WO2001002591A1

WO2001002591A1 - Plants expressing δ6-desaturase genes and oils from these plants containing pufas and method for producing unsaturated fatty acids

Info

Publication number: WO2001002591A1
Application number: PCT/EP2000/006223
Authority: WO
Inventors: Ernst Heinz; Thomas Girke; Jodi Scheffler; Oswaldo Da Costa E Silva
Original assignee: Basf Plant Science Gmbh
Priority date: 1999-07-06
Filing date: 2000-07-04
Publication date: 2001-01-11
Also published as: AU776417B2; EP1190080A1; AU6560700A; CA2378423A1

Abstract

The invention relates to an improved method for producing unsaturated fatty acids and to a method for producing triglycerides with an increased unsaturated fatty acid content. The invention also relates to the production of a transgenic organism, preferably a transgenic plant or a transgenic micro-organism, containing increased quantities of unsaturated fatty acids, oils or lipids with Δ6-double bonds as a result of the expression of a Δ-6-desaturase, from moss. The invention also relates to transgenic organisms containing a Δ6-desaturase gene, and to the use of the unsaturated fatty acids or triglycerides with an increased unsaturated fatty acid content produced in the method.

Description

Plants expressing Δ6-desaturase genes and oils containing PUFAS from these plants and a process for producing unsaturated fatty acids

description

The present invention relates to an improved process for the production of unsaturated fatty acids and a process for the production of triglycerides with an increased content of unsaturated fatty acids. The invention relates to the production of a transgenic organism, preferably a transgenic plant or a transgenic microorganism with an increased content of fatty acids, oils or lipids with Δ6 double bonds due to the expression of a Δ6-desaturase from moss.

The invention also relates to transgenic organisms which contain a Δ6-desaturase gene, and to the use of the unsaturated fatty acids or triglycerides produced in the process with an increased content of unsaturated fatty acids.

Fatty acids and triglycerides have a variety of uses in the food industry, animal nutrition, cosmetics and pharmaceuticals. Depending on whether it is free saturated or unsaturated fatty acids or triglycerides with an increased content of saturated or unsaturated fatty acids, they are suitable for a wide variety of applications, for example polyunsaturated fatty acids are added to baby food to increase the nutritional value. The various fatty acids and triglycerides are mainly obtained from microorganisms such as Mortierella or from oil-producing plants such as soybean, rapeseed, sunflower and others, where they are generally obtained in the form of their triacylglycerides. But they can also be obtained from animals such as fish. The free fatty acids are advantageously produced by saponification.

Depending on the application, oils with saturated or unsaturated fatty acids are preferred. For example, lipids with unsaturated fatty acids, especially polyunsaturated fatty acids, are preferred in human nutrition because they have a positive influence on the cholesterol level in the blood and thus on the possibility of heart disease. Unsaturated fatty acids are also said to have a positive effect on carcinogenesis. They are also important raw materials for the synthesis of compounds that are important biological processes within the Control the organism. They are therefore used in various diet foods or medications.

In the past, due to their positive properties, there has been no lack of approaches to make genes involved in the synthesis of fatty acids or triglycerides available for the production of oils in various organisms with a modified content of unsaturated fatty acids. Thus, in WO 91/13972 and its US equivalent, a Δ9 desaturase

10 described. In WO 93/11245 a Δ15 desaturase is described in

WO 94/11516 claims a Δ12 desaturase. Δ6 desaturases are described in Girke et al. (The Plant Journal, 15, 1998: 39-48), Napier et al. (Biochem. J., 330, 1998: 611-614), Murata et al. (Biosynthesis of γ-linolenic acid in cyanobacterium spirulina

15 patensis, pp 22-32, In: γ-linolenic acid, metabolism an its roles in nutrition and medicine, Huang, Y. and Milles, D.E. [eds.], AOC Press, Champaign, Illinois), Sayanova et al. (Proc. Natl. Acad. Sci. USA, 94, 1997: 4211-4216), WO 98/46764, Cho et al. (J. Biol. Che., 274, 1999: 471-477), Aki et al. (Biochem. Biophys. Res.

20 Commun., 255, 1999: 575-579), and Reddy et al. (Plant Mol. Biol., 27, 1993: 293-300). Further desaturases are described, for example, in EP-A-0 550 162, WO 94/18337, WO 97/30582, WO 97/21340, WO 95/18222, EP-A-0 794 250, Stukey et al. , J. Biol. Che., 265, 1990: 20144-20149, Wada et al. , Nature 347, 1990:

25 200-203 or Huang et al. , Lipids 34, 1999: 649-659. Further Δ6-desaturases are described in WO 93/06712, US 5,614,393, US5,614,393, WO 96/21022, WO00 / 21557 and WO 99/27111. The biochemical characterization of the various desaturases has, however, hitherto been inadequate, since the enzymes as

30 membrane-bound proteins are very difficult to isolate and characterize (McKeon et al., Methods in Enzymol. 71, 1981: 12141-12147, Wang et al., Plant Physiol. Biochem., 26, 1988: 777-792). As a rule, membrane-bound desaturases are characterized by incorporation into one

35 suitable organism, which is then examined for enzyme activity by means of starting material and product analysis. The application for production in transgenic organisms as described in WO 98/46763 W098 / 46764, W098 / 46765. The expression of various desaturases as in W099 / 64616 or 0 W098 / 46776 and the formation of polyunsaturated fatty acids is also described and claimed. With regard to the effectiveness of the expression of desaturases and their influence on the formation of polyunsaturated fatty acids, it should be noted that the expression of a single desaturase as described in the aforementioned prior art 5 only low levels of unsaturated fatty acids, for example of Δ-6 unsaturated fatty acids / lipids such as γ -Linolenic acid have been and are being achieved. There is therefore still a great need for new and more suitable genes which code for enzymes which are involved in the biosynthesis of unsaturated fatty acids and make it possible to produce them on an industrial scale. There continues to be a need for improved processes for obtaining the highest possible levels of polyunsaturated fatty acids.

The object was therefore to provide a process for the production of unsaturated fatty acids using genes which code, for example, for desaturase enzymes and which are involved in the synthesis of polyunsaturated fatty acids in the seeds of an oilseed, and thus to increase the content of polyunsaturated fatty acids. This object was achieved by a process for the production of unsaturated fatty acids, characterized in that at least one isolated nucleic acid sequence which codes for a polypeptide with Δδ-desaturase activity, selected from the group:

a) a nucleic acid sequence with the sequence shown in SEQ ID NO: 1,

b) Nucleic acid sequences which are derived as a result of the degenerate genetic code from that in SEQ ID NO: 1

c) derivatives of the nucleic acid sequence shown in SEQ ID NO: 1, which code for polypeptides with the amino acid sequences shown in SEQ ID NO: 2 and have at least 50% homology at the amino acid level without the enzymatic action of the polypeptides being significantly reduced,

is introduced into an organism, this organism is attracted, the attracted organism containing at least 1 mol% of unsaturated fatty acids based on the total fatty acid content in the organism.

Cultivation of the organism is to be understood as the cultivation of plants as well as the cultivation of eukaryotic or prokaryotic microorganisms such as bacteria, yeasts, fungi, ciliates, algae, cyanobacteria, animal or plant cells or cell groups or the cultivation of animals.

The organisms obtained in the process according to the invention generally contain unsaturated fatty acids in the form of bound fatty acids, that is to say the unsaturated fatty acids are predominantly in the form of their mono-, di- or triglycerides, glycolipids, lipoproteins or phospholipids such as oils or lipids or other fatty acids bound as esters or amides. Free fatty acids are also contained in the organisms in the form of the free fatty acids or in the form of their salts. The free or bound unsaturated fatty acids advantageously contain, compared to the starting organisms, an increased content of fatty acids with Δ6 double bonds, such as γ-linolenic acid. The organisms obtained by cultivation in the process according to the invention and the unsaturated fatty acids contained in them can be used directly, for example, for the production of pharmaceutical preparations, agrochemicals, animal feeds or foods or after isolation from the organisms. All stages of the purification of the unsaturated fatty acids can be used, ie from crude extracts of the fatty acids to completely purified fatty acids are suitable for the production of the aforementioned products. In an advantageous embodiment, the bound fatty acids can be released from, for example, the oils or lipids, for example via basic hydrolysis, for example with NaOH or KOH. These free fatty acids can be used directly in the mixture obtained or after further purification for the production of pharmaceutical preparations, agrochemicals, animal feeds or foods. The bound or free fatty acids can also be used for transesterification or esterification, for example with other mono-, di- or triglycerides or glycerol, in order to increase the proportion of unsaturated fatty acids in these compounds, for example in the triglycerides.

A further subject of the invention is a process for the production of triglycerides with an increased unsaturated fatty acid content by triglycerides with saturated or unsaturated or saturated and unsaturated fatty acids with at least one of the protein which is encoded by the sequence SEQ ID NO: 2 , incubated. The process is advantageously carried out in the presence of compounds which can absorb or give off reduction equivalents. The fatty acids can then be released from the triglycerides.

The above-mentioned processes advantageously enable the synthesis of fatty acids or bound fatty acids such as triglycerides with an increased content of fatty acids with Δ6 double bonds.

Examples of organisms for the processes mentioned are plants such as arabidopsis, barley, wheat, rye, oats, corn, soybeans, rice, cotton, sugar beet, tea, carrots, peppers, canola, sunflower, flax, hemp, potatoes, triticale, tobacco, Tomato, rapeseed, coffee, tapioca, cassava, arrowroot, tagetes, alfalfa, peanut, castor bean, coconut, oil palm, safflower (Carthamus tinctorius), lettuce and the various tree, nut and wine species, or cocoa beans, microorganisms such as fungi Mortierella, Saprolegnia or Pythium, bacteria such as the genus Escherichia, cyanobacteria, algae or protozoa such as dinoflagellates such as Crypthecodinium. Organisms which can naturally synthesize oils in large quantities, such as microorganisms such as fungi such as Mortierella alpina, Pythium insidiosum or plants such as soybean, rapeseed, coconut, oil palm, canola, safflower (Carthamus tinctorius), castor oil, calendula, linseed, borage, peanut, are preferred , Cocoa bean or sunflower, soya, rape or sunflower are particularly preferred.

Depending on the host organism, the organisms used in the processes are grown or cultivated in a manner known to those skilled in the art. Microorganisms such as bacteria, fungi, ciliates, plant or animal cells are usually in a liquid medium containing a carbon source mostly in the form of sugars, a nitrogen source mostly in the form of organic nitrogen sources such as yeast extract or salts such as ammonium sulfate, trace elements such as iron, Manganese, magnesium salts and possibly vitamins contains, at temperatures between 0 ° C and 100 ° C, preferably between 10 ° C to 60 ° C, depending on the organism, oxygen or in the absence of oxygen. The pH of the nutrient liquid can be kept at a fixed value, i.e. the pH is regulated during cultivation or the pH is not regulated and changes during cultivation. The cultivation can be batch-wise, semi-batch wise or continuous. Nutrients can be added at the start of the fermentation or fed semi-continuously or continuously. Cultivation on solid media is also possible.

After transformation, plants are generally regenerated and then grown or grown as usual. This can be done in the greenhouse or outdoors.

After culturing, the lipids are usually obtained from the organisms. For this purpose, the organisms can first be digested after harvesting or used directly. The lipids are advantageously mixed with suitable solvents such as apolar

Solvents such as hexane or ethanol, isopropanol or mixtures such as hexane / isopropanol, phenol / chloroform / isoamyl alcohol extracted at temperatures between 0 ° C to 80 ° C, preferably between 20 ° C to 50 ° C. The biomass is usually extracted with an excess of solvent, for example an excess of solvent to biomass of 1: 4. The solvent is then removed, for example by distillation. The extraction can also be carried out with supercritical CO ₂ . After extraction, the remaining biomass can be removed, for example, by filtration.

The crude oil obtained in this way can then be further purified, for example by removing turbidity by adding polar solvents such as acetone or chloroform and then filtering or centrifuging. Further purification using chromatographic processes, distillation or crystallization is also possible.

To obtain the free fatty acids from the triglycerides, they are saponified in the usual way, as described above.

Another object of the invention are unsaturated fatty acids and trigylcerides with an increased content of unsaturated fatty acids, which were prepared by the above methods, and their use for the production of food, animal feed, cosmetics or pharmaceuticals. For this purpose, they are added to the food, animal feed, cosmetics or pharmaceuticals in the usual amounts.

In the process according to the invention, expression of a Δ6-desaturase from moss in organisms such as fungi, bacteria, animals or plants, preferably fungi, bacteria and plants, particularly preferably in plants, very particularly preferably in oil crop plants such as rapeseed, canola, linseed, soybean, sunflower , Borage, castor, oil palm, safflower (Carthamus tinctorius), coconut, peanut or cocoa bean receive higher levels of unsaturated fatty acids such as γ-linolenic acid. Expression in crops such as corn, wheat, rye, oats, triticale, rice, barley, alfalfa or bush plants (coffee, cocoa, tea) is also advantageous. The expression of a gene which codes for a Δ-6-desaturase from moss in the above-mentioned organisms enables contents of unsaturated fatty acids in the organisms of at least 1 mol%, preferably at least 3 mol%, particularly preferably at least 4 mol -%, very particularly preferably at least 5 mol% can be achieved.

Derivatives are, for example, functional homologues of the enzymes encoded by SEQ ID NO: 1 or their enzymatic activity, that is to say enzymes which catalyze the same enzymatic reactions as those of SEQ ID NO: 1. These genes also enable advantageous production of unsaturated fatty acids with double bonds in the Δ6 position. Below unsaturated fatty acids are double or polyunsaturated fatty acids which have double bonds, to understand. The double bonds can be conjugated or non-conjugated. The sequence mentioned in SEQ ID NO: 1 codes for an enzyme which has a Δ6-desaturase activity.

5 The enzyme Δ6-desaturase according to the invention advantageously introduces a cis double bond in position C ₆ ~ C into fatty acid residues of glycerolipids (see SEQ ID NO: 1). The enzyme also has a Δ6-desaturase activity which advantageously only introduces a cis double bond in the 10 position Cg-C into fatty acid residues of glycerolipids. The enzyme with the sequence given in SEQ ID NO: 1, which is a monofunctional Δ6 desaturase, also has this activity.

The nucleic acid sequence (s) used in the method according to the invention (for the application, the singular should comprise the plural and vice versa) or fragments thereof can advantageously be used for the isolation of further genomic sequences via homology screening.

20 The derivatives mentioned can be isolated, for example, from other organisms in eukaryotic organisms such as plants such as specifically mosses, dinoflagellates or fungi.

Furthermore, derivatives or functional derivatives include

25 sequence in SEQ ID NO: 1 to understand, for example, allelic variants which have at least 50% homology at the derived amino acid level, advantageously at least 70% homology, preferably at least 80% homology, particularly preferably at least 85% homology, very particularly preferably 90% homology ,

30 The homology was calculated over the entire amino acid range. The program PileUp, BESTFIT, GAP, TRANSLATE or BACKTRANSLATE (= part of the program package UWGCG, Wisconsin Package, Version 10.0-UNIX, January 1999, Genetics Computer Group, Inc., Deverux et al., Nucleic. Acid Res., 12

35 1984: 387-395) (J. Mol. Evolution., 25, 351-360, 1987, Higgins et al., CABIOS, 5 1989: 151-153). The amino acid sequence derived from the nucleic acids mentioned can be found in sequence SEQ ID NO: 2. Homology means identity, that is, the amino acid sequences are at least

40 50% identical. At the nucleic acid level, the sequences according to the invention are at least 65% homologous, preferably at least 70%, particularly preferably 75%, very particularly preferably at least 80%.

45 allele variants comprise in particular functional variants which can be obtained by deleting, inserting or substituting nucleotides from the sequence shown in SEQ ID NO: 1, wherein the enzymatic activity of the derived synthesized proteins is retained.

Such DNA sequences can be started from the DNA sequence described in SEQ ID NO: 1 or parts thereof

Isolate sequences, for example with conventional hybridization methods or the PCR technique, from other eukaryotes such as those mentioned above. These DNA sequences hybridize to the sequences mentioned under standard conditions. Short oligonucleotides, for example of the conserved regions, which can be determined by comparison with other desaturase genes in a manner known to the person skilled in the art, are advantageously used for the hybridization. The histidine box sequences are advantageously used. However, longer fragments of the nucleic acids according to the invention or the complete sequences can also be used for the hybridization. These standard conditions vary depending on the nucleic acid used: oligonucleotide, longer fragment or complete sequence or depending on the type of nucleic acid DNA or RNA used for the hybridization. For example, the melting temperatures for DNA: DNA hybrids are approx. 10 ° C lower than those of DNA: RNA hybrids of the same length.

Under standard conditions, for example, depending on the nucleic acid, temperatures between 42 and 58 ° C in an aqueous buffer solution with a concentration between 0.1 to 5 x SSC (1 X SSC - 0.15 M NaCl, 15 M sodium citrate, pH 7.2) ) or additionally in the presence of 50% formamide such as 42 ° C in 5 x SSC, 50% formamide. The hybridization conditions for DNA: DNA hybrids are advantageously 0.1 × SSC and temperatures between approximately 20 ° C. to 45 ° C., preferably between approximately 30 ° C. to 45 ° C. For DNA: RNA hybrids the hybridization conditions are advantageously 0.1 x SSC and temperatures between about 30 ^C C and 55 ° C, preferably between about 45 ° C to 55 ° C. These specified temperatures for the hybridization are, for example, calculated melting temperature values for a nucleic acid with a length of approx. 100 nucleotides and a G + C content of 50% in the absence of formamide. The experimental conditions for DNA hybridization are in relevant textbooks of genetics such as Sambrook et al. , "Molecular Cloning", Cold Spring Harbor Laboratory, 1989, and can be calculated according to formulas known to the person skilled in the art, for example depending on the length of the nucleic acids, the type of hybrid or the G + C content. The person skilled in the art can obtain further information on hybridization from the following textbooks: Ausubel et al.

(eds), 1985, Current Protocols in Molecular Biology, John Wiley & Sons, New York; Harnes and Higgins (eds), 1985, Nucleic Acids Hybridization: A Practical Approach, IRL Press at Oxford University Press, Oxford; Brown (ed), 1991, Essential Molecular Biology: A Practical Approach, IRL Press at Oxford University Press, Oxford.

Derivatives homologs of the sequence SEQ ID No: 1 are furthermore to be understood, for example, as eukaryotic homologs, shortened sequences, single-stranded DNA of the coding and non-coding DNA sequence or RNA of the coding and non-coding DNA sequence.

In addition, homologs of the sequence SEQ ID NO: 1 are to be understood as derivatives such as promoter variants. These variants can be changed by one or more nucleotide exchanges, by insertion (s) and / or deletion (s), but without the functionality or effectiveness of the promoters being impaired. Furthermore, the effectiveness of the promoters can be increased by changing their sequence, or completely replaced by more effective promoters, including organisms of other species.

Derivatives are also advantageously to be understood as variants whose nucleotide sequence in the range -1 to -2000 before the start codon has been changed such that the gene expression and / or the protein expression is changed, preferably increased. Derivatives are also to be understood as variants that were changed at the 3 'end.

The nucleic acid sequences which code for a Δ6-desaturase can be produced synthetically or obtained naturally or contain a mixture of synthetic and natural DNA components, and can consist of different heterologous Δ6-desaturase gene segments from different organisms. In general, synthetic nucleotide sequences with codons are generated which are preferred by the corresponding host organisms, for example plants. This usually leads to optimal expression of the heterologous genes. These plant preferred codons can be determined from the highest protein frequency codons expressed in most interesting plant species. An example of Corynebacterium glutamicum is given in: Wada et al. (1992) Nucleic Acids Res. 20: 2111 to 2118). Such experiments can be carried out using standard methods and are known to the person skilled in the art.

Functionally equivalent sequences which code for the Δ6-desaturase gene are those derivatives of the sequence according to the invention which, despite the differing nucleotide sequence, are still the desired ones Functions, that is, possess the enzymatic activity of the proteins. Functional equivalents thus include naturally occurring variants of the sequences described here, as well as artificial, for example chemical nucleotide sequences obtained by chemical synthesis and adapted to the codon use of a plant.

In addition, artificial DNA sequences are suitable as long as, as described above, they impart the desired property, for example increasing the content of Δ6 double bonds in fatty acids, oils or lipids in the plant by overexpression of the Δ6 desaturase gene in crop plants. Such artificial DNA sequences can be determined, for example, by back-translating proteins constructed using molecular modeling, which have Δ6-desaturase activity, or by in vitro selection. Possible techniques for the in vitro evolution of DNA to change or improve the DNA sequences are described in Patten, P.A. et al. , Current Opinion in Biotechnology 8, 724-733 (1997) or Moore, J.C. et al., Journal of Molecular Biology 272, 336-347 (1997). Coding DNA sequences which are obtained by back-translating a polypeptide sequence in accordance with the odon usage specific for the host plant are particularly suitable. The specific codon usage can easily be determined by a person skilled in plant genetic methods by computer evaluations of other, known genes of the plant to be transformed.

Other suitable equivalent nucleic acid sequences are sequences which code for fusion proteins, part of the fusion protein being a Δ6-desaturase polypeptide or a functionally equivalent part thereof. The second part of the fusion protein can e.g. be another polypeptide with enzymatic activity or an antigenic polypeptide sequence that can be used to detect Δ6-desaturase expression (e.g. mye-tag or his-tag). However, this is preferably a regulatory protein sequence, such as e.g. a signal sequence for the ER that directs the Δ6-desaturase protein to the desired site of action.

The Δ6-desaturase genes can advantageously be combined in the method according to the invention with other genes of fatty acid biosynthesis. Examples of such genes are acetyltransferases, further desaturases or elongases of unsaturated or saturated fatty acids as described in WO 00/12720. For in-vivo and especially in-vitro synthesis, the combination with, for example, NADH cytochrome B5 reductases is advantageous, which can absorb or release reduction equivalents. The proteins used in the method according to the invention are to be understood as proteins which contain an amino acid sequence shown in the sequence SEQ ID NO: 2 or a sequence obtainable therefrom by substitution, inversion, insertion or deletion of one or 5 more amino acid residues, the enzymatic activity of the protein shown in SEQ ID NO: 2 is retained or is not significantly reduced. Not significantly reduced is to be understood as meaning all enzymes which are still at least 10%, preferably 20%, particularly preferred

10 30% of the enzymatic activity of the starting enzyme. For example, certain amino acids can be replaced by those with similar physicochemical properties (space filling, basicity, hydrophobicity, etc.). For example, arginine residues against lysine residues, valine residues against isoleucine

15 residues or aspartic acid residues exchanged for glutamic acid residues. However, one or more amino acids can also be interchanged, added or removed in their order, or several of these measures can be combined with one another.

20

Derivatives are also to be understood as functional equivalents which in particular also include natural or artificial mutations of an originally isolated sequence coding for Δ6-desaturase, which furthermore show the desired function, that

25 means that their enzymatic activity is not significantly reduced. Mutations include substitutions, additions, deletions, exchanges or insertions of one or more nucleotide residues. Thus, for example, the present invention also encompasses those nucleotide sequences which are obtained by modifying the Δ6-desaturase nucleotide sequence. The aim of such a modification can e.g. further narrowing down the coding sequence contained therein or e.g. also be the insertion of further restriction enzyme interfaces.

5 Functional equivalents are also those variants whose function is weakened (= not significantly reduced) or enhanced compared to the starting gene or gene fragment (= enzyme activity is stronger than the activity of the starting enzyme, i.e. activity is higher than 100%, preferred higher than 0%, particularly preferably higher than 130%).

The above-mentioned nucleic acid sequences used in the method according to the invention are advantageously inserted into an expression cassette for introduction into a host organism. 5 However, the nucleic acid sequences can also be introduced directly into the host organism. The nucleic acid sequence can advantageously be, for example, a DNA or cDNA sequence. Coding sequences suitable for insertion into an expression cassette are, for example, those which code for a Δ6-desaturase with the sequences described above and which give the host the ability to overproduce fatty acids, oils or lipids with double bonds in the Δ6-position. These sequences can be of homologous or heterologous origin.

An expression cassette (= nucleic acid construct or fragment) is the sequence mentioned in SEQ ID NO: 1, which is to be understood as the result of the genetic code and / or its functional or non-functional derivatives, which advantageously with one or more regulatory signals to increase the Gene expression were functionally linked and which control the expression of the coding sequence in the host cell. These regulatory sequences are intended to enable targeted expression of the genes and protein expression. Depending on the host organism, this can mean, for example, that the gene is only expressed and / or overexpressed after induction, or that it is expressed and / or overexpressed immediately. For example, these regulatory sequences are sequences to which inducers or repressors bind and thus regulate the expression of the nucleic acid. In addition to these new regulatory sequences or instead of these sequences, the natural regulation of these sequences may still be present before the actual structural genes and may have been genetically modified so that the natural regulation has been switched off and the expression of the genes increased. However, the gene construct can also have a simpler structure, that is to say no additional regulation signals have been inserted in front of the nucleic acid sequence or its derivatives, and the natural promoter with its regulation has not been removed. Instead, the natural regulatory sequence was mutated in such a way that regulation no longer takes place and / or gene expression is increased. These modified promoters can also be brought in front of the natural gene to increase the activity in the form of partial sequences (= promoter with parts of the nucleic acid sequences according to the invention). The gene construct can also advantageously contain one or more so-called "enhancer sequences" functionally linked to the promoter, which enable increased expression of the nucleic acid sequence. Additional advantageous sequences, such as further regulatory elements or terminators, can also be inserted at the 3 'end of the DNA sequences. The Δ6-desaturase gene can be contained in one or more copies in the expression cassette (= gene construct). Genes which are possibly also expressed and which are advantageously involved in fatty acid biosynthesis can also be present in one or more copies in the expression cassette. As described above, the regulatory sequences or factors can preferably have a positive influence on the gene expression of the introduced genes and thereby increase it. Thus, the regulatory elements can advantageously be strengthened at the transcription level by using strong transcription signals such as promoters and / or "enhancers". In addition, an increase in translation is also possible, for example, by improving the stability of the mRNA.

In principle, all promoters which can advantageously control the expression of foreign genes in organisms in plants or fungi are suitable as promoters in the expression cassette. In particular, a plant promoter or promoters which originate, for example, from a plant virus are preferably used. Advantageous regulatory sequences for the method according to the invention are, for example, in promoters such as cos, tac, trp, tet, trp-tet, lpp, lac, lpp-lac, lacl ^ - T7, T5, T3 -, gal-, trc-, ara-, SP6-, λ-P _R - or contained in the λ-P _L promoter, which are advantageously used in gram-negative bacteria. Further advantageous regulatory sequences are, for example, in the gram-positive promoters amy and SP02, in the yeast or fungal promoters ADC1, MFα, AC, P-60, CYC1, GAPDH, TEF, rp28, ADH or in the plant promoters such as CaMV / 35S [Franck et al. , Cell 21 (1980) 285-294], RUBISCO SSU, OCS, B33, nos (= nopaline synthase promoter) or in the ubiquitin promoter. The expression cassette can also contain a chemically inducible promoter, by means of which the expression of the exogenous Δ6-desaturase gene in the organisms can advantageously be controlled in the plants at a specific point in time. Such advantageous plant promoters are, for example, the PRPl promoter [Ward et al. , Plans. Mol. Biol. 22 (1993), 361-366], one which is inducible by benzenesulfonamide (EP 388186), one which is inducible by tetracycline (Gatz et al., (1992) Plant J. 2,397-404), one inducible by salicylic acid Promoter (WO 95/19443), an abscisic acid-inducible (EP335528) or an ethanol- or cyclohexanone-inducible (WO 93/21334) promoter. Other plant promoters are, for example, the promoter of the cytosolic FBPase from potato, the ST-LSI promoter from potato (Stockhaus et al., EMBO J. 8 (1989) 2445-245), the promoter of the phosphoribosyl pyrophosphate amidotransferase from Glycine max (see also Genbank Accession Number U87999) or a node-specific promoter as in EP 249676 can advantageously be used. Plant promoters which ensure expression in tissues or plant parts / organs in which fatty acid biosynthesis or its precursors take place, such as, for example, in the endosperm or in the developing embryo, are particularly advantageous. INS Particular mention should be made of advantageous promoters which ensure seed-specific expression, such as, for example, the USP promoter or derivatives thereof, the LEB4 promoter, the phaseolin promoter or the napin promoter. The 5 and particularly advantageous USP promoter or its derivatives listed according to the invention mediate very early gene expression in seed development (Baeumlein et al., Mol Gen Genet, 1991, 225 (3): 459-67). Further advantageous seed-specific promoters that can be used for monocot and dicot plants are those for dicots

10 suitable promoters such as Napingen promoter from rapeseed (US5, 608, 152), the oleosin promoter from Arabidopsis (WO98 / 45461), the phaseolin promoter from Phaseolus vulgaris (US5, 504, 200), the Bce4- Promoter from Brassica (W091 / 13980) or the legume B4 promoter (LeB4, Baeumlein

15 et al., Plant J., 2, 2, 1992: 233-239) or promoters suitable for monocotyledons such as the promoters, the promoters of the barley Ipt2 or Iptl gene (WO95 / 15389 and WO95 / 23230) or the promoters of the barley Hordein gene, the rice glutelin gene, the rice oryzin gene, the rice prolamin gene, the wheat gliadin

20 genes, the wheat glutelin gene, the maize zein gene, the oat glutelin gene, the sorghum kasirin gene or the rye secalin gene, which are described in WO99 / 16890.

Furthermore, promoters are particularly preferred which ensure expression in tissues or parts of plants in which, for example, the biosynthesis of fatty acids, oils and lipids or their precursors takes place. Promoters that ensure seed-specific expression should be mentioned in particular. The promoter of the napin gene from rapeseed 30 (US 5,608,152), the USP promoter from Vicia faba (USP = unknown seed protein, Baeumlein et al., Mol Gen Genet, 1991, 225 (3): 459-67) should be mentioned , the oleosin gene from Arabidopsis (WO98 / 45461), the phaseolin promoter (US 5,504,200) or the promoter of the legumin B4 gene (LeB4; Baeumlein et al., 1992, Plant Journal, 2 (2): 35 233- 9). Also to be mentioned are promoters, such as that of the lpt2 or Iptl gene from barley (WO95 / 15389 and WO95 / 23230), which mediate seed-specific expression in monocotyledonous plants.

As described above, the expression cassette (= gene construct, nucleic acid construct) may also contain further genes which are to be introduced into the organisms. These genes can be under separate regulation or under the same regulatory region as the Δ6-desaturase gene. These genes are, for example, further biosynthesis genes 5, advantageously of fatty acid biosynthesis, which are increased

Enable synthesis. For example, the genes for the Δ15-, Δ12-, Δ9-, Δ5-, Δ4-desaturase, the various hydroxylases, called the acyl-ACP thioesterases, β-ketoacyl synthases or β-ketoacyl reductases. The desaturase genes are advantageously used in the nucleic acid construct.

In principle, all natural promoters with their regulatory sequences such as those mentioned above can be used for the expression cassette according to the invention and the method according to the invention, as described below. In addition, synthetic promoters can also be used advantageously.

Various DNA fragments can be manipulated in order to obtain a nucleotide sequence which is expediently read in the correct direction and which is equipped with a correct reading frame. To connect the DNA fragments (= nucleic acids according to the invention) to one another, adapters or linkers can be attached to the fragments.

The promoter and the terminator regions can expediently in the transcription direction with a linker or polylinker which has one or more restriction sites for the

Insertion of this sequence contains. As a rule, the linker has 1 to 10, usually 1 to 8, preferably 2 to 6, restriction sites. In general, the linker has a size of less than 100 bp, often less than 60 bp, but at least 5 bp within the regulatory ranges. The promoter can be native or homologous as well as foreign or heterologous to the host organism, for example to the host plant. The expression cassette contains in the 5 '-3' transcription direction the promoter, a DNA sequence which codes for a Δ6-desaturase gene used in the method according to the invention and a region for the transcriptional termination. Different termination areas are interchangeable.

Manipulations which provide suitable restriction sites or which remove superfluous DNA or restriction sites can also be used. Where insertions, deletions or substitutions such as transitions and transversions are possible, in vitro mutagenesis, primer repair, restriction or ligation can be used. With suitable manipulations, such as restriction, chewing back or filling in of overhangs for blunt ends, complementary ends of the fragments can be made available for the ligation. The attachment of the specific ER retention signal SEKDEL (Schouten, A. et al., Plant Mol. Biol. 30 (1996), 781-792) can be important for an advantageous high expression, the average expression level is thus tripled to quadrupled , Other retention signals, which occur naturally in plant and animal proteins located in the ER, can also be used to construct the cassette.

Preferred polyadenylation signals are plant polyadenylation signals, preferably those which essentially correspond to T-DNA polyadenylation signals from Agrobacterium tumefaciens, in particular gene 3 of T-DNA (octopine synthase) of the Ti plasmid pTiACH5 (Gielen et al., EMBO J. 3 (1984), 835 ff) or corresponding functional equivalents.

An expression cassette is produced by fusing a suitable promoter with a suitable Δ6-desaturase DNA sequence and a polyadenylation signal according to common recombination and cloning techniques, as described, for example, in T. Maniatis, E.F. Fritsch and J. Sambrook, Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory, Cold Spring Harbor, NY (1989) and in T.J. Silhavy, M.L. Ber an and L.W. Enquist, Experiments with Gene Fusions, Cold Spring Harbor Laboratory, Cold Spring Harbor, NY (1984) and in Ausubel, F.M. et al. , Current Protocols in Molecular Biology, Greene Publishing Assoc. and Wiley-Interscience (1987).

The DNA sequence coding for a Δ6-desaturase from Phsyco-mitrella patens contains all the sequence features which are necessary in order to achieve a localization correct for the location of the fatty acid, lipid or oil biosynthesis. Therefore no further targeting sequences per se are necessary. However, such a localization can be desirable and advantageous and can therefore be artificially modified or reinforced, so that such fusion constructs are also a preferred advantageous embodiment of the invention.

Sequences which ensure targeting in plastids are particularly preferred. Under certain circumstances, targeting in other compartments (ref .: Kermode, Crit. Rev. Plant Sei. 15, 4 (1996), 285-423) can also be carried out, for example, in the vacuole, in the mitochondrion, in the endoplasmic reticulum (ER) , Peroxisomes, lipid bodies or, due to the lack of corresponding operative sequences, it would be desirable to remain in the compartment of formation, the cytosol. The nucleic acid sequences coding for Δ6-desaturase genes are advantageously cloned together with at least one reporter gene into an expression cassette which is introduced into the organism via a vector or directly into the genome. This reporter gene should be easy to detect via a

Allow growth, fluorescence, chemo-, bioluminescence or resistance assay or via a photometric measurement. Examples of reporter genes are antibiotic or herbicide resistance genes, hydrolase genes, fluorescence protein genes, bioluminescence genes, sugar or nucleotide metabolism genes or biosynthesis genes such as the Ura3 gene, the Ilv2 gene, the luciferase gene, the β-galactosidase gene, the gfp gene Deoxyglucose-6-phosphate-phosphatase gene, the ß-glucuronidase gene, ß-lactamase gene, the neomycin phosphotransferase gene, the hygromycin phosphotransferase gene or the BASTA (= gluphosinate resistance) gene is called. These genes enable the transcription activity and thus the expression of the genes to be easily measured and quantified. This enables genome sites to be identified that show different levels of productivity.

According to a preferred embodiment, an expression cassette comprises upstream, i.e. at the 5 'end of the coding sequence, a promoter and downstream, i.e. at the 3 'end, a polyadenylation signal and optionally further regulatory elements which are operatively linked to the coding sequence for the Δ6-desaturase DNA sequence in between. An operative link is understood to mean the sequential arrangement of promoter, coding sequence, terminator and, if appropriate, further regulatory elements in such a way that each of the regulatory elements can perform its function as intended in the expression of the coding sequence. The sequences preferred for the operative linkage are targeting sequences to ensure subcellular localization in plastids. But also targeting sequences to ensure subcellular localization in the mitochondrion, in the endoplasmic reticulum

(= ER), in the cell nucleus, in oil corpuscles or other compartments can be used if necessary, and translation enhancers such as the 5 'guiding sequence from the tobacco mosaic virus (Gallie et al., Nucl. Acids Res. 15 (1987), 8693- 8711).

An expression cassette can contain, for example, a constitutive promoter (preferably the USP or Napin promoter), the gene to be expressed and the ER retention signal. The amino acid sequence KDEL (lysine, aspartic acid, glutamic acid, leucine) is preferably used as the ER retention signal. For expression in a prokaryotic or eukaryotic host organism, for example a microorganism such as a fungus or a plant, the expression cassette is advantageously inserted into a vector such as, for example, a plasmid, a phage or other DNA, which enables optimal expression of the genes in the host organism. Suitable plasmids are, for example, in E. coli pLG338, pACYC184, pBR series such as pBR322, pUC series such as pUC18 or pUC19, M113mp series, pKC30, pRep4, pHSl, pHS2, pPLc236, pMBL24, pLG200, pUR290, pIN-III ¹¹³ -Bl, λgtll or pBdCI, in Streptomyces pIJlOl, pIJ364, PIJ702 or pIJ361, in Bacillus pUBllO, pC194 or pBD214, in Corynebacterium pSA77 or pAJ667, in mushrooms pALSl, pILvektor, et al , , [(1992) "Foreign gene expression in yeast: a review", Yeast 8: 423-488] and by van den Hondel, CAMJJ et al. [(1991) "Heterologous gene expression in filamentous fungi] and in More Gene Manipulations in Fungi [JW Bennet & LL Lasure, eds., P. 396-428: Academic Press: San Diego] and in" Gene transfer Systems and vector development for filamentous fungi "[van den Hondel, CAMJJ & Punt, PJ (1991) in: Applied

Molecular Genetics of Fungi, Peberdy, JF et al. , eds., p. 1-28, Cambridge University Press: Cambridge]. Advantageous yeast vectors are, for example, 2μM, pAG-1, YEp6, YEpl3 or pEMBLYe23. Examples of algae or plant promoters are pLGV23, pGHlac ⁺ , pBIN19, pAK2004, pVKH or pDH51 (see Schmidt, R. and Willmitzer, L., 1988). The above-mentioned vectors or derivatives of the above-mentioned vectors represent a small selection of the possible plasmids. Further plasmids are well known to the person skilled in the art and can be found, for example, in the book Cloning Vectors (Eds. Pouwels PH et al. Elsevier, Amsterdam-New York-Oxford , 1985, ISBN 0 444 904018). Suitable plant vectors are described in "Methods in Plant Molecular Biology and Biotechnology" (CRC Press), Chap. 6/7, p.71-119. Advantageous vectors are so-called shuttle vectors or binary vectors which replicate in E. coli and Agrobacterium.

In addition to plasmids, vectors are also understood to mean all other vectors known to the person skilled in the art, such as phages, viruses such as SV40, CMV, baculovirus, adenovirus, transposons, IS elements, phasmids, phagemids, cosmids, linear or circular DNA. These vectors can be replicated autonomously in the host organism or replicated chromosomally, chromosomal replication is preferred. In a further embodiment of the vector, the expression cassette according to the invention can also advantageously be introduced into the organisms in the form of a linear DNA and integrated into the genome of the host organism via heterologous or homologous recombination. This linear DNA can consist of a linearized plasmid or only the expression cassette as a vector or the nucleic acid sequences according to the invention.

In a further advantageous embodiment, the nucleic acid sequence according to the invention can also be introduced into an organism on its own.

If, in addition to the nucleic acid sequence according to the invention, further genes are to be introduced into the organism, they can all be introduced into the organism together with a reporter gene in a single vector or each individual gene with a reporter gene in each vector or several genes together in different vectors, the different vectors can be introduced simultaneously or successively.

The vector advantageously contains at least one copy of the nucleic acid sequences which code for a Δ6-desaturase and / or the expression cassette.

For example, the plant expression cassette can be transformed into the transformation vector pRT ((a) Toepfer et al., 1993, Methods Enzymol., 217: 66-78; (b) Toepfer et al. 1987, Nucl. Acids. Res. 15: 5890 ff. ) to be built in.

Alternatively, a recombinant vector (= expression vector) can also be transcribed and translated in vitro, e.g. by using the T7 promoter and the T7 RNA polymerase.

Expression vectors used in prokaryotes frequently use inducible systems with and without fusion proteins or fusion oligopeptides, it being possible for these fusions to take place both at the N-terminal and at the C-terminal or other usable domains of a protein. Such fusion vectors usually serve: i.) To increase the expression rate of the RNA ii.) To increase the achievable protein synthesis rate, iii.) To increase the solubility of the protein, iv. ) or to simplify purification by means of a binding sequence which can be used for affinity chromatography. Frequently, proteolytic cleavage sites are also introduced via fusion proteins, which enables a part of the fusion protein to be split off, also for purification. Such recognition sequences for Identifying proteases are, for example, factor Xa, thrombin and enterokinase.

Typical advantageous fusion and expression vectors are pGEX [Pharmacia Biotech Ine; Smith, D.B. and Johnson, K.S. (1988) Gene 67: 31-40], pMAL (New England Biolabs, Beverly, MA) and pRIT5 (Pharmacia, Piscataway, NJ) which contains glutathione S-transferase (GST), maltose binding protein, or protein A.

Further examples of E. coli expression vectors are pTrc

[Amann et al. , (1988) Gene 69: 301-315] and pET vectors [Studier et al. , Gene Expression Technology: Methods in Enzymology 185, Academic Press, San Diego, California (1990) 60-89; Stratagene, Amsterdam, Netherlands].

Further advantageous vectors for use in yeast are pYepSecl (Baldari, et al., (1987) Embo J. 6: 229-234), pMFa (Kurjan and Herskowitz, (1982) Cell 30: 933-943), pJRY88 (Schultz et al., (1987) Gene 54: 113-123), and pYES derivatives (Invitrogen Corporation, San Diego, CA). Vectors for use in filamentous mushrooms are described in: van den Hondel, C.A.M.J.J. & Punt, P.J. (1991) "Gene transfer Systems and vector development for filamentous fungi, in: Applied Molecular Genetics of Fungi, J.F. Peberdy, et al., Eds., P. 1-28, Cambridge University Press: Cambridge.

Alternatively, insect cell expression vectors can also be used advantageously, e.g. for expression in Sf 9 cells. These are e.g. the vectors of the pAc series (Smith et al. (1983) Mol. Cell Biol. 3: 2156-2165) and the pVL series (Lucklow and Summers (1989) Virology 170: 31-39).

Furthermore, plant cells or algal cells can advantageously be used for gene expression. Examples of plant expression vectors can be found in Becker, D., et al. (1992) "New plant binary vectors with selectable markers located proximal to the left border", Plant Mol. Biol. 20: 1195-1197 or in Bevan, M.W. (1984) "Binary Ägebbacte ium vectors for plant transformation", Nucl. Acid. Res. 12: 8711-8721.

Furthermore, the nucleic acid sequences coding for the Δ6-desaturase can be expressed in mammalian cells. Examples of corresponding expression vectors are pCDM8 and pMT2PC mentioned in: Seed, B. (1987) Nature 329: 840 or Kaufman et al. (1987) EMBO J. 6: 187-195). In this case, promoters to be used are preferably of viral origin, such as promoters of the polyoma, adenovirus 2, cytomegalovirus or Simian virus 40. Others prokaryotic and eukaryotic expression systems are mentioned in chapters 16 and 17 in Sambrook et al. , Molecular Cloning: A Laboratory Manual. 2nd, ed., Cold Spring Harbor Laboratory, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, 5 1989.

The introduction of the nucleic acids according to the invention, the expression cassette or the vector into organisms, for example into plants, can in principle be carried out by all methods known to the person skilled in the art.

For microorganisms, the person skilled in the art can use the corresponding textbooks from Sambrook, J. et al. (1989) Molecular cloning: A laboratory manual, Cold Spring Harbor Laboratory Press, by 5 F.M. Ausubel et al. (1994) Current protocols in molecular biology, John Wiley and Sons, by D.M. Glover et al. , DNA Cloning Vol.l, (1995), IRL Press (ISBN 019-963476-9), by Kaiser et al. (1994) Methods in Yeast Genetics, Cold Spring Habor Laboratory Press or Guthrie et al. See Guide to Yeast Genetics and Molecular 0 Biology, Methods in Enzymology, 1994, Academie Press.

The transfer of foreign genes into the genome of a plant is called transformation. The methods described for the transformation and regeneration of plants from 5 plant tissues or plant cells for transient or stable transformation are used. Suitable methods are protoplast transformation by polyethylene glycol-induced DNA uptake, the biolistic method with the gene cannon - the so-called particle bombardment method -, electroporation, the incubation of dry embryos in DNA-containing solution, microinjection and the gene transfer mediated by Agrobacterium. The methods mentioned are described, for example, in B. Jenes et al. , Techniques for Gene Transfer, in: Transgenic Plants, Vol. 1, Engineering and Utilization, edited by SD Kung and R. 5 Wu, Academie Press (1993) 128-143 and in Potrykus Annu. Rev. Plant Physiol. Plant Molec. Biol. 42 (1991) 205-225). The construct to be expressed is preferably cloned into a vector which is suitable for transforming Agrobacterium tumefaciens, for example pBin19 (Bevan et al., Nucl. Acids Res. 0 12 (1984) 8711). Agrobacteria transformed with such a vector can then be used in a known manner for transforming plants, in particular crop plants, such as tobacco plants, for example, by bathing wounded leaves or leaf pieces in an agrobacterial solution and then cultivating them in suitable media. The transformation of plants with Agrobacterium tumefaciens is described, for example, by Höfgen and Willmitzer in Nucl. Acid Res. (1988) 16, 9877 or is known, inter alia, from FF White, Vectors for Gene Transfer in Higher Plants; in Transgenic Plants, Vol. 1, Engineering and Utilization, edited by SD Kung and R. Wu, Academie Press, 1993, pp. 15-38.

Agrobacteria transformed with an expression vector as described above can also be used in a known manner to transform plants such as test plants such as Arabidopsis or crop plants such as cereals, corn, oats, rye, barley, wheat, soybeans, rice, cotton, sugar beet, canola, triticale, rice, Sunflower, flax, hemp, potato, tobacco, tomato, coffee, cocoa, tea, carrot, paprika, rapeseed, tapioca, cassava, arrowroot, tagetes, alfalfa, lettuce and the various tree, nut and wine species, especially oil containing crops such as soy, peanut, castor, borage, flax, sunflower,

Canola, cotton, flax, rapeseed, coconut, oil palm, safflower (Carthamus tinctorius) or cocoa bean can be used, e.g. by bathing wounded leaves or leaf pieces in an agrobacterial solution and then cultivating them in suitable media.

The genetically modified plant cells can be regenerated using all methods known to the person skilled in the art. Appropriate methods can be found in the above-mentioned writings by S.D. Kung and R. Wu, Potrykus or Höfgen and Willmitzer can be found.

In principle, all organisms which are able to synthesize fatty acids, especially unsaturated fatty acids or are suitable for the expression of recombinant genes are advantageously suitable as organisms or host organisms for the nucleic acids used, the expression cassette or the vector used. Examples include plants such as Arabidopsis, Asteraceae such as Calendula or crops such as soybean, peanut, castor oil, sunflower, maize, cotton, flax, rapeseed, coconut, oil palm, safflower (Carthamus tinctorius) or cocoa bean, microorganisms such as fungi, for example the genus Mortierella, Saprolegnia or Pythium, bacteria such as the genus Escherichia, cyanobacteria, ciliates, Thrausto- or Schizichytria, algae or protozoa such as dinoplagellates such as Crypthecodinium. Organisms which can naturally synthesize oils in large quantities, such as fungi of the genera Mortierella or Pythium, such as Mortierella alpina, Pythium insidiosum, or plants, such as soybean, rapeseed, coconut, oil palm, color safflower, castor oil, calendula, peanut, cocoa bean or sunflower, are particularly preferred be soybean, rapeseed, sunflower, castor oil, or Mortierella Pythium. In principle, transgenic animals are also suitable as host organisms, for example C. elegans.

Useful host cells are also mentioned in: Goeddel, Gene Expression Technology: Methods in Enzymology 185, Academie Press, San Diego, CA (1990).

Usable expression strains e.g. those which have a lower protease activity are described in: Gottesman, S., Gene Expression Technology: Methods in Enzymology 185, Academie Press, San Diego, California (1990) 119-128.

Depending on the choice of the promoter, the expression of the Δ6-desaturase gene can take place specifically in the leaves, in the seeds, in the tubers or in other parts of the plant. Such fatty acids, oils or lipids with Δ6 double bonds overproducing transgenic plants, their reproductive material and their plant cells, tissue or parts are a further subject of the present invention. A preferred object according to the invention is transgenic plants, for example crop plants such as corn, oats, rye, wheat, barley, corn, rice, soybeans, sugar beet, canola, triticale, sunflower, flax, hemp, tobacco, tomato, coffee, cocoa, tea, Carrot, bell pepper, rapeseed, tapioca, cassava, arrowroot, tagetes, alfalfa, lettuce and the various tree, nut and wine species, potato, in particular oil-containing crops, such as soybean, peanut, castor oil, borage, flax, sunflower, canola , Cotton, flax, rapeseed, coconut, oil palm, safflower (Carthamus tinctorius) or cocoa bean, test plants such as Arabidopsis or other plants such as moss or algae containing a functional nucleic acid sequence according to the invention or a functional expression cassette. Functional means here that an enzymatically active enzyme is formed.

The expression cassette or the nucleic acid sequences according to the invention containing a Δ6-desaturase gene sequence can also be used to transform the above-mentioned organisms such as bacteria, cyanobacteria, filamentous fungi, ciliates, animals or algae with the aim of increasing the content of fatty acids, oils or lipids Δ6 double bonds can be used. Preferred transgenic organisms are bacteria, cyanobacteria, filamentous fungi or algae.

Transgenic organisms are understood to mean organisms which contain a foreign nucleic acid from another organism which codes for a Δ6-desaturase used in the process according to the invention. Transgenic organisms are also understood to mean organisms which have a nucleic acid which comes from the same organism and which codes for a Δ6-desaturase, whereby this nucleic acid is contained as an additional gene copy or is not contained in the natural nucleic acid environment of the Δ6-desaturase gene. Transgenic organisms are also organisms in which the natural 3 'and / or 5' region of the Δ6-desaturase gene has been changed by targeted genetic engineering changes compared to the parent organism. Transgenic organisms in which a foreign DNA has been introduced are preferred. Transgenic plants into which foreign DNA has been introduced are particularly preferred. Transgenic plants are understood to mean individual plant cells and their cultures, such as callus cultures on solid media or in liquid culture, plant parts and whole plants.

Another subject of the invention are transgenic organisms selected from the group of plants, fungi, ciliates, algae, bacteria, cyanobacteria or animals, preferably transgenic plants or algae, which contain at least one isolated nucleic acid sequence which codes for a polypeptide with Δ6-desaturase activity from the group:

a) a nucleic acid sequence with the sequence shown in SEQ ID NO: 1,

c) Derivatives of the nucleic acid sequence shown in SEQ ID NO: 1, which code for polypeptides with the amino acid sequences shown in SEQ ID NO: 2 and have at least 50% homology at the amino acid level without the enzymatic action of the polypeptides being significantly reduced.

Increase in the content of fatty acids, oils or lipids

In the context of the present invention, Δ6 double bonds mean, for example, the artificially acquired ability of an increased biosynthesis capacity through functional overexpression of the Δ6-desaturase gene in the organisms according to the invention advantageously in the transgenic plants according to the invention compared to the non-genetically modified starting plants, at least for the duration of at least one plant generation.

The biosynthesis site of fatty acids, oils or lipids, for example, is generally the seed or cell layers of the seed, so that a seed-specific expression of the Δ6-desaturase gene is useful. However, it is obvious that biosynthesis of fatty acids, oils or lipids need not be limited to the seed tissue, but also in all other parts of the plant - for example in epidermal cells or in the tubers - tissue can take place specifically.

In addition, constitutive expression of the exogenous Δ6-desaturase gene is advantageous. On the other hand, inducible expression may also appear desirable.

The effectiveness of the expression of the Δ6-desaturase gene can be determined, for example, in vitro by proliferation of the shoot meristem. In addition, a change in the type and level of expression of the Δ6-desaturase gene and its effect on the fatty acid, oil or lipid biosynthesis performance on test plants can be tested in greenhouse experiments.

As described above, the invention relates to transgenic plants transformed with a nucleic acid sequence which codes for a Δ6-desaturase, a vector or an expression cassette containing a Δ6-desaturase gene sequence or DNA sequences which hybridize therewith, and transgenic cells, tissue , Parts and propagation material of such plants. Transgenic crop plants as described above are particularly preferred.

Plants in the sense of the invention are mono- and dicotyledonous plants or algae.

Further objects of the invention are:

- Use of a Δ6-desaturase DNA gene sequence with the in

SEQ ID N0: 1 sequence or hybridizing DNA sequences for the production of fungi, bacteria, animals or plants, preferably plants with an increased content of fatty acids, oils or lipids with Δ6 double bonds by expression of this Δ6-desaturase DNA sequence in plants ,

- Use of the proteins with the sequences SEQ ID NO: 2 for

Production of unsaturated fatty acids in plants, fungi, bacteria or animals, preferably plants. The invention is illustrated by the following examples:

Examples

5 Example 1: General cloning and growing methods:

The cloning processes such as Restriction cleavage, agarose gel electrophoresis, purification of DNA fragments, transfer

10 of nucleic acids on nitrocellulose and nylon membranes, linking of DNA fragments, transformation of Escherichia coli cells, cultivation of organisms and the sequence analysis of recombinant DNA were carried out as in Sambrook et al. (1989) (Cold Spring Harbor Laboratory Press: ISBN 0-87969-309-6).

15 The protonema of Physcomitrella patens (= P. patens) was in liquid medium, as by Reski et al. (Mol. Gen. Genet., 244, 1994: 352-359).

Example 2: Sequence analysis of recombinant DNA

20

The sequencing of recombinant DNA molecules was carried out with a laser fluorescence DNA sequencer from ABI according to the method of Sanger (Sanger et al. (1977) Proc. Natl. Acad. Sci. USA74, 5463-5467). Fragments resulting from a polymerase chain reaction were sequenced and checked to avoid polymerase errors in constructs to be expressed.

Example 3: Lipid analysis from the protonema of P. patens and from yeast cells

30

The lipids were treated with chloroform / methanol as in Siebertz et al. (Eur. J. Biochem., 101, 1979: 429-438) described from the protonema of S. patens or extracted from yeast cells and extracted by thin layer chromatography (= TLC) with diethyl ether.

35 cleans. The fatty acids obtained were transmethylated to the corresponding methyl esters and analyzed by gas chromatography (= GC). The various methyl esters were identified with the appropriate standards. Corresponding fatty acid pyrrolidides were, as in Anderson et al. (Lipids, 9, 1974:

40 185-190), obtained and determined by GC-MS.

45 Example 4 Functional Expression of P. patens Δ6-Desaturase cDNA in Yeast

Expression experiments in yeasts were carried out with PPDES6 cDNA. Knock-out Exprimente had shown (data and the experiment not shown or described), that the knock-out to a loss of 20: 3 ¹¹ - ¹⁴ ^<17 - 20: 4 ⁵ ^<8, n, ¹⁴ _, 20 : 4 ^{5 1!} - ¹⁴ < ¹⁷ - and 20: 5 ⁵ _' ⁸ _' ^{1: L} _' ¹⁴ _' ¹⁷ fatty acids leads. At ¹ _^'15 fatty acids: _-' 3 ⁹ and 18, ¹² _'2 ^9: 18 simultaneously rise. For expression in yeast, the PPDES6 cDNA was subcloned into the yeast expression vector pYES2 (Invitrogen). The vector obtained was called pYES-deltaβ. Yeast cultures transformed with pYES2 (control) and pYESdeltaδ (Δ6-desaturase cDNA) were grown on uracil-dop-out medium with 2% raffinose and 1% tergitol NP-40 (for stabilizing the fatty acids). For expression, the cells were grown with galactose (final concentration 2%) to an optical density (= OD) of 0.5 at 600 nm. In feeding experiments, fatty acids were solubilized in 5% tergitol and added at a final concentration of 0.0003%. The results of the expression are shown in Table I. The synthesis of fatty acids with a double bond at position 6 is only possible in the presence of the expression construct with the Δ6-desaturase cDNA. This Δ6-desaturase enzyme has a greater activity towards fatty acids which already contain a double bond at position 9 or 12 (in relation to the carbon atom in the chain). The fatty acid methyl esters of the entire lipid of the yeast were analyzed by GC. The individual fatty acids synthesized are given in the table in mol% of the total fatty acids.

Table I: Fatty acid composition in transformed yeasts versus the control

Example 5: Transformation of P. patens

The polyethylene glycol mediated direct DNA transformation of protoplasts was carried out as described by Schäfer et al. (Mol. Gen. Genet., 5 226, 1991: 418-424). The transformants were selected on G418-containing medium (Girke et al., The Plant Journal, 15, 1998: 39-48).

Example 6: Isolation of Δ6-desaturase cDNA and genomic 10 clones from P. patens

Using a PCR approach with the following degenerate oligonucleotides as primers:

15 A: TGGTGGAA (A / G) TGGA (C / A) ICA (T / C) AA and

B: GG (A / G) AA (A / C / G / T) A (A / G) (G / A) TG (G / A) TG (C / T) TC]

and the following temperature program:

94 ° C, 3 min; [94 ° C, 20 sec; 45 ° C, 30 sec; 72 ° C, 1 min], 30 cycles;

Finally, fragments of a Δ6-desaturase gene were cloned at 20 72 ° C., 5 min. For cloning, poly (A) RNA was isolated from P. patens Protonema culture 12 days old. The PCR described above was carried out with this poly (A) RNA. Fragments of the expected fragment length (500 to 600 bp) were cloned into pUC18 and

25 sequenced. The deduced amino acid sequence of a PCR fragment showed similarities to known Δ6 desaturases. Since it was known that P. patens had a Δ6-desaturase, it was assumed that this clone encodes part of a Δ6-desaturase.

30 A complete cDNA clone (= PPDES6-CDNA) was created from one

P. patens cDNA library isolated from 12-day-old protonemata using the above-mentioned PCR fragment. The nucleotide sequence is given in SEQ ID NO: 1. The deduced amino acid sequence can be found in SEQ ID NO: 2. The associated genomic sequence

35 (= PPDES6 gene) could be isolated using the PCR and the following oligonucleotides as primers:

C: CCGAGTCGCGGATCAGCC

D: CAGTACATTCGGTCATTCACC: 0

Table II shows the results of the comparison between the new P. patens Δ6-desaturase over the entire nucleic acid sequence with the following known Δ6-desaturase: Borago officinalis (U79010), Synechocystis sp (L11421), Spirulina platensis 5 (X87094), Caenorhabiditis elegans ( AF031477), Mortierella alpina (WO 98/46764), Homo sapiens (Cho et al., J. Biol. Chem., 274, 1999: 471-477), Rattus norvegicus (AB021980) and Mus musculus (Cho et al., J. Biol. Chem., 274, 1999: 471-477). The analysis was carried out with the gap program (GCG package, version 9.1) and the following analysis parameters: scoring matrix, blosum62, gap creation penalty, 12; gap extension penalty, 4. The results reflect the specific identity or similarity [] in percent (%) compared to the P. patens sequence.

Table II: Sequence comparison between P. patens Δ6-desaturase and other Δ6-desaturases

Example 7: Cloning of Δ6-desaturase from Physcomitrella patens

The genomic Δ6-acyllipid desaturase from Physcomitrella patens was modified based on the published sequence (Girke et al., Plant J., 15, 1998: 39-48) by means of polymerase chain reaction and cloning, isolated and used for the method according to the invention. For this purpose, a desaturase fragment was first isolated using a polymerase chain reaction using two gene-specific primers and into which Girke et al. (see above) Desaturasegen described.

Primer TG5 5 '- ccgctcgagcgaggttgttgtggagcggc and primer TG3: 5 ^λ -ctgaaatagtcttgctcc-3'

were first used to amplify a gene fragment using a polymerase chain reaction (30 cycles, 30 seconds 94 ° V, 30 seconds 50 ° C, 60 seconds 72 ° C, 10 minutes after incubation at 72 ° C, in a Perkin Elmer thermal cycler). a) Cloning an expression plasmid which expresses the Δ6-desaturase under the control of the 35S CaMV promoter:

An Xhol site was introduced into the fragment by primer TG5. An XhoI / Eco47lII fragment was made by

Obtained restriction and in the in Girke et al. PPDES6 gene sequence described was exchanged after analog restriction with XhoI / Eco47III. The construct was given the name pZK. The insert of pZK was cloned as an Xhol / HindIII fragment after filling in the HindIII site with nucleotides by treatment with the Klenow fragment of DNA polymerase I in the Xhol / Smal sites of pRT99 / 35S. The resulting plasmid pSK contains the 35S promoter [Cauliflower-Mosaik-Virus, Franck et al. (1980) Cell 21, 285], the Δ6-desaturase from moss and the 35S terminator in the vector pRT.

b) Construction of an expression construct under the control of the napin promoter:

The promoter-desaturase fragment obtained was cloned into the vector pJH3 by terminating the plasmid pSK with Xhol, treatment with T4-DNA polymerase and PstI restriction. For this purpose, the vector BamHI was cut and the overhangs were filled in with Klenow enzyme and then cut again with PstI. It was created by ligation of the

Desaturase terminator fragment in the vector the plasmid pJH7, which contains a napin promoter (Scofield et al., 1987, J. Biol. Chem. 262, 12202-8). The expression cassette from pJH7 was cut with Bspl20l and Notl and cloned into the binary vector pRE. The plasmid pRE-Ppdesδ was formed.

The Δ6-desaturase cDNA from P. patens according to the invention was used as a template in a PCR reaction. With the help of the oligonucleotides listed below, a BamHI restriction site before the start codon and three adenine nucleotides were introduced into the Δ6-desaturase cDNA as consensus translation sequence for eukaryotes. A 1512 base pair fragment of the Δ6-desaturase was amplified and sequenced.

Pp-d6Desl: 5 '- CC GGTACC aaaatggtattcgcgggcggtg -3' Pp-d6Desl: 5 '- CC GGTACC ttaactggtggtagcatgct -3'

The reaction mixtures contained approx. 1 ng / micro 1 matrices

DNA, 0.5 UM of the oligonucleotides and, 200 μM deoxy nucleotides (Pharmacia), 50 mM KC1, 10 mM Tris-HCl (pH 8.3 at 25 ° C, 1.5 mM MgCl ₂ > and 0.02 U / μl Pwo polymerase (Boehringer Mannheim) and are incubated in a PCR machine from Perkin Elmer with the following temperature program:

Annealing temperature: 50 ° C, 30 sec

Denaturation temperature: 95 ° C, 30 sec

Elongation temperature: 72 ° C, 90 sec

Number of cycles: 30

c) Construction of an expression construct under the control of the USP promoter:

The fragment of approximately 1.5 kB base pairs obtained was ligated into the vector pBluescript SK- (Stratagene) which had been cleaved with EcoRV and was available as BamHI fragment for further cloning.

For the transformation of plants, a further transformation vector based on pBin-USP was generated, which contains the BamHI fragment of the Δ6-desaturase. pBin-USP is a derivative of the plasmid pBinl9. pBinUSP originated from pBinl9 by using pBinl9 [Bevan et al. (1980) Nucl. Acids Res. 12, 8711], a USP promoter was inserted as an EcoRI-BaMHI fragment. The polyadenylation signal is that of gene 3 of the T-DNA of the Ti plasmid pTiACH5 (Gielen et al., (1984) EMBO J. 3, 835), nucleotides 11749-11939 being isolated as a PvuII-HindIII fragment and after addition of Sphl -Linkers cloned to the PvuII interface between the SpHI-HindIII interface of the vector. The USP promoter corresponds to nucleotides 1-684 (Genbank Accession X56240), with part of the non-coding region of the USP gene being contained in the promoter. The 684 base pair promoter fragment was amplified using a commercially available T7 standard primer (Stratagene) and using a synthesized primer via a PCR reaction using standard methods (primer sequence: 5 '-GTCGACCCGCGGACTAGTG- GGCCCTCTAGACCCGGGGGATCC GGATCTGCTGGCTATGAA. The PCR fragment was cut with EcoRI / SalI and inserted into the vector pBin19 with OCS terminator. The plasmid called pBinUSP was created.

d) Construction of an expression construct under the control of the vATPase-Cl promoter from Beta vulgaris:

Analogously to the expression plasmid with the USP promoter, a construct was created using the v-ATPase-cl promoter. The promoter was cloned as an EcoRI / Kpnl fragment into the plasmid pBinl9 with OCS terminator and the Δ6-desaturase gene from P. patens between promoter and via BamHI Terminator advertises. The promoter corresponds to a 1153 base pair fragment from beta-Vulgaris (Plant Mol Biol, 1999, 39: 463-475).

The construct was used to transform Arabidopsis thaliana and oilseed rape plants.

Example 8: Generation of transgenic rape plants (modified after

Moloney et al. , 1992, Plant Cell Reports, 8: 238-242)

Binary vectors in Agrobacterium tumefaciens C58C1: pGV2260 or Escherichia coli were used to generate transgenic rape plants (Deblaere et al., 1984, Nucl. Acids. Res. 13, 4777-4788). For the transformation of rape plants (Var. Drakkar, NPZ North German Plant Breeding, Hohenlieth, Germany), a 1:50 dilution of an overnight culture of a positively transformed agrobacterial colony in Murashige-Skoog medium (Murashige and Skoog 1962 Physiol. Plant. 15, 473) with 3% sucrose (SMS medium) used. Petioles or hypocotyledons of freshly sprouted sterile rape plants (each about 1 cm ² ) were incubated in a petri dish with a 1:50 agrobacterial dilution for 5-10 minutes. This was followed by a 3-day incubation in the dark at 25 ° C. on 3MS medium with 0.8% Bacto agar. The cultivation was continued after 3 days with 16 hours of light / 8 hours of darkness and on a weekly basis on MS medium with 500 mg / 1 claforan (Cefotaxi e-sodium), 50 mg / 1 kanamycin, 20 μM benzylaminopurine ( BAP) and 1.6 g / 1 glucose continued. Growing shoots were transferred to MS medium with 2% sucrose, 250 mg / 1 Claforan and 0.8% Bacto agar. If no roots formed after three weeks, 2-indolebutyric acid was added to the medium as root for growth.

Regenerated shoots were obtained on 2MS medium with kanamycin and claforan, transferred to soil after rooting and after cultivation, grown in a climatic chamber or in a greenhouse for two weeks, brought to flower, ripe seeds were harvested and analyzed for Δ6-desaturase expression using lipid analyzes. Lines with increased levels or double bonds at the Δ6 position would be identified. In the stably transformed transgenic lines, which functionally expressed the transgene, an increased content of double bonds at the Δ6 position was found in comparison to untransformed control plants. Example 8: Lipid extraction from seeds

The plant material was first mechanically homogenized using mortars to make it more accessible for extraction.

Then it was boiled at 100 ° C. for 10 min and, after cooling, sedimented on ice. The cell sediment was hydrolyzed with 1 N methanolic sulfuric acid and 2% dimethoxypropane at 90 ° C. and the lipids were transmethylated. The resulting fatty acid methyl esters (FAME) were extracted into petroleum ether. The extracted FAME were analyzed by gas liquid chromatography with a capillary column (chrome pack, WCOT fused silica, CP-Wax-52 CB, 25 m, 0.32 mm) and a temperature gradient from 170 ° C to 240 ° C in 20 min and 5 min at 240 ° C analyzed. The identity of the fatty acid methyl ester was confirmed by comparison with corresponding FAME standards (Sigma). The identity and the position of the double bond could be determined by suitable chemical derivatization of the FAME mixtures e.g. to 4,4-dimethoxyoxazoline derivatives (Christie, 1997, in: Advances in Lipid Methodology, 4th edition: Christie, Oily Press, Dundee, 119-169, and 1998, gas chromatography-mass spectrometry method, lipids 33: 343- 353) can be further analyzed using GC-MS. The GC analyzes of the fatty acid methyl esters from the transgenic rapeseed, which expressed the Δ6-desaturase in a seed-specific manner, are shown in Table III. The transgenic rapeseed has at least 4.95% γ-linolenic acid in the seed.

Table III shows the GC analyzes of the fatty acid methyl esters from mature, transgenic rapeseed which express Δ6-desaturase in a seed-specific manner. The fatty acid composition is given in [mol%] of the total fatty acids. It should be noted that individual plants of the T2 generation, which were obtained from positively transformed and self-grown plants, contain up to 4.95% γ-linolenic acid.

Table III: GC analyzes of the fatty acid methyl esters of rapeseed

Claims

claims

1. A process for the production of unsaturated fatty acids, characterized in that at least one isolated nucleic acid sequence which codes for a polypeptide with Δ6-desaturase activity, selected from the group:

a) a nucleic acid sequence with the sequence shown in SEQ ID NO: 1,

b) Nucleic acid sequences which are derived from the one in SEQ ID NO: 1 as a result of the degenerate genetic code

c) derivatives of the nucleic acid sequence shown in SEQ ID NO: 1, which code for polypeptides with the amino acid sequences shown in SEQ ID NO: 2 and at least

Have 50% homology at the amino acid level without significantly reducing the enzymatic activity of the polypeptides,

2. The method according to claim 1, characterized in that the nucleic acid sequence comes from a plant or algae.

3. The method according to claim 1 or 2, characterized in that the nucleic acid sequence is derived from Physcomitrella patens.

4. The method according to claims 1 to 3, characterized in that the organism is an organism selected from the group of bacteria, fungus, ciliate, algae, cyanobacterium, animal or plant.

5. The method according to claims 1 to 4, characterized in that the organism is a plant or algae.

6. The method according to claims 1 to 5, characterized in that the organism is an oil crop.

7. The method according to claims 1 to 6, characterized in that the attracted organism contains at least 5% by weight of unsaturated fatty acids based on the total fatty acid content in the organism.

8. The method according to claims 1 to 7, characterized in that the unsaturated fatty acids are isolated from the organism.

9. Transgenic organism selected from the group of plants, fungi, ciliates, algae, bacteria, cyanobacteria or animals which contain at least one isolated nucleic acid sequence which codes for a polypeptide with Δ6-desaturase activity, selected from the group:

a) a nucleic acid sequence with the sequence shown in SEQ ID NO: 1,

c) Derivatives of the nucleic acid sequence shown in SEQ ID NO: 1, which code for polypeptides with the amino acid sequences shown in SEQ ID NO: 2 and have at least 50% homology at the amino acid level, without the enzymatic action of the polypeptides being significantly reduced.

10. Transgenic organism according to claim 9, characterized in that the organism is a plant or algae.

11. Oil, lipids or fatty acids or a fraction thereof, produced by the method according to one of claims 1 to 8.

12. Use of the oil, lipid or fatty acid composition according to claim 11 or transgenic organisms according to claim 9 in animal feed, food, cosmetics or pharmaceuticals.