcriptional activation (Badiani et al., Genes Dev. 8:770-782, 1994; Conlon et al., Development 122:2427-2435, 1996). Targeting of the repressor domain can be achieved by producing a fusion protein containing the repressor domain fused in frame to a DNA binding domain known to bind to the desired gene regulatory region. The fusion protein can be produced using standard methods and administered in a pharmaceutically-acceptable carrier to the cell or tissue of interest as described herein for the RBPl polypeptides. Alternatively, the nucleic acid sequence encoding the fusion protein can be used in gene therapy, as described above.

The following examples are to illustrate the invention. They are not meant to limit the invention in any way.

Example 1 : RBPl is present in E2F-RB family complexes

Because of its slow migration in E2F-specific electrophoretic mobility shift assays (EMS A), we hypothesized that the pl30-E2F complex appeared to contain one or more additional proteins and that such proteins interact with pi 30 via a site in the RB pocket similar to that utilized by the adenovirus El A protein which binds via a conserved Leu-X-Cys-X-Glu motif found in several other viral and cellular RB -binding proteins.

To determine if RBPl was present in E2F complexes, we harvested monkey CV-1 cells from either rapidly growing or serum-starved growth-arrested cultures, and subjected cell extracts to electrophoretic mobility shift assays (EMSA) using an E2F-specific radioactive oligonucleotide, as described previously (Corbeil et al., Oncogene 15:657-668, 1997). Fig. 1 shows that serum-starved (lanes 5 and 10) and asynchronously growing cells (lanes 1 and 9) contain a variety of E2F complexes; we observed the large pl30-E2F complex only in the former. No complexes were detected using an unrelated or altered E2F oligonucleotide. The components of these E2F complexes were partially resolved through the addition of antibodies that recognize various RB family members. Addition of anti-pRB serum caused a supershift of at least two faster migrating pRB-E2F complexes (termed RB in the figure) to slower migrating species (*RB) in both growing (lane 2) and serum-starved (lane 6) cells. We did not observe any effect on the migration of pl30-E2F with this serum (lane 6). Addition of anti-pl07 antibody SD9 had little effect on any of the complexes (lanes 3 and 7); addition of C-20 serum specific for the carboxyl terminus of pl30, however, caused a supershift of pl30-E2F in extracts from growth-arrested cells (lanes 8 and 11). Anti-pl30 serum also made evident the existence of more minor, faster-migrating pl30-E2F complexes that were evident in lane 11, upon prolonged exposure of the gel. To determine if RBPl is present in pl30-E2F or any of the other E2F complexes, we conducted a similar experiment in asynchronously growing and serum-starved CV-1 cells using antiserum against human RBPl. Fig. 1 (lane 12) shows that both pl30-E2F and the faster-migrating pRB-E2F complexes, identified in lane 2, had disappeared and that one or more new complexes (termed *RB in the figure) were evident. In addition, analysis of these same samples under different conditions of PAGE indicated the presence of an additional, very slowly-migrating E2F complex (termed pi 30-E2F in Fig. 1) that just barely entered the gel (lane 12A). Thus it appeared that pl30-E2F and certain pRB-E2F complexes in growth arrested cells contain RBPl.

Example 2: RBPl inhibits E2F-mediated transcription

To analyze the role of RBPl in RB-E2F complexes, we analyzed rapidly growing C33A human cervical carcinoma cells, which are deficient both for functional p53 and pRB, for their ability to regulate the E2F- 1 promoter. We chose this promoter because it contains E2F recognition sites that are tightly regulated during growth arrest by E2F-RB family complexes, particularly pl30/E2F (Hsiao et al., Genes Dev. 8:1526-1537, 1994; Johnson et al., Nature 365:349-352, 1993; Johnson et al, Genes Dev. 8, 1514-1525, 1994; Johnson, Oncogene 11 : 1685-1692, 1995). We transfected cells with DNA from

E2Fl-Luc(Wt), a luciferase reporter construct driven by the E2F-1 promoter, together with pCMVRBPl-HA plasmid that encodes a haemagglutinin (HA) epitope-tagged RBPl, or pCMVRBPlΔLCE-HA (a mutant RBPl lacking the Leu-X-Cys-X-Glu pl30/pRB binding site). In some cases, we also assayed DNA from plasmids encoding pRB, pl30, or E1A-243R (the 243-residue product of human adenovirus type 5 12S El A mRNA). As shown in Fig. 2A, increasing the amount of cotransfected RBPl(Wt) resulted in decreasing amount of luciferase activity. Thus, expression is comparable to the transcriptional repression effect that pi 30 and pRB each exerted on this E2F1-Luc(wt) reporter. Overexpression of RBPl caused about a 50% reduction in luciferase activity, whereas introduction of the ΔLCE mutant had no inhibitory effect. Expression of E1A-243R increased luciferase activity by almost nineteen-fold, as was expected. To determine if RBPl -mediated transcriptional repression was specific to the E2F-regulated transcription on this promoter, we used an E2Fl-luc(mE2F) reporter, which contains four point mutations within the E2F recognition sites (Johnson, Oncogene 11:1685-1692, 1995). This mutated sequence was unable to interact with E2F in EMSA (Johnson et al., Genes Dev. 8, 1514-1525, 1994). As shown in Fig. 2B, the relative luciferase activity of this reporter was about three- to four- fold higher than the E2Fl-luc(wt) reporter. Overexpression of either RBPl(Wt) or RBPl (ΔLCE) had no effect on the mutated E2F1 promoter, suggesting the transcriptional repression by RBPl is specific to the E2F element within the E2F1 promoter. Taken with the finding that RBPl and pRB are together in a complex, these results suggest that RBPl inhibits E2F-dependent transcription and that such inhibition requires binding to RB family members. We obtained similar results with other cell types, including CHO C33A cells, which lack functional pRB. Thus, endogenous pl30 and/or pl07 must be sufficient for this inhibition.

Overexpression of either pi 30 or pRB has no effect on the E2Fl-luc(mE2F) promoter, whereas overexpression of E1A-243R results in about three-fold activation of this promoter (Fig. 2B). El A has been shown to enhance Spl driven transcription (Weintraub and Dean, Nature 358:259-261, 1992). Additionally, both the wild-type and mutated E2F-1 promoters contain a series of Spl recognition sites. These data explain El A-enhanced transcription of both promoters, as shown in Figs. 2A and 2B. The fact that the E2Fl-luc(Wt) promoter was activated by El A stronger than the E2Fl-luc(mE2F) promoter, suggests that the E2F element within the E2F1 promoter is also effected by El A overexpression.

Example 3: RBPl inhibition of E2F-mediated transcription is dependent on interaction with RB family members

We predicted that overexpression of RBPl, together with RB family members, should cause further inhibition to the E2F-1 promoter. This was observed, as shown in Fig. 2C. With increasing amount of RBPl (Wt), along with constant amount of cotransfected pi 30 or pRB, we detected further inhibition of luciferase activity. Interestingly, with increasing amount of

RBPl(ΔLCE), along with constant amount of cotransfected pl30 or pRB, we observed a gradual increase of luciferase activity. Our observation of de-repression by the RBPl (ΔLCE) mutant suggests one or more common factor(s), required for RBPl transcriptional repression effect on the E2F1 promoter, interact with both endogenous RBP 1 and transfected RBPl (ΔLCE). Overexpression of RBPl (ΔLCE) would sequester these essential factors from the E2F-1 promoter due to the inability of ΔLCE mutant to interact with the RB family members. The inhibitory effect on E2F-1 promoter by RBPl required the interaction with RB family members through the LXCXE motif. Accordingly RBPl (ΔLCE) is likely to act as a dominant negative mutant, partially abolishing the transcriptional repression effect of exogenously transfected pl30 or pRB on the E2F-1 promoter (Fig. 2C). The fact that RBPl (ΔLCE) could only partially abolish the transcriptional repression effect exerted by the cotransfected pl30 or pRB, suggests that pRB or pl30 repress transcription by other mechanisms, possibly through interaction with other LXCXE-containing cellular proteins. Example 4: Overexpression of RBPl induces growth arrest

As the E2F-pl07 complex containing RBPl is only formed during growth arrest, it seemed possible that RBPl might play a role in the control of cell proliferation by inhibiting E2F-dependent transcription, thus inducing, enhancing, or maintaining exit from the cell cycle. To determine if RBPl suppressed cell growth, we transfected C V- 1 cells with DNA from plasmids that provide neomycin resistance and express RBPl . Constructs included pRcCMVRBPl-HA (encoding an HA-tagged version of RBPl), pcDNA3Gal4- RBP1 (containing RBPl fused to the Gal4 DNA-binding motif); and ρcDNA3Gal4-RBP 1 ΔLCE. Following transfection, we plated cells and allowed them to grow under G418 selection. Fig. 3 A shows that no colonies were formed in the absence of vectors. With pcDNA3Gal4-RBPlΔLCE, a significant number of large colonies were produced with a morphology similar to those obtained with the control pcDNA3, lacking RBPl coding sequences (Fig. 3B). With each of the plasmids expressing wild-type RBPl, we observed a significant reduction in colony formation. In addition, the colonies of cells transfected wild-type RBPl were considerably smaller and composed of only small numbers of sparse cells (see Fig. 3B).

To examine the mechanism by which RBPl inhibits E2F activity, we fused the GAL4 DNA binding sequence to RBPl. We then co-transfected CHO cells were with DNA encoding GAL4-RBP1 (or control proteins) and G5TKCAT, a reporter construct that expresses CAT by GAL4-dependent transcription. Fig. 4A shows that GAL4-RBP1, expressed from either the CMV or SV40 promoter, repressed transcription by 80 to 90%. This expression was as great as that by the adenovirus ElB-55kDa product

(Gal4AdElB-55K), known to be a potent transcriptional repressor when linked to the Gal4 DNA binding domain. RBPl -HA that was not linked to Gal4 (pRcCMVRBPl-HA) had no effect on expression of CAT. Thus, RBPl appears to function as a transcriptional repressor, but only when tethered to a promoter. GAL4-RBP1ΔLCE also exhibited similar repression activity, indicating that repression by RBPl is independent of RB family binding when fused to a heterologous DNA binding domain. To identify the region of RBPl required for repression, we created a series of mutants in the GAL4-RBP1 construct in which increasing regions from the carboxyl terminus of RBPl were deleted (see Fig 4B). Fig. 4 shows that elimination of sequences encoding up to 805 residues from the carboxyl terminus resulted in little or no reduction of repression activity; removal of additional sequences, however, greatly reduced or eliminated repression. It is likely that residues 241 to 452 are responsible for RBPl repression activity. This portion of RBPl contains a sequence predicted to encode an α-helical domain, preceded by a region, termed ARID, found in several other proteins, including the product of dead ringer (dri) from Drosophila melanogaster (Gregory et al., Mol. Cell. Biol. 16:792-799, 1996), SWI1/ADR6 from yeast (Cote et al., Science 265:53-60, 1994), B Cell Regulator of IgH Transcription from mouse (Herrscher et al., Genes Dev. 9:3067-3082, 1995), human Mrfl and Mrf2A (Huang et al., Nucl. Acids Res. 24:1695-1701, 1996), and RBP2 (Defeo-Jones et al, Nature 353:251-254, 1991; Fattaey et al., Oncogene 8:3149-3156,1993; Kaelin et al., Cell 70: 351-364, 1992; Kim et al., Mol. Cell. Biol. 14: 7256-7264, 1994; Otterson et al., Oncogene 8:949-957, 1993). When we fused residues 241 to 452 of RBPl to Gal4 (Gal4-RBP1-Rl), the resulting fusion protein repressed transcription at a level comparable to wild type Gal4-RBP1 (Fig. 4A), suggesting that this region is responsible for the transcriptional repression activity.

Example 5: Endogenous interactions between RB family members and histone deacetylases We conducted co-immunoprecipitation experiments to determine the ability of pRB to interact with various HDAC enzymes in vivo. Rabbit polyclonal antibodies that specifically recognize HDAC2, or HDACl and HDAC3 were used under low stringency conditions to immunoprecipitate endogenous HDAC species from extracts of human HI 299 cells. In each case, we immunoprecipitated significant amounts of corresponding HDAC proteins. We determined the presence of pRB in these complexes by Western blot analysis using G3-245 monoclonal antibody that recognizes both hyperphosphorylated and hypophosphorylated forms of pRB. Fig. 5 A shows that the hypophosphorylated form of pRB co-precipitated with HDAC 1.

Interestingly, we also detected significant amounts of hypophosphorylated pRB in association with HDAC2 and HDAC3. These interactions were specific as we did not detect pRB in immunoprecipitates prepared from the same cell extracts using antibody to CREB-binding protein (CBP), a histone acetyltransferase. These results indicate that the active form of pRB is able to recruit all three forms of HDACs.

HDACl also interacts with pRB-related family members pi 07 and pi 30 We immunoblotted immunoprecipitates from HI 299 cells containing various HDACs with C-18 polyclonal antibody, which recognizes up to three different phosphorylated forms of pl07 in various cell lines. Fig. 5B shows that pl07, in particular its underphosphorylated forms, also co-precipitated with all endogenous HDAC species. We attempted a similar experiment with pi 30, but, as H1299 cells die upon serum starvation and pl30 is expressed largely at growth arrest, we were unable to detect sufficient quantities. Significant amounts of pl30 were present in asynchronized H1299 cells, but these pl30 species are mostly hyperphosphorylated and did not appear to associate with HDACs at significant levels.

Adenovirus El A protein and SV40 large T antigen associate with the pRB pocket via LXCXE binding motifs and disrupt interactions between pRB and HDACl . We therefore conducted a parallel series of binding studies in 293T cells, which express high levels of both Ad5 El A proteins and SV40 large T antigen. Fig. 5 A shows that no interactions were apparent between pRB and any of the HDAC enzymes, including HDAC3 in these cells. Fig. 5B shows that a similar effect was apparent with pi 07. Thus in both cases, binding of all three HDAC enzymes seemed to require the RB pocket region targeted by DNA tumor virus proteins.

Example 6: The small pocket of pRB interacts with different histone deacetylases

It has been proposed that HDACl utilizes a degenerate IXCXE motif to interact with the pocket (residues 379 to 792) of pRB (Ferreira et al., Proc. Natl. Acad. Sci. USA 95:10493-10498, 1998; Magnaghi-Jaulin et al., Nature 391:601-605, 1998). To determine directly if this region is involved in binding of all of the HDACs, we carried out studies using extracts from HI 299 cells co-transfected with plasmid DNA expressing the small pocket of pRB as a fusion product with the DNA binding domain of Gal4 (Gal4DBD), termed Gal4-RB (pocket), as well as Flag-tagged versions of HDACl, 2, or 3. Following immunoprecipitation using an antibody against Gal4DBD, we resolved precipitates by SDS-PAGE and, after transfer, analyzed the presence of HDACl, 2, or 3 by Western blotting using anti-Flag antibody. Fig. 6A shows that all three HDACs, which were detected at similar levels in whole cell extracts, associated with the small pocket of pRB in vivo. Anti-Flag antibody recognized three Flag-HDACl species, but only the slowest migrating form was evident in Gal4-RB(pocket) precipitates, suggesting that the faster migrating species may be degradation products. We detected Flag-HDAC3 as two closely migrating species and both associated with the Gal4-RB (pocket). These interactions were highly specific as a cDNA expressing Gal4DBD linked to VP16, a known transcriptional activator, did not associate with any of the histone deacetylases (Fig. 6 A) even though Gal4-RB(pocket) and Gal4-VP16 were expressed at comparable levels. These results, as well as those described above with anti-CBP antibody, demonstrate clearly the specificity of interactions involving HDACs, and rule out the possibility that the interactions we observed were non-specific.

Fig. 6B shows that in a similar experiment in 293T cells, none of the HDAC proteins were present in immunoprecipitates containing Gal4-RB(pocket). Identical results were also obtained in 293 cells that express only Ad5 El A proteins (Fig. 6C). Fig. 6D shows that addition prior to immunoprecipitation of increasing amounts of in vitro synthesized El A protein fused to GST (GST-El A) (Corbeil et al., J. Virol. 68:6697-6709, 1994) to extracts from HI 299 cells expressing Gal4-pRB(pocket) and Flag-HDACl caused a decrease in binding of HDACl to the small pocket of pRB. We did not observe such an effect with GST/glutathione-Sepharose alone. Fig. 6D also demonstrates that pRB coimmunoprecipitated with El A protein but not with GST. We obtained similar results using Flag-HDAC2 and Flag-HDAC3. Thus the small pocket of pRB is important for interactions not only with HDACl, but also with HDAC2 and HDAC3. Disruption of such binding by El A protein or T antigen also implied that the association of histone deacetylases may be mediated by LXCXE-like interactions. Although HDACl and HDAC2 contain IXCXE motifs, the mechanism of binding of HDAC3 was uncertain as HDAC3 lacks such sequences. Of further interest, no interaction was previously observed between the pocket of pRB and HDACl or HDAC2 in studies involving the yeast two-hybrid method (Brehm et al., Nature 391 :597-601, 1998). As all three human histone deacetylases are highly homologous, it was possible that interactions of all three with the pocket may be indirect, and involve an additional LXCXE- containing protein as a linker. One possible candidate is RBP 1.

Example 7: RBPl interacts with histone deacetylases

We tested the ability of RBPl to associate with histone deacetylases. Fig. 7 A shows that, when expressed in HI 299 cells, Gal4-RBP1 (but not Gal4-VP16) interacted with all three histone deacetylases. Again, only the slowest migrating Flag-HDACl species was evident and Flag-HDAC3 was present as a doublet in Gal4-RBP1 precipitates. Fig. 7B shows that in 293T cells expressing El A products and SV40 large T antigen, both HDACl and HDAC 3 associated with Gal4RBP 1 , indicating that these interactions were unaffected by high levels of these viral pocket-binding proteins, and thus did not require the binding to RB. Although binding of HDAC2 to RBPl was not evident in Fig. 7B, residual amounts of HDAC2 were detected after longer exposures of the blot. In addition, we observed a low level of binding of HDAC2 to RBPl in a parallel experiment, shown in Fig. 6C, using 293 cells. Flag-HDAC2 expression was consistently low in 293 T or 293 cells and this effect probably resulted from the fact that Flag-HDAC2 was expressed under a hybrid SV40/HTLVI promoter, whereas Flag-HDACl and Flag-HDAC3 expression relied on the CMV promoter. Thus, we re-examined RBPl -HDAC binding in an additional experiment in which all three HDACs were expressed along with HA-tagged RBPl in 293T cells as Gal4DBD-HDAC fusion products under the SV40 early promoter. Fig. 7C shows that all HDACs were expressed at comparable levels as determined by immunoblotting of whole cell extracts with anti-Gal4DBD antibody. Similarly, all cells expressed comparable amounts of RBPl, as detected using anti-HA antibody. Fig. 7C with anti-HA antibody. We observed no such binding with Gal4 alone or with Gal4-VP16. Fig. 7D shows that interactions between RBPl and endogenous HDAC enzymes could also be detected in HI 299 cells. With immunoprecipitates prepared using the same polyclonal antibodies against individual HDACs employed in Figs. 5 A and 5B, we found RBPl in association with all three HDACs. RBPl interactions with HDACl clearly occurred at much higher levels than with HDAC2 and HDAC3, implying that RBPl/HDACl complexes represent the predominant species in H1299 cells. This observation may suggest that RBPl could be a component of the HDACl core complex. If this is the case, much of the endogenous RBPl/HDACl complex could be targeted to sites other than RB family members as the levels of RBPl detected in association with these proteins were much lower than those observed with HDACl . Fig. 7D also shows that RBPl associates with all members of the RB family, and examination of pertinent lanes in Figs. 5 A and 5B indicated that this association occurred preferentially with hypophosphorylated forms of pRB (Fig. 1A) and pi 07 (Fig. IB). In addition, Fig. 7D shows that such RBPl-pRB/pl07/pl30 interactions were disrupted in 293T cells, as expected. Taken together, these results indicate that interactions between RBPl and RB family members are truly pocket-dependent, as they were disrupted by T antigen or El A pocket-binding proteins. To the contrary, interactions between RBPl and HDACs were not sensitive to disruption by these viral pocket-binding proteins, suggesting that HDACs cannot be recruited to RBPl via endogenous RB family members present in 293T cells. Instead, RBPl could mediate the association between RB family members and all three HDAC enzymes.

It is unlikely that interactions of histone deacetylases with RBPl occur indirectly through the recruitment of RB family members by RBPl. In 293T/293 cells, we failed to observe interactions either between the pocket of pRB and these enzymes (Figs. 2B and 2C) or between RBPl and RB family members (Figs. 1A, IB, and 3D). In addition, we studied interactions between histone deacetylases and RBPl (ΔLCE). Fig. 7E shows that in 293T cells, both Gal4RBPl(ΔLCE) or RBP1(ΔLCE)-HA mutants interacted with Flag-tagged or Gal4DBD-tagged histone deacetylases. We obtained similar results in human HI 299 cells. Thus, histone deacetylases appear to interact with RBPl in a region apart from the pocket-binding motif, further supporting a role for RBPl in bridging interactions between histone deacetylases and pRB/E2F complexes.

Example 8: RBPl contains two independent transcriptional repression domains As described herein, we identified a repression domain within RBPl . When Gal4 was fused to RBPl having a deletion of this repression domain, referred to henceforth as Rl, this mutant RBPl product (Gal4-RBP1ΔR1) still repressed CAT expression at high levels (Fig. 8A), suggesting that a second repression domain may exist towards the carboxyl terminus of RBPl. We therefore generated a series of in- frame carboxyl terminal deletion mutants that also lacked Rl (illustrated in Fig. 8B) and found that all, including Gal4-ΔR1-93C that lacked only 93 residues at the carboxyl terminus, failed to repress CAT expression (Fig. 8A). We showed that all mutants used in experiments in Fig. 8 were expressed at similar high levels. As these data indicated that the second repression domain likely lies at the very carboxyl terminus, we generated three additional constructs that contained only varying amounts of the carboxyl terminus of RBPl linked to the Gal4DBD. Fig. 8 A shows that all three, Gal4-R2(1311-C), Gal4-R2(1314-C) and Gal4-R2(1263-C), repressed CAT expression. Thus, a second RBPl repression domain (termed R2) exists between residues 1167-1257. Furthermore, repression by neither Rl nor R2 relies on the LXCXE pocket-binding motif domain (termed R2) exists between residues 1167-1257. Furthermore, repression by neither Rl nor R2 relies on the LXCXE pocket-binding motif when RBPl is tethered to DNA by a heterologous DNA binding domain like Gal4DBD. Example 9: Transcriptional repression by RBPl is both dependent and independent of histone deacetylases activity

The ability of the pocket to actively repress transcription relies on both histone deacetylase-dependent and -independent mechanisms. Only a subset of promoters repressed by the pocket of pRB were sensitive to the specific histone deacetylase inhibitor, trichostatin A (TSA). Among these, the only Gal4-dependent promoter/reporter construct found to be repressed by the pocket and to be sensitive to TSA is G5MLPCAT (containing the adenovirus major late promoter). Fig. 8C shows that both Gal4-RBP 1 and Gal4-pRB(pocket) repressed the G5MLPCAT reporter, as did both Gal4-Rl and Gal4-R2 that contain only Rl and R2, respectively. Fig. 8C also shows that following treatment of transfected cells with 33 OnM TSA for 24 hours prior to harvesting, repression by both Gal4-pRB (pocket) and Gal4-RBP1 was partially relieved; however, whereas drug treatment completely abolished repression by Gal4-R2, however, it had no effect on that by Gal4-Rl . Thus it appears that repression by R2 depends on histone deacetylases whereas that by Rl does not. We also noted that whereas Gal4-HDAC1 repression activity is completely relieved by TSA (Fig. 8C), repression by Gal4-Ad5-E1B-55K, an adenoviral repressor known to block p53-dependent transactivation (Yew et al., Genes Dev. 8:190-202, 1994; Teodoro et al., J. Virol. 71 :3620-3627, 1997), at this promoter is not affected by TSA, suggesting that the adenovirus major late promoter can also be subject to both histone deacetylase-dependent and -independent repression. These results therefore indicate that RBPl plays an important role in repression by pRB as TSA only partially relieves repression by the pRB pocket. Interestingly, TSA had little effect on repression by Gal4-RBP1 or Gal4-R2 using either the G5TKCAT or G5SV40CAT promoters. We extended studies from the synthetic G5MLPCAT construct to the E2F-dependent promoter regulating E2F-1 expression (E2Fl-luc). Fig. 8D shows that both RBPl and the pocket of pRB repressed expression of luciferase from the E2Fl-luc reporter, whereas RBPl lacking the LXCXE pocket-binding motif or a pRB point mutant (C706F) did not. Addition of TSA partially relieved repression by both RBPl and the pRB pocket. These results indicate that both the RBP 1 histone deacetylase-dependent and -independent repression activities can repress this E2F-dependent promoter via interactions with RB family members, and thus interactions with RBPl could provide both types of repression activities attributed to the pocket of RB family members (Luo et al., Cell 92:463-473, 1998).

Example 10: Only one repression domain of RBPl interacts with histone deacetylases We tested the ability of individual Rl and R2 transcriptional repression domains to interact with histone deacetylases. Fig. 9A shows results of co-immunoprecipitation experiments using 293T cells expressing Gal4-RBP1 constructs and Flag-HDAC3 in which we immunoprecipitated RBPl with anti-Gal4DBD antibodies, then detected HDAC3 by immunoblotting with anti-Flag antibody. We did not observe any HDAC3 binding using either Rl or just the ARID portion of Rl, but such binding was clearly evident with both R2 constructs and with RBPl lacking Rl . Binding was eliminated or greatly reduced using RBPl lacking R2. We obtained similar results using Flag-HDACl and -HDAC2. At present it is not known if histone deacetylases bind directly to the

RBPl or if they interact indirectly via an additional R2 -binding protein. It is highly likely that RBPl directly binds to another member of the protein complex that contains an HDAC. The most likely candidate is the SAP30 adaptor protein, but other proteins (e.g., SinA and SinB) that are part of protein complexes that contain HDACs may also bind directly to RBPl (Pazin and Kadonaga, Cell 89:325-328, 1997, hereby incorporated by reference). The actual direct binding partners can be determined, for example, by ascertaining whether in vitro translated protein pairs are capable of direct binding. We have discovered the presence of several proteins that co-precipitate with RBPl using anti-RBPl antibodies. One of the most prominent species was a protein of about 48kDa. HDACl copurifies with RbAp48 that, along with RbAp46, plays a role in targeting HDACl to histones (Zhang et al, Mol Cell 1 : 1021-31,

1998). It is possible that both RBPl and RbAp48/46 could co-exist in a single HDAC complex. RbAp48 binds to the so-called "extended pocket" including a carboxy terminal portion of pRB and thus might play a role as a linker for HDACl . RbAp48 lacks the LXCXE- binding motif, however, and thus is not targeted to the small pocket. In addition, no interactions have been detected using the yeast two-hybrid system between the pRB pocket and HDACl or HDAC2, even though yeast cells contain high levels of MSI 1, a protein that is highly homologous to RbAp48/46 (Zhang et al., Mol Cell 1:1021-31, 1998). It is very likely, then, that RBPl is responsible for bridging the pocket of RB family members to histone deacetylase complexes to repress a diversity of E2F-dependent promoters. RBPl therefore appears to represent a major component of the growth regulatory machinery controlled by RB family members.

The above-described results were obtained using the following materials and methods.

Cell culture and transfection

Monkey CV-1 cells (ATCC CCL 70) and human lung carcinoma- H1299 cells were grown in Dulbecco's modified eagle medium (D-MEM) containing 10% fetal calf serum. Chinese hamster ovary (CHO) cells (ATCC CCL-61) were grown in α-minimal essential medium supplemented with 10% fetal calf serum. Human cervical carcinoma (C33A; ATCC HTB-31), 293 cells, 293T cells (a variant of 293 cells that express SV40 large T antigen) and Chinese hamster ovary (CHO) cells (ATCC CCL-61) were grown in α-minimal essential medium supplemented with 10% fetal calf serum. In many experiments, CV-1 cells were induced to stop proliferating by incubating in D-MEM containing 2% dialyzed calf serum for 72 hrs, as described previously (Corbeil et al., Oncogene 15:657-668, 1997). Transfections were carried out by the calcium phosphate precipitation method (Graham and van der Eb, Virology 52:456-467, 1973) using pGEM plasmid as carrier DNA.

Plasmids

E2Fl-luc(wt) and E2F-luc (E2F-) reporter constructs were described previously (Smith et al., Mol. Cell. Biol. 16:6965-6976, 1996). Mammalian plasmid expression vectors included pCMVRBPl-HA (provided by Bill Kaelin) and pCMVRBPlΔLCE-HA (constructed by deleting residues 921-1056 of RBPl coding region from pCMVRBPl-HA using restriction enzyme digests involving Nsil and Kpnϊ). Plasmids expressing human pRB and pi 30, or the product of 12S Ad5 El A mRNA were subcloned into pcDNA3 (Invitrogen). The G5TKCAT reporter construct has been described elsewhere (Yew et al., Genes Dev. 8:190-202, 1994; Teodoro et al., J. Virol. 71:3620-3627, 1997). Gal4-RBP1(SV40) plasmid was generated from pCMVRBPl-HA by polymerase chain reaction using Vent DNA polymerase (New England Biolabs, Mississaugua, ON) with primers specific for the RBPl coding region. The amplified products were digested with Smal and Xbal restriction enzymes and subcloned in- frame with the Gal4 DNA binding domain of pSG424, which expresses Gal4 fusion proteins in mammalian cells under the SV40 promoter. Gal4-RBP1(CMV) plasmid was constructed by subcloning the Hindlll digested fragment of Gal4-RBP1(SV40) plasmid into pcDNA3, which expresses proteins in mammalian cells under the CMV promoter. All the carboxyl- terminal deletion mutants of Gal4-RBP1 were generated from restriction enzyme digests of the Gal4-RBP1(SV40) plasmid and subcloned into a modified pcDN A3 construct containing stop codons inserted 3' of the multicloning cassette. Gal4-RBP 1 -ΔLCE plasmid was constructed by deleting residues 921-1056 of RBPl coding region from Gal4-RBP1(SV40) using restriction enzymes Nsz^'I and Kpnl. Gal4-RBP1-Rep plasmid was constructed by subcloning the restriction enzyme digested fragment that correspond to residues 388-599 of the Gal4-RBP1 coding region into pSG424. Gal4-Ad5ElB55K plasmid was described previously (Teodoro and Branton, J. Virol. 71:3620-3627, 1997). Mammalian expression plasmid expressing Gal4-pRB (pocket) was provided by Tony Kouzarides (Brehm et al., Nature 391 :597-601, 1998). Flag-HDACl, 2, and 3 and Gal4-HDAC1, HDAC2, HDAC3 constructs have been described elsewhere (Yang et al., Proc. Natl. Acad. Sci. USA 93:12845-12850, 1996; Yang et al., J. Biol. Chem. 272:28001-28007, 1997). Gal4-VP16 was provided by Arnie Berk (Yew et al., Nature 357:82-85, 1992). The G5MLPCAT reporter was provided by Doug Dean (Luo et al., Cell 92:463-473, 1998). Mutants of Gal4DBD-RBPl were generated as follows: Gal4-ΔR1 mutants were generated using two specific primers close to the 3' end of the Rl region and the end of RBPl coding sequence. PCR was done to generate fragments with unique restriction sites (BspllOΑ, Hindlll) which were subcloned into digested RBPl constructs in which all RBPl coding sequences between the beginning of Rl to the end of the protein had been removed using the same restriction enzymes. All carboxy terminal deletion mutants of Gal4-ΔR1 were generated from fragments produced by restriction enzyme digestion of the Gal4-ΔR1 plasmid DNA and these were then subcloned into a modified pcDNA3 (Invitrogen) construct containing stop codons inserted 3' of the multicloning cassette. Gal4-R2 truncation mutants were constructed by subcloning the restriction enzyme-digested fragments that correspond to residues 1311 - 1404, or 1314-1404, or 1263-1404 of the Gal4-RBP1 coding region into pSG424. Mammalian expression plasmids encoding the pocket of pRB and the inactive pRB pocket (C706F) mutant have been described previously (Kaelin et al., Cell 70:351-364, 1992). All constructs made were confirmed by sequencing using specific primers.

Cell Lysis and electrophoretic mobility shift assay(EMSA)

CV-1 cells were harvested and whole cell extracts were prepared using lysis buffer (50 miM HEPES-KOH, pH 7.9, containing 0.4 M KC1, 0.1%(v/v) NP-40, 4 mM NaF, 4 mM NaV0₄, 0.2 mM EDTA, 0.2 mM EGTA, 10% Glycerol (v/v), 1 mM DTT, 0.5 mM PMSF, 1 μg/mL pepstatin, 1 μg/mL leupeptin and 1 μg/mL aprotinin) and centrifuged for 45 min at 20,000 x g (Corbeil et al., Oncogene 11 :909-920, 1995; Corbeil et al., Oncogene 15:657-668, 1997). EMSA was performed using whole cell extracts and an E2F-specific oligonucleotide (GATTTAAGTTTCGCGCCCTTTCTCAA (SEQ ID NO: 1)) and double stranded oligonucleotides were labeled using

[α³²P]dCTP and Klenow polymerase. EMSA was carried out in 20 μL reaction mixtures containing 10-20 μg of whole cell extract in 20 mM HEPES-KOH (pH 7.9) containing 40 mM KC1, 1 mM MgCl₂, 0.1 mM EGTA, 0.4 mM DTT, 4 μg BSA, 2.5% (v/v) Ficoll, 1-2 μg of salmon sperm DNA, and labeled probe containing 20,000-50,000 cpm. Antibody supershift experiments were performed by incubating extracts for 10 min on ice with 1-2 μg of antisera recognizing pl30, pRB, pl07, or RBPl . Reactions were incubated at room temperature for 30 min and then samples were loaded on a 4% polyacrylamide gel (30: 1 polyacrylamide: bis-acrylamide) in 0.25X TBE and subjected to electrophoresis at 200 V for 2 hr. Gels were dried and analyzed by autoradiography using Kodak X-omat film.

Antibodies

A rabbit polyclonal antibody raised against HDAC2 was described previously (Laherty et al., Cell 89:349-356, 1997). Antibodies against HDACl and HDAC3 were prepared against peptides corresponding to the unique carboxy termini of HDACl (EEKPEAKGVKEEVKLA) (SEQ ID NO: 2) and HDAC3 (NEFYDGDHDNDKESDVEI) (SEQ ID NO: 3) coupled to KLH and injected separately into New Zealand white rabbits. The resulting antibodies were immunoaffinity purified on peptide columns. Anti-pRB antibody G3-245 was purchased from PharMingen (San Diego, CA). Antibodies against pi 30 (C-20), pl07 (C-18), and Gal4DBD (RK5C1) were purchased from Santa Cruz, anti-HA antibody HA.l 1 was purchased from BAbCo (Richmond, CA) and anti-Flag antibody M2 from Sigma, (St. Louis, MO).

Chloramphenicol acetyltransferase (CAT), β-galactosidase and luciferase assays

CAT and β-galactosidase assays were performed as described previously (Teodoro and Branton, J. Virol. 71 :3620-3627, 1997). Luciferase assays were performed as described elsewhere (Wrana et al., Cell 71:1003-1014, 1992).

Colony formation assay

CV-1 cells were transfected with 3 μg of DNA from plasmids expressing neo as well as RBPl, including pRcCMVRBPl-HA (encoding an HA-tagged version of RBP 1 ), pcDNA3Gal4-RBP 1 , and pcDNA3Gal4-

RBP1ΔLCE. Cells were plated in medium containing 500 μg/mL of G418, allowed to grow for two weeks, and then stained with crystal violet. Binding assays

1 μg of cDNA encoding Gal4DBD, fused with the pocket of pRB, RBPl, or mutated RBPl, were introduced using lipofectamine (NEN Life Science, Boston, MA) along with 1 μg of those encoding Flag-tagged HDACl, HDAC2, or HDAC3 into HI 299 or 293T cells. In some experiments, 1 μg of cDNAs encoding HA- tagged RBPl or RBPl mutants were introduced using lipofectamine along with 1 μg of those encoding Gal4DBD fused HDACl, HDAC2, or HDAC3 into H1299 or 293T. Cells were harvested 40 hours post-transfection and lysed with "low stringency buffer." Cell extracts were diluted to 150mM KC1 in a 1 mL volume and precleared with protein G-Sepharose (Pharmacia, Baie D'Urfe, QC) for 2 hours. Precleared extracts were incubated with 1 μg of RK5Cl-Gal4DBD antibody (Santa Cruz) and 30 μL of a 50% slurry of protein G-Sepharose for at least 12 hours. Immunoprecipitated Gal4-tagged protein complexes were washed six times with lysis buffer and eluted by boiling in 2X sample buffer. Eluted proteins were subjected to SDS-PAGE using a 10% polyacrylamide gel, and proteins were then transferred to PVDF membranes (Millipore, Bedford, MA) which were probed with either anti-HA or anti-Flag antibody and then by HRP-conjugated goat anti-mouse (light chain specific) secondary antibody. Binding was detected by Enhanced Luminol Reagent (NEN Life Science).

Other Embodiments All publications and patents mentioned in the above specification are herein incorporated by reference. Various modifications and variations of the described invention will be apparent to those skilled in the art. Although the invention has been described in connection with specific preferred embodiments, it should be understood that the invention as claimed should not be unduly limited to such specific embodiments. Indeed, various modifications of the described modes for carrying out the invention which are obvious to those skilled in molecular biology or related fields are intended to be within the scope of the invention. What is claimed is:

Claims

1. A method for modulating proliferation of a cell, said method comprising contacting said cell with an RBPl polypeptide or a compound that modulates RBPl biological activity or expression.

2. The method of claim 1, wherein said cell proliferation is decreased.

3. A method for identifying a compound that modulates cell proliferation, said method comprising contacting a cell with a candidate compound and monitoring the level of expression of an RBPl polypeptide in said cell, wherein a change in said level of expression in response to said candidate compound, relative to the level of expression in a cell not contacted with said candidate compound, identifies said compound as one that modulates cell proliferation.

4. A method for identifying a compound that modulates cell proliferation, said method comprising:

(a) providing an RBPl polypeptide having biological activity; (b) contacting said RBPl polypeptide with a candidate compound; and

(c) monitoring the level of said biological activity of said RBPl polypeptide, wherein a change in said level of biological activity in response to said candidate compound, relative to the level of biological activity of an RBPl polypeptide not contacted with said candidate compound, identifies said compound as a compound that modulates cell proliferation.

5. The method of claim 4, wherein said RBPl polypeptide is in a cell.

6. The method of claim 1 or 5, wherein said cell is in a mammal.

7. The method of claim 6, wherein said mammal is a human or a rodent.

8. The method of claim 4, wherein said RBPl polypeptide is in a cell- free system.

9. A method for determining whether a patient has a cell proliferation disease or an increased likelihood of developing said disease, said method comprising measuring the level of RBPl biological activity in a sample from the mammal, wherein an alteration in said level of said biological activity, relative to a level of RBPl biological activity in a matched sample from an unaffected person, indicates that the patient has said disease or increased likelihood of developing said disease.

10. The method of claim 1, 4, or 9, wherein said biological activity is binding of said RBPl polypeptide to an E2F protein or repression of E2F- mediated transcription.

11. The method of claim 10, wherein said E2F is E2F-1, E2F-2, E2F-3, E2F-4, or E2F-5.

12. The method of claim 1, 4, or 9, wherein said biological activity is binding of said RBPl polypeptide to an HDAC or a protein that is part of a complex containing an HDAC.

13. The method of claim 12, wherein said protein SAP30, SinA, or SinB.

14. A method for determining whether a patient has a cell proliferation disease or an increased likelihood of developing said disease, said method comprising measuring the level of expression of an RBPl polypeptide in a sample from said mammal, wherein an alteration in said level of expression of said RBPl polypeptide, relative to a matched sample from an unaffected person, indicates that the patient has a cell proliferation disease or increased likelihood of developing said disease.

15. A method of repressing transcription in a cell, said method comprising introducing into said cell a polypeptide comprising: (i) a repressor domain from RBPl, and (ii) a DNA binding domain.

16. A polypeptide comprising: (i) a repressor domain from RBPl, and

(ii) a DNA binding domain.

17. The polypeptide of claim 16, wherein said repressor domain comprises amino acids 241-452 or 1167-1257 of SEQ ID NO: 4.

18. A nucleic acid molecule encoding a polypeptide comprising: (i) a repressor domain from RBP, and (ii) a DNA binding domain.

19. A composition comprising (i) a substantially purified RBPl polypeptide, a substantially purified nucleic acid encoding an RBP 1 polypeptide, or a substantially purified antibody that specifically binds an RBPl polypeptide, and (ii) a physiologically acceptable carrier.

20. A kit for determining whether a human has a cell proliferation disease or an increased likelihood of developing said disease, said kit comprising a substantially pure antibody that specifically binds an RBPl polypeptide.

21. The kit of claim 20, wherein said kit further comprises a means for detecting said binding of said antibody to said RBPl polypeptide.

22. Use of an RBPl polypeptide, a nucleic acid molecule encoding an RBPl polypeptide, or an antibody that specifically binds to an RBPl polypeptide for preparing a medicament for the treatment of a cell proliferation disease.