WO2000066704A1

WO2000066704A1 - Microspheres useful in detergent compositions

Info

Publication number: WO2000066704A1
Application number: PCT/US2000/011306
Authority: WO
Inventors: Walter August Maria Broeckx; James Pyott Johnston; Jean-Pol Boutique
Original assignee: The Procter & Gamble Company
Priority date: 1999-04-29
Filing date: 2000-04-27
Publication date: 2000-11-09
Also published as: AU4494500A

Abstract

Detergent compositions, more particularly laundry detergent compositions and/or products, such as heavy duty aqueous and/or non-aqueous and/or gelled liquid laundry detergents and granular and/or powder laundry detergents, include one or more microspheres having a polymeric expandable outer shell made of a polymeric material that is soluble in an alkaline aqueous solution, wherein the shell defines a cavity containing a means for expanding the microsphere such that the microsphere cavity's volume increases. The microspheres can be used as low density filler particles and/or encapsulates comprising one or more detergent ingredients.

Description

MICROSPHERES USEFUL IN DETERGENT COMPOSITIONS

FIELD OF THE INVENTION This invention relates to detergent compositions, more particularly laundry detergent compositions and/or products, such as heavy duty aqueous and/or non-aqueous and/or gelled liquid laundry detergents and granular and/or powder laundry detergents, which include one or more microspheres having a polymeric expandable outer shell made of a polymeric mateπal that is soluble in an alkaline aqueous solution, wherein the shell defines a cavity containing a means for expanding the microsphere such that the microsphere cavity's volume increases. The microspheres of the present invention can be used as low density filler particles and/or encapsulates compπsmg one or more detergent ingredients.

BACKGROUND OF THE INVENTION The incorporation of conventional detergent ingredients, such as bleaching agents, builders, chelants, alkalinity sources (i.e., buffers), anti redeposition agents, catalysts, surfactants, and other non-enzyme detergent ingredients into conventional liquid laundry detergents has been problematic due to the tendency of detergent ingredients, typically in the form of particulate solids, to sediment and/or settle out of liquid detergent products, especially during storage and/or transportation of the liquid detergent products. This problem is also present, although usually not to the same extent, m granular and/or powder laundry detergents wherein the particulate solids tend to sediment and/or settle out of the granular and/or powder detergent products dunng storage, transportation and/or any other activity that results in sifting of the products.

It is known that one of the major problems with built liquid laundry detergents is their physical stability Non-aqueous built laundry liquid detergent compositions are often confronted with problems of phase separation, sedimentation and/ or settling out of the suspended builder and other laundry additives The considerations have an impact on, for example, product pourabihty, dispensability and/or stability. Conventional non-aqueous heavy duty liquid detergents, which compπse a surfactant system in a non-aqueous organic solvent combined with particulate solids which have beneficial effects in the wash (e g , bleaches and bleach activators), have a tendency to be quite unstable and thus, result in the sedimentation and/or settling out of the particulate solids as well as the formation of a clear liquid layer at the surface of the product.

This problem of unstabihty associated with non-aqueous heavy duty liquid detergents stems from the fact that the density of the solid suspended particles is higher than the density of the liquid matπx. Therefore, the solid particles tend to sediment according to Stoke 's law.

U.S Patent No. 4,828,723 to Cao et al, U.S. Patent No. 5,176,713 to Dixit et al., DE3824252 (GB 2208233) and DE 3833368 (GB2210383) all of which are owned by Colgate- Palmolive of New York, disclose stable non-aqueous heavy duty liquid laundry detergent compositions in the form of suspensions of builder salt m liquid nonionic surfactant wherein the compositions are stabilized against phase separation by the addition of small amounts of low density filler, such as hollow plastic or glass microspheres. All of the references teach that the ratio of the average particle size diameter of the low density filler particle to the average particle size diameter of the dispersed particles (i.e., builder salts) must be at least 6: 1.

However, these references fail to teach laundry detergent compositions, particularly liquid laundry detergent compositions that compπse microspheres m the form of low density filler particles and/or encapsulates compπsmg one or more detergent ingredients wherein the microspheres compπse an expandable outer shell made of a mateπal that is soluble in alkaline aqueous solutions.

Further, the low density filler mateπals used in these references tend to deposit on fabπcs and on washing machine parts.

EP 839 902 (BASF) discloses a process for the production of microspheres containing a bleach aid for use in detergents. However, this reference fails to teach microspheres in the form of low density filler particles and/or encapsulates compπsmg one or more detergent ingredients wherein the microspheres compπse an expandable outer shell that defines a cavity containing a means for expanding the microsphere. Further, this reference fails to teach the use of water soluble and/or easily dispersible m water low density filler particles for improving the physical stability and the dissolution of laundry detergents, especially non-aqueous liquid laundry detergents

Other unsuccessful prior art attempts at solving these problems associated with non- aqueous heavy duty liquid laundry detergents include forming a structuπng network within the liquid laundry detergent such that the liquid laundry detergent acquires a high viscosity High viscosity liquid laundry detergents can negatively impact the dissolution and the dispersion of the laundry detergent product in the wash, resulting in the deposition of imperfectly dissolved product on fabrics under stressed, low temperature/agitation conditions, or when the laundry detergent is used for pre-treatmg stams. Technologies used for this type of structuπng network formation include polymers, clays and hydrophobic silica.

In light of the foregoing, it is evident that formulators of liquid laundry detergent compnsmg detergent ingredients in particulate solid form have encountered a challenge to stably suspend the detergent ingredients in the form of particulate solids in the liquid laundry detergents.

There is a need to formulate liquid laundry detergent compositions having stably suspended detergent ingredients in the form of particulate solids.

There is a need to formulate granular and/or powder laundry detergent compositions having stably suspended detergent ingredients m the form of particulate solids.

There is a need to provide methods for producing the laundry detergent compositions and/or products compnsmg detergent ingredient particulate solids wherein the particulate solids can be stably suspended in the laundry detergent compositions.

Accordingly, there is a need to identify mateπals and procedures which can be used to stably suspend and/or incorporate detergent ingredients in the form of particulate solids into liquid and/or granular and/or powder laundry detergent products wherein such matenals are soluble in alkaline aqueous solutions.

SUMMARY OF THE INVENTION The present invention fulfills the needs identified above by providing detergent compositions, preferably laundry detergent compositions and/or products compnsmg one or more microspheres preferably in the form of low density fillers and/or encapsulates compnsmg one or more detergent ingredients.

The microspheres of the present invention compnse a polymenc expandable outer shell made of a polymenc matenal that is soluble in an alkaline aqueous solution and wherein the shell defines a cavity containing a means for expanding the microsphere such that the microsphere cavity's volume increases. Detergent compositions, preferably laundry detergent compositions and/or products, more preferably liquid laundry detergent compositions and/or products employing the microspheres of the present invention exhibit properties such that the tendency of particulate solids and/or encapsulates within the laundry detergent to sediment and/or settle out of the laundry detergent is reduced. Methods for making the microspheres of the present invention and methods of laundeπng using detegent compositions of the present invention are also provided

Surprisingly it has been found that by incorporating the microspheres of the present invention preferably in the form of low density fillers and/or encapsulates compnsmg one or more detergent ingredients into laundry detergent compositions and/or products, especially non- aqueous liquid laundry detergents, that contain detergent ingredients in the form of particulate solids and/or encapsulates compnsmg one or more detergent ingredients, the particulate solids and/or encapsulate can be stably suspended in liquid laundry detergent products.

By stably suspending the particulate solids and/or encapsulates compnsmg one or more detergent ingredients in the liquid laundry detergent products, the particulate solids and/or encapsulates withm the laundry detergent products of the present invention have a reduced tendency to sediment and/or settle out of the laundry detergent products dunng storage and/or transportation.

As a result of the particulate solids and/or encapsulates compnsmg one or more detergent ingredients having a reduced tendency to sediment and/or settle out of the laundry detergent products, consumers can have more comstent doses with respect to the level of actives, especially the particulate solids, per dose.

Further, as a result of the particulate solids and/or encapsulates compnsmg one or more detergent ingredients having a reduced tendency to sediment and/or settle out of the laundry detergent products, the appearance of a clear top layer in the product is inhibited and/or resisted.

Still further, as a result of the particulate solids and or encapsulates compnsmg one or more detergent ingredients having a reduced tendency to sediment and/or settle out of the laundry detergent products, the dissolution of the product is not impaired as the microspheres of the present invention maintain a low product viscosity. Still even further, as a result of the physical form and composition of the microspheres of the present invention, which are either water soluble or easily dispersible in water, the microspheres do not result m unacceptable residues on fabncs and on washing machine parts dunng use.

Accordingly, the present invention provides a way to suspend heavy solids in a laundry detergent, preferably a non-aqueous liquid laundry detergent without increasing the low shear viscosity of the detergent, thus avoiding any slow down of the rate of dissolution in the wash which may occur as a result of increasing the low shear viscosity of the detergent. In addition, by not increasing the low shear viscosity of the detergent, the mileage of the product is not reduced as a result of product hang-up in the bottle. In one aspect of the present invention, a microsphere compπsmg a polymenc expandable outer shell made of a polymenc material that is soluble in an alkaline aqueous solution and wherein the shell defines a cavity containing a mean-T for expanding the microsphere such that the microsphere cavity's volume increases is provided. Preferably, the microsphere is m the form of a low density filler particle which is useful m stably suspending detergent ingredients in the form of particulate solids in laundry detergent compositions, especially in liquid laundry detergent compositions. Also it is desirable that the microsphere is in the form of encapsulates containing one or more detergent ingredients which are useful in stably suspending the detergent ingredients withm the encapsulates in laundry detergent compositions, especially in liquid laundry detergent compositions.

In another aspect of the present invention, a method for making a microsphere having a polymeric expandable outer shell made of a polymenc matenal that is soluble in an alkaline aqueous solution and wherein the shell defines a cavity containing a means for expanding the^" microsphere such that the microsphere cavity's volume increases is provided. In yet another aspect of the present invention a detergent composition, preferably a laundry detergent composition and/or product compnsmg one or more microspheres having a polymenc expandable outer shell made of a polymenc mateπal that is soluble m an alkaline aqueous solution and wherein the shell defines a cavity containing a means for expanding the microsphere such that the microsphere cavity's volume increases, and one or more cleaning adjunct mateπals in the form of particulate solids is provided.

In another aspect of the present invention a liquid laundry detergent composition compnsmg one or more microspheres having a polymenc expandable outer shell made of a polymenc mateπal that is soluble m an alkaline aqueous solution and wherein the shell defines a cavity containing a means for expanding the microsphere such that the microsphere cavity's volume increases, and one or more cleaning adjunct matenals in the form of particulate solids is provided.

In still another aspect of the present invention a granular and/or powder laundry detergent product compnsmg one or more microspheres having a polymenc expandable outer shell made of a polymenc matenal that is soluble in an alkaline aqueous solution and wherein the shell defines a cavity containing a means for expanding the microsphere such that the microsphere cavity's volume increases, and one or more cleaning adjunct matenals m the form of particulate solids is provided.

In yet another aspect of the present invention a method for making the microspheres of the present invention is provided. In still yet another aspect of the present invention a method for laundeπng fabncs comprising contacting the fabrics with the laundry detergent compositions and/or products of the present invention, preferably the liquid laundry detergent composition and/or product of the present invention, is provided In even still another aspect of the present invention a method for stabilizing a liquid laundry detergent composition comprising particulate solids wherein the method compπses the step of adding one or more microspheres of the present invention to the composition is provided.

In still yet another aspect of the present invention a method for inhibiting the formation of a clear top layer m a liquid laundry detergent composition compnsmg particulate solids wherein the method compnses the step of adding one or more microspheres of the present invention to the composition is provided.

In even yet another aspect of the present invention a method for reducing and/or preventing the deposit of residues on a fabnc in need of laundenng dunng laundenng of the fabnc with a liquid laundry detergent composition compnsmg particulate solids wherein the method compπses the step of adding one or more microspheres of the present invention to the composition is provided.

It is an object of the present invention to formulate detergent compositions, preferably laundry detergent compositions and/or products that have properties such that the tendency of cleaning adjunct matenals/detergent ingredients in the form of particulate solids to sediment or settle out of the laundry detergent compositions and/or products is reduced as compared to detergent compositions, preferably laundry detergent compositions and/or products without such microspheres of the present invention.

These and other aspects, objects, features and advantages will be clear from the following detailed descnption, examples and appended claims All percentages, ratios and proportions herein are on a weight basis unless otherwise indicated. All documents cited herein are hereby incorporated by reference.

BRIEF DESCRIPTION OF THE DRAWINGS

FIG. 1 is a schematic representation of the microspheres in accordance with the present invention;

FIG. 2 is a schematic representation of the microsphere of FIG. 1 after expansion.

DETAILED DESCRIPTION OF THE INVENTION The present invention relates to detergent compositions, more particularly laundry detergent compositions and/or products that compnse one or more microspheres m the form of low density fillers and/or encapsulates compnsmg one or more detergent ingredients wherein the microspheres compnse an expandable outer shell that defines a cavity containing a means for expanding the microspheres and wherein the laundry detergent compositions and/or products exhibit properties such that the tendency of the particulate solids withm the laundry detergent and/or encapsulates to sediment and/or settle out of liquid laundry detergent products is reduced and methods of making such laundry detergent compositions and/or products.

"Low Density Filler Particles" herein is meant any component that when incorporated into a laundry detergent composition and or product compnsmg particulate solids exhibits a reduced tendency for the particulate solids to sediment and/or settle out of the laundry detergent composition and/or product. Suitable examples of low density filler particles include, but are not limited to, water soluble or water insoluble organic or inorganic matenals, microspheres (liquid hydrocarbon-containing and/or gas-contammg depending upon temperature, and/or hollow) and other components that result a reduction of the tendency of the particulate solids withm a laundry detergent composition and/or product to sediment and/or settle out of the laundry detergent composition and or product. Preferably the low density filler particles of the present invention are water soluble and/or easily dispersible in water.

"Particulate solids" herein is meant any detergent mgredient/cleamng adjunct mateπal that is in the form of a solid (i.e., granules, powder, flakes, chips, particles, etc.). Preferably, the particulate solids have a particle size of from 1-2000 microns.

"Encapsulates" herein is meant any the microspheres of the present invention that compπse one or more detergent ingredients within the cavity of the microsphere. MICROSPHERES The microspheres of the present invention are particularly useful m laundry detergent compositions, more particularly liquid laundry detergent compositions. However, such microspheres may be in other types of cleaning compositions, especially liquid cleaning compositions such as liquid dishwashing compositions and liquid hard surface cleaning compositions The microspheres of the present invention are particularly useful in laundry detergent compositions m the form of low density filler particles, wherein the low density filler particles have a tendency to stabilize and/or resist the sedimentation and/or settling out of the detergent ingredients with the compositions that are in the form of particulate solids by suspending such particulate solids. The laundry detergent compositions of the present invention, preferably the liquid laundry detergent compositions of the present invention, more preferably the non-aqueous liquid laundry detergent compositions of the present invention include the low density filler particles and particulate solids at levels such that the ratio of the average particle size diameter of the low density filler particles to the average particle size diameter of the dispersed particulate solids is preferably less than 6: 1, more preferably less than 5:1, even more preferably less than 4: 1, still even more preferably less than 3: 1, yet even more preferably less than 2: 1, most preferably about 1 : 1.

In another aspect of the present invention, the microspheres of the present invention are particularly useful in laundry detergent compositions in the form of encapsulates which contain one or more detergent ingredients, which are typically in the form of particulate solids. Such encapsulates have a tendency to stabilize and/or resist the sedimentation and/or settling out of the detergent ingredients with the compositions that are in the form of particulate solids by suspending such particulate solids. Polymeric Expandable Outer Shell As shown in FIGs. 1 and 2, the polymenc expandable outer shell 12, 12' of the microsphere 10, 10' of the present invention is made of a polymenc mateπal that is soluble in alkaline aqueous solutions.

The polymenc matenal of the polymenc expandable outer shell 12, 12' compπses as an essential ingredient an anhydπde. Preferably, the anhydπde is selected from the group consisting of: ethylenically unsaturated monocarboxy c acid anhydndes; ethylemcally unsaturated dicarboxy c acid anhydndes and mixtures thereof.

The polymenc matenal of the polymenc expandable outer shell 12, 12' can further compπse additional monomenc mateπals. Suitable additional monomeπc matenals include, but are not limited to, monoethylemcally unsaturated monomers which differ from the ethylenically unsaturated carboxylic acid anhydndes and which do not react with the anhydndes; cross-linking agents (monomers which have a cross linking action and have at least two monoethylemcally unsaturated, non-conjugated double bindings); polar, water-soluble monoethylemcally unsaturated monomers and mixtures thereof.

The anhydnde and one or more additional monomeπc matenals preferably compπse 100% by weight of the polymenc matenal compnsmg the polymenc expandable outer shell.

However, some minimal quantity of blowing agents that are soluble in the anhydπde and/or the additional monomeπc mateπals compnsmg the polymenc matenal may also be included in the polymenc expandable outer shell 12, 12' as a result of the process for making the microspheres 10, 10' of the present invention. Further, the anhydπde and one or more additional monomeπc materials may be present m the polymeric material at any weight ratio, provided that the polymenc mateπal comprises anhydride and that the polymeric mateπal is soluble in alkaline aqueous solutions.

The anhydndes, preferably ethylenically unsaturated carboxylic acid anhydndes include both monocarboxyhc acid anhydndes and dicarboxyhc acid anhydndes. Preferred ethylenically unsaturated carboxylic acid anhydndes of the present invention preferably include from about 2 to about 20, more preferably from about 3 to about 12, most preferably from about 3 to about 6 carbon atoms.

Suitable ethylenically unsaturated monocarboxyhc acid anhydndes include, but are not limited to, monocarboyxlic acids selected from the group consisting of: acrylic acid; methacrylic acid; ethylacryhc acid; allylacetic acid; crotomc acid; v ylacetic acid and mixtures thereof. Preferably, the ethylenically unsaturated monocarboxyhc acid anhydndes are selected from the group consisting of acrylic acid anhydnde; methacrylic acid anhydπde and mixtures thereof. Ethylenically unsaturated monocarboxyhc acid anhydndes which have two ethylemc double bonds permit cross-lmking within the polymenc matenal of the polymenc expandable outer shell, when they are used. Such ethylenically unsaturated monocarboxyhc acid anhydndes thus can also act as cross-lmking agents.

Suitable ethylenically unsaturated dicarboxyhc acid anhydndes include, but are not limited to, dicarboxyhc acids selected from the group consisting of: maleic acid; C\-C\2, preferably Cj-Cg mono- and/or dialkyl maleic acid; maleic acid monoaklyester; ltacomc acid; mesaconic acid; fumanc acid; citracomc acid; methylenemalonic acid; acomtic acid and mixtures thereof. Preferably, the ethylenically unsaturated dicarboxyhc acid anhydndes are selected from the group consisting of maleic acid anhydnde; ltacomc acid anhydnde; citracomc acid anhydnde and mixtures thereof. Preferably, the ethylenically unsaturated dicarboxyhc acid anhydndes are ethylenically unsaturated inner dicarboxyhc acid anhydndes. The ethylenically unsaturated inner dicarboxyhc acid anhydndes can be incorporated into the polymenc matenal of the polymenc expandable outer shell without having any cross-linking in the polymenc matenal.

Mixtures of the ethylenically unsaturated monocarboxyhc acid anhydndes, preferably acrylic acid anhydnde, and ethylenically unsaturated dicarboxyhc acid anhydndes, preferably maleic acid anhydnde, are highly preferred for use in the present invention. When ethylenically unsaturated monocarboxyhc acid anhydndes, preferably acrylic acid anhydnde, and ethylenically unsaturated dicarboxyhc acid anhydndes, preferably maleic acid anhdynde, are present together m a mixture, the weight ratio of said ethylenically unsaturated dicarboxyhc acid anhydndes, preferably maleic acid anhydπde, to said ethylenically unsaturated monocarboxyhc acid anhydndes, preferably acrylic acid anhydride is from about 1 :10 to about 10.1, more preferably from about 1 :5 to about 5: 1

The ethylenically unsaturated carboxylic acid anhydndes of the present invention are preferably present m the polymenc material compnsmg the polymenc expandable outer shell 12, 12' of the microspheres 10, 10' of the present invention at a level of from about 5% to about

100%, more preferably from about 10% to about 80%, most preferably from about 10% to about 60% by weight of the polymenc material compnsmg the polymenc expandable outer shell 12, 12'.

Suitable monoethylemcally unsaturated monomers which differ from the ethylenically unsaturated carboxylic acid anhydndes and which do not react with the anhydndes include, but are not limited to, acrylic acid and/or methacrylic acid esters of monovalent Ci -C24 alcohols.

Preferred monoethylemcally unsaturated monomers of this type include, but are not limited to, methyl acrylate, methylmethacrylate, ethylacrylate, ethylmethacrylate, n-propylacrylate, n- propylmethacrylate, isopropylacrylate, lsopropylmethacrylate, n-butylacrylate, isobutylacrylate, t- butyl acrylate, n-butylmethacrylate, isobutylmethacrylate, t-butyl methacrylate, octylacrylate, octylmethacrylate, 2-ethylhexylacrylate, 2-ethylhexylmethacrylate, laurylacrylate, laurylmethacrylate, stearylacrylate, palmitylacrylate, stearylmethacrylate, palmitylmethacrylate, styrol, α-methylstyrol, vinyl acetate, vinyl propionate, vmylpryndme, methacrylomtπle, methacrylamide, N-methylmethacrylamide, dimethylaminopropylmethacryloamide, cyclohexylacrylate, cyclohexylmethacrylate, phenylacrylate, phenylmethacrylate, dimethylammoethylacrylate, dimethylammoethylmethacrylate, vmylcyclohexane, vinyl chloπde, vmyhdene chlonde, 2-hydroxypropylacrylate, 2-hydroxypropylmethacrylate and mixtures thereof. More preferred monoethylemcally unsaturated monomers of this type are selected from the group consisting of: methyl acrylate, methylmethacrylate, ethylacrylate, ethylmethacrylate, styrol, vinyl acetate, v ylpyπdine and mixtures thereof.

The monoethylemcally unsaturated monomers which differ from the ethylenically unsaturated carboxylic acid anhydndes and which do not react with the anhydndes of the present invention are preferably present m the polymenc matenal compnsmg the polymenc expandable outer shell 12, 12' of the microspheres 10, 10' of the present invention at a level of from about 0% to about 95%, more preferably from about 0% to about 90% by weight of the polymenc matenal compnsmg the polymenc expandable outer shell 12, 12'

Suitable cross-linking agents (monomers that have a cross linking action and at least two monoethylemcally unsaturated, non-conjugated double bindings) include, but are not limited to, acrylic acid and methacrylic acid esters which are denved from alcohols which contain bivalent alcohols containing from about 2 to about 24 carbon atoms and mixtures thereof. Preferred monomers of this type include, but are not limited to, ethylene glycol diacrylate, ethylene glycol dimethacrylate, propylene glycol dimethacrylate, 1 ,4-butandιol diacrylate, 1 ,4-butandιol dimethacrylate, 1.6-hexandιol diacrylate, 1,6-hexandιol dimethacrylate, divinylbenzol, methallylmethacryloamide, allylmethacrylate, allylacrylate, methylenebisacryloamide, tnmethylolpropane tnacrylate, tnmethylolpropane tnmethacrylate, pentaerythntol tnallylether, pentaerythntol tetraacrylate, pentaerythntol tetramethacrylate and mixtures thereof.

These cross-linking agents preferably permit the polymenc expandable outer shell 12, 12' to swell and become more permeable in alkaline aqueous solutions without permitting the polymenc expandable outer shell 12, 12' to dissolve completely or burst. The permeability of the polymenc expandable outer shell 12, 12' is desired, especially m the case of the microspheres 10, 10' of the present invention which contain one or more detergent ingredients within its cavity 14, 14', in order to release the matenals contained within the microsphere's cavity 14, 14' at an uncontrolled and/or spontaneous rate or a controlled (delayed) rate. Accordingly, the rate of release of matenals contained withm the cavity 14, 14' of the microspheres 10, 10' of the present invention is dependent upon the amount and type of cross-linking agents present m the polmeπc mateπal compnsmg the polymenc expandable outer shell 12, 12*. In minor amounts, up to about 10% by weight of the polymenc matenal compnsmg the polymenc expandable outer shell 12, 12', the cross-linking agents of the present invention tngger a delayed release of the contents of the cavity 14, 14' of the microspheres 10, 10' of the present invention, which may possibly be dissolved m oil, after the hydrolysis of the polymenc mateπal compnsmg the polymenc expandable outer shell 12, 12'. Larger cross-linkmg agent amounts generally lead to slower release of the contents of the cavity 14, 14' of the microspheres 10, 10' of the present invention in the case of alkaline hydrolysis. The cross-linking agents of the present invention are preferably present m the polymenc matenal compnsmg the polymenc expandable outer shell 12, 12' of the microspheres 10, 10' of the present invention at a level of from about 0% to about 80%, more preferably from about 0% to about 50% by weight of the polymenc matenal compnsmg the polymenc expandable outer shell 12, 12'. Preferably, the cross-linking agents do not react with the anhydndes, discussed above, dunng the polymenzation process for the polymenc mateπal.

Suitable polar, water-soluble monoethyle cally unsaturated monomers including, but not limited to, acrylic acid, methacrylic acid, acrylamide, hydroxyethylacrylate, hydroxyethylmethacrylate, vmylsulfomc acid, acrylamidopropanesulfomc acid, styrolsulfonic acid, sulfoethylacrylate, sulfoethylmethacrylate, sulfopropylacrylate, sulfopropylmethacrylate, acrylonitnle and mixtures thereof. Preferably, the polar, water-soluble monoethylemcally unsaturated monomers are selected from the group consisting of acrylic acid, methacrylic acid, acrylamide, hydroxyethylacrylate, hydroxyethylmethacrylate, vinylsulfomc acid, acrylamidopropanesulfonic acid, styrolsulfonic acid, sulfoethylacrylate, sulfoethylmethacrylate, sulfopropylacrylate, sulfopropylmethacrylate and mixtures thereof

The polar, water-soluble monoethylemcally unsaturated monomers of the present invention are preferably present in the polymenc matenal compnsmg the expandable outer shell 12, 12' of the microspheres 10, 10' of the present invention at a level of from about 0% to about 20%, more preferably from about 0% to about 10% by weight of the polymenc matenal comprising the polymenc expandable outer shell 12, 12'.

The polymenc matenal compnsmg the polymenc expandable outer shell 12, 12' of the microspheres 10, 10' of the present invention preferably compnse, in addition to the anhydπde, one or more of the additional monomeπc mateπals descπbed above. Additional or further descnptions of the anhydndes and/or additional monomeπc mateπals for use m the polymenc matenal of the polymenc expandable outer shell 12, 12' of the microspheres 10, 10' of the present invention are descπbed in EP 839 902 published May 6, 1998 in the name of BASF.

The anhydπde and preferably one or more additional monomeπc matenals of the polymenc matenal comprising the polymenc expandable outer shell 12, 12' are preferably selected such that the expanded microspheres 10', as represented in FIG. 2, of the present invention have a density of less than 0.4 g/mL; more preferably less than 0.2 g/mL; most preferably less than 0.1 g/mL.

The polymenc matenal of the polymenc expandable outer shell 12, 12' can be and preferably is designed such that the microspheres 10, 10' of the present invention can substantially, preferably completely withm 5 minutes, preferably withm 3 minutes, more preferably withm 1 minute of coming into contact with an alkaline aqueous solution. The amount and types of mateπals compnsmg the polymenc mateπal of the polymenc expandable outer shell 12, 12' influences the dissolution rate of the microspheres 10, 10' of the present invention.

Alternatively, the polymenc matenal of the polymenc expandable outer shell 12, 12' can be designed such that the microspheres of the present invention dissolve such that contents withm the microspheres 10, 10', such as softening agents, enzymes and other detergent ingredients partially or fully incompatible with an alkaline aqueous solution are released from the microspheres 10, 10' in a delayed and/or controlled manner. In other words, the partially or fully incompatible detergent ingredients do not enter the alkaline aqueous solution all at once, but over a penod of time It has been found and/or is known that the ethylenically unsaturated dicarboxyhc acid anhydndes, such as maleic acid anhydride have a slower hydrolysis than the ethylenically unsaturated monocarboxhc acid anhydndes, such as -acrylic acid anhydnde. The rate of hydrolysis of the ethylenically unsaturated dicarboxyhc acid anhydndes results in the polymenc material compnsmg the polymeric expandable outer shell 12, 12' to swell. The ethylenically unsaturated monocarboxyhc acid anhydndes result m the disruption of cross-linking agents, and thus result in the polymenc matenal compnsmg the polymeric expandable outer shell 12, 12' to dissolve, rather than swell. Accordingly, the ratio of ethylenically unsaturated monocarboxyhc acid anhydndes to ethylenically unsaturated dicarboxyhc acid anhydndes in the polymenc material compnsmg the polymenc expandable outer shell 12, 12' controls the rate of dissolution of the outer shell 12 and thus the release of the contents of the microsphere's cavity 14, 14'. Blowing Agents

The microspheres 10, 10' of the present invention contain withm their cavity 14, 14' formed and/or defined by their polymenc expandable outer shell 12, 12' a means for expanding the microspheres. The means for expanding the microsphere are capable of increasing the microsphere cavity's volume.

A preferred means for expanding the microsphere of the present invention such that the microsphere cavity's volume increases include, but are not limited to, blowing agents contained withm the cavity 14, 14' of the microspheres 10, 10' of the present invention and/or heating the microspheres 10, 10' of the present invention . Suitable blowing agents for use in the microspheres 10, 10' of the present invention include, but are not limited to, the blowing agents descπbed in U.S. Patent No. 3,615,972 issued October 26, 1971 m the name of The Dow Chemical Company.

Preferred blowing agents include, but are not limited to, aliphatic hydrocarbons, chlorofluorocarbons, nitrogen, carbon dioxide, oxygen, tetraalkyl silanes and mixtures thereof.

More preferably, the blowing agents are selected from the group consisting of aliphatic hydrocarbons.

Preferred aliphatic hydrocarbons include, but are not limited to, ethane, ethylene, propane, propene, butene, isobutene, isobutane, neopentane, isopentane, acetylene, hexane, heptane, propylene, n-butane, n-pentane, petroleum ether, halogemzed methane, and mixtures thereof.

Suitable tertraalkyl silanes include, but are not limited to, tetramethyl silane, tnmethylethyl silane, tnmethyhsopropyl silane and tnmethyl n-propyl silane. It is desirable that the boiling point of such blowing agents at atmospheπc pressure is about the same temperature range or lower than the softening point of the anhydnde and additional monomenc matenals, when present, -of the polymenc matenal compnsmg the polymenc expandable outer shell 12, 12' of the microspheres 10, 10' of the present invention. Cavity Contents

In addition to the blowing agents of the present invention, one or more detergent ingredients may be contained within the cavity 14, 14' of the microspheres 10, 10' of the present invention. It is highly preferred to incorporate the detergent ingredients, especially when they are in the form of particulate solids, into the cavity 14, 14' of the microspheres 10, 10' of the present invention when the microspheres 10, 10' are used m liquid laundry detergents. By placing the particulate solid detergent ingredients withm the cavity 14, 14' of the microspheres 10, 10', the tendency of the particulate solid detergent ingredients to sediment and/or settle out of the liquid laundry detergent is reduced.

Suitable detergent ingredients for incorporation into the cavity 14, 14' of the microspheres 10, 10' of the present invention include but are not limited to, surfactants, builders, bleaching agents, dye transfer inhibiting agents, chelants, dispersants, polysacchandes, ohgosacchaπdes, softening agents, suds suppressors, earners, enzymes, enzyme stabilizing systems, polyacids, soil removal agents, anti-redeposition agents, hydrotropes, opacifiers, antioxidants, bactencides, dyes, perfumes, bπghteners, anti-encrustation agents and mixtures thereof. Preferred detergent ingredients are selected from the group consisting of: surfactants, builders, bleaching agents, chelants, enzymes, soil removal agents, anti-redeposition agents, perfumes and mixtures thereof. METHOD FOR MAKING MICROSPHERES

The microspheres 10, 10' of the present invention are preferably made by any suitable process known in the art. Preferably, the microspheres 10, 10' are made by a suspension polymenzation of droplets of a mixture of expandable outer shell mateπals and one or more of blowing agents and detergent ingredients, as more fully descπbed in EP 839 902 published May 6, 1998 in the name of BASF and/or U.S. Patent Nos. 3,615,972, 4,108,806, 4,075,138, 4,016,110, 3,945,956, 4,075,134 and 4,049,604 all in the name of The Dow Chemical Company. The microspheres 10, 10' of the present invention are readily prepared from a wide vaπety of matenals. Advantageously, the microspheres 10, 10' are typically prepared by providing an aqueous dispersion and/or suspension comprising: a) one or more anhydndes and preferably one or more additional monomenc mateπals preferably suitable for polymerization to form the polymenc mateπal comprising the polymeric expandable outer shell of the microspheres of the present invention having the desired physical properties descπbed herein, b) a blowing agent which preferably exerts little solvent action on the resulting polymenc expandable outer shell of the microspheres of the present invention and is either insoluble in the polymeric expandable outer shell or is in a quantity in excess of that which is soluble m the polymenc expandable outer shell; and c) a dispersion stabilizing matenal, preferably one or more protective colloids, which preferably is utilized to maintain the dispersion, subsequently polymenzing the anhydndes and preferably one or more additional monomenc mateπals to form the polymenc matenal compnsmg the polymenc expandable outer shell, having a quantity of the blowing agent encapsulated therein as a distinct and separate phase.

Suspensions of the anhydnde and additional monomenc mateπals for the preparation of the polymenc matenal compnsmg the polymenc expandable outer shell of the microspheres 10, 10' of the present invention are typically made employing one or more dispersion stabilizing mateπals, preferably protective colloids. Typically and preferably, the polymenzation is initiated by a suitable catalyst, preferably, an oil-soluble catalyst, which is incorporated into the aqueous dispersion. Suitable catalysts include, but are not limited to, peroxide compounds, such as organic peroxides, as well as radiation, such as high energy ionizing radiation. Suitable organic peroxides include, but are not limited to, benzyl peroxide, lauryl peroxide, t-butyl peracetate, t-butyl perbenzoate, cumene hydroperoxide, cumene ethylperoxide and mixtures thereof

The method for making the microspheres 10, 10' of the present invention is preferably earned out an oxygen-free environment and in the absence of free radical chain-terminating matenals. Such an environment can easily be accomplished by flushing the aqueous dispersion system with an inert atmosphere such as nitrogen. In accordance with the method of making the microspheres 10, 10' of the present invention, the anhydπde and additional monomeπc mateπals and blowing agents constitute a major portion of the oil phase withm the aqueous dispersion, and are incorporated with water m a ratio of from about 1 : 1 oil-phase to water to about 1 6 oil-phase to water. Typically, the dispersion stabizing mateπal is incorporated within the water phase and the expandable outer shell matenals, blowing agents and catalyst are mixed, preferably dunng violent agitation if the microspheres 10, 10' are desired to have a smaller diameter.

Generally, if extremely small diameter microspheres are desired, it is necessary to use a homogemzer or similar device in order to obtain uniform control of particle size. It is frequently beneficial to utilize a limited coalescence technique in combination with a mechanical homogemzer or similar device that will subject the aqueous dispersion to coniditions of high shear pnor to polymenzation. Suitable coalescence techniques are descπbed m U.S. Patent No. 3,615,972 in the name of The Dow Chemical Company.

The diameter of the droplets of polymenzable aqueous dispersion, and hence the diameter of the polymenc expandable outer shell microspheres of the present invention, can be vaπed predictably, by deliberate vanation of the composition of the aqueous dispersion, withm the range of from about one-half of a micron or less to about 0.5 centimeter. Preferably, the diameter of the droplets formed by the process range from about 1 micron to about 100 microns,^" more preferably from about 1 micron to about 50 microns. The polymenzation method for making the microspheres 10, 10' is typically earned out at a temperature of from about 20 °C to about 90 °C, more preferably from about 40 °C to about 65 °C.

The preferred method for making the microspheres 10, 10' of the present invention compnses dispersing one part by volume of a mixture of one or more anhydndes and preferably one or more additional monomenc mateπals and one or more blowing agents into at least 0.5, preferably from about 0.5 to bout 10 or more parts by volume of a nonsolvent aqueous medium compnsmg water and: a) a water-dispersible, water-insoluble protective colloid, the particles of which, in aqueous dispersion, have dimensions in the order of from about 0.008 to about 50 microns, which particles tend to gather at the liquid-liquid interface or are caused to do so by the presence of one or more of the following optional ingredients: i) a water-soluble "promoter" that affects the "hydrophihc- hydrophobic balance" of the protective colloids; and/or n) an electrolyte such as alkali metal and ammonium salts; and/or in) colloid-active modifiers such as peptizmg agents, flocculating agents, deflocculatmg agents and surface-active agents; and/or _IV) a water-soluble, expandable outer shell matenal insoluble inhibitor of polymerization, preferably at a level of 1 -5 ppm. The "promoter" is preferably an organic mateπal that has an affinity for the protective colloids and also for the oil droplets and that are capable of making the protective colloid more oleophilic. Dispersion Stabilizing Material

Suitable dispersion stabilizing materials include, but are not limited to, protective colloids. Preferred protective colloids are cellulose denvatives, polyvmylpyrrolidone, copolymers of N-vmyl pyrrohdone, polyvmyl alcohol and partially hydrolyzed polyvmyl acetates. Preferred cellulose denvatives are selected from the group consisting of: carboxymethylcellulose (CMC), ethylhydroxyethylcellulose (EHEC), hydroxyethylcellulose (HEC), hydroxypropylcellulose (HPC), hydroxybutylcellulose (HBC), methylcellulose (MC), ethylcellulose (EC), propylcellulose (PC), carboxymethylhydroxyethylcellulose (CMHEC), methoxypropyl methyl cellulose (MPMC), hexylcarboxymethyl cellulose, C12 - C20 alkyl carboxymethylcellulose, methylhydroxyethylcellulose (MHEC), methylhydroxypropylcellulose (MHPC), hydroxyethylmethylcellulose (HEMC), hydroxypropylmethylcellulose (HPMC), hydroxybutylmethylcellulose (HBMC) and mixtures thereof.

Examples of such cellulose denvatives are commercially available from the following companies: Aqualon, Dow Chemical, ShimEtsu, MetsaSeila, Akzo Nobel, Zoltak, Nippon Soda, Sigma. In particular, Hydroxypropyl-cellulose (HPC): Klucel from Aqualon; Hydroxypropylmethylcellulose (HPMC): e.g. Metolose SH from ShmEtsu Chemical co, Ltd; Carboxymethylcellulose (CMC): Blanose from Aqualon; Methylcellulose (MC): e.g. Metolose SM from ShmEtsu Chemical Co.,Ltd, Benecel from Aqualon; Methylhydroxyethylcellulose (HEMC): e.g. Metolose SE from Shin Etsu Chemical Co., Ltd; Hydroxyethylcellulose (HEC)- Natrosol from Aqualon; Carbomethylhydroxyethylcellulose; Ethylhydroxyethylcellulose: Aqualon from Aqualon.

Additional protective colloids that are suitable for use in the present invention include, but are not limited to, gelatine, gum arable, xanthan, sodium algmate, pectin, partly hydrolyzed starch and casein. Protective colloids are used alone or in the form of mixtures of protective colloids.

Preferably, protective colloids are used m accordance with the present invention at levels of from about 0.1% to about 10%, preferably from about 0.5% to about 5% by weight of the mixture of the dispersion stabilizing material, preferably protective colloid, and one or more expandable outer shell mateπals. LAUNDRY COMPOSITIONS

The laundry compositions of the present invention preferably also compnse, m addition to one or more microspheres 10, 10' of the present invention and one or more particulate solids of the present invention descnbed hereinbefore, one or more cleaning adjunct mateπals, preferably compatible with the microspheres 10, 10' and the detergent ingredient particulate sohd(s). The term "cleaning adjunct matenals", as used herein, means any liquid, solid or gaseous mateπal selected for the particular type of laundry composition desired and the form of the product (e.g., liquid; granule; powder; gel composition), which matenals are also preferably compatible with the microspheres 10, 10' of the present invention. The specific selection of cleaning adjunct matenals are readily made by considenng the surface, item or fabric to be cleaned, and the desired form of the composition for the laundry conditions dunng use (e.g., through the wash detergent use). The term "compatible", as used herein, means the cleaning adjunct matenals do not reduce the detersive activity of the non- enzyme detergent ingredients in the particulate solids to such an extent that the non-enzyme detergent ingredients are not effective as desired dunng normal use situations. Examples of suitable cleaning adjunct matenals include, but are not limited to, surfactants, builders, bleaches, bleach activators, bleach catalysts, other enzymes, enzyme stabilizing systems, chelants, optical bnghteners, soil release polymers, dye transfer agents, dispersants, suds suppressors, dyes, perfumes, colorants, filler salts, hydrotropes, photoactivators, fluorescers, fabnc conditioners, hydrolyzable surfactants, perservatives, anti-oxidants, anti-shnnkage agents, anti-wnnkle agents, germicides, fungicides, color speckles, silvercare, anti-tarnish and/or anti-corrosion agents, alkalinity sources, solubi zmg agents, earners, processing aids, pigments and pH control agents as descnbed in U.S. Patent Nos. 5,705,464, 5,710,115, 5,698,504, 5,695,679, 5,686,014 and 5,646,101. Specific cleaning adjunct matenals are exemplified m detail hereinafter. If the cleaning adjunct matenals are not compatible with the microspheres and the detergent ingredient particulate solids withm the laundry compositions, then suitable methods of keeping the cleaning adjunct matenals separate from (not in contact with each other) the microspheres and the detergent ingredient particulate solids until combination of the cleaning adjunct matenals and the microspheres and detergent ingredient particulate solids is appropnate can be used. Suitable methods can be any method known in the art, such as gelcaps, encapulation, tablets, physical separation, etc.

Preferably an effective amount of one or more particulate solids descnbed above are included in compositions useful for laundenng a vanety of fabncs m need of cleaning. O 00/66704

19

As used herein, "effective amount of one or more particulate solids" refers to the quantity of particulate solids of the present invention descnbed hereinbefore necessary to achieve the detersive activity necessary m the specific laundry composition. Such effective amounts are readily ascertained by one of ordinary skill in the art and is based on many factors, such as the particular enzyme used, the laundry application, the specific composition of the laundry composition, and whether a liquid or dry (e.g., granular, powder) composition is required, and the like.

The laundry detergent compositions of the present invention compnse:

(a) one or more microspheres of the present invention; and (b) one or more particulate solids of the present invention; and

(c) optionally, one or more cleaning adjunct mateπals.

Preferably, a laundry detergent composition of the present invention compπses one or more microspheres of the present invention and one or more particulate solids of the present invention such that the density difference between the density of the laundry detergent composition and/or product and the density of the particulate solids is equivalent to the density difference seen m a laundry detergent composition and/or product wherein the density difference between the density of a laundry detergent composition and/or product and the density of a particulate solid is less than about 0.2 g/mL, more preferably less than about 0.1 g/mL, most preferably less than about 0.05 g mL. Preferably, the laundry detergent compositions and/or products of the present invention compπse from about 0.001%, preferably from about 0.1%, more preferably from about 0.25% by weight of the laundry compositions of one or more particulate solids of the present invention, to about 50%, preferably to about 25%, more preferably to about 10%.

Preferably, the laundry compositions compπse from about 0 1%, preferably from about 1%, more preferably from about 2%, by weight of the laundry compositions of one or more particulate solids of the present invention, to about 60%, preferably to about 40%, more preferably to about 25% Several examples of various laundry compositions wherein the particulate solids of the present invention may be employed are discussed in further detail below Also, the laundry compositions may include from about 1% to about 99 9% by weight of the composition of the cleaning adjunct matenals.

As used herein, "fabric laundry compositions" include hand and machine laundry detergent compositions including laundry additive compositions and compositions suitable for use in the soaking and/or pretreatment of stained fabncs

When the laundry compositions of the present invention are formulated as compositions suitable for use in a laundry machine washing method, the compositions of the present invention preferably contain both a surfactant and a builder compound and additionally one or more cleaning adjunct matenals preferably selected from organic polymenc compounds, bleaching agents, additional enzymes, suds suppressors, dispersants, lime-soap dispersants, soil suspension and anti-redeposition agents and corrosion inhibitors. Laundry compositions can also contain softening agents, as additional cleaning adjunct mateπals.

The compositions of the present invention can also be used as detergent additive products m solid or liquid form. Such additive products are intended to supplement or boost the performance of conventional detergent compositions and can be added at any stage of the laundry process.

If needed the density of the laundry detergent compositions herein ranges from 400 to 1200 g/htre, preferably 500 to 950 g/htre of composition measured at 20°C. The "compact" form of the laundry compositions herein is best reflected by density and, in terms of composition, by the amount of inorganic filler salt; inorganic filler salts are conventional ingredients of detergent compositions in powder form; in conventional detergent compositions, the filler salts are present in substantial amounts, typically 17-35% by weight of the total composition. In the compact compositions, the filler salt is present in amounts not exceeding 15% of the total composition, preferably not exceeding 10%, most preferably not exceeding 5% by weight of the composition. The inorganic filler salts, such as meant in the present compositions are selected from the alkali and alkaline-earth-metal salts of sulfates and chlondes. A preferred filler salt is sodium sulfate Liquid laundry compositions according to the present invention can also be m a "concentrated form", in such case, the liquid laundry compositions according the present invention will contain a lower amount of water, .compared to conventional liquid detergents Typically the water content of the concentrated liquid laundry composition is preferably less than 40%, more preferably less than 30%, most preferably less than 20% by weight of the laundry composition.

The laundry detergent compositions and/or products preferably incorporate microspheres of the present invention m an amount sufficient to suspend the particulate solids of the present invention such that the laundry detergent compositions and/or products of the present invention are similar in properties to laundry detergent compositions and/or products compnsmg particulate solids having a particle density of from about 0.8 to about 2.1 g/mL, more preferably from about 0.8 to about 1.5 g/mL, most preferably from about 0.9 to about 1.2 g/mL. A. Liquid Laundry Detergent Compositions NON-AQUEOUS BASED HEAVY DUTY LIQUID DETERGENTS SURFACTANT-CONTAINING LIQUID PHASE

Non-aqueous, liquid, heavy-duty detergent compositions in accordance with the present invention are in the form of a stable suspension of solid, substantially insoluble particulate matenal dispersed throughout a structured, surfactant-containing liquid phase. Such detergent compositions compπse from about 49% to 99.95% by weight of the composition of a structured, surfactant-containing liquid phase formed by combining: i) from about 1% to 80% by weight of said liquid phase of one or more nonaqueous organic diluents; and n) from about 20% to 99% by weight of said liquid phase of a surfactant system compnsmg surfactants selected from the group consisting of anionic, noniomc, cationic surfactants and combinations thereof.

The surfactant-containing, non-aqueous liquid phase of the non-aqueous liquid laundry detergent compositions of the present invention will generally compnse from about 52% to about 98.9% by weight of the detergent compositions herein. More preferably, this liquid phase is surfactant-structured and will compnse from about 55% to 98% by weight of the compositions. Most preferably, this non-aqueous liquid phase will compπse from about 55% to 70% by weight of the compositions herein. Such a surfactant-containing liquid phase will frequently have a density of from about 0.6 to 1.4 g/cc, more preferably from about 0.9 to 1.3 g/cc. The liquid phase of the detergent compositions herein is preferably formed from one or more non-aqueous organic diluents into which is mixed a surfactant structuring agent which is preferably a specific type of aniomc surfactant-containing powder l Non-aqueous Organic Diluents

The major component of the liquid phase of the detergent compositions herein compπses one or more non-aqueous organic diluents The non-aqueous organic diluents used in this invention may be either surface active, i.e., surfactant, liquids or non-aqueous, non-surfactant liquids referred to herein as non-aqueous solvents. The term "solvent" is used herein to connote the non-surfactant, non-aqueous liquid portion of the compositions herein. While some of the essential and/or optional components of the compositions herein may actually dissolve m the "solvent"-contaιnιng liquid phase, other components will be present as particulate matenal dispersed within the "solvent"-contammg liquid phase. Thus the term "solvent" is not meant to require that the solvent mateπal be capable of actually dissolving all of the detergent composition components added thereto.

The non-aqueous liquid diluent component will generally compπse from about 50% to 100%), more preferably from about 50% to 80%, most preferably from about 55%> to 75%, of a structured, surfactant-containing liquid phase. Preferably the liquid phase of the compositions herein, i.e., the non-aqueous liquid diluent component, will compπse both non-aqueous liquid surfactants and non-surfactant non-aqueous solvents. u. Non-aqueous Surfactant Liquids Suitable types of non-aqueous surfactant liquids which can be used to form the liquid phase of the compositions herein include the alkoxylated alcohols, ethylene oxide (EO)- propylene oxide (PO) block polymers, polyhydroxy fatty acid amides, alkylpolysacchaπdes, and the like. Such normally liquid surfactants are those having an HLB ranging from 10 to 16. Most preferred of the surfactant liquids are the alcohol alkoxylate nonionic surfactants. Alcohol alkoxylates are matenals which correspond to the general formula:

R¹(C_mH_2mO)_nOH wherein R¹ is a Cg - C_jg alkyl group, m is from 2 to 4, and n ranges from about 2 to 12.

Preferably R¹ is an alkyl group, which may be pnmary or secondary, that contains from about 9 to 15 carbon atoms, more preferably from about 10 to 14 carbon atoms. Preferably also the alkoxylated fatty alcohols will be ethoxylated mateπals that contain from about 2 to 12 ethylene oxide moieties per molecule, more preferably from about 3 to 10 ethylene oxide moieties per molecule. The alkoxylated fatty alcohol mateπals useful m the liquid phase will frequently have a hydrophihc-hpophilic balance (HLB) which ranges from about 3 to 17. More preferably, the HLB of this material will range from about 6 to 15, most preferably from about 8 to 15.

Examples of fatty alcohol alkoxylates useful in or as the non-aqueous liquid phase of the compositions herein will include those which are made from alcohols of 12 to 15 carbon atoms and which contain about 7 moles of ethylene oxide. Such materials have been commercially marketed under the trade names Neodol 25-7 and Neodol 23-6.5 by Shell Chemical Company. Other useful Neodols include Neodol 1-5, an ethoxylated fatty alcohol averaging 11 carbon atoms m its alkyl chain with about 5 moles of ethylene oxide; Neodol 23-9, an ethoxylated pπmary Cj2 - Cj3 alcohol having about 9 moles of ethylene oxide and Neodol 91-10, an ethoxylated C9-C11 pnmary alcohol having about 10 moles of ethylene oxide. Alcohol ethoxylates of this type have also been marketed by Shell Chemical Company under the Dobanol tradename. Dobanol 91-5 is an ethoxylated C9-C1 \ fatty alcohol with an average of 5 moles ethylene oxide and Dobanol 25-7 is an ethoxylated C^-C^ fatty alcohol with an average of 7 moles of ethylene oxide per mole of fatty alcohol.

Other examples of suitable ethoxylated alcohols include Tergitol 15-S-7 and Tergitol 15- S-9 both of which are linear secondary alcohol ethoxylates that have been commercially marketed by Union Carbide Corporation. The former is a mixed ethoxylation product of C1 j to C\ζ linear secondary alkanol with 7 moles of ethylene oxide and the latter is a similar product but with 9 moles of ethylene oxide being reacted.

Other types of alcohol ethoxylates useful m the present compositions are higher molecular weight nonionics, such as Neodol 45-11, which are similar ethylene oxide condensation products of higher fatty alcohols, with the higher fatty alcohol being of 14-15 carbon atoms and the number of ethylene oxide groups per mole being about 11. Such products have also been commercially marketed by Shell Chemical Company.

If alcohol alkoxylate noniomc surfactant is utilized as part of the non-aqueous liquid phase in the detergent compositions herein, it will preferably be present to the extent of from about 1% to 60% of the composition structured liquid phase. More preferably, the alcohol alkoxylate component will compπse about 5% to 40% of the structured liquid phase. Most preferably, an alcohol alkoxylate component will compπse from about 5% to 35% of the detergent composition structured liquid phase. Utilization of alcohol alkoxylate in these concentrations m the liquid phase corresponds to an alcohol alkoxylate concentration in the total O 00/66704

composition of from about 1% to 60% by weight, more preferably from about 2% to 40% by weight, and most preferably from about 5% to 25% by weight, of the composition.

Another type of non-aqueous surfactant liquid which may be utilized m this invention are the ethylene oxide (EO) - propylene oxide (PO) block polymers. Materials of this type are well known noniomc surfactants which have been marketed under the tradename Pluronic These matenals are formed by adding blocks of ethylene oxide moieties to the ends of polypropylene glycol chains to adjust the surface active properties of the resulting block polymers. EO-PO block polymer noniomcs of this type are descπbed m greater detail in Davidsohn and Milwidsky; Synthetic Detergents. 7th Ed : Longman Scientific and Technical (1987) at pp. 34-36 and pp. 189-191 and in U.S. Patents 2,674,619 and 2,677,700. All of these publications are incorporated herein by reference. These Pluronic type noniomc surfactants are also believed to function as effective suspending agents for the particulate mateπal which is dispersed m the liquid phase of the detergent compositions herein.

Another possible type of non-aqueous surfactant liquid useful m the compositions herein compnses polyhydroxy fatty acid amide surfactants. If present, the polyhydroxy fatty acid amide surfactants are preferably present in a concentration of from about 0.1 to about 8%. Matenals of this type of noniomc surfactant are those which conform to the formula:

O CρH₂p+l II I R— C— N— Z wherein R is a Cg.\_j alkyl or alkenyl, p is from 1 to 6, and Z is glycityl denved from a reduced sugar or alkoxylated denvative thereof. Such mateπals include the C^-Cjg N-methyl glucamides Examples are N-methyl N-1-deoxyglucιtyl cocoamide and N-methyl N-l- deoxyglucityl oleamide. Processes for making polyhydroxy fatty acid, amides are know and can be found, for example, in Wilson, U.S. Patent 2,965,576 and Schwartz, U.S. Patent 2,703,798, the disclosures of which are incorporated herein by reference. The matenals themselves and their preparation are also descnbed in greater detail in Honsa, U.S. Patent 5,174,937, Issued December 26, 1992, which patent is also incorporated herein by reference.

The amount of total liquid surfactant in the preferred surfactant-structured, non-aqueous liquid phase herein will be determined by the type and amounts of other composition components and by the desired composition properties. Generally, the liquid surfactant can compnse from about 35% to 70% of the non-aqueous liquid phase of the compositions herein. More preferably, the liquid surfactant will compnse from about 50% to 65% of a non-aqueous structured liquid phase. This corresponds to a non-aqueous liquid surfactant concentration in the total composition O 00/66704

25

of from about 15% to 70% by weight, more preferably from about 20% to 50% by weight, of the composition. in Non-surfactant Non-aqueous Organic Solvents

The liquid phase of the detergent compositions herein may also comprise one or more non-surfactant, non-aqueous organic solvents. Such non-surfactant non-aqueous liquids are preferably those of low polanty. For purposes of this invention, "low-polanty" liquids are those which have little, if any, tendency to dissolve one of the preferred types of particulate mateπal used in the compositions herein, i.e., the peroxygen bleaching agents, sodium perborate or sodium percarbonate. Thus relatively polar solvents such as ethanol are preferably not utilized. Suitable types of low-polanty solvents useful m the non-aqueous liquid detergent compositions herein do include non-vicinal C4-Cg alkylene glycols, alkylene glycol mono lower alkyl ethers, lower molecular weight polyethylene glycols, lower molecular weight methyl esters and amides, and the like.

A preferred type of non-aqueous, low-polanty solvent for use m the compositions herein compnses the non-vicmal C -Cg branched or straight chain alkylene glycols. Matenals of this type include hexylene glycol (4-methyl-2,4-pentanedιol), 1 ,6-hexanedιol, 1,3-butylene glycol and 1,4-butylene glycol. Hexylene glycol is the most preferred.

Another preferred type of non-aqueous, low-polanty solvent for use herein compnses the mono-, di-, tπ-, or terra- C2-C3 alkylene glycol mono -C alkyl ethers. The specific examples of such compounds include diethylene glycol monobutyl ether, tetraethylene glycol monobutyl ether, dipropolyene glycol monoethyl ether, and dipropylene glycol monobutyl ether. Diethylene glycol monobutyl ether, dipropylene glycol monobutyl ether and butoxy-propoxy-propanol (BPP) are especially preferred. Compounds of the type have been commercially marketed under the trade names Dowanol, Carbitol, and Cellosolve. Another preferred type of non-aqueous, low-polanty organic solvent useful herein compnses the lower molecular weight polyethylene glycols (PEGs). Such matenals are those having molecular weights of at least about 150. PEGs of molecular weight ranging from about 200 to 600 are most preferred.

Yet another preferred type of non-polar, non-aqueous solvent compnses lower molecular weight methyl esters. Such matenals are those of the general formula: R¹-C(0)-OCH3 wherein

R! ranges from 1 to about 18. Examples of suitable lower molecular weight methyl esters include methyl acetate, methyl propionate, methyl octanoate, and methyl dodecanoate. „,_«.,_«.. PCT/US00/11306 O 00/66704

26

The non-aqueous, generally low-polanty, non-surfactant organic solvent(s) employed should, of course, be compatible and non-reactive with other composition components, e g , bleach and/or activators, used m the liquid detergent compositions herein Such a solvent component is preferably utilized in an amount of from about 1% to 70% by weight of the liquid phase More preferably, a non-aqueous, low-polanty, non-surfactant solvent will compπse from about 10% to 60% by weight of a structured liquid phase, most preferably from about 20% to 50% by weight, of a structured liquid phase of the composition Utilization of non-surfactant solvent m these concentrations in the liquid phase corresponds to a non-surfactant solvent concentration in the total composition of from about 1 % to 50% by weight, more preferably from about 5% to 40% by weight, and most preferably from about 10% to 30% by weight, of the composition. lv Blends of Surfactant and Non-surfactant Solvents

In systems which employ both non-aqueous surfactant liquids and non-aqueous non- surfactant solvents, the ratio of surfactant to non-surfactant liquids, e.g., the ratio of alcohol alkoxylate to low polanty solvent, withm a structured, surfactant-containing liquid phase can be used to vary the rheological properties of the detergent compositions eventually formed. Generally, the weight ratio of surfactant liquid to non-surfactant organic solvent will range about 50: 1 to 1:50. More preferably, this ratio will range from about 3:1 to 1 :3, most preferably from about 2:1 to 1 :2. v Surfactant Structurant

The non-aqueous liquid phase of the detergent compositions of this invention is prepared by combining with the non-aqueous organic liquid diluents hereinbefore descπbed a surfactant which is generally, but not necessaπly, selected to add structure to the non-aqueous liquid phase of the detergent compositions herein. Structuπng surfactants can be of the anionic, noniomc, cationic, and/or amphoteπc types.

Preferred structunng surfactants are the anionic surfactants such as the alkyl sulfates, the alkyl polyalkxylate sulfates and the linear alkyl benzene sulfonates. Another common type of anionic surfactant matenal which may be optionally added to the detergent compositions herein as structurant compnses carboxylate-type aniomcs Carboxylate-type anionics include the C JQ- Cjg alkyl alkoxy carboxylates (especially the EO 1 to 5 ethoxycarboxylates) and the C JQ- I S sarcosmates, especially oleoyl sarcosmate Yet another common type of anionic surfactant matenal which may be employed as a structurant comprises other sulfonated anionic surfactants such as the Cg-Cjg paraffin sulfonates and the Cg-Cjg olefin sulfonates Structunng anionic surfactants will generally compπse from about 1% to 30% by weight of the compositions herein.

As indicated, one preferred type of structuring anionic surfactant compπses pnmary or secondary alkyl sulfate anionic surfactants. Such surfactants are those produced by the sulfation of higher C -C20 fatty alcohols.

Conventional pnmary alkyl sulfate surfactants have the general formula

R0S0₃-M⁺ wherein R is typically a linear Cg - C20 hydrocarbyl group, which may be straight chain or branched chain, and M is a water-solubihzmg cation. Preferably R is a C JO- 14 alkyl, and M is alkali metal. Most preferably R is about C\2 and M is sodium.

Conventional secondary alkyl sulfates may also be utilized as a structunng anionic surfactant for the liquid phase of the compositions herein. Conventional secondary alkyl sulfate surfactants are those matenals which have the sulfate moiety distπbuted randomly along the hydrocarbyl "backbone" of the molecule. Such matenals may be depicted by the structure: CH₃(CH₂)n(CH0S03-M⁺) (CH₂)_mCH₃ wherein m and n are integers of 2 or greater and the sum of m + n is typically about 9 to 15, and

M is a water-solubihzmg cation.

If utilized, alkyl sulfates will generally compnse from about 1% to 30% by weight of the composition, more preferably from about 5% to 25%> by weight of the composition. Non-aqueous liquid detergent compositions containing alkyl sulfates, peroxygen bleaching agents, and bleach activators are descnbed in greater detail in Kong-Chan et al.; WO 96/10073; Pubhched Apnl 4,

1996, which application is incorporated herein by reference.

Another preferred type of anionic surfactant mateπal which may be optionally added to the non-aqueous laundry compositions herein as a structurant compπses the alkyl polyalkoxylate sulfates. Alkyl polyalkoxylate sulfates are also known as alkoxylated alkyl sulfates or alkyl ether sulfates. Such mateπals are those which correspond to the formula

R2-0-(C_mH_2mO)_n-S0₃M

wherein R^ IS a C10- 22 alky- group, m is from 2 to 4, n is from about 1 to 15, and M is a salt- forming cation. Preferably, R^ is a C^- j g alkyl, m is 2, n is from about 1 to 10, and M is sodium, potassium, ammonium, alkylammonium or alkanolammonium. Most preferably, R^ is a Cl2"Cl6> m is 2, n is from about 1 to 6, and M is sodium. Ammonium, alkylammonium and alkanolammonium counteπons are preferably avoided when used in the compositions herein because of incompatibility with peroxygen bleaching agents. If utilized, alkyl polyalkoxylate sulfates can also generally compπse from about 1% to

30% by weight of the composition, more preferably from about 5% to 25% by weight of the composition. Non-aqueous liquid detergent compositions containing alkyl polyalkoxylate sulfates, in combination with polyhydroxy fatty acid amides, are descπbed in greater detail in Boutique et al; PCT Application No PCT/US96/04223, which application is incorporated herein by reference.

The most preferred type of anionic surfactant for use as a structurant m the compositions herein compπses the linear alkyl benzene sulfonate (LAS) surfactants. In particular, such LAS surfactants can be formulated into a specific type of anionic surfactant-contammg powder which is especially useful for incorporation into the non-aqueous liquid detergent compositions of the present invention. Such a powder compπses two distinct phases. One of these phases is insoluble in the non-aqueous organic liquid diluents used m the compositions herein; the other phase is soluble in the non-aqueous organic liquids. It is the insoluble phase of this preferred anionic surfactant-contammg powder which can be dispersed in the non-aqueous liquid phase of the preferred compositions herein and which forms a network of aggregated small particles that allows the final product to stably suspend other solid particulate matenals m the composition.

Such a preferred anionic surfactant-contammg powder is formed by co-drying an aqueous slurry which essentially contains a) one of more alkali metal salts of C JQ-16 linear alkyl benzene sulfomc acids; and b) one or more non-surfactant diluent salts. Such a slurry is dned to a solid mateπal, generally in powder form, which compπses both the soluble and insoluble phases. The linear alkyl benzene sulfonate (LAS) mateπals used to form the preferred anionic surfactant-contammg powder are well known matenals. Such surfactants and their preparation are descnbed for example in U.S. Patents 2,220,099 and 2,477,383, incorporated herein by reference. Especially preferred are the sodium and potassium linear straight chain alkylbenzene sulfonates in which the average number of carbon atoms in the alkyl group is from about 11 to 14 Sodium C\ \-\^, e.g., C\ , LAS is especially preferred. The alkyl benzene surfactant anionic surfactants are generally used m the powder-formmg slurry in an amount from about 20 to 70% by weight of the slurry, more preferably from about 20% to 60% by weight of the slurry. The powder-formmg slurry also contains a non-surfactant, organic or inorganic salt component that is co-dπed with the LAS to form the two-phase anionic surfactant-contammg powder. Such salts can be any of the known sodium, potassium or magnesium hahdes, sulfates, citrates, carbonates, sulfates, borates, succmates, sulfo-succmates and the like. Sodium sulfate, which is generally a bi-product of LAS production, is the preferred non-surfactant diluent salt for use herein. Salts which function as hydrotropes such as sodium sulfo-succinate may also usefully be included The non-surfactant salts are generally used m the aqueous slurry, along with the LAS, m amounts ranging from about 1 to 50% by weight of the slurry, more preferably from about 5% to 40% by weight of the slurry. Salts that act as hydrotropes can preferably compπse up to about 3% by weight of the slurry.

The aqueous slurry containing the LAS and diluent salt components hereinbefore descnbed can be dned to form the anionic surfactant-contammg powder preferably added to the non-aqueous diluents m order to prepare a structured liquid phase withm the compositions herein. Any conventional drying technique, e.g., spray drying, drum drying, etc., or combination of drying techniques, may be employed. Drying should take place until the residual water content of the solid matenal which forms is within the range of from about 0.5% to 4% by weight, more preferably from about 1% to 3% by weight.

The anionic surfactant-contammg powder produced by the drying operation constitutes two distinct phases, one of which is soluble in the inorganic liquid diluents used herein and one of which is insoluble in the diluents. The insoluble phase m the anionic surfactant-contammg powder generally compπses from about 10% to 45% by weight of the powder, more preferably from about 15% to 35% by weight of a powder.

The anionic surfactant-containing powder that results after drying can compnse from about 45%o to 94%, more preferably from about 60% to 94%, by weight of the powder of alkyl benzene sulfonic acid salts. Such concentrations are generally sufficient to provide from about 0.5% to 60%, more preferably from about 15% to 60%>, by weight of the total detergent composition that is eventually prepared, of the alkyl benzene sulfonic acid salts. The anionic surfactant-contammg powder itself can compnse from about 0.45% to 45% by weight of the total composition that is eventually prepared. After drying, the anionic surfactant-contammg powder will also generally contain from about 2% to 50%, more preferably from about 2% to 25% by weight of the powder of the non-surfactant salts.

After it is dned to the requisite extent, the combined LAS/salt mateπal can be converted to flakes or powder form by any known suitable milling or comminution process. Generally at the time such mateπal is combined with the non-aqueous organic solvents to form the structured liquid phase of the compositions herein, the particle size of this powder will range from 0.1 to 2000 microns, more preferably from about 0.1 to 1000 microns.

A structured, surfactant-containing liquid phase of the preferred detergent compositions herein can be prepared by combining the non-aqueous organic diluents hereinbefore descπbed with the anionic surfactant-contammg powder as hereinbefore descπbed. Such combination results in the formation of a structured surfactant-containing liquid phase. Conditions for making this combination of preferred structured liquid phase components are descπbed more fully hereinafter in the "Composition Preparation and Use" section. As previously noted, the formation of a structured, surfactant-contammg liquid phase permits the stable suspension of colored speckles and additional functional particulate solid mateπals within the preferred detergent compositions of this invention.

Additional suitable surfactants for use m the present invention included noniomc surfactants, specifically, polyhydroxy fatty acid amides of the formula:

O R,

II I

R— C — N — Z wherein R is a C9.17 alkyl or alkenyl, R\ is a methyl group and Z is glycityl deπved from a reduced sugar or alkoxylated denvative thereof. Examples are N-methyl N-1-deoxyglucιtyl cocoamide and N-methyl N-1-deoxyglucιtyl oleamide. Processes for making polyhydroxy fatty acid amides are known and can be found in Wilson, U.S. Patent 2,965,576 and Schwartz, U.S. Patent 2,703,798, the disclosures of which are incorporated herein by reference.

Preferred surfactants for use in the detergent compositions descnbed herein are amine based surfactants of the general formula:

R3

I

R₁-X-(CH₂)_n-N

R₄

wherein R_j is a Cg-C^ alkyl group; n is from about 2 to about 4, X is a bndgmg group which is selected from NH, CONH, COO, or O or X can be absent; and R3 and R4 are individually selected from H, C1-C4 alkyl, or (CH2-CH₂-0(R5)) wherein R5 is H or methyl. Especially preferred amines based surfactants include the following:

Rl-(CH₂)2*NH₂

R!-0-(CH₂)3-NH2

R₁-C(0)-NH-(CH₂)3-N(CH₃)2

CH₂-CH(0H)-R₅

R_j-N

CH₂-CH(QH)-R₅

wherein Rj is a Cg-C^ alkyl group and R5 is H or CH3. Particularly preferred amines for use in the surfactants defined above include those selected from the group consisting of octyl amme, hexyl amme, decyl amme, dodecyl amme, Cg-Ci2 bιs(hydroxyethyl)amme, Cg-C_]2 bιs(hydroxyιsopropyl)amme, C -Ci2 amido-propyl dimethyl amme, or mixtures thereof.

In a highly preferred embodiment, the amme based surfactant is descπbed by the formula R!-C(0)-NH-(CH2)3-N(CH3)2 wherein Rj is C -Cj2 alkyl. vi. Solid Particulate Mateπals

The non-aqueous detergent compositions herein preferably compnse from about 0.01% to

50% by weight, more preferably from about 0.2% to 30% by weight, of solid phase particulate matenal which is dispersed and suspended withm the liquid phase. Generally such particulate matenal will range in size from about 0.1 to 1500 microns, more preferably from about 0.1 to 900 microns. Most preferably, such mateπal will range in size from about 5 to 200 microns.

The particulate mateπal utilized herein can compπse one or more types of detergent composition components which in particulate form are substantially insoluble in the non-aqueous liquid phase of the composition. The types of particulate mateπals which can be utilized are descnbed in detail as follows: AQUEOUS BASED HEAVY DUTY LIQUID DETERGENTS SURFACTANTS

The present invention also comprises aqueous based liquid detergent compositions. The aqueous liquid detergent compositions preferably compnse from about 10% to about 98%, preferably from about 30% to about 95%, by weight of an aqueous liquid earner which is preferably water Additionally, the aqueous liquid detergent compositions of the present invention compnse a surfactant system which preferably contains one or more detersive co- surfactants in addition to the branched surfactants disclosed above. The additional co-surfactants can be selected from noniomc detersive surfactant, anionic detersive surfactant, zwittenomc detersive surfactant, amme oxide detersive surfactant, and mixtures thereof The surfactant system typically compπses from about 5% to about 70%, preferably from about 15% to about 30%, by weight of the detergent composition. i. Anionic Surfactant

Anionic surfactants include Ci j-Cig alkyl benzene sulfonates (LAS) and primary, branched-cham and random C10-C20 alkyl sulfates (AS), the CjQ-Ci secondary (2,3) alkyl

sulfates of the foπnula CH₃(CH₂)_x(CHOSθ3^"M⁺) CH₃ and CH₃ (CH₂)y(CHOS0₃ ^"M⁺) CH2CH3 where x and (y + 1) are integers of at least about 7, preferably at least about 9, and M is a water-solubihzmg cation, especially sodium, unsaturated sulfates such as oleyl sulfate, the CJQ- Cjg alkyl alkoxy sulfates ("AE_XS"; especially EO 1-7 ethoxy sulfates), Cj_Q-Cig alkyl alkoxy carboxylates (especially the EO 1-5 ethoxycarboxylates), the CjQ.jg glycerol ethers, the CI Q-CJ g alkyl polyglycosides and their corresponding sulfated polyglycosides, and C^- j alpha- sulfonated fatty acid esters.

Generally speaking, anionic surfactants useful herein are disclosed in U.S. Patent No 4,285,841, Barrat et al, issued August 25, 1981, and m U.S. Patent No. 3,919,678, Laughlm et al, issued December 30, 1975. Useful anionic surfactants include the water-soluble salts, particularly the alkali metal, ammonium and alkylolammonium (e.g., monoethanolammonium or tnethanolammomum) salts, of organic sulfuπc reaction products having in their molecular structure an alkyl group containing from about 10 to about 20 carbon atoms and a sulfonic acid or sulfunc acid ester group (Included in the term "alkyl" is the alkyl portion of aryl groups.) Examples of this group of synthetic surfactants are the alkyl sulfates, especially those obtained by sulfatmg the higher alcohols (Cg-C_j carbon atoms) such as those produced by reducing the glycendes of tallow or coconut oil. Other anionic surfactants herein are the water-soluble salts of alkyl phenol ethylene oxide ether sulfates containing from about 1 to about 4 units of ethylene oxide per molecule and from about 8 to about 12 carbon atoms in the alkyl group.

Other useful anionic surfactants herein include the water-soluble salts of esters of a- sulfonated fatty acids containing from about 6 to 20 carbon atoms in the fatty acid group and from about 1 to 10 carbon atoms in the ester group; water-soluble salts of 2-acyloxy-alkane-l -sulfonic acids containing from about 2 to 9 carbon atoms in the acyl group and from about 9 to about 23 carbon atoms m the alkane moiety; water-soluble salts of olefin sulfonates containing from about 12 to 24 carbon atoms; and b-alkyloxy alkane sulfonates containing from about 1 to 3 carbon atoms in the alkyl group and from about 8 to 20 carbon atoms m the alkane moiety.

Particularly preferred anionic surfactants herein are the alkyl polyethoxylate sulfates of the formula:

RO(C₂H₄0)_xS03-M⁺ wherein R is an alkyl chain having from about 10 to about 22 carbon atoms, saturated or unsaturated, M is a cation which makes the compound water-soluble, especially an alkali metal, ammonium or substituted ammonium cation, and x averages from about 1 to about 15.

Preferred alkyl sulfate surfactants are the non-ethoxylated C 12-15 pnmary and secondary alkyl sulfates. Under cold water washing conditions, i.e., less than abut 65°F (18.3°C), it is preferred that there be a mixture of such ethoxylated and non-ethoxylated alkyl sulfates. Examples of fatty acids include capnc, launc, mynstic, palmitic, steaπc, arachidic, and behenic acid. Other fatty acids include palmitoleic, oleic, lmoleic, hnolenic, and πcmoleic acid. n. Noniomc Surfactant

Conventional noniomc and amphoteπc surfactants include C^-C^g alkyl ethoxylates

(AE) including the so-called narrow peaked alkyl ethoxylates and -C\2 alkyl phenol alkoxylates (especially ethoxylates and mixed ethoxy/propoxy) The CiQ-Cj N-alkyl polyhydroxy fatty acid amides can also be used. Typical examples include the Ci2-Cι N- methylglucamides. See WO 9,206,154. Other sugar-deπved surfactants include the N-alkoxy polyhydroxy fatty acid amides, such as C JQ-C I S N-(3-methoxypropyl) glucamide. The N-propyl through N-hexyl C^-Cig glucamides can be used for low sudsmg. C10-C20 conventional soaps may also be used. If high sudsmg is desired, the branched-cham C10-C16 soaps may be used Examples of noniomc surfactants are descnbed in U S. Patent No. 4,285,841, Barrat et al, issued August 25, 1981 00/66704

Preferred examples of these surfactants include ethoxylated alcohols and ethoxylated alkyl phenols of the formula R(OC₂H4)_nOH, wherein R is selected from the group consisting of aliphatic hydrocarbon radicals containing from about 8 to about 15 carbon atoms and alkyl phenyl radicals in which the alkyl groups contain from about 8 to about 12 carbon atoms, and the average value of n is from about 5 to about 15. These surfactants are more fully descnbed in U.S. Patent No 4,284,532, Leikhim et al, issued August 18, 1981. Particularly preferred are ethoxylated alcohols having an average of from about 10 to abut 15 carbon atoms m the alcohol and an average degree of ethoxylation of from about 6 to about 12 moles of ethylene oxide per mole of alcohol. Mixtures of anionic and noniomc surfactants are especially useful. Other conventional useful surfactants are listed m standard texts, including Cι₂-Cι betames and sulfobetames (sultames). in Amine Oxide Surfactants The compositions herein also contain amine oxide surfactants of the formula:

Rl(EO)_x(PO)_y(BO)_zN(0)(CH₂R')₂.qH₂0 (I) In general, it can be seen that the structure (I) provides one long-chain moiety

R*(EO)_x(PO)y(BO)_z and two short chain moieties, CH₂R'. R' is preferably selected from hydrogen, methyl and -CH₂OH. In general R* is a pnmary or branched hydrocarbyl moiety which can be saturated or unsaturated, preferably, R^ is a pnmary alkyl moiety. When x+y+z = 0,

Ri is a hydrocarbyl moiety having chamlength of from about 8 to about 18. When x+y+z is different from 0, R^ may be somewhat longer, having a chamlength m the range Cj₂-C₂4- The general formula also encompasses amme oxides wherein x+y+z = 0, R' = Cg-Cjg, R' is H and q is 0-2, preferably 2. These amme oxides are illustrated by Cι₂_i4 alkyldimethyl amme oxide, hexadecyl dimethylarnine oxide, octadecylamme oxide and their hydrates, especially the dihydrates as disclosed in U.S. Patents 5,075,501 and 5,071,594, incorporated herein by reference.

The invention also encompasses amine oxides wherein x+y+z is different from zero, specifically x+y+z is from about 1 to about 10, R* is a pnmary alkyl group containing 8 to about 24 carbons, preferably from about 12 to about 16 carbon atoms; m these embodiments y + z is preferably 0 and x is preferably from about 1 to about 6, more preferably from about 2 to about 4, EO represents ethyl eneoxy; PO represents propyleneoxy; and BO represents butyleneoxy. Such amine oxides can be prepared by conventional synthetic methods, e.g., by the reaction of alkylethoxysulfates with dimethylamine followed by oxidation of the ethoxylated amine with hydrogen peroxide.

Highly preferred amine oxides herein are solids at ambient temperature, more preferably they have melting-points in the range 30°C to 90°C. Amine oxides suitable for use herein are made commercially by a number of suppliers, including Akzo Chemie, Ethyl Corp., and Procter & Gamble. See McCutcheon's compilation and Kirk-Othmer review article for alternate amme oxide manufacturers. Preferred commercially available amme oxides are the solid, dihydrate ADMOX 16 and ADMOX 18, ADMOX 12 and especially ADMOX 14 from Ethyl Corp.

Preferred embodiments include dodecyldimethylamine oxide dihydrate, hexadecyldimethylamme oxide dihydrate, octadecyldimethylamme oxide dihydrate, hexadecyltns(ethyleneoxy)dιmethyl-amme oxide, tetradecyldimethylamme oxide dihydrate, and mixtures thereof.

Whereas in certain of the preferred embodiments R' is H, there is some latitude with respect to having R' slightly larger than H. Specifically, the invention further encompasses embodiments wherein R' is CH₂OH, such as hexadecylbιs(2- hydroxyethyl)amιne oxide, tallowbιs(2-hydroxyethyl)amme oxide, stearylbιs(2-hydroxyethyl)amιne oxide and oleylbιs(2- hydroxyethyl)amme oxide.

HEAVY DUTY GEL LAUNDRY DETERGENT COMPOSITIONS

The present invention encompasses a heavy duty gel laundry detergent compositions compnsmg, by weight of the composition: a) from about 15% to about 40% of an anionic surfactant component which compnses, by weight of the composition:

(l) from about 5% to about 25% of alkyl polyethoxylate sulfates wherein the alkyl group contains from about 10 to about 22 carbon atoms and the polyethoxylate chain contains from 0.5 to about 15, preferably from 0.5 to about 5, more preferably from

0.5 to about 4, ethylene oxide moieties; and (n) from about 5% to about 20% of fatty acids; and b) one or more of the following ingredients detersive amme, modified polyamme, polyamide-polyamme, polyethoxylated-polyamine polymers, quaternary ammonium surfactants, suitable electrolyte or acid equivalents thereof, and mixtures thereof.

The compositions herein may further contain one or more additional detersive additives selected from the group consisting of non-citrate builders, optical bπghteners, soil release polymers, dye transfer inhibitors, polymenc dispersing agents, enzymes, suds suppressers, dyes, perfumes, colorants, filler salts, hydrotropes, antiredeposition agents, antifadmg agent, dye fixative agents, pnll/fuzzing reducing agents, and mixtures thereof.

The compositions herein have a viscosity at 20 s'l shear rate of from about 100 cp to about 4,000 cp, preferably from about 300 cp to about 3,000 cp, more preferably from about 500 cp to about 2,000 cp and are stable upon storage.

The compositions herein are structured and have a specific rheology. The rheology can be modeled by the following formula: η = η₀ + Aγ(»-l) where η is the viscosity of the liquid at a given shear rate, η₀ is the viscosity at infinite shear rate, γ is the shear rate, n is the shear rate index, and K is the consistency index. As used herein, the term "structured" indicates a heavy duty liquid composition having a liquid crystalline lamellar phase and an infinite shear viscosity (ηo) value between 0 and about 3,000cp (centipoise), a shear index («) value of less than about 0.6, a consistency index value, K, of above about 1,000, and a viscosity (η) measured at 20 s"¹ of less, than about 10,000cp, preferably less than about 5,000cp. Under low stress levels, a "zero shear" viscosity is above about 100,000cp wherein "zero shear" is meant a shear rate of 0.001 s-"* or less. The yield value of the compositions herein, obtained by plotting viscosity versus stress, is larger than 0.2Pa. These rheology parameters can be measured with any commercially available rheometer, such as the Cammed CSL 100 model. The compositions herein are clear or translucent, i.e. not opaque. Electrolytes - Without being limited by theory, it is believed that the presence of electrolytes acts to control the viscosity of the gel compositions. Thus, the gel nature of the compositions herein are affected by the choice of surfactants and by the amount of electrolytes present. In preferred embodiments herein, the compositions will further compnse from 0% to about 10%, more preferably from about 1% to about 8%, even more preferably from about 2%> to about 6%, of a suitable electrolyte or acid equivalent thereof. Sodium citrate is a highly preferred electrolyte for use herein.

The compositions herein may optionally contain from about 0% to about 10%, by weight, of solvents and hydrotropes. Without being limited by theory, it is believed that the presence of solvents and hydrotropes can affect the structured versus lsotropic nature of the compositions; By "solvent" is meant the commonly used solvents m the detergent industry, including alkyl monoalcohol, di-, and tn-alcohols, ethylene glycol, propylene glycol, propanediol, ethanediol, glycenne, etc. By "hydrotrope" is meant the commonly used hydrotropes in the detergent industry, including short chain surfactants that help solubihze other surfactants. Other examples of hydrotropes include cumene, xylene, or toluene sulfonate, urea, Cg or shorter chain alkyl carboxylates, and Cg or shorter chain alkyl sulfate and ethoxylated sulfates.

Modified polyamme - The compositions herein may compπse at least about 0.05%, preferably from about 0.05% to about 3%, by weight, of a water-soluble or dispersible, modified polyamme agent, said agent compnsmg a polyamme backbone corresponding to the formula:

[(R²)2-N]_w-[R¹-N]_χ-[R¹-N]_y-[R¹-N]_z

B R² (R²)₂ wherein each R^ is independently C2-C5 alkylene, alkenylene or arylene; each R² is independently H, or a moiety of formula OH[(CH2)_xO]_n, wherein x is from about 1 to about 8 and n is from about 10 to about 50; w is 0 or 1; x+y+z is from about 5 to about 30; and B represents a continuation of this structure by branching; and wherein said polyamme before alkylation has an average molecular weight of from about 300 to about 1,200.

In preferred embodiments, R! IS C2-C4 alkylene, more preferably ethylene; R² is

OH[CH2CH2θ]_n, wherein n is from about 15 to about 30, more preferably n is about 20. The average Molecular Weight of the polyarmne before alkylation is from about 300 to about 1200, more preferably from about 500 to about 900, still more preferably from about 600 to about 700, even more preferably from about 600 to about 650.

In another preferred embodiment, R^ is C₂-C4 alkylene, more preferably ethylene; R² is

OH[CH2CH2θ]_n, wherein n is from about 10 to about 20, more preferably n is about 15. The average Molecular Weight of the polyarmne before alkylation is from about 100 to about 300, more preferably from about 150 to about 250, even more preferably from about 180 to about 200.

Polvamide-Polyamines - The polyamide-polyamines useful herein will generally compπse from about 0.1% to 8% by the weight of the composition. More preferably, such polyamide-polyamine matenals will compnse from about 0.5% to 4%> by weight of the compositions herein. Most preferably, these polyamide-polyamines will compnse from about 1% to 3% by weight of the composition.

The polyamide-polyamine matenals used in this invention are those which have repeating, substituted amido-amme units which correspond to the general Structural Formula No I as follows.

Structural Formula No. I In Structural Formula No. I, R_[, R₂ and R5 are each independently C1 - alkylene, C_j_4 alkarylene or arylene. It is also possible to eliminate R\ entirely so that the polyamide- polyamme is deπved from oxalic acid.

Also m Structural Formula No. I, R3 is H, epichlorohydnn, an azetidimum group, an epoxypropyl group or a dimethylammohydroxypropyl group, and R4 can be H, C_j^ alkyl, Cι_4 alkaryl, or aryl. R4 may also be any of the foregoing groups condensed with C1.4 alkylene oxide R\ is preferably butylene, and R₂ and R5 are preferably ethylene. R3 is preferably epichlorohydnn. R4 is preferably H.

The polyamide-polyamine matenals useful herein can be prepared by reacting polyamines such as diethylenetnamme, tnethylenetetraamme, tetraethylenepentanune or dipropylenetnamme with C₂-C ₂ dicarboxyhc acids such as oxalic, succmic, glutanc, adipic and diglycolic acids. Such mateπals may then be further deπvatized by reaction with, for example, epichlorohydnn. Preparation of such matenals is descπbed m greater detail in Keim, U.S. Patent 2,296,116, Issued February 23, 1960; Keim, U.S. Patent 2,296,154, Issued February 23, 1960 and Keim, U.S. Patent 3,332,901, Issued July 25, 1967.

The polyamide-polyamine agents preferred for use herein are commercially marketed by Hercules, Inc. under the tradename Kymene® . Especially useful are Kymene 557H® and

Kymene 557LX® which are epichlorohydnn adducts of polyamide-polyamines which are the reaction products of diethylenetnamme and adipic acid. Other suitable mateπals are those marketed by Hercules under the tradenames Reten® and Delsette®' and by Sandoz under the tradename Cartaretm® These polyamide-polyamine mateπals are marketed in the form of aqueous suspensions of the polymenc matenal containing, for example, about 12.5% by weight of solids.

Detersive Amme - Suitable amine surfactants for use herein include detersive amines according to the formula: R3 Ri— X— (CH₂)_n— N

R4 wherein Rj is a -C\2 alkyl group; n is from about 2 to about 4, X is a bndging group which is selected from NH, CONH, COO, or O or X can be absent; and R3 and R4 are individually selected from H, C1-C4 alkyl, or (CH2-CH2-0(R5)) wherein R5 is H or methyl. Preferred amines include the following:

R₁-(CH₂)₂-NH₂ (1)

R!-0-(CH₂)₃-NH₂ (2)

R₁-C(0)-NH-(CH₂)₃-N(CH₃)₂ (3)

CH₂-CH(OH)-R₅

R!-N (4)

CH₂-CH(OH)-R₅

wherein Rj is a Cg-C^ alkyl group and R5 is H or CH3.

In a highly preferred embodiment, the amme is descπbed by the formula:

R!-C(0)-NH-(CH₂)₃-N(CH3)₂ wherein Rj is C -Cj2 alkyl. Particularly preferred amines include those selected from the group consisting of octyl amme, hexyl amme, decyl amme, dodecyl amme, Cg-Ci2 bιs(hydroxyethyl)amme, Cg-Cj2 bιs(hydroxyιsopropyl)amme, and Cg-Cj2 amido-propyl dimethyl amine, and mixtures.

If utilized the detersive amines compnse from about 0.1% to about 10%, preferably from about 0.5%) to about 5%, by weight of the composition. Quaternary Ammonium Surfactants - from about 1% to about 6% of a quaternary ammonium surfactant having the formula

Φ

R4 Ri

N x ^θ R3 R2 wherein Rj and R2 are individually selected from the group consisting of C1-C4 alkyl, C1-C4 hydroxy alkyl, benzyl, and -(C2H4θ)_xH where x has a value from about 2 to about 5; X is an am on; and (1) R3 and R4 are each a Cg-Ci 4 alkyl or (2) R3 is a Cg-C_j alkyl, and R4 is selected from the group consisting of C J -C J O alkyl, C J -C J O hydroxy alkyl, benzyl, and -(C2H4θ)_xH where x has a value from 2 to 5.

Prefeπed quaternary ammonium surfactants are the chlonde, bromide, and methylsulfate salts. Examples of preferred mono-long chain alkyl quaternary ammonium surfactants are those wherein R\, R2, and R4 are each methyl and R3 is a Cg-Ci g alkyl; or wherein R3 is Cg.j alkyl and Rj, R₂, and R4 are selected from methyl and hydroxy-alkyl moieties. Lauryl tnmethyl ammonium chlonde, mynstyl tnmethyl ammonium chloπde, palmityl tπmethyl ammonium chloride, coconut tnmethylammonium chloπde, coconut tπmethylammonium methylsulfate, coconut dimethyl-monohydroxyethyl-ammonium chlonde, coconut dimethy - monohydroxyethylammonium methylsulfate, steryl dimethyl-monohydroxy-ethylammomum chloπde, steryl dimethylmonohydroxy-ethylammomum methylsulfate, di- Cι₂-Cj4 alkyl dimethyl ammonium chloπde, and mixtures thereof are particularly preferred. ADOGEN 412™, a lauryl tnmethyl ammonium chloπde commercially available from Witco, is also preferred. Even more highly preferred are the lauryl tπmethyl ammonium chlonde and mynstyl tnmethyl ammonium chlonde.

Alkoxylated quaternary ammonium (AQA) surfactants useful in the present invention are of the general formula:

wherein R¹ is an alkyl or alkenyl moiety containing from about 8 to about 18 carbon atoms, preferably 10 to about 16 carbon atoms, most preferably from about 10 to about 14 carbon atoms, R² and R³ are each independently alkyl groups containing from one to about three carbon atoms, preferably methyl; R³ and R⁴ can vary independently and are selected from hydrogen (preferred), methyl and ethyl, X^" is an amon such as chloπde, bromide, methylsulfate, sulfate, or the like, to provide electncal neutrality; A is selected from C1 -C4 alkoxy, especially ethoxy (i.e., - CH2CH2O-), propoxy, butoxy and mixtures thereof;and for formula I, p is from 2 to about 30, preferably 2 to about 15, most preferably 2 to about 8; and for formula π, p is from 1 to about 30, preferably 1 to about 4 and q is from 1 to about 30, preferably 1 to about 4, and most preferably both p and q are 1.

Other quaternary surfactants include the ammonium surfactants such as alkyldimethylammonium halogenides, and those surfactants having the formula:

[R²(OR³)_y] [R⁴(OR³)_y]₂R⁵N+X- wherein R² is an alkyl or alkyl benzyl group having from about 8 to about 18 carbon atoms in the alkyl chain, each R³ is selected from the group consisting of -CH2CH₂-, -CH₂CH(CH3)-, -

CH CH(CH₂OH)-, -CH₂CH CH₂-, and mixtures thereof; each R⁴ is selected from the group consisting of C1-C4 alkyl, C1-C4 hydroxyalkyl, benzyl, nng structures formed by joining the two

R⁴ groups, -CH₂CHOHCHOHCOR⁶CHOH-CH₂OH wherein R⁶ is any hexose or hexose polymer having a molecular weight less than about 1000, and hydrogen when y is not O; R is the same as R⁴ or is an alkyl chain wherein the total number of carbon atoms of R² plus R^ is not more than about 18; each y is from 0 to about 10 and the sum of the y values is from 0 to about 15; and X is any compatible amon.

Polvefhoxylated-Polvamme Polymers - Another polymer dispersant form use herein includes polyethoxyated-polyamme polymers (PPP). The preferred polyethoxylated-polyammes useful herein are generally polyalkyleneammes (PAA's), polyalkyleneimmes (PAI's), preferably polyethyleneamine (PEA's), polyethyleneimmes (PEI's). A common polyalkyleneamine (PAA) is tetrabutylenepentamine. PEA's are obtained by reactions involving ammonia and ethylene dichlonde, followed by fractional distillation. The common PEA's obtained are tπethylenetetramme (TETA) and teraethylenepentamine (TEPA). Above the pentammes, i.e., the hexammes, heptammes, octammes and possibly nonammes, the cogenencally denved mixture does not appear to separate by distillation and can include other matenals such as cyclic amines and particularly piperazmes. There can also be present cyclic ammes with side chains in which nitrogen atoms appear. See U.S Patent 2,792,372, Dickinson, issued May 14, 1957, which descnbes the preparation of PEA's.

Polyethoxylated polyammes can be prepared, for example, by polymeπzing ethyleneimine in the presence of a catalyst such as carbon dioxide, sodium bisulfite, sulfunc acid, hydrogen peroxide, hydrochlonc acid, acetic acid, etc Specific methods for prepanng these polyamme backbones are disclosed m U.S. Patent 2,182,306, Ulπch et al., issued December 5, 1939; U.S. Patent 3,033,746, Mayle et al., issued May 8, 1962; U.S. Patent 2,208,095, Esselmann et al., issued July 16, 1940; U.S. Patent 2,806,839, Crowther, issued September 17, 1957; and U.S. Patent 2,553,696, Wilson, issued May 21, 1951 Optionally, but preferred polyethoxyated-polyamme polymers useful for this invention are alkoxylated quaternary diammes of the general formula:

where R is selected from linear or branched C₂-Cι₂ alkylene, C3-C12 hydroxyalkylene, C4-Cι₂ dihydroxyalkylene, Cg-C₁₂ dialkylarylene, [(CH₂CH2θ)_qCH₂CH2]- and -CH₂CH(0H)CH₂0- (CH₂CH₂0)_qCH₂CH(OH)CH ]- where q is from about 1 to about 100. Each Rx is independently selected from C1-C4 alkyl, C -C^ alkylaryl, or A. A is of the formula: (CH-CH₂-0)_nB

I R₃ where R3 is selected from H or C1 -C3 alkyl, n is from about 5 to about 100, and B is selected from H, C1-C4 alkyl, acetyl, or benzoyl; X is a water soluble amon.

In preferred embodiments, R is selected from C4 to Cg alkylene, R\ is selected from C\-

C2 alkyl or C2-C3 hydroxyalkyl, and A is: (CH-CH₂-0)_nH

R3 where R3 is selected from H or methyl, and n is from about 10 to about 50.

In another preferred embodiment R is linear or branched Cg, Rj is methyl, R3 is H, and n is from about 20 to about 50. Additional alkoxylated quaternary polyamme dispersants which can be used in the present invention are of the general formula

where R is selected from linear or branched C₂-C^₂ alkylene, C3-C12 hydroxyalkylene, C4-C12 dihydroxyalkylene, Cg-C₁₂ dialkylarylene, [(CH₂CH₂0)_qCH₂CH₂]- and -CH₂CH(0H)CH₂0- (CH2CH2θ)_qCH₂CH(OH)CH₂]- where q is from about 1 to about 100. If present, Each R\ is independently selected from C1 -C4 alkyl, C7-C12 alkylaryl, or A. Rj may be absent on some nitrogens, however, at least three nitrogens must be quatermzed. A is of the formula:

(CH-CH₂-0)_nB

R3 where R3 is selected from H or C1-C3 alkyl, n is from about 5 to about 100 and B is selected from H, C 1-C4 alkyl, acetyl, or benzoyl; m is from about 0 to about 4, and X is a water soluble amon.

In preferred embodiments, R is selected from C4 to Cg alkylene, Rj is selected from C1 -

C₂ alkyl or C2-C3 hydroxyalkyl, and A is:

(CH-CH₂-0)_nH |

R3 where R3 is selected from H or methyl, and n is from about 10 to about 50; and m is 1.

In another preferred embodiment R is linear or branched Cg, R\ is methyl, R3 is H, and n is from about 20 to about 50, and m is 1. The levels of these polyethoxyated-polyamme polymers used can range from about 0.1% to about 10%, typically from about 0.4% to about 5%, by weight. These polyethoxyated- polyamme polymers can be synthesized following the methods outline in U.S. Patent No 4,664,848, or other ways known to those skilled m the art. Anionic Surfactant - The anionic surfactant component contains alkyl polyethoxylate sulfates and may contain other non-soap anionic surfactants or mixtures thereof.

Generally speaking, anionic surfactants useful herein are disclosed in U.S. Patent No. 4,285,841, Barrat et al, issued August 25, 1981, and m U.S. Patent No. 3,919,678, Laughhn et al, issued December 30, 1975, both incorporated herein by reference.

Useful anionic surfactants include the water-soluble salts, particularly the alkali metal, ammonium and alkylolammomum (e.g., monoethanolammonium or tnethanolammonium) salts, of organic sulfunc reaction products having in their molecular structure an alkyl group containing from about 10 to about 20 carbon atoms and a sulfonic acid or sulfunc acid ester group. (Included in the term "alkyl" is the alkyl portion of aryl groups.) Examples of this group of synthetic surfactants are the alkyl sulfates, especially those obtained by sulfatmg the higher alcohols (Cg-C g carbon atoms) such as those produced by reducing the glycendes of tallow or coconut oil. Especially valuable are linear straight chain alkylbenzene sulfonates in which the average number of carbon atoms m the alkyl group is from about 11 to 13, abbreviated as C_u- C_I3LAS.

Other anionic surfactants herein are the water-soluble salts of alkyl phenol ethylene oxide ether sulfates containing from about 1 to about 4 units of ethylene oxide per molecule and from about 8 to about 12 carbon atoms in the alkyl group.

Other useful anionic surfactants herein include the water-soluble salts of esters of a- sulfonated fatty acids containing from about 6 to 20 carbon atoms in the fatty acid group and from about 1 to 10 carbon atoms in the ester group; water-soluble salts of 2-acyloxy-alkane-l -sulfonic acids containing from about 2 to 9 carbon atoms in the acyl group and from about 9 to about 23 carbon atoms m the alkane moiety; water-soluble salts of olefin sulfonates containing from about

12 to 24 carbon atoms; and b-alkyloxy alkane sulfonates containing from about 1 to 3 carbon atoms m the alkyl group and from about 8 to 20 carbon atoms in the alkane moiety.

The alkyl polyethoxylate sulfates useful herein are of the formula

RO(C₂H₄0)_xS0₃-M⁺ wherein R is an alkyl chain having from about 10 to about 22 carbon atoms, saturated or unsaturated, M is a cation which makes the compound water-soluble, especially an alkali metal, ammonium or substituted ammonium cation, and x averages from about 0.5 to about 15.

Preferred alkyl sulfate surfactants are the non-ethoxylated Cι₂-15 pnmary and secondary alkyl sulfates. Under cold water washing conditions, i.e., less than abut 65°F (18.3°C), it is preferred that there be a mixture of such ethoxylated and non-ethoxylated alkyl sulfates. Fatty Acids - Moreover, the anionic surfactant component herein compnses fatty acids.

These include saturated and/or unsaturated fatty acids obtained from natural sources or synthetically prepared. Examples of fatty acids include capnc, launc, myπstic, palmitic, steaπc, arachidic, and behenic acid. Other fatty acids include palmitoleic, oleic, lmoleic, hnolenic, and ncmoleic acid.

Noniomc Detergent Surfactants - Suitable noniomc detergent surfactants are generally disclosed m U.S. Patent 3,929,678, Laughhn et al., issued December 30, 1975, and U.S. Patent No. 4,285,841, Barrat et al, issued August 25, 1981. Exemplary, non-limiting classes of useful noniomc surfactants include: Cg-Cjg alkyl ethoxylates ("AE"), with EO about 1-22, including the so-called narrow peaked alkyl ethoxylates and Cg-Cj2 alkyl phenol alkoxylates (especially ethoxylates and mixed ethoxy/propoxy), alkyl dialkyl amine oxide, alkanoyl glucose amide, and mixtures thereof.

If noniomc surfactants are used, the compositions of the present invention will preferably contain up to about 10%, preferably from 0% to about 5%, more preferably from 0% to about 3%, by weight of an noniomc surfactant. Preferred are the ethoxylated alcohols and ethoxylated alkyl phenols of the formula R(0C2H4)_n0H, wherein R is selected from the group consisting of aliphatic hydrocarbon radicals containing from about 8 to about 15 carbon atoms and alkyl phenyl radicals in which the alkyl groups contain from about 8 to about 12 carbon atoms, and the average value of n is from about 5 to about 15. These surfactants are more fully descnbed m U.S. Patent No. 4,284,532, Leikhim et al, issued August 18, 1981. Particularly preferred are ethoxylated alcohols having an average of from about 10 to abut 15 carbon atoms m the alcohol and an average degree of ethoxylation of from about 6 to about 12 moles of ethylene oxide per mole of alcohol.

Other noniomc surfactants for use herein include: The polyethylene, polypropylene, and polybutylene oxide condensates of alkyl phenols.

In general, the polyethylene oxide condensates are preferred. These compounds include the condensation products of alkyl phenols having an alkyl group containing from about 6 to about 12 carbon atoms in either a straight chain or branched chain configuration with the alkylene oxide. In a preferred embodiment, the ethylene oxide is present in an amount equal to from about 5 to about 25 moles of ethylene oxide per mole of alkyl phenol. Commercially available noniomc surfactants of this type include Igepal® CO-630, marketed by the GAF Corporation; and Tnton® X-45, X-l 14, X-100, and X-102, all marketed by the Rohm & Haas Company. These compounds are commonly referred to as alkyl phenol alkoxylates, (e g.. alkyl phenol ethoxylates). The condensation products of aliphatic alcohols with from about 1 to about 25 moles of ethylene oxide The alkyl chain of the aliphatic alcohol can either be straight or branched, primary or secondary, and generally contains from about 8 to about 22 carbon atoms. Particularly preferred are the condensation products of alcohols having an alkyl group containing from about 10 to about 20 carbon atoms with from about 2 to about 18 moles of ethylene oxide per mole of alcohol. Examples of commercially available noniomc surfactants of this type include Tergitol® 15-S-9 (the condensation product of Ci 1-C15 linear secondary alcohol with 9 moles ethylene oxide), Tergitol® 24-L-6 NMW (the condensation product of C12-C14 pnmary alcohol with 6 moles ethylene oxide with a narrow molecular weight distnbution), both marketed by Union Carbide Corporation; Neodol® 45-9 (the condensation product of CJ4-C15 linear alcohol with 9 moles of ethylene oxide), Neodol® 23-6.5 (the condensation product of C12-C13 linear alcohol with 6.5 moles of ethylene oxide), Neodol® 45-7 (the condensation product of C14-C15 linear alcohol with 7 moles of ethylene oxide), Neodol® 45-4 (the condensation product of C14-C15 linear alcohol with 4 moles of ethylene oxide), marketed by Shell Chemical Company, and Kyro® EOB (the condensation product of C13-C15 alcohol with 9 moles ethylene oxide), marketed by The Procter & Gamble Company. Other commercially available noniomc surfactants include Dobanol 91-8® marketed by Shell Chemical Co. and Genapol UD-080® marketed by Hoechst. This category of noniomc surfactant is referred to generally as "alkyl ethoxylates." The condensation products of ethylene oxide with a hydrophobic base formed by the condensation of propylene oxide with propylene glycol. The hydrophobic portion of these compounds preferably has a molecular weight of from about 1500 to about 1800 and exhibits water insolubility. The addition of polyoxyethylene moieties to this hydrophobic portion tends to increase the water solubility of the molecule as a whole, and the liquid character of the product is retained up to the point where the polyoxyethylene content is about 50% of the total weight of the condensation product, which corresponds to condensation with up to about 40 moles of ethylene oxide. Examples of compounds of this type include certain of the commercially-available

Pluronic® surfactants, marketed by BASF.

The condensation products of ethylene oxide with the product resulting from the reaction of propylene oxide and ethylenediamme. The hydrophobic moiety of these products consists of the reaction product of ethylenediamme and excess propylene oxide, and generally has a molecular weight of from about 2500 to about 3000. This hydrophobic moiety is condensed with ethylene oxide to the extent that the condensation product contains from about 40% to about 80% by weight of polyoxyethylene and has a molecular weight of from about 5,000 to about 11,000 Examples of this type of noniomc surfactant include certain of the commercially available Tetromc® compounds, marketed by BASF.

Semi-polar noniomc surfactants are a special category of noniomc surfactants which include water-soluble amme oxides containing one alkyl moiety of from about 10 to about 18 carbon atoms and 2 moieties selected from the group consisting of alkyl groups and hydroxyalkyl groups containing from about 1 to about 3 carbon atoms; water-soluble phosphme oxides containing one alkyl moiety of from about 10 to about 18 carbon atoms and 2 moieties selected from the group consisting of alkyl groups and hydroxyalkyl groups containing from about 1 to about 3 carbon atoms; and water-soluble sulfoxides containing one alkyl moiety of from about 10 to about 18 carbon atoms and a moiety selected from the group consisting of alkyl and hydroxyalkyl moieties of from about 1 to about 3 carbon atoms. Semi-polar noniomc detergent surfactants include the amine oxide surfactants having the formula

O

R3(OR⁴)_xN(R5)₂ wherein R³ is an alkyl, hydroxyalkyl, or alkyl phenyl group or mixtures thereof containing from about 8 to about 22 carbon atoms; R⁴ is an alkylene or hydroxyalkylene group containing from about 2 to about 3 carbon atoms or mixtures thereof; x is from 0 to about 3; and each R^ is an alkyl or hydroxyalkyl group containing from about 1 to about 3 carbon atoms or a polyethylene oxide group containing from about 1 to about 3 ethylene oxide groups. The R^ groups can be attached to each other, e.g., through an oxygen or nitrogen atom, to form a nng structure.

These amine oxide surfactants in particular include CjQ- i alkyl dimethyl amine oxides and C -Cj2 alkoxy ethyl dihydroxy ethyl amme oxides.

Alkylpolysacchandes disclosed in U.S. Patent 4,565,647, Llenado, issued January 21, 1986, having a hydrophobic group containing from about 6 to about 30 carbon atoms, preferably from about 10 to about 16 carbon atoms and a polysacchande, e.g., a polyglycoside, hydrophilic group containing from about 1.3 to about 10, preferably from about 1.3 to about 3, most preferably from about 1.3 to about 2.7 sacchande units. Any reducing sacchaπde containing 5 or 6 carbon atoms can be used, e.g., glucose, galactose and galactosyl moieties can be substituted for the glucosyl moieties (Optionally the hydrophobic group is attached at the 2-, 3-, 4-, etc. positions thus giving a glucose or galactose as opposed to a glucoside or galactoside.) The lntersacchaπde bonds can be, e.g., between the one position of the additional sacchaπde units and the 2-, 3-, 4-, and or 6- positions on the preceding sacchande units. Optionally, and less desirably, there can be a polyalkylene-oxide chain joining the hydrophobic moiety and the polysacchande moiety. The preferred alkyleneoxide is ethylene oxide. Typical hydrophobic groups include alkyl groups, either saturated or unsaturated, branched or unbranched containing from about 8 to about 18, preferably from about 10 to about 16, carbon atoms. Preferably, the alkyl group is a straight chain saturated alkyl group. The alkyl group can contain up to about 3 hydroxy groups and/or the polyalkyleneoxide chain can contain up to about 10, preferably less than 5, alkyleneoxide moieties. Suitable alkyl polysacchandes are octyl, nonyl, decyl, undecyldodecyl, tπdecyl, tetradecyl, pentadecyl, hexadecyl, heptadecyl, and octadecyl, di-, tn-, tetra-, penta-, and hexaglucosides, galactosides, lactosides, glucoses, fructosides, fructoses and or galactoses. Suitable mixtures include coconut alkyl, di-, tn-, tetra-, and pentaglucosides and tallow alkyl tetra-, penta-, and hexa-glucosides. The preferred alkylpolyglycosides have the formula

R2θ(C_nH_2nO)_t(glycosyl)_x wherein R² is selected from the group consisting of alkyl, alkyl-phenyl, hydroxyalkyl, hydroxyalkylphenyl, and mixtures thereof in which the alkyl groups contain from about 10 to about 18, preferably from about 12 to about 14, carbon atoms; n is 2 or 3, preferably 2; t is from 0 to about 10, preferably 0; and x is from about 1.3 to about 10, preferably from about 1.3 to about 3, most preferably from about 1.3 to about 2.7. The glycosyl is preferably denved from glucose. To prepare these compounds, the alcohol or alkylpolyethoxy alcohol is formed first and then reacted with glucose, or a source of glucose, to form the glucoside (attachment at the 1 -position). The additional glycosyl units can then be attached between their 1 -position and the preceding glycosyl units 2-, 3-, 4- and/or 6-posιtιon, preferably predominantly the 2-posιtιon. Fatty acid amide surfactants having the formula: O

R⁶-C-N(R⁷)₂ wherein R" is an alkyl group containing from about 7 to about 21 (preferably from about 9 to about 17) carbon atoms and each R⁷ is selected from the group consisting of hydrogen, C1-C4 alkyl, C1-C4 hydroxyalkyl, and -(C²H4θ)_xH where x vanes from about 1 to about 3.

Preferred amides are Cg-C20 ammonia amides, monoethanolamides, dietha-nolamides, and isopropanolamides.

Cationic/amphotenc - Non-quaternary, cationic detersive surfactants can also be included in detergent compositions of the present invention. Cationic surfactants useful herein are descπbed in U.S. Patent 4,228,044, Cambre, issued October 14, 1980.

Ampholytic surfactants can be incorporated into the detergent compositions hereof. These surfactants can be broadly descπbed as aliphatic denvatives of secondary or tertiary amines, or aliphatic denvatives of heterocyc c secondary and tertiary ammes in which the aliphatic radical can be straight chain or branched. One of the aliphatic substituents contains at least about 8 carbon atoms, typically from about 8 to about 18 carbon atoms, and at least one contains an anionic water-solubihzmg group, e.g., carboxy, sulfonate, sulfate. See U.S. Patent No. 3,929,678 to Laughlin et al., issued December 30, 1975 at column 19, lines 18-35 for examples of ampholytic surfactants. Preferred amphotenc include C12 -C_jg alkyl ethoxylates

("AE") including the so-called narrow peaked alkyl ethoxylates and Cg-C^ alkyl phenol alkoxylates (especially ethoxylates and mixed ethoxy/propoxy), C^-Cjg betames and sulfobetames ("sultames"), Ci_Q-C_jg amme oxides, and mixtures thereof. Polyhydroxy Fatty Acid Amide Surfactant - The detergent compositions hereof may also contain polyhydroxy fatty acid amide surfactant. The polyhydroxy fatty acid amide surfactant component compπses compounds of the structural formula:

O R¹

R² - C - N - Z wherein: R* IS H, C1-C4 hydrocarbyl, 2-hydroxy ethyl, 2-hydroxy propyl, or a mixture thereof, preferably C1-C4 alkyl, more preferably C or C2 alkyl, most preferably Cj alkyl (i.e., methyl), and R² is a C5-C31 hydrocarbyl, preferably straight chain C7-C19 alkyl or alkenyl, more preferably straight chain C9-C17 alkyl or alkenyl, most preferably straight chain C11-C15 alkyl or alkenyl, or mixtures thereof; and Z is a polyhydroxyhydrocarbyl having a linear hydrocarbyl chain with at least 3 hydroxyls directly connected to the chain, or an alkoxylated derivative (preferably ethoxylated or propoxylated) thereof. Z preferably will be deπved from a reducing sugar in a reductive animation reaction; more preferably Z will be a glycityl. Suitable reducing sugars include glucose, fructose, maltose, lactose,- galactose, mannose, and xylose. As raw materials, high dextrose corn syrup, high fructose corn syrup, and high maltose corn syrup can be utilized as well as the individual sugars listed above. These corn syrups may yield a mix of sugar components for Z. It should be understood that it is by no means intended to exclude other suitable raw mateπals. Z preferably will be selected from the group consisting of -CH2- (CHOH)_n-CH₂OH, -CH(CH₂OH)-(CHOH)_n.₁ -CH₂OH, -CH₂-(CHOH)₂(CHOR')(CHOH)- CH2OH, and alkoxylated denvatives thereof, where n is an integer from 3 to 5, inclusive, and R' is H or a cyclic or aliphatic monosacchande Most preferred are glycityls wherein n is 4, particularly -CH₂-(CHOH)₄-CH₂OH.

R can be, for example, N-methyl, N-ethyl, N-propyl, N-isopropyl, N-butyl, N-2 -hydroxy ethyl, or N-2 -hydroxy propyl.

R -CO-N< can be, for example, cocamide, steararmde, oleamide, lauramide, myπstamide, capncamide, palmitamide, tallowamide, etc.

Z can be 1-deoxyglucιtyl, 2-deoxyfructιtyl, 1-deoxymaltιtyl, 1-deoxylactιtyl, 1- deoxygalactityl, 1-deoxymannιtyl, 1-deoxymaltotπotιtyl, etc.

Methods for making polyhydroxy fatty acid amides are known in the art. In general, they can be made by reacting an alkyl amine with a reducing sugar in a reductive animation reaction to form a corresponding N-alkyl polyhydroxyamme, and then reacting the N-alkyl polyhydroxyamme with a fatty aliphatic ester or tnglyceπde in a condensation/amidation step to form the N-alkyl, N-polyhydroxy fatty acid amide product. Processes for making compositions containing polyhydroxy fatty acid amides are disclosed, for example, in G.B. Patent Specification 809,060, published February 18, 1959, by Thomas Hedley & Co., Ltd., U.S. Patent 2,965,576, issued December 20, 1960 to E. R. Wilson, and U S. Patent 2,703,798, Anthony M. Schwartz, issued March 8, 1955, and U.S. Patent 1,985,424, issued December 25, 1934 to Piggott, each of which is incorporated herein by reference. B. Granular and/or Powder Laundry Detergent Compositions

Granular and/or powder laundry detergent compositions preferably compπse, in addition to the particulate solids of the present invention, one or more cleaning adjunct mateπals as described herein. DETERGENT INGREDIENTS (CLEANING ADJUNCT MATERIALS) The laundry detergent compositions of the present invention as descπbed hereinbefore may optionally include, in addition to the particulate solids of the present invention, cleaning adjunct materials descπbed below.

Biodegradablv branched surfactants The present invention includes important embodiments compnsmg at least one biodegradably branched and/or crystallmity disrupted and/or mid-cham branched surfactant or surfactant mixture. The terms "biodegradably branched" and/or "crystallmity disrupted" and/or "mid-cham branched" (acronym "MCB" used hereinafter) indicate that such surfactants or surfactant mixtures are charactenzed by the presence of surfactant molecules having a moderately non-linear hydrophobe; more particularly, wherein the surfactant hydrophobe is not completely linear, on one hand, nor is it branched to an extent that would result m unacceptable biodegradation. The preferred biodegradably branched surfactants are distinct from the known commercial LAS, ABS, Exxal, Lial, etc. types, whether branched or unbranched. The biodegradably branched mateπals compπse particularly positioned light branching, for example from about one to about three methyl, and/or ethyl, and/or propyl or and/or butyl branches in the hydrophobe, wherein the branching is located remotely from the surfactant headgroup, preferably toward the middle of the hydrophobe. Typically from one to three such branches can be present on a single hydrophobe, preferably only one. Such biodegradably branched surfactants can have exclusively linear aliphatic hydrophobes, or the hydrophobes can include cycloahphatic or aromatic substitution. Highly preferred are MCB analogs of common linear alkyl sulfate, linear alkyl poly(alkoxylate) and linear alkylbenzenesulfonate surfactants, said surfactant suitably being selected from mιd-cham-C C₄-branched C₈-Cι₈-alkyl sulfates, mιd-cham-C C4-branched C₈-Cι₈- alkyl ethoxylated, propoxylated or butoxylated alcohols, mιd-chaιn-Cι-C₄-branched C₈-C₁₈-alkyl ethoxysulfates, mιd-chaιn-Cι-C₄-branched C₈-Cι₆-alkyl benzenesulfonates and mixtures thereof When anionic, the surfactants can in general be in acid or salt, for example sodium, potassium, ammonium or substituted ammonium, form. The biodegradably branched surfactants offer substantial improvements in cleaning performance and/or usefulness in cold water and/or resistance to water hardness and/or economy of utilization. Such surfactants can, general, belong to any known class of surfactants, e.g., anionic, noniomc, cationic, or zwitteπonic. The biodegradably branched surfactants are synthesized through processes of Procter & Gamble, Shell, and Sasol. These surfactants are more fully disclosed m W098/23712 A published 06/04/98; W097/38957 A published 10/23/97; W097/38956 A published 10/23/97, WO97/39091 A published 10/23/97; WO97/39089 A published 10/23/97; WO97/39088 A published 10/23/97; WO97/39087 Al published 10/23/97, W097/38972 A published 10/23/97, WO 98/23566 A Shell, published 06/04/98, technical bulletins of Sasol, and the following pending patent applications assigned to Procter & Gamble:

Preferred biodegradably branched surfactants herein m more detail include MCB surfactants as disclosed in the following references: W098/23712 A published 06/04/98 includes disclosure of MCB noniomc surfactants including MCB pnmary alkyl polyoxyalkylenes of formula (1):

CH₃CH₂(CH₂)_wC(R)H(CH₂)_xC(R¹)H(CH₂)_yC(R²)H(CH₂)_z(EO/PO)_mOH (1), where the total number of carbon atoms in the branched pnmary alkyl moiety of this formula, including the R, R¹ and R² branching, but not including the carbon atoms m the EO/PO alkoxy moiety, is preferably 14-20, and wherein further for this surfactant mixture, the average total number of carbon atoms in the MCB pnmary alkyl hydrophobe moiety is preferably 14.5-17.5, more preferably 15-17; R, R¹ and R² are each independently selected from hydrogen and 1-3C alkyl, preferably methyl, provided R, R¹ and R² are not all hydrogen and, when z is 1 , at least R or R¹ is not hydrogen; w is an integer of 0-13; x is an integer of 0-13; y is an integer of 0-13; z is an integer of at least 1; w+x+y+z is 8-14; and EO/PO are alkoxy moieties preferably selected from ethoxy, propoxy and mixed ethoxy/propoxy groups, where m is at least 1, preferably 3-30, more preferably 5-20, most preferably 5-15. Such MCB nomonics can alternately include butylene oxide deπved moieties, and the -OH moiety can be replaced by any of the well-known end-capping moieties used for conventional noniomc surfactants. W097/38957 A published 10/23/97 includes disclosure of mid- to near-mid-chain branched alcohols of formulae R-CH₂CH₂CH(Me)CH-R¹-CH₂OH (I) and H0CH₂-R-CH₂-CH₂- CH(Me)-R' (II) compnsmg: (A) dimensmg alpha -olefins of formula RCH=CH₂ and R'CH=CH₂ to form olefins of formula R(CH₂)₂-C(R')=CH₂ and R'(CH₂)₂-C(R)=CH₂; (B) (I) lsomeπsmg the olefins and then reacting them with carbon monoxide/hydrogen under Oxo conditions or (n) directly reacting the olefins from step (A) with CO/H₂ under Oxo conditions. In the above formulae, R, R¹ = 3-7C linear alkyl. W097/38957 A also discloses (l) production of MCB alkyl sulphate surfactants by sulphatmg (I) or (II); (n) preparation of MCB alkylethoxy sulphates which compnses ethoxylatmg and then sulphatmg (I) or (II); (in) preparation of MCB alkyl carboxylate surfactants which compnses oxidising (I) or (II) or their aldehyde intermediates and (iv) preparation of MCB acyl taurate, MCB acyl isethionate, MCB acyl sarcosinate or MCB acyl N-methylglucamide surfactants using the branched alkyl carboxylates as feedstock.

W097/38956 A published 10/23/97 discloses the preparation of mid- to near mid-cham branched alpha olefins which is effected by: (a) prepanng a mixture of carbon monoxide and hydrogen; (b) reacting this mixture in the presence of a catalyst under Fischer-Tropsch conditions to prepare a hydrocarbon mixture compnsmg the descnbed olefins; and (c) separating the olefins from the hydrocarbon mixture W097/38956 A further discloses the preparation of mid- to near mid-cham branched alcohols by reacting the olefins descnbed with CO/H₂ under Oxo conditions. These alcohols can be used to prepare (1) MCB sulphate surfactants by sulphatmg the alcohols, (2) MCB alkyl ethoxy sulphates by ethoxylating, then sulphatmg, the alcohols; or (3) branched alkyl carboxylate surfactants by oxidising the alcohols or their aldehyde intermediates. The branched carboxylates formed can be used as a feedstock to prepare branched acyl taurate, acyl isethionate, acyl sarcosinate or acyl N-methylglucamide surfactants, etc.

WO97/39091 A published 10/23/97 includes disclosure of a detergent surfactant composition compnsmg at least 0.5 ( especially 5, more especially 10, most especially 20) wt% of longer alkyl chain, MCB surfactant of formula (I). A-X-B (I) wherein A is a 9-22 (especially 12-18) C MCB alkyl hydrophobe having: (l) a longest linear C chain attached to the X-B moiety of 8-21 C atoms; (n) 1-3C alkyl moιety(s) branching from this longest lmear chain; (in) at least one of the branching alkyl moieties attached directly to a C of the longest linear C chain at a position withm the range of position 2 C, counting from C 1 which is attached to the CH₂B moiety, to the omega-2 carbon (the terminal C minus 2C); and (iv) the surfactant composition has an average total number of C atoms m the A-X moiety of 14.5-17.5 ( especially 15-17); and B is a hydrophilic (surfactant head-group) moiety preferably selected from sulfates, sulfonates, polyoxyalkylene ( especially polyoxyethylene or polyoxypropylene), alkoxylated sulphates, polyhydroxy moieties, phosphate esters, glycerol sulphonates, polygluconates, polyphosphate esters, phosphonates, sulphosuccmates, sulphosuccinates, polyalkoxylated carboxylates, glucamides, tauπnates, sarcosinates, glycinates, lsethionates, mono-/dι-alkanol-amιdes, monoalkanolamide sulphates, diglycol-amide and their sulphates, glyceryl esters and their sulphates, glycerol ethers and their sulphates, polyglycerol ether and their sulphates, sorbitan esters, polyalkoxylated sorbitan esters, ammonio-alkane-sulphonates, amidopropyl betames, alkylated quat, alkylated/poly-hydroxyalkylated (oxypropyl) quat., lmidazolmes, 2-yl succmates, sulphonated alkyl esters and sulphonated fatty acids; and X- is -CH₂- or -C(O)-. WO97/39091 A also discloses a laundry detergent or other cleaning composition compnsmg: (a) 0.001-99% of detergent surfactant (I); and (b) 1 - 99.999% of adjunct ingredients. WO97/39089 A published 10/23/97 includes disclosure of liquid cleaning compositions compnsmg: (a) as part of surfactant system 0.1-50 (especially 1-40) wt % of a mid-chain branched surfactant of formula (I); (b) as the other part of the surfactant system 0 1-50 wt% of co-surfactant(s), (c) 1-99.7 wt% of a solvent; and (d) 0.1-75 wt% of adjunct ingredients. Formula (I) is A-CH₂-B wherein A = 9-22 (especially 12-18) C MCB alkyl hydrophobe having: (I) a longest linear C chain attached to the X-B moiety of 8-21C atoms; (n) 1-3C alkyl moιety(s) branching from this longest linear chain; (in) at least one of the branching alkyl moieties attached directly to a C of the longest linear C chain at a position withm the range of position 2 C, counting from Carbon No. 1 which is attached to the CH₂B moiety, to the omega-2 carbon (the terminal C minus 2C); and (iv) the surfactant composition has an average total number of C atoms in the A-X moiety of 14.5-17.5 ( especially 15-17); and B is a hydrophilic moiety selected from sulphates, polyoxyalkylene (especially polyoxyethylene and polyoxypropylene) and alkoxylated sulphates.

WO97/39088 A published 10/23/97 includes disclosure of a surfactant composition compnsmg 0.001 - 100%> of MCB pnmary alkyl alkoxylated sulphate(s) of formula (I):

CH₃CH₂(CH)_wCHR(CH₂)_xCHR¹(CH₂)_yCHR²(CH₂)_zOS0₃M (I) wherein the total number of C atoms in compound (I) including R, R¹ and R², is preferably 14-20 and the total number of C atoms in the branched alkyl moieties preferably averages 14.5-17.5 (especially 15-17); R, R¹ and R² are selected from H and 1-3C alkyl ( especially Me) provided R, R¹ and R² are not all H; when z = 1 at least R or R¹ is not H; M are cations especially selected from Na, K, Ca, Mg, quaternary alkyl ammonium of formula NTI'RVR⁶ (II); M is especially Na and or K; R³, R⁴, R⁵, R⁶ are selected from H, 1-22C alkylene, 4-22C branched alkylene, 1-6C alkanol, 1-22C alkenylene, and/or 4-22C branched alkenylene; w, x, y = 0-13; z is at least 1; w+x+y+z = 8-14. WO97/39088 A also discloses (1) a surfactant composition compnsmg a mixture of branched pnmary alkyl sulphates of formula (I) as above. M is a water-soluble cation; When R² is 1-3C alkyl, the ratio of surfactants having z = 1 to surfactants having z = 2 or greater is preferably at least 1:1 ( most especially 1: 100); (2) a detergent composition compnsmg: (a) 0.001-99% of MCB pnmary alkyl alkoxylated sulphate of formula (IB) and or (IV). CH₃(CH₂)_aCH(CH₃)(CH₂)_bCH₂OS0₃M (m) CH₃(CH₂)_dCH(CH₃χCH₂)_eCH(CH₃)CH₂OS0₃M (IV) wherein a, b, d, and e are integers, preferably a+b = 10-16, d+e = 8-14 and when a+b = 10, a = 2-9 and b = 1-8; when a+b = 11, a = 2-10 and b = 1-9; when a+b = 12, a = 2-11 and b = 1-10; when a+b = 13, a = 2-12 and b = 1-11; when a+b = 14, a = 2-13 and b = 1-12; when a+B = 15, a = 2-14 and b = 1-13; when a+b = 16, a = 2-14 and b = 1-14; when d+e = 8, d = 2-7 and e = 1-6; when d+e = 9, d = 2-8 and e = 1-7; when d+e = 10, d = 2-9 and e = 1-8; when d+e = 11, d = 2-10 and e = 1-9; when d+e = 12, d = 2-11 and e = 1-10; when d+e = 13, d = 2-12 and e = 1-11; when d+e = 14, d = 2-13 and e = 1-12; and (b) 1- 99.99 wt% of detergent adjuncts; (3) a mid-cham branched pnmary alkyl sulphate surfactant of formula(V):

CH₃CH₂(CH₂)_xCHR'(CH₂)_yCHR²(CH₂)_zOS0₃M (V) wherein x, y = 0-12; z is at least 2; x+y+z = 11-14, R¹ and R² are not both H; when one of R¹ or R² is H, and the other is Me, x + y +z is not 12 or 13; and when R¹ is H and R² is Me, x + y is not 11 when z = 3 and x + y is not 9 when z = 5; (4) Alkyl sulphates of formula (III) in which a and b are integers and a = b = 12 or 13, a = 2- 1 1, b = 1-10 and M is Na, K, and optionally substituted ammonium; (5) alkyl sulphates of formula (IV) in which d and e are integers and d = e is 10 or 11 and when d = e is 10, d = 2-9 and e = 1-8; when d = e = 1 1, d = 2-10 and e = 1-9 and m is Na, K, optionally substituted ammonium ( especially Na); (6) methyl branched pnmary alkyl sulphates selected from 3-, 4- 5-, 6-, 1-, 8-, 9-, 10-, 1 1-, 12- or 13- methyl pentadecanol sulphate; 3-, 4-, 5-, 6-, 7-, 8-, 9-, 10-, 11-, 12-, 13-, or 14- methyl hexadecanol sulphate; 2,3-, 2,4-, 2,5-, 2,6-, 2,7-, 2,8-, 2,9-, 2,10-, 2,11-, 2,12-methyl tetradecanol sulphate; 2,3-, 2,4-, 2,5-, 2,6-, 2,7-, 2,8-, 2,9-, 2,10-, 2,1 1-, 2,12-, or 2,13- methyl pentadecanol sulphate and/or mixtures of these compounds.

WO97/39087 A published 10/23/97 includes disclosure of a surfactant composition compnsmg 0.001-100% of mid-cham branched pnmary alkyl alkoxylated sulphate(s) of formula (I) wherein that total number of C atoms in compound (I) including R, R¹ and R³, but not including C atoms of EO/PO alkoxy moieties is 14-20 and the total number of C atoms m branched alkyl moieties averages 14.5-17.5 (especially 15-17); R, RI and R2 = H or 1-3C alkyl ( especially Me) and R, R¹ and R² are not all H; when z = 1 at least R or R¹ is not H; M = cations especially selected from Na, K, Ca, Mg, quaternary alkyl ammes of formula (II) ( M is especially Na and/or K) R³, R⁴, R⁵, R⁶ = H, 1-22C alkylene, 4-22C branched alkylene, 1-6C alkanol, 1-22C alkenylene, and or 4-22C branched alkenylene; w, x, y = 0-13; z is at least 1; w+x+y+z = 8-14; EO/PO are alkoxy moieties, especially ethoxy and/or propoxy; m is at least 0.01, especially 0.1- 30, more especially 0.5-10, most especially 1-5. Also disclosed are: (1) a surfactant composition compnsmg a mixture of branched pnmary alkyl alkoxylated sulphates of formula (I) When R² = 1-3C alkyl, the ratio of surfactants having z = 2 or greater to surfactant having z = 1 is at least 1 : 1, especially 1.5: 1, more especially 3: 1, most especially 4: 1; (2) a detergent composition compnsmg: (a) 0.001-99% of mid-cham branched pnmary alkyl alkoxylated sulphate of formula (HI) and/or (IV) M is as above; a, b, d, and e are integers, a+b = 10-16, d+e = 8-14 and when a+b = 10, a = 2-9 and b = 1-8; when a+b = 11, a = 2-10 and b = 1-9; when a+b = 12, a = 2-1 1 and b = 1-10; when a+b = 13, a = 2-12 and b = 1-1 1 ; when a+b = 14, a = 2-13 and b = 1-12; when a+b = 15, a = 2-14 and b = 1-13; when a+b = 16, a = 2-14 and b = 1-14; when d+e = 8, d = 2-7 and e = 1-6; when d+e = 9, d = 2-8 and e = 1-7; when d+e = 10, d = 2-9 and e = 1-8; when d+e = 11, d = 2-10 and e = 1-9; when d+e = 12, d = 2-11 and e = 1-10; when d+e = 13, d = 2-12 and e = 1-11; when d+e = 14, d = 2-13 and e = 1-12; and (b) 1-99 99 wt% of detergent adjuncts; (3) a MCB pnmary alkyl alkoxylated sulphate surfactant of formula(V) RI, R2, M, EO/PO, m as above; x,y = 0-12; z is at least 2; x+y+z = 11-14; (4) a mid-chain branched alkyl alkoxylated sulphate of formula (DI) in which: a = 2-1 1; b = 1-10; a+b = 12 or 13; M, EO/PO and m are as above; (5) a mid-cham branched alkyl alkoxylated sulphate compound of formula (IV) m which- d+e = 10 or 11; when d+e = 10, d = 2-9 and e = 1-8 and when d+e = 11, d = 2-10 and e = 1-9; M is as above ( especially Na), EO/PO and m are as above; and (6) methyl branched pnmary alkyl ethoxylated sulphates selected from 3-, 4- 5-, 6-, 7-, 8-, 9-, 10-, 11-, 12- or 13- methyl pentadecanol ethoxylated sulphate; 3-, 4-, 5-, 6-, 7-, 8-, 9-, 10-, 11-, 12-, 13-, or 14- methyl hexadecanol ethoxylated sulphate; 2,3-, 2,4-, 2,5-, 2,6-, 2,7-, 2,8-, 2,9-, 2,10-, 2,11-, 2,12-methyl tetradecanol ethoxylated sulphate; 2,3-, 2,4-, 2,5-, 2,6-, 2,7-, 2,8-, 2,9-, 2,10-, 2,11-, 2,12-, or 2,13- methyl pentadecanol ethoxylated sulphate and/or mixtures of these compounds. The compounds are ethoxylated with average degree of ethoxylation of 0.1-10.

W097/38972 A published 10/23/97 includes disclosure of a method for manufactunng longer chain alkyl sulphate surfactant mixture compositions compnsmg (a) sulphatmg with S0₃, preferably in a falling film reactor, a long chain aliphatic alcohol mixture having an average carbon chain length of at least 14.5-17.5, the alcohol mixture compnsmg at least 10%, preferably at least 25%, more preferably at least 50% still more preferably at least 75%, most preferably at least 95% of a MCB aliphatic alcohol having formula (I); where: R,R',R² = H or 1-3C alkyl, preferably methyl, provided R, R¹ and R² are not all H, and when z = 1, at least R or R¹ is not H; w,x,y = integers 0-13; z = integer of at least 1; and w+x+y+z = 8-14; where the total number of carbon atoms in the branched pnmary, alkyl moiety of formula (I), including the R, R' and R² branching, is 14-20, and where further for the alcohol mixture the average total number of carbon atoms in the branched pnmary alkyl moieties having foπnula (I) is > 14.5-17.5, preferably, >15- 17; and (b) neutralising the alkyl sulphate acid produced by step (a), preferably using a base selected from KOH, NaOH, ammonia, monoethanolamme, tπethanolamme and mixtures of these. Also disclosed is a method for manufactunng longer chain alkyl alkoxylated sulphate surfactant mixture compositions, compnsmg alkoxylatmg the specified long chain aliphatic alcohol mixture; sulphatmg the resulting polyoxyalkylene alcohol with S0₃; and neutralising the resulting alkyl alkoxylate sulphate acid. Alternatively, the alkyl alkoxylated sulphates may be produced directly from the polyoxyalkylene alcohol by sulphatmg with S0₃ and neutralising.

WO 98/23566 A Shell, published 06/04/98 discloses branched pnmary alcohol compositions having 8-36 C atoms and an average number of branches per mol of 0.7-3 and compnsmg ethyl and methyl branches. Also disclosed are- (1) a branched pnmary alkoxylate composition preparable by reacting a branched pnmary alcohol composition as above with an oxirane compound; (2) a branched pnmary alcohol sulphate preparable by sulphatmg a pnmary alcohol composition as above; (3) a branched alkoxylated pnmary alcohol sulphate preparable by alkoxylatmg and sulphatmg a branched alcohol composition as above; (4) a branched pnmary alcohol carboxylate preparable by oxidising a branched pnmary alcohol composition as above, (5) a detergent composition compnsmg: (a) surfactant(s) selected from branched pnmary alcohol alkoxylates as in (1), branched primary alcohol sulphates as in (2), and branched alkoxylated pnmary alcohol sulphates as in (3); (b) a builder; and (c) optionally addιtιve(s) selected from foam control agents, enzymes, bleaching agents, bleach activators, optical bnghteners, co- builders, hydrotropes and stabilisers. The pnmary alcohol composition, and the sulphates, alkoxylates, alkoxy sulphates and carboxylates prepared from them exhibit good cold water detergency and biodegradabihty. Biodegradably branched surfactants useful herein also include the modified alkylaromatic, especially modified alkylbenzenesulfonate surfactants descnbed in copendmg commonly assigned patent applications (P&G Case Nos. 7303P, 7304P). In more detail, these surfactants include (P&G Case 6766P) alkylarylsulfonate surfactant systems compnsmg from about 10% to about 100% by weight of said surfactant system of two or more crystalhmty- disrupted alkylarylsulfonate surfactants of formula (B-Ar-D)_a(M⁽l wherein D is SO3", M is a cation or cation mixture, q is the valence of said cation, a and b are numbers selected such that said composition is electroneutral; Ar is selected from benzene, toluene, and combinations thereof; and B compnses the sum of at least one pnmary hydrocarbyl moiety containing from 5 to 20 carbon atoms and one or more crystallmity-disrupting moieties wherein said crystalhnity- disrupting moieties interrupt or branch from said hydrocarbyl moiety; and wherein said alkylarylsulfonate surfactant system has crystallmity disruption to the extent that its Sodium Cπtical Solubility Temperature, as measured by the CST Test, is no more than about 40°C and wherein further said alkylarylsulfonate surfactant system has at least one of the following properties: percentage biodegradation, as measured by the modified SCAS test, that exceeds tetrapropylene benzene sulfonate; and weight ratio of nonquatemary to quaternary carbon atoms in B of at least about 5: 1.

Such compositions also include (P&G Case 7303P) surfactant mixtures compnsmg (preferably, consisting essentially of): (a) from about 60% to about 95% by weight (preferably from about 65% to about 90%, more preferably from about 70% to about 85%) of a mixture of branched alkylbenzenesulfonates having formula (I)

(D wherein L is an acyclic aliphatic moiety consisting of carbon and hydrogen and having two methyl termini, and wherein said mixture of branched alkylbenzenesulfonates contains two or more (preferably at least three, optionally more) of said compounds diffeπng in molecular weight of the amon of said formula (I) and wherein said mixture of branched alkylbenzenesulfonates is characteπzed by an average carbon content of from about 10.0 to about 14.0 carbon atoms (preferably from about 11.0 to about 13.0, more preferably from about 11.5 to about 12.5), wherein said average carbon content is based on the sum of carbon atoms m R¹, L and R², (preferably said sum of carbon atoms m R¹, L and R² is from 9 to 15, more preferably, 10 to 14) and further, wherein L has no substituents other than A, R¹ and R²; M is a cation or cation mixture (preferably selected from H, Na, K, Ca, Mg and mixtures thereof, more preferably selected from H, Na, K and mixtures thereof, more preferably still, selected from H, Na, and mixtures thereof) having a valence q (typically from 1 to 2, preferably 1); a and b are integers selected such that said compounds are electroneutral (a is typically from 1 to 2, preferably 1, b is 1), R^! is Cι-C₃ alkyl (preferably C C₂ alkyl, more preferably methyl); R² is selected from H and C]-C₃ alkyl (preferably H and C C₂ alkyl, more preferably H and methyl, more preferably H and methyl provided that in at least about 0.5, more preferably 0.7, more preferably 0.9 to 1.0 mole fraction of said branched alkylbenzenesulfonates R² is H); A is a benzene moiety (typically A is the moiety -CβH-r , with the S0₃ moiety of Formula (I) m para- position to the L moiety, though in some proportion, usually no more than about 5%, preferably from 0 to 5% by weight, the S0₃ moiety is ortho- to L); and (b) from about 5% to about 60% by weight (preferably from about 10% to about 35%, more preferably from about 15% to about 30%) of a mixture of nonbranched alkylbenzenesulfonates having formula (II):

wherein a, b, M, A and q are as defined hereinbefore and Y is an unsubstituted linear aliphatic moiety consisting of carbon and hydrogen having two methyl termini, and wherein Y has an average carbon content of from about 10.0 to about 14.0 (preferably from about 11.0 to about 13.0, more preferably 11.5 to 12.5 carbon atoms); (preferably said mixture of nonbranched alkylbenzenesulfonates is further characteπzed by a sum of carbon atoms in Y, of from 9 to 15, more preferably 10 to 14); and wherein said composition is further charactenzed by a 2/3-phenyl index of from about 350 to about 10,000 (preferably from about 400 to about 1200, more preferably from about 500 to about 700) (and also preferably wherein said surfactant mixture has a 2-methyl-2-phenyl index of less than about 0.3, preferably less than about 0.2, more preferably less than about 0.1, more preferably still, from 0 to 0.05).

Also encompassed by way of mid-cham branched surfactants of the alkylbenzene-deπved types are surfactant mixtures compnsmg the product of a process compnsmg the steps of: alkylatmg benzene with an alkylatmg mixture; sulfonatmg the product of (I); and neutralizing the product of (II); wherein said alkylatmg mixture compnses: (a) from about 1% to about 99.9%, by weight of branched C₇-C₂₀ monoolefins, said branched monoolefins having structures identical with those of the branched monoolefins formed by dehydrogenatmg branched parafins of formula R'LR² wherein L is an acyclic aliphatic moiety consisting of carbon and hydrogen and containing two terminal methyls; R¹ is Ci to C₃ alkyl; and R² is selected from H and Ci to C₃ alkyl; and (b) from about 0.1% to about 85%, by weight of C₇-C₂₀ linear aliphatic olefins; wherein said alkylatmg mixture contains said branched C₇-C₂₀ monoolefins having at least two different carbon numbers in said C₇-C₂₀ range, and has a mean carbon content of from about 9.5 to about 14.5 carbon atoms; and wherein said components (a) and (b) are at a weight ratio of at least about 15:85. Bleaching System - The laundry compositions of the present invention may compnse a bleaching system. Bleaching systems typically compnse a "bleaching agent" (source of hydrogen peroxide) and an "initiator" or "catalyst". When present, bleaching agents will typically be at levels of from about 1%, preferably from about 5% to about 30%, preferably to about 20% by weight of the composition. If present, the amount of bleach activator will typically be from about 0.1%, preferably from about 0.5% to about 60%, preferably to about 40% by weight, of the bleaching composition comprising the bleaching agent-plus-bleach activator

Bleaching Agents - Hydrogen peroxide sources are descnbed in detail in the herein incorporated Kirk Othmer's Encyclopedia of Chemical Technology, 4th Ed (1992, John Wiley & Sons), Vol. 4, pp 271-300 "Bleaching Agents (Survey)", and include the vanous forms of sodium perborate and sodium percarbonate, including vanous coated and modified forms.

The preferred source of hydrogen peroxide used herein can be any convenient source, including hydrogen peroxide itself. For example, perborate, e.g., sodium perborate (any hydrate but preferably the mono- or tetra-hydrate), sodium carbonate peroxyhydrate or equivalent percarbonate salts, sodium pyrophosphate peroxyhydrate, urea peroxyhydrate, or sodium peroxide can be used herein. Also useful are sources of available oxygen such as persulfate bleach (e.g., OXONE, manufactured by DuPont). Sodium perborate monohydrate and sodium percarbonate are particularly preferred. Mixtures of any convenient hydrogen peroxide sources can also be used. A preferred percarbonate bleach compnses dry particles having an average particle size in the range from about 500 micrometers to about 1,000 micrometers, not more than about 10% by weight of said particles being smaller than about 200 micrometers and not more than about 10% by weight of said particles being larger than about 1,250 micrometers. Optionally, the percarbonate can be coated with a silicate, borate or water-soluble surfactants. Percarbonate is available from vanous commercial sources such as FMC, Solvay and Tokai Denka.

Compositions of the present invention may also compnse as the bleaching agent a chlonne-type bleaching mateπal. Such agents are well known in the art, and include for example sodium dichloroisocyanurate ("NaDCC"). However, chlonne-type bleaches are less preferred for compositions which compnse enzymes. fa) Bleach Activators - Preferably, the peroxygen bleach component m the composition is formulated with an activator (peracid precursor). The activator is present at levels of from about 0.01%, preferably from about 0.5%o, more preferably from about 1% to about 15%, preferably to about 10%, more preferably to about 8%, by weight of the composition. Preferred activators are selected from the group consisting of tetraacetyl ethylene diam e (TAED), benzoylcaprolactam (BzCL), 4-mtrobenzoylcaprolactam, 3-chlorobenzoylcaprolactam, benzoyloxybenzenesulphonate (BOBS), nonanoyloxybenzenesulphonate (NOBS), phenyl benzoate (PhBz), decanoyloxybenzenesulphonate (C JQ-OBS), benzoylvalerolactam (BZVL), octanoyloxybenzenesulphonate (Cg-OBS), perhydrolyzable esters and mixtures thereof, most preferably benzoylcaprolactam and benzoylvalerolactam. Particularly preferred bleach activators in the pH range from about 8 to about 9.5 are those selected having an OBS or VL leaving group. Preferred hydrophobic bleach activatoYs include, but are not limited to, nonanoyloxybenzenesulphonate (NOBS), 4-[N-(nonaoyl) ammo hexanoyloxy] -benzene sulfonate sodium salt (NACA-OBS) an example of which is descπbed in U.S. Patent No. 5,523,434, dodecanoyloxybenzenesulphonate (LOBS or C12-OBS), 10-undecenoyloxybenzenesulfonate

(UDOBS or Ci j-OBS with unsaturation m the 10 position), and decanoyloxybenzoic acid

(DOBA).

Preferred bleach activators are those descπbed in U.S. 5,698,504 Chπstie et al., issued December 16, 1997; U.S. 5,695,679 Chπstie et al. issued December 9, 1997; U.S. 5,686,401

Willey et al., issued November 11, 1997; U.S. 5,686,014 Hartshorn et al., issued November 11,

1997; U.S. 5,405,412 Willey et al., issued Apnl 11, 1995; U.S. 5,405,413 Willey et al, issued

Apπl 11, 1995; U.S. 5,130,045 Mitchel et al., issued July 14, 1992; and U.S. 4,412,934 Chung et al, issued November 1, 1983, and copendmg patent applications U. S. Senal Nos. 08/709,072, 08/064,564, all of which are incorporated herein by reference.

The mole ratio of peroxygen bleaching compound (as AvO) to bleach activator the present invention generally ranges from at least 1:1, preferably from about 20: 1, more preferably from about 10: 1 to about 1 : 1, preferably to about 3: 1.

Quaternary substituted bleach activators may also be included. The present laundry compositions preferably compπse a quaternary substituted bleach activator (QSBA) or a quaternary substituted peracid (QSP); more preferably, the former. Preferred QSBA structures are further descπbed in U.S. 5,686,015 Willey et al, issued November 1 1, 1997; U.S. 5,654,421

Taylor et al, issued August 5, 1997; U.S. 5,460,747 Gosselmk et al, issued October 24, 1995;

U.S. 5,584,888 Miracle et al, issued December 17, 1996; and U.S. 5,578,136 Taylor et al, issued November 26, 1996; all of which are incorporated herein by reference.

Highly preferred bleach activators useful herein are amide-substituted as descnbed m

U.S. 5,698,504, U.S. 5,695,679, and U.S. 5,686,014 each of which are cited herein above.

Preferred examples of such bleach activators include: (6- octanamιdocaproyl)oxybenzenesulfonate,(6-nonanamιdocaproyl) oxybenzenesulfonate, (6-decanamιdocaproyl)oxybenzenesulfonate and mixtures thereof.

Other useful activators, disclosed in U.S. 5,698,504, U.S. 5,695,679, U S 5,686,014 each of which is cited herein above and U.S. 4,966,723Hodge et al, issued October 30, 1990, include benzoxazm-type activators, such as a C₆H₄ nng to which is fused in the 1 ,2-posιtιons a moiety -C(0)OC(R¹)=N-.

Depending on the activator and precise application, good bleaching results can be obtained from bleaching systems having with m-use pH of from about 6 to about 13, preferably from about 9.0 to about 10.5 Typically, for example, activators with electron- withdrawing moieties are used for near-neutral or sub-neutral pH ranges. Alkalis and buffenng agents can be used to secure such pH.

Acyl lactam activators, as descπbed in U.S. 5,698,504, U.S. 5,695,679 and U.S. 5,686,014, each of which is cited herein above, are very useful herein, especially the acyl caprolactams (see for example WO 94-28102 A) and acyl valerolactams (see U.S. 5,503,639 Willey et al, issued Apπl 2, 1996 incorporated herein by reference).

(b) Organic Peroxides, especially Diacyl Peroxides - These are extensively illustrated in Kirk Othmer, Encyclopedia of Chemical Technology, Vol. 17, John Wiley and Sons, 1982 at pages 27-90 and especially at pages 63-72, all incorporated herein by reference. If a diacyl peroxide is used, it will preferably be one which exerts minimal adverse impact on spotting/filming.

(c) Metal-containmg Bleach Catalysts - The present invention compositions and methods may utilize metal-containmg bleach catalysts that are effective for use in bleaching compositions. Preferred are manganese and cobalt-containmg bleach catalysts. One type of metal-contammg bleach catalyst is a catalyst system compnsmg a transition metal cation of defined bleach catalytic activity, such as copper, iron, titanium, ruthenium tungsten, molybdenum, or manganese cations, an auxiliary metal cation having little or no bleach catalytic activity, such as zmc or aluminum cations, and a sequestrate having defined stability constants for the catalytic and auxiliary metal cations, particularly ethylenediammetetraacetic acid, ethylenediaminetefra (methylenephosphomc acid) and water-soluble salts thereof Such catalysts are disclosed in U.S. 4,430,243 Bragg, issued February 2, 1982.

Manganese Metal Complexes - If desired, the compositions herein can be catalyzed by means of a manganese compound. Such compounds and levels of use are well known in the art and include, for example, the manganese-based catalysts disclosed in U.S. Patent Nos. 5,576,282; 5,246,621; 5,244,594; 5,194,416; and 5,114,606, and European Pat. App. Pub. Nos. 549,271 Al, 549,272 Al, 544,440 A2, and 544,490 Al, Preferred examples of these catalysts include

Mn^2(^u-°)3( ,7-tnmethyl-l,4,7-tnazacyclononane)2(PF₆)₂, Mn^m2(u-0)₁(u-OAc) ( 1,4,7- tπmethyl-l,4,7-tnazacyclononane)2(Clθ4)2, Mn^IV4(u-0)6(l,4,7-tnazacyclononane)4(C104)4, Mn^mMn^IV4(u-0) (u-OAc)₂.( 1 ,4,7-tπmethyl- 1 ,4,7-tπazacyclononane)2(C10₄)3 , Mn^rv( 1 ,4,7- tπmethyl-l,4,7-tπazacyclononane)- (OC^^PFg), and mixtures thereof. Other metal-based bleach catalysts include those disclosed in U.S. Patent Nos. 4,430,243 and U.S. 5,114,611. The use of manganese with various complex hgands to enhance bleaching is also reported in the following: U.S. Patent Nos. 4,728,455; 5,284,944; 5,246,612, 5,256,779; 5,280,117; 5,274,147; 5,153,161; and 5,227,084.

Cobalt Metal Complexes - Cobalt bleach catalysts useful herein are known, and are descπbed, for example, m U.S. Patent Nos. 5,597,936; 5,595,967; and 5,703,030; and M. L.

Tobe, "Base Hydrolysis of Transition-Metal Complexes", Adv. Inorg. Biomorg. Mech., (1983), 2, pages 1-94. The most preferred cobalt catalyst useful herein are cobalt pentaamme acetate salts having the formula [Co(NH3)5θAc] Ty, wherein "OAc" represents an acetate moiety and "Ty" is an amon, and especially cobalt pentaamme acetate chloπde, [Co(NH3)5θAc]Cl2; as well as

[Co(NH₃)₅OAc](OAc)₂; [Co(NH₃)₅OAc](PF₆)₂; [Co(NH₃)₅OAc](S0₄); [Co-

(NH₃)5θAc](BF₄)2; and [Co(NH₃)₅OAc](N03)₂ (herein "PAC"). These cobalt catalysts are readily prepared by known procedures, such as taught for example in U.S. Patent Nos. 5,597,936; 5,595,967; and 5,703,030; in the Tobe article and the references cited therein; and in U.S. Patent 4,810,410; J. Chem. Ed. (1989), 66 (12), 1043-45; The Synthesis and Characteπzation of Inorganic Compounds, W.L. Jolly (Prentice-Hall; 1970), pp. 461-3; Inorg. Chem.. 18, 1497-1502 (1979); Inorg. Chem.. 21, 2881-2885 (1982); Inorg Chem.. 18, 2023-2025 (1979); Inorg. Synthesis, 173-176 (1960); and Journal of Physical Chemistry. 56, 22-25 (1952).

Transition Metal Complexes of Macropolvcvchc Rigid Ligands - Compositions herein may also suitably include as bleach catalyst a transition metal complex of a macropolycychc ngid hgand. The phrase "macropolycychc πgid hgand" is sometimes abbreviated as "MRL" in discussion below. The amount used is a catalytically effective amount, suitably about 1 ppb or more, for example up to about 99.9%, more typically about 0.001 ppm or more, preferably from about 0.05 ppm to about 500 ppm (wherein "ppb" denotes parts per billion by weight and "ppm" denotes parts per million by weight).

Suitable transition metals e.g., Mn are illustrated hereinafter. "Macropolycychc" means a MRL is both a macrocycle and is polycychc "Polycychc" means at least bicychc. The term "πgid" as used herein herein includes "having a superstructure" and "cross-bndged". "Rigid" has been defined as the constrained converse of flexibility: see D.H. Busch, Chemical Reviews , (1993), 93, 847-860, incorporated by reference. More particularly, "πgid" as used herein means that the MRL must be determinably more rigid than a macrocycle ("parent macrocycle") which is otherwise identical (having the same ring size and type and number of atoms the main nng) but lacking a superstructure (especially linking moieties or, preferably cross-bπdgmg moieties) found m the MRL's In determining the comparative πgidity of macrocycles with and without superstructures, the practitioner will use the free form (not the metal-bound form) of the macrocycles. Rigidity is well-known to be useful in compaπng macrocycles; suitable tools for determining, measunng or compaπng πgidity include computational methods (see, for example,

Zimmer, Chemical Reviews. (1995), 95(38), 2629-2648 or Hancock et al, Inorganica Chimica

Acta. (1989). 164. 73-84. Preferred MRL's herein are a special type of ultra-ngid hgand which is cross-bndged. A

"cross-bπdge" is nonhmitmgly illustrated m 1.11 herembelow. In 1.11, the cross-bπdge is a -

1 8

CH2CH2- moiety. It bπdges N and N in the illustrative structure. By companson, a "same-

1 12 side" bπdge, for example if one were to be introduced across N and N in 1.11 , would not be sufficient to constitute a "cross-bπdge" and accordingly would not be preferred. Suitable metals m the πgid hgand complexes include Mn(II), Mn(DI), Mn(IV), Mn(V),

Fe(D), Fe(DI), Fe(IV), Co(I), Co(D), Co(ID), Nι(I), Nι(D), Ni(DI), Cu(I), Cu(D), Cu(DI), Cr(II), Cr(m), Cr(IV), Cr(V), Cr(VI), V(DI), V(IV), V(V), Mo(IV), Mo(V), Mo(VI), W(IV), W(V), W(VI), Pd(II), Ru(D), Ru(DI), and Ru(IV). Preferred transition-metals in the instant transition- metal bleach catalyst include manganese, iron and chromium. More generally, the MRL's (and the corresponding transition-metal catalysts) herein suitably compnse:

(a) at least one macrocycle main nng compnsmg four or more heteroatoms; and

(b) a covalently connected non-metal superstructure capable of increasing the ngidity of the macrocycle, preferably selected from (1) a bπdgmg superstructure, such as a linking moiety;

(II) a cross-bndg g superstructure, such as a cross-bndgmg linking moiety; and

(III) combinations thereof.

The term "superstructure" is used herein as defined in the literature by Busch et al, see, for example, articles by Busch m "Chemical Reviews". Preferred superstructures herein not only enhance the ngidity of the parent macrocycle, but also favor folding of the macrocycle so that it co-ordinates to a metal in a cleft. Suitable superstructures can be remarkably simple, for example a linking moiety such as any of those illustrated in Fig. 1 and Fig. 2 below, can be used. CH₂)_n

wherein n is an integer, for example from 2 to 8, preferably less than 6, typically 2 to 4, or

wherein m and n are integers from about 1 to 8, more preferably from 1 to 3; Z is N or CH; and T is a compatible substituent, for example H, alkyl, tnalkylammomum, halogen, mtro, sulfonate, or the like. The aromatic nng m 1.10 can be replaced by a saturated nng, in which the atom m Z connecting into the nng can contain N, O, S or C.

Suitable MRL's are further nonhmitmgly illustrated by the following compound:

Fig. 3

This is a MRL in accordance with the invention which is a highly preferred, cross- bπdged, methyl-substituted (all nitrogen atoms tertiary) denvative of cyclam. Formally, this hgand is named 5,12-dιmethyl-l,5,8,12-tetraazabιcyclo[6.6.2]hexadecane using the extended von Baeyer system. See "A Guide to IUPAC Nomenclature of Organic Compounds: Recommendations 1993", R. Pamco, W.H. Powell and J-C Richer (Eds.), Blackwell Scientific Publications, Boston, 1993; see especially section R-2.4.2.1.

Transition-metal bleach catalysts of Macrocychc Rigid Ligands which are suitable for use in the invention compositions can m general include known compounds where they conform with the definition herein, as well as, more preferably, any of a large number of novel compounds expressly designed for the present laundry or laundry uses, and non-hmitmgly illustrated by any of the following: Dιchloro-5,12-dιmethyl-l,5,8,12-tetraazabιcyclo[6.6.2]hexadecane Manganese(D) Dιaquo-5,12-dιmethyl-l,5,8,12-tetraazabιcyclo[6 6.2]hexadecaneManganese(D)

Hexafluorophosphate Aquo-hydroxy-5,12-dιmethyl-l,5,8,12-tetraazabιcyclo[6.6.2]hexadecane Manganese(DI) Hexafluorophosphate

Dιaquo-5,12-dιmethyl-l,5,8,12-tetraazabιcyclo[6.6.2]hexadecaneManganese(II) Tetrafluoroborate Dιchloro-5,12-dιmethyl-l,5,8,12-tetraazabιcyclo[6.6.2]hexadecaneManganese(iπ)

Hexafluorophosphate Dιchloro-5,12-dι-n-butyl-l,5,8,12-tetraaza bιcyclo[6.6.2]hexadecaneManganese(II) Dιchloro-5,12-dιbenzyl-l,5,8,12-tetraazabιcyclo[6.6.2]hexadecaneManganese(II) Dιchloro-5-n-butyl-12-methyl-l,5,8,12-tetraaza-bιcyclo[6.6.2]hexadecane

Manganese(D) Dιchloro-5-n-octyl-12-methyl-l,5,8,12-tetraaza-bιcyclo[6.6.2]hexadecane Manganese(II) Dιchloro-5-n-butyl-12-methyl-l,5,8,12-tetraaza-bιcyclo[6.6.2]hexadecane Manganese(D).

As a practical matter, and not by way of limitation, the compositions and laundry processes herein can be adjusted to provide on the order of at least one part per hundred million of the active bleach catalyst species in the aqueous washing medium, and will preferably provide from about 0.01 ppm to about 25 ppm, more preferably from about 0.05 ppm to about 10 ppm, and most preferably from about 0.1 ppm to about 5 ppm, of the bleach catalyst species in the wash liquor. In order to obtain such levels in the wash liquor of an automatic washing process, typical compositions herein will compπse from about 0.0005%> to about 0.2%, more preferably from about 0.004% to about 0.08%, of bleach catalyst, especially manganese or cobalt catalysts, by weight of the bleaching compositions.

(d) Other Bleach Catalysts - The compositions herein may compπse one or more other bleach catalysts. Preferred bleach catalysts are zwittenonic bleach catalysts, which are descnbed in U.S. Patent No. 5,576,282 (especially 3-(3,4-dιhydroιsoqumohnιum) propane sulfonate. Other bleach catalysts include cationic bleach catalysts are descπbed in U.S. Patent Nos. 5,360,569, 5,442,066, 5,478,357, 5,370,826, 5,482,515, 5,550,256, and WO 95/13351, WO 95/13352, and WO 95/13353.

(e) Bleach Boosting Compounds - The compositions herein may compnse one or more bleach boosting compounds. Bleach boosting compounds provide increased bleaching effectiveness in lower temperature applications. The bleach boosters act in conjunction with conventional peroxygen bleaching sources to provide increased bleaching effectiveness.

Suitable bleach boosting compounds for use in accordance with the present invention comprise cationic lmines, zwittenonic -mines, anionic lmines and/or polyionic mimes having a net charge of from about +3 to about -3, and mixtures thereof. These imme bleach boosting compounds of the present invention include those of the general structure:

[I]

where R^ - R⁴ may be a hydrogen or an unsubstituted or substituted radical selected from the group consisting of phenyl, aryl, heterocychc nng, alkyl and cycloalkyl radicals.

Preferred bleach boosting compounds include where Rl - R⁴ may be a hydrogen or an unsubstituted or substituted radical selected from the group consisting of phenyl, aryl, heterocychc nng, alkyl and cycloalkyl radicals except that at least one of R* - R⁴ contains an amonically charged moiety.

More preferred bleach boosting compounds include the amonically charged moiety bonded to the imme nitrogen. Such bleach boosting compounds compπse quaternary imme zwitteπons represented by the formula:

wherein Rl - R^ is hydrogen or an unsubstituted or substituted radical selected from the group consisting of phenyl, aryl, heterocychc nng, alkyl and cycloalkyl radicals; R\ and R2 form part of a common nng; T has the formula.

wherein x is equal to 0 or 1 ; J, when present, is selected from the group consisting of

-CR^{1 l}R¹²-, -CR¹ !R¹²CR¹³R1⁴-, and -CR¹ ΪR^CR^R^CR^R¹⁶-; R⁷-R*6 are individually selected from the group consisting of H, linear or branched Ci -C_jg substituted or unsubstituted alkyl, alkylene, oxyalkylene, aryl, substituted aryl, substituted arylcarbonyl groups and amide groups; Z is covalently bonded to J_x when x is 1 and to Cj, when x is 0, and Z is selected from the group consisting of -CO2", -Sθ3"and -OS03^"and a is 1. R\ and R2 together may form the non- charged moiety:

Most preferred bleach boosting compounds include are ary mmium zwittenons wherein R3 is H, Z is -SO3" or -OSO3", and a is 1. The aryhmmium zwittenons may have the foπnula:

or

where R*⁷ is selected from the group consisting of H and linear or branched Ci -Cjg substituted or unsubstituted alkyl, preferably C J-C14 alkyl and even more preferably Cg-Ci Q linear alkyl chain. The bleach boosting compounds may also compnse an aryhmmum polyion having a net negative charge and R³ is H, T is -(CH2)t>- or -CH2(C6H4)-, Z is -SO3- , a is 2 and b is from 2 to 4 The aryhmmium polyion preferably has the formula:

or is a water-soluble salt of these compounds.

The quaternary imme bleach boosting compounds preferably act m conjunction with a peroxygen source to provide a more effective bleaching system. The bleach boosting compounds react with the peroxygen source to form a more active bleaching species, an oxazindimum compound. The formed oxazindimum compounds are either cationic, zwittenonic or polyionic with a net negative charge as was the imme bleach boosting compound. The oxazindimum compound has an increased activity at lower temperatures relative to the peroxygen compound. The oxazindimum compound is represented by the formula:

(ID)

and can be produced from the imme of formula (I) or (H), wherein R⁴ is T — (Z^")_a , of the present invention with the reaction:

(I) (ID)

Thus, the preferred bleach boosting compounds of the present invention represented by the formula (D) produces the active oxazindimum bleaching species represented by the formula (IV)

or

(V)

wherein R^⁷ is defined as above.

Peroxygen sources are well-known m the art and the peroxygen source employed m the present invention may compπse any of these well known sources, including peroxygen compounds as well as compounds which under consumer use conditions provide an effective amount of peroxygen m situ. The peroxygen source may include a hydrogen peroxide source, the in situ formation of a peracid amon through the reaction of a hydrogen peroxide source and a bleach activator, preformed peracid compounds or mixtures of suitable peroxygen sources. Of course, one of ordinary skill m the art will recognize that other sources of peroxygen may be employed without departing from the scope of the invention.

The bleach boosting compounds, when present, are preferably employed m conjunction with a peroxygen source in the bleaching compositions of the present invention. In such a composition, the peroxygen source is preferably present at a level of from about 0.1% to about 60% by weight of the composition, and more preferably from about 1% to about 40%> by weight of the composition. In the composition, the bleach boosting compound is preferably present at a level of from about 0.01% to about 10% by weight of the composition, and more preferably from about 0.05% to about 5% by weight of the composition.

(f) Preformed Peracids - Also suitable as bleaching agents are preformed peracids, such as phthalimido-peroxy-caproic acid ("PAP") See for example U.S. Patent Nos 5,487,818, 5,310,934, 5,246,620, 5,279,757 and 5,132,431

Enzymes - With respect to the enzymes m the particulate solid of the present invention, any suitable enzyme can be used. The preferred enzymes for use in the particulate solids of the present invention are selected from proteases, amylases, cellulases and mixtures thereof Non miting examples of other suitable enzymes include the following:

Examples of suitable enzymes include_? but are not limited to, hemicellulases, peroxidases, proteases, cellulases, xylanases, hpases, phosphohpases, esterases, cutmases, pectmases, keratanases, reductases, oxidases, phenoloxidases, hpoxygenases, hgnmases, pullulanases, tannases, pentosanases, malanases, β-glucanases, arabmosidases, hyaluromdase, chondroitmase, laccase, mannanases, more preferably plant cell wall degrading enzymes and non- cell wall-degrading enzymes (WO 98/39403 A) and can, more specifically, include pectmase (WO 98/06808 A, JP10088472 A, JP10088485 A); pectolyase (WO98/06805 Al); pectin lyases free from other pectic enzymes (WO9806807 Al); chondnotmase ( EP 747,469 A); xylanase ( EP 709,452 A, WO 98/39404 A, WO98/39402 A) including those denved from microtetraspora flexuosa (US 5683911); isopeptidase (WO 98/16604 A); keratmase (EP 747,470 A, WO 98/40473 A); hpase ( GB 2,297,979 A; WO 96/16153 A; WO 96/12004 A; EP 698,659 A; WO 96/16154 A); cellulase or endoglucanase (GB 2,294,269 A; WO 96/27649 A; GB 2,303,147 A; WO98/03640 A; see also neutral or alkaline cellulases denved from chrysosponum lucknowense strain VKM F-3500D as disclosed in W09815633 A); polygalacturonase (WO 98/06809 A); mycodextranase (WO 98/13457 A); thermitase (WO 96/28558 A); cholesterol esterase (WO 98 28394 A); or any combination thereof; and known amylases; oxidoreductases; oxidases or combination systems including same (DE19523389 Al ); mutant blue copper oxidases (WO9709431 Al), peroxidases (see for example US 5,605,832, WO97/31090 Al), mannanases (W09711 164 Al); laccases, see W09838287 Al or W09838286 Al or for example, those laccase vanants having ammo acid changes m mycelwphthora or scytahdium laccase(s) as descπbed in W09827197 Al or mediated laccase systems as descnbed in DE19612193 Al), or those denved from coprinus strains (see, for example WO9810060 Al or W09827198 Al), phenol oxidase or polyphenol oxidase (JP10174583 A) or mediated phenol oxidase systems (W09711217 A); enhanced phenol oxidase systems (WO 9725468 A W09725469 A); phenol oxidases fused to an ammo acid sequence having a cellulose binding domain (WO9740127 Al, WO9740229 Al) or other phenol oxidases (WO9708325 A, W09728257 Al) or superoxide dismutases. Oxidoreductases and/or their associated antibodies can be used, for example with H₂0₂, as taught in WO 98/07816 A. Depending on the type of detergent composition, other redox-active enzymes can be used, even, for example, catalases (see, for example JP09316490 A).

Also useful herein are any oxygenases of extracellular ongm, especially fungal oxygenase such as dioxygenase of extracellular ongm. The latter is most especially quercetinase, catechmase or an anthocyanase, optionally in combination with other suitable oxidase, peroxidase or hydrolytic enzymes, all a taught in WO9828400 A2.

Examples of such suitable enzymes and/or levels of use are disclosed in U.S. Patent Nos. 5,705,464, 5,710,1 15, 5,576,282, 5,728,671 and 5,707,950 The cellulases useful in the present invention include both bactenal or fungal cellulases.

Preferably, they will have a pH optimum of between 5 and 12 and a specific activity above 50 CEVU/mg (Cellulose Viscosity Unit). Suitable cellulases are disclosed in U.S. Patent 4,435,307, J61078384 and WO96/02653 which discloses fungal cellulase produced respectively from Humicola msolens, Tπchoderma, Thielavia and Sporotnchum. EP 739 982 descnbes cellulases isolated from novel Bacillus species. Suitable cellulases are also disclosed m GB-A-2.075.028; GB-A-2.095.275; DE-OS-2.247.832 and W095/26398.

Examples of such cellulases are cellulases produced by a strain of Humicola insolens (Humicola gπsea var. thermoidea), particularly the Humicola strain DSM 1800.

Other suitable cellulases are cellulases oπgmated from Humicola msolens having a molecular weight of about 50KDa, an isoelectnc point of 5.5 and containing 415 ammo acids; and a "43kD endoglucanase denved from Humicola msolens, DSM 1800, exhibiting cellulase activity; a preferred endoglucanase component has the ammo acid sequence disclosed in WO 91/17243 Also suitable cellulases are the EGIQ cellulases from Tnchoderma longibrachiatum descnbed in WO94/21801 to Genencor. Especially suitable cellulases are the cellulases having color care benefits. Examples of such cellulases are cellulases descπbed in European patent application No. 91202879.2, filed November 6, 1991 (Novo). Carezyme and Celluzyme (Novo Nordisk A S) are especially useful. See also W091/17244 and WO91/21801. Other suitable cellulases for fabnc care and/or laundry properties are descnbed in WO96/34092, W096/17994 and W095/24471. Peroxidase enzymes are used in combination with oxygen sources, e.g. percarbonate, perborate, persulfate, hydrogen peroxide, etc and with a phenolic substrate as bleach enhancing molecule. They are used for "solution bleaching", I e to prevent transfer of dyes or pigments removed from substrates dunng wash operations to other substrates in the wash solution. Peroxidase enzymes are known in the art, and include, for example, horseradish peroxidase, hgninase and haloperoxidase such as chloro- and bromo-peroxidase. Suitable peroxidases and peroxidase-containmg detergent compositions are disclosed, for example, in U.S. Patent Nos 5,705,464, 5,710,115, 5,576,282, 5,728,671 and 5,707,950, PCT International Application WO 89/099813, WO89/09813 and in European Patent application EP No 91202882.6, filed on November 6, 1991 and EP No. 96870013 8, filed February 20, 1996 Also suitable is the laccase enzyme.

Suitable enhancers are selected from the group consisting of substituted phenthiazine and phenoxasme 10-Phenothιazιnepropιonιcacιd (PPT), 10-ethylphenothiazine-4-carboxylic acid (EPC), 10-phenoxazmepropionic acid (POP) and 10-methylphenoxazme (descnbed m WO

94/12621), substitued syπngates (C3-C5 substitued alkyl syπngates), phenols and mixtures thereof. Sodium percarbonate or perborate are preferred sources of hydrogen peroxide.

Enzymatic systems may be used as bleaching agents. The hydrogen peroxide may also be present by adding an enzymatic system (i.e. an enzyme and a substrate therefore) which is capable of generating hydrogen peroxide at the beginning or dunng the washing and/or nnsmg process. Such enzymatic systems are disclosed m EP Patent Application 91202655.6 filed

October 9, 1991.

Other preferred enzymes that can be included in the laundry compositions of the present invention include hpases. Suitable hpase enzymes for detergent usage include those produced by microorganisms of the Pseudomonas group, such as Pseudomonas stutzen ATCC 19.154, as disclosed in Bntish Patent 1,372,034. Suitable hpases include those which show a positive immunological cross-reaction with the antibody of the hpase, produced by the microorganism Pseudomonas fluorescent LAM 1057. This hpase is available from Amano Pharmaceutical Co. Ltd, Nagoya, Japan, under the trade name Lipase P "Amano," hereinafter referred to as "Amano- P". Other suitable commercial hpases include Amano-CES, hpases ex Chromobacter viscosum, e.g. Chromobacter viscosum var polyticum NRRLB 3673 from Toyo Jozo Co, Tagata, Japan, Chromobacter viscosum hpases from U.S. Biochemical Corp, U.S.A. and Disoynth Co, The Netherlands, and hpases ex Pseudomonas gladioli. Especially suitable hpases are hpases such as

Ml Lipase* - and

which have found to be very effective when used m combination with the compositions of the present invention. Also suitable are the hpolytic enzymes descπbed in EP 258 068, WO 92/05249 and

WO 95/22615 by Novo Nordisk and in WO 94/03578, WO 95/35381 and WO 96/00292 by

Unilever.

Also suitable are cutmases [EC 3.1.1.50] which can be considered as a special kind of lipase, namely hpases which do not require mterfacial activation. Addition of cutmases to laundry compositions have been descπbed in e.g. WO-A-88/09367 (Genencor); WO 90/09446

(Plant Genetic System) and WO 94/14963 and WO 94/14964 (Unilever).

In addition to the above referenced hpases, phosphohpases may be incorporated into the laundry compositions of the present invention. Nonhmitmg examples of suitable phosphohpases included: EC 3.1.1 32 Phosphohpase Al; EC 3.1.1 4 Phosphohpase A2; EC 3.1 1.5 Lysophohpase; EC 3.1.4 3 Phosphohpase C; EC 3.1.4.4. Phospohpase D. Commercially available phosphohpases include LECITASE® from Novo Nordisk A/S of Denmark and Phosphohpase A2 from Sigma. When phospohpases are included in the compositions of the present invention, it is preferred that amylases are also included. Without desinng to be bound by theory, it is believed that the combined action of the phosphohpase and amylase provide substantive stain removal, especially on greasy/oily, starchy and highly colored stams and soils. Preferably, the phosphohpase and amylase, when present, are incorporated into the compositions of the present invention at a pure enzyme weight ratio between 4500: 1 and 1:5, more preferably between 50: 1 and 1 : 1.

Suitable proteases are the subtihsms which are obtained from particular strains of B subtihs and B. licheniformis (subti sin BPN and BPN') One suitable protease is obtained from a strain of Bacillus, having maximum activity throughout the pH range of 8-12, developed and sold as ESPERASE® by Novo Industries A/S of Denmark, hereinafter "Novo". The preparation of this enzyme and analogous enzymes is descnbed in GB 1,243,784 to Novo. Proteolytic enzymes also encompass modified bactenal seπne proteases, such as those descnbed in European Patent Application Senal Number 87 303761.8, filed Apπl 28, 1987 (particularly pages 17, 24 and 98), and which is called herein "Protease B", and m European Patent Application 199,404, Venegas, published October 29, 1986, which refers to a modified bactenal senne proteolytic enzyme which is called "Protease A" herein. Suitable is the protease called herein "Protease C", which is a vaπant of an alkaline senne protease from Bacillus in which Lysine replaced argmine at position 27, tyrosme replaced valme at position 104, senne replaced asparagme at position 123, and alanine replaced threomne at position 274. Protease C is descπbed in EP 90915958:4, corresponding to WO 91/06637, Published May 16, 1991. Genetically modified vanants, particularly of Protease C, are also included herein.

A preferred protease referred to as "Protease D" is a carbonyl hydrolase as descnbed m U.S. Patent No. 5,677,272, and WO95/10591. Also suitable is a carbonyl hydrolase vanant of the protease descnbed in WO95/10591, having an ammo acid sequence denved by replacement of a plurality of ammo acid residues replaced in the precursor enzyme corresponding to position +210 m combination with one or more of the following residues : +33, +62, +67, +76, +100, +101, +103, +104, +107, +128, +129, +130, +132, +135, +156, +158, +164, +166, +167, +170, +209, +215, +217, +218, and +222, where the numbered position corresponds to naturally- occurπng subtihsm from Bacillus amylohquefaciens or to equivalent ammo acid residues in other carbonyl hydrolases or subtihsms, such as Bacillus lentus subtihsin (co-pendmg patent application US Senal No. 60/048,550, filed June 04, 1997 and PCT International Application Seπal No. PCT/IB98/00853).

Also suitable for the present invention are proteases descπbed in patent applications EP 251 446 and WO 91/06637, protease BLAP® descπbed in WO91/02792 and their vaπants described in WO 95/23221

See also a high pH protease from Bacillus sp. NCIMB 40338 descπbed m WO 93/18140 A to Novo. Enzymatic detergents compnsmg protease, one or more other enzymes, and a reversible protease inhibitor are descπbed in WO 92/03529 A to Novo. When desired, a protease having decreased adsorption and increased hydrolysis is available as descπbed in WO 95/07791 to Procter & Gamble. A recombmant trypsm-hke protease for detergents suitable herein is descπbed in WO 94/25583 to Novo. Other suitable proteases are descnbed in EP 516 200 by Unilever.

Particularly useful proteases are descnbed m PCT publications: WO 95/30010; WO

95/30011; and WO 95/29979. Suitable proteases are commercially available as ESPERASE®, ALCALASE®, DURAZYM®, SAVINASE®, EVERLASE® and KANNASE® all from Novo

Nordisk A/S of Denmark, and as MAXATASE®, MAXACAL®, PROPERASE® and

MAXAPEM® all from Genencor International (formerly Gist-Brocades of The Netherlands).

Preferred proteases useful herein include certain vanants ( WO 96/28566 A; WO 96/28557 A, WO 96/28556 A; WO 96/25489 A). Other particularly useful proteases are multiply-substituted protease vanants compnsmg a substitution of an ammo acid residue with another naturally occurπng ammo acid residue at an ammo acid residue position corresponding to position 103 of Bacillus amyloliquefaciens subtihsin in combination with a substitution of an ammo acid residue with another naturally occurnng ammo acid residue at one or more amino acid residue positions corresponding to positions 1, 3, 4, 8, 9, 10, 12, 13, 16, 17, 18, 19, 20, 21, 22, 24, 27, 33, 37, 38, 42, 43, 48, 55, 57, 58, 61, 62, 68, 72, 75, 76, 77, 78, 79, 86, 87, 89, 97, 98, 99, 101, 102, 104, 106, 107, 109, 111, 114, 116, 117, 119, 121, 123, 126, 128, 130, 131, 133, 134, 137, 140, 141, 142, 146, 147, 158, 159, 160, 166, 167, 170, 173, 174, 177, 181, 182, 183, 184, 185, 188, 192, 194, 198, 203, 204, 205, 206, 209, 210, 211, 212, 213, 214, 215, 216, 217, 218, 222, 224, 227, 228, 230, 232, 236, 237, 238, 240, 242, 243, 244, 245, 246, 247, 248, 249, 251, 252, 253, 254, 255, 256, 257, 258, 259, 260, 261, 262, 263, 265, 268, 269, 270, 271, 272, 274 and 275 of Bacillus amyloliquefaciens subtihsin; wherein when said protease vaπant includes a substitution of ammo acid residues at positions corresponding to positions 103 and 76, there is also a substitution of an amino acid residue at one or more amino acid residue positions other than ammo acid residue positions corresponding to positions 27, 99, 101, 104, 107, 109, 123, 128, 166, 204, 206, 210, 216, 217, 218, 222, 260, 265 or 274 of Bacillus amyloliquefaciens subtihsin and/or multiply-substituted protease vaπants compnsmg a substitution of an ammo acid residue with another naturally occurnng amino acid residue at one or more ammo acid residue positions corresponding to positions 62, 212, 230, 232, 252 and 257 of Bacillus amyloliquefaciens subtihsin as descnbed in PCT Application Nos. PCT/US98/22588, PCT/US98/22482 and PCT/US98/22486 all filed on October 23, 1998 from The Procter & Gamble Company (P&G Cases 7280&, 7281& and 7282L, respectively). More preferably the protease vaπant includes a substitution set selected from the group consisting of:

12/76/ 103/ 104/ 130/222/245/261 ; 62/103/104/159/232/236/245/248/252; 62/103/104/159/213/232/236/245/248/252; 62/101/103/104/159/212/213/232/236/245/248/252;

68/103/104/159/232/236/245;

68/103/104/159/230/232/236/245;

68/103/104/159/209/232/236/245;

68/103/104/159/232/236/245/257; 68/76/103/104/159/213/232/236/245/260;

68/103/104/159/213/232/236/245/248/252;

68/103/104/159/183/232/236/245/248/252;

68/103/104/159/185/232/236/245/248/252;

68/103/104/159/185/210/232/236/245/248/252; 68/103/104/159/210/232/236/245/248/252;

68/103/104/159/213/232/236/245;

98/103/104/159/232/236/245/248/252;

98/102/103/104/159/212/232/236/245/248/252;

101/103/104/159/232/236/245/248/252; 102/103/104/159/232/236/245/248/252;

103/104/159/230/236/245;

103/104/159/232/236/245/248/252;

103/104/159/217/232/236/245/248/252;

103/ 104/ 130/ 159/232/236/245/248/252 ; 103/104/131/159/232/236/245/248/252;

103/104/159/213/232/236/245/248/252; and

103/104/159/232/236/245.

Still even more preferably the protease vanant includes a substitution set selected from the group consisting of:

12R/76D/103A/104T/130T/222S/245R 261D; 62D/103A 104I/159D/232V/236H/245R/248D/252K; 62D/103A 104I/159D/213R 232V/236H/245R 248D/252K;

68A/103A/104I/159D/209W/232V/236H/245R;

68A/76D/103 A/1041/ 159D/213R/232V/236H/245R 260A;

68A/103A 104I/159D/213E/232V/236H/245R/248D/252K;

68A/103A/104I/159D/183D/232V/236H/245R 248D/252K; 68A/103A/104I/159D/232V/236H/245R;

68A 103A 104I/159D/230V/232V/236H/245R;

68A/103A 104I/159D/232V/236H/245R 257V;

68A 103A/104I/159D/213G/232V/236H/245R/248D/252K;

68A/103A/104I/159D/185D/232V/236H/245R 248D/252K; 68A 103A/104I/159D/185D/210L/232V/236H/245R/248D/252K;

68A/103A 104I/159D/210L/232V/236H/245R/248D/252K;

68A/103A/104I/159D/213G/232V/236H/245R;

98L/103A 104I/159D/232V/236H/245R/248D/252K;

98L/102A7103A/104I/159D/212G/232V/236H/245R/248D/252K; 101G/103A 104I/159D/232V/236H 245R/248D/252K;

102A 103A/104I/159D/232V/236H/245R/248D/252K;

103A/104I/159D/230V/236H 245R;

103A 104I/159D/232V/236H/245R/248D/252K;

103A 104I/159D/217E/232V/236H/245R/248D/252K; 103A/104I/130G/159D/232V/236H/245R/248D/252K;

103A/104I/131V/159D/232V/236H 245R 248D/252K;

103A 104I/159D/213R/232V/236H/245R 248D/252K; and

103A/104I/159D/232V/236H/245R. Most preferably the protease vaπant includes the substitution set 101/103/104/159/232/236/245/248/252, preferably 101G/103A 104I/159D/232V/ 236H/245R 248D/252K

Also suitable for the present invention are proteases descπbed m patent applications EP 251 446 and WO 91/06637, protease BLAP® descnbed m WO91/02792 and their vaπants descπbed in WO 95/23221.

See also a high pH protease from Bacillus sp. NCIMB 40338 descπbed in WO 93/18140 A to Novo. Enzymatic detergents compnsmg protease, one or more other enzymes, and a reversible protease inhibitor are descnbed WO 92/03529 A to Novo. When desired, a protease having decreased adsorption and increased hydrolysis is available as descπbed m WO 95/07791 to Procter & Gamble. A recombmant trypsin-hke protease for detergents suitable herein is descπbed in WO 94/25583 to Novo. Other suitable proteases are descnbed in EP 516 200 by Unilever.

Commercially available proteases useful m the present invention are known as ESPERASE®, ALCALASE®, DURAZYM®, SAVINASE®, EVERLASE® and KANNASE® all from Novo Nordisk A/S of Denmark, and as MAXATASE®, MAXACAL®, PROPERASE® and MAXAPEM® all from Genencor International (formerly Gist-Brocades of The Netherlands). Bleach/amylase/protease combinations (EP 755,999 A; EP 756,001 A; EP 756,000 A) are also useful. Also in relation to enzymes herein, enzymes and their directly linked inhibitors, e.g., protease and its inhibitor linked by a peptide chain as descπbed m WO 98/13483 A, are useful in conjunction with the present hybπd builders. Enzymes and their non-lmked inhibitors used in selected combinations herein include protease with protease inhibitors selected from proteins, peptides and peptide denvatives as descnbed in WO 98/13461 A, WO 98/13460 A, WO 98/13458 A, WO 98/13387 A.

Amylases can be used with amylase antibodies as taught m WO 98/07818 A and WO 98/07822 A, hpases can be used in conjunction with lipase antibodies as taught in WO 98/07817 A and WO 98/06810 A, proteases can be used in conjunction with protease antibodies as taught in WO 98/07819 A and WO 98/06811 A, Cellulase can be combined with cellulase antibodies as taught in WO 98/07823 A and WO 98/07821 A. More generally, enzymes can be combined with similar or dissimilar enzyme directed antibodies, for example as taught in WO 98/07820 A or WO 98/06812 A. The prefeπed enzymes herein can be of any suitable ongm, such as vegetable, animal, bactenal, fungal and yeast ongin.

Preferred selections are influenced by factors such as pH-activity and or stability optima, thermostabi ty, and stability to active detergents, builders and the like. In this respect bactenal or fungal enzymes are preferred, such as bactenal amylases and proteases, and fungal cellulases

Amylases (α and/or β) can be included for removal of carbohydrate-based stains. WO94/02597 descπbes laundry compositions which incorporate mutant amylases. See also W095/ 10603. Other amylases known for use m laundry compositions include both α- and β- amylases. α-Amylases are known in the art and include those disclosed m US Pat. no. 5,003,257, EP 252,666; WO/91/00353; FR 2,676,456; EP 285,123; EP 525,610; EP 368,341; and Bπtish Patent specification no. 1,296,839 (Novo). Other suitable amylases are stability-enhanced amylases descnbed in W094/18314 and WO96/05295, Genencor, and amylase vanants having additional modification m the immediate parent available from Novo Nordisk A S, disclosed in WO 95/10603. Also suitable are amylases descnbed in EP 277 216. Examples of commercial α-amylases products are Purafect Ox Am® from Genencor and

Termamyl®, Ban® ,Fungamyl® and Duramyl®, all available from Novo Nordisk A S Denmark. W095/26397 descnbes other suitable amylases : α-amylases charactensed by having a specific activity at least 25% higher than the specific activity of Termamyl® at a temperature range of 25°

C to 55°C and at a pH value m the range of 8 to 10, measured by the Phadebas® α-amylase activity assay. Suitable are vanants of the above enzymes, descπbed in W096/23873 (Novo

Nordisk). Other amylolytic enzymes with improved properties with respect to the activity level and the combination of thermostabihty and a higher activity level are descπbed m W095/35382.

The compositions of the present invention may also compπse a mannanase enzyme.

Preferably, the mannanase is selected from the group consisting of: three mannans-degrading enzymes : EC 3.2.1.25 : β-mannosidase, EC 3.2.1.78 : Endo-l,4-β-mannosιdase, referred therein after as "mannanase" and EC 3.2.1.100 : 1 ,4-β-mannobιosιdase and mixtures thereof. (IUPAC

Classification- Enzyme nomenclature, 1992 ISBN 0-12-227165-3 Academic Press).

More preferably, the treating compositions of the present invention, when a mannanase is present, compπse a β-l,4-Mannosιdase (E.C. 3.2.1.78) referred to as Mannanase. The term "mannanase" or "galactomannanase" denotes a mannanase enzyme defined according to the art as officially being named mannan endo-l,4-beta-mannosιdase and having the alternative names beta-mannanase and endo-l,4-mannanase and catalysing the reaction: random hydrolysis of 1,4- beta-D- mannosidic linkages m mannans, galactomannans, glucomannans, and galactoglucomannans.

In particular, Mannanases (EC 3.2 1.78) Constitute a group of polysaccharases which degrade mannans and denote enzymes which are capable of cleaving polyose chains contanmg mannose units, i.e. are capable of cleaving glycosidic bonds in mannans, glucomannans, galactomannans and galactogluco-mannans. Mannans are polysacchaπdes having a backbone composed of β-1,4- linked mannose; glucomannans are polysacchandes having a backbone or more or less regularly alternating β-1,4 linked mannose and glucose; galactomannans and galactoglucomannans are mannans and glucomannans with α-1,6 linked galactose sidebranches. These compounds may be acetylated.

The degradation of galactomannans and galactoglucomannans is facilitated by full or partial removal of the galactose sidebranches. Further the degradation of the acetylated mannans, glucomannans, galactomannans and galactogluco-mannans is facilitated by full or partial deacetylation. Acetyl groups can be removed by alkali or by mannan acetylesterases. The oligomers which are released from the mannanases or by a combination of mannanases and α- galactosidase and/or mannan acetyl esterases can be further degraded to release free maltose by β-mannosidase and/or β-glucosidase.

Mannanases have been identified in several Bacillus organisms. For example, Talbot et al, Appl. Environ. Microbiol, Vol.56, No. 11, pp. 3505-3510 (1990) descnbes a beta-mannanase denved from Bacillus stearothermophilus in dimer form having molecular weight of 162 kDa and an optimum pH of 5.5-7.5. Mendoza et al. World J. Microbiol. Biotech, Vol. 10, No. 5, pp. 551- 555 (1994) descnbes a beta-mannanase denved from Bacillus subtihs having a molecular weight of 38 kDa, an optimum activity at pH 5.0 and 55C and a pi of 4.8. JP-03047076 discloses a beta- mannanase denved from Bacillus sp, having a molecular weight of 373 kDa measured by gel filtration, an optimum pH of 8-10 and a pi of 5.3-5.4. JP-63056289 descnbes the production of an alkaline, thermostable beta-mannanase which hydrolyses beta-l,4-D-mannopyranosιde bonds of e.g. mannans and produces manno-o gosacchandes. JP-63036774 relates to the Bacillus microorganism FERM P-8856 which produces beta-mannanase and beta-mannosidase at an alkaline pH. JP-08051975 discloses alkaline beta-mannanases from alkalophihc Bacillus sp. AM- 001. A puπfied mannanase from Bacillus amyloliquefaciens useful in the bleaching of pulp and paper and a method of preparation thereof is disclosed in WO 97/11164. WO 91/18974 descnbes a hemicellulase such as a glucanase, xylanase or mannanase active at an extreme pH and temperature. WO 94/25576 discloses an enzyme from Aspergillus aculeatus, CBS 101.43, exhibiting mannanase activity which may be useful for degradation or modification of plant or algae cell wall matenal. WO 93/24622 discloses a mannanase isolated from Tnchoderma reseei useful for bleaching hgnocellulosic pulps. An hemicellulase capable of degrading mannan- contaimng hemicellulose is descπbed in W091/18974 and a puπfied mannanase from Bacillus amyloliquefaciens is descnbed in W097/11164. Preferably, the mannanase enzyme will be an alkaline mannanase as defined below, more preferably, a mannanase ong atmg from a bactenal source. Especially, the laundry detergent composition of the present invention will compnse an alkaline mannanase selected from the mannanase from the strain Bacillus agaradhaerens NICMB 40482; the mannanase from Bacillus subtilis strain 168, gene yght; the mannanase from Bacillus sp. 1633 and/or the mannanase from Bacillus sp. AAI12. Most preferred mannanase for the inclusion in the detergent compositions of the present invention is the mannanase enzyme ongmatmg from Bacillus sp. 1633 as descπbed in the co-pendmg Danish patent application No. PA 1998 01340.

The terms "alkaline mannanase enzyme" is meant to encompass an enzyme having an enzymatic activity of at least 10%, preferably at least 25%, more preferably at least 40% of its maximum activity at a given pH ranging from 7 to 12, preferably 7.5 to 10.5.

The alkaline mannanase from Bacillus agaradhaerens NICMB 40482 is descπbed in the co-pendmg U.S. patent application seπal No. 09/111,256. More specifically, this mannanase is: l) a polypeptide produced by Bacillus agaradhaerens, NCIMB 40482; or n) a polypeptide compnsmg an amino acid sequence as shown m positions 32-343 of SEQ ID NO:2 as shown in U.S. patent application senal No. 09/111,256; or in) an analogue of the polypeptide defined in l) or n) which is at least 70% homologous with said polypeptide, or is denved from said polypeptide by substitution, deletion or addition of one or several ammo acids, or is lmmunologically reactive with a polyclonal antibody raised against said polypeptide in punfied form.

Also encompassed is the corresponding isolated polypeptide having mannanase activity selected from the group consisting of:

(a) polynucleotide molecules encoding a polypeptide having mannanase activity and compnsmg a sequence of nucleotides as shown in SEQ ID NO. 1 from nucleotide 97 to nucleotide 1029 as shown in U.S. patent application senal No

09/111,256;

(b) species homologs of (a);

(c) polynucleotide molecules that encode a polypeptide having mannanase activity that is at least 70% identical to the amino acid sequence of SEQ ID NO 2 from ammo acid residue 32 to amino acid residue 343 as shown m U S. patent application senal No 09/111,256,

(d) molecules complementary to (a), (b) or (c), and

(e) degenerate nucleotide sequences of (a), (b), (c) or (d) The plasmid pSJ1678 compnsmg the polynucleotide molecule (the DNA sequence) encoding said mannanase has been transformed into a strain of the Escherichia coll which was deposited by the inventors according to the Budapest Treaty on the International Recognition of the Deposit of Microorganisms for the Purposes of Patent Procedure at the Deutsche Sammlung von Mikroorgamsmen und Zellkulturen GmbH, Mascheroder Weg lb, D-38124 Braunschweig, Federal Republic of Germany, on 18 May 1998 under the deposition number DSM 12180.

A second more preferred enzyme is the mannanase from the Bacillus subtilis strain 168, which is descπbed in the co-pending U.S. patent application senal No. 09/095,163. More specifically, this mannanase is: l) is encoded by the coding part of the DNA sequence shown in SED ID No. 5 shown in the U.S. patent application senal No. 09/095,163 or an analogue of said sequence; and/or n) a polypeptide compnsmg an ammo acid sequence as shown SEQ ID NO:6 shown in the U.S. patent application senal No. 09/095,163; or in) an analogue of the polypeptide defined in u) which is at least 70% homologous with said polypeptide, or is denved from said polypeptide by substitution, deletion or addition of one or several ammo acids, or is lmmunologically reactive with a polyclonal antibody raised against said polypeptide m puπfied form. Also encompassed m the corresponding isolated polypeptide having mannanase activity selected from the group consisting of: (a) polynucleotide molecules encoding a polypeptide having mannanase activity and compnsmg a sequence of nucleotides as shown in SEQ ID NO:5 as shown in the U.S. patent application senal No 09/095,163

(b) species homologs of (a);

(c) polynucleotide molecules that encode a polypeptide having mannanase activity that is at least 70% identical to the ammo acid sequence of SEQ ID NO

6 as shown in the U.S. patent application senal No. 09/095,163,

(d) molecules complementary to (a), (b) or (c), and

(e) degenerate nucleotide sequences of (a), (b), (c) or (d) A third more preferred mannanase is descπbed m the co-pending Danish patent application No PA 1998 01340. More specifically, this mannanase is: 0 a polypeptide produced by Bacillus sp 1633; n) a polypeptide compnsmg an ammo acid sequence as shown in positions 33-340 of SEQ ID NO:2 as shown in the Danish application No. PA 1998 01340; or in) an analogue of the polypeptide defined in l) or n) which is at least 65% homologous with said polypeptide, is denved from said polypeptide by substitution, deletion or addition of one or several amino acids, or is lmmunologically reactive with a polyclonal antibody raised against said polypeptide m puπfied form. Also encompassed is the corresponding isolated polynucleotide molecule selected from the group consisting of:

(a) polynucleotide molecules encoding a polypeptide having mannanase activity and compnsmg a sequence of nucleotides as shown m SEQ ID NO: 1 from nucleotide 317 to nucleotide 1243 the Danish application No. PA 1998 01340;

(b) species homologs of (a);

(c) polynucleotide molecules that encode a polypeptide having mannanase activity that is at least 65% identical to the ammo acid sequence of SEQ ID NO: 2 from amino acid residue 33 to ammo acid residue 340 the Danish application

No. PA 1998 01340;

(d) molecules complementary to (a), (b) or (c); and

(e) degenerate nucleotide sequences of (a), (b), (c) or (d).

The plasmid pBXM3 compnsmg the polynucleotide molecule (the DNA sequence) encoding a mannanase of the present invention has been transformed into a strain of the Escherichia coli which was deposited by the inventors according to the Budapest Treaty on the International Recognition of the Deposit of Microorganisms for the Purposes of Patent Procedure at the Deutsche Sammlung von Mikroorgamsmen und Zellkulturen GmbH, Mascheroder Weg lb, D-38124 Braunschweig, Federal Republic of Germany, on 29 May 1998 under the deposition number DSM 12197.

A fourth more preferred mannanase is descπbed in the Danish co-pendmg patent application No. PA 1998 01341. More specifically, this mannanase is: I) a polypeptide produced by Bacillus sp. AAI 12; n) a polypeptide compnsmg an amino acid sequence as shown in positions

25-362 of SEQ ID NO:2as shown in the Danish application No. PA 1998 01341; or in) an analogue of the polypeptide defined in I) or n) which is at least 65% homologous with said polypeptide, is denved from said polypeptide by substitution, deletion or addition of one or several ammo acids, or is lmmunologically reactive with a polyclonal antibody raised against said polypeptide in punfied form. Also encompassed is the corresponding isolated polynucleotide molecule selected from the group consisting of

(a) polynucleotide molecules encoding a polypeptide having mannanase activity and compnsmg a sequence of nucleotides as shown in SEQ ID NO: 1 from nucleotide 225 to nucleotide 1236 as shown in the Danish application No. PA 1998 01341; (b) species homologs of (a);

(c) polynucleotide molecules that encode a polypeptide having mannanase activity that is at least 65% identical to the ammo acid sequence of SEQ ID NO: 2 from amino acid residue 25 to amino acid residue 362 as shown m the Danish application No. PA 1998 01341; (d) molecules complementary to (a), (b) or (c); and

(e) degenerate nucleotide sequences of (a), (b), (c) or (d).

The plasmid pBXMl compnsmg the polynucleotide molecule (the DNA sequence) encoding a mannanase of the present invention has been transformed into a strain of the Escherichia coli which was deposited by the inventors according to the Budapest Treaty on the International Recognition of the Deposit of Microorganisms for the Purposes of Patent Procedure at the Deutsche Sammlung von Mikroorgamsmen und Zellkulturen GmbH, Mascheroder Weg lb, D-38124 Braunschweig, Federal Republic of Germany, on 7 October 1998 under the deposition number DSM 12433.

The mannanase, when present, is incorporated into the treating compositions of the present invention preferably at a level of from 0.0001% to 2%, more preferably from 0.0005% to 0.1%, most preferred from 0.001% to 0.02% pure enzyme by weight of the composition.

The compositions of the present invention may also compπse a xyloglucanase enzyme Suitable xyloglucanases for the purpose of the present invention are enzymes exhibiting endoglucanase activity specific for xyloglucan, preferably at a level of from about 0.001% to about 1%, more preferably from about 0.01% to about 0.5%, by weight of the composition. As used herein, the term "endoglucanase activity" means the capability of the enzyme to hydrolyze 1,4-β-D-glycosιdιc linkages present in any cellulosic mateπal, such as cellulose, cellulose denvatives, lichemn, β-D-glucan, or xyloglucan. The endoglucanase activity may be determined m accordance with methods known in the art, examples of which are descnbed in WO 94/14953 and hereinafter. One unit of endoglucanase activity (e.g. CMCU, AVIU, XGU or BGU) is defined as the production of 1 μmol reducing sugar/mm from a glucan substrate, the glucan substrate being, e.g., CMC (CMCU), acid swollen Avicell (AVIU), xyloglucan (XGU) or cereal β-glucan (BGU). The reducing sugars are determined as descπbed in WO 94/14953 and hereinafter. The specific activity of an endoglucanase towards a substrate is defined as units/mg of protein.

Suitable are enzymes exhibiting as its highest activity XGU endoglucanase activity (hereinafter "specific for xyloglucan"), which enzyme:

I) is encoded by a DNA sequence compnsmg or included in at least one of the following partial sequences

(a) ATTCATTTGT GGACAGTGGA C (SEQ ID No: 1)

(b) GTTGATCGCA CATTGAACCA (SEQ ID NO: 2)

(c) ACCCCAGCCG ACCGATTGTC (SEQ ID NO: 3)

(d) CTTCCTTACC TCACCATCAT (SEQ ID NO: 4) (e) TTAACATCTT TTCACCATGA (SEQ ID NO: 5)

(f) AGCTTTCCCT TCTCTCCCTT (SEQ ID NO: 6)

(g) GCCACCCTGG CTTCCGCTGC CAGCCTCC (SEQ ID NO: 7) (h) GACAGTAGCA ATCCAGCATT (SEQ ID NO: 8)

(l) AGCATCAGCC GCTTTGTACA (SEQ JD NO: 9) 0) CCATGAAGTT CACCGTATTG (SEQ ID NO: 10)

(k) GCACTGCTTC TCTCCCAGGT (SEQ ID NO: 11)

(1) GTGGGCGGCC CCTCAGGCAA (SEQ ID NO: 12)

(m) ACGCTCCTCC AATTTTCTCT (SEQ ID NO: 13)

(n) GGCTGGTAG TAATGAGTCT (SEQ JD NO: 14) (o) GGCGCAGAGT TTGGCCAGGC (SEQ ID NO: 15)

(p) CAACATCCCC GGTGTTCTGG G (SEQ ID NO: 16)

(q) AAAGATTCAT TTGTGGACAG TGGACGTTGA TCGCACATTG AACCAACCCC

AGCCGACCGA TTGTCCTTCC TTACCTCACC ATCATTTAAC ATCTTTTCAC CATGAAGCTT

TCCCTTCTCT

CCCTTGCCAC CCTGGCTTCC GCTGCCAGCCTCCAGCGCCG CACACTTCTG

CGGTCAGTGG GATACCGCCA CCGCCGGTGA CTTCACCCTG TACAACGACC TTTGGGGCGA

GACGGCCGGC

ACCGGCTCCC AGTGCACTGG AGTCGACTCC TACAGCGGCG ACACCATCGC

TTGTCACACC

AGCAGGTCCT GGTCGGAGTA GCAGCAGCGT CAAGAGCTAT GCCAACG (SEQ ID NO: 17) or

(r) CAGCATCTCC ATTGAGTAAT CACGTTGGTG TTCGGTGGCC CGCCGTGTTG

CGTGGCGGAG

GCTGCCGGGA GACGGGTGGG GATGGTGGTG GGAGAGAATG TAGGGCGCCG

TGTTTCAGTC CCTAGGCAGG ATACCGGAAA ACCGTGTGGT AGGAGGTTTA TAGGTTTCCA

GGAGACGCTG

TATAGGGGAT AAATGAGATT GAATGGTGGC CACACTCAAA CCAACCAGGT

CCTGTACATA

CAATGCATAT ACCAATTATA CCTACCAAAA AAAAAAAAAA AAAAAAAAAA AAAA (SEQ ID NO: 18) or a sequence homologous thereto encoding a polypeptide specific for xyloglucan with endoglucanase activity, n) is lmmunologically reactive with an antibody raised against a highly punfied endoglucanase encoded by the DNA sequence defined in i) and denved from Aspergillus aculeatus, CBS 101.43, and is specific for xyloglucan.

More specifically, as used herein the term "specific for xyloglucan" means that the endoglucanse enzyme exhibits its highest endoglucanase activity on a xyloglucan substrate, and preferably less than 75% activity, more preferably less than 50%> activity, most preferably less than about 25%_> activity, on other cellulose-containing substrates such as carboxymethyl cellulose, cellulose, or other glucans.

Preferably, the specificity of an endoglucanase towards xyloglucan is further defined as a relative activity determined as the release of reducing sugars at optimal conditions obtained by incubation of the enzyme with xyloglucan and the other substrate to be tested, respectively. For instance, the specificity may be defined as the xyloglucan to β-glucan activity (XGU/BGU), xyloglucan to carboxy methyl cellulose activity (XGU/CMCU), or xyloglucan to acid swollen Avicell activity (XGU/ AVIU), which is preferably greater than about 50, such as 75, 90 or 100.

The term "denved from" as used herein refers not only to an endoglucanase produced by strain CBS 101 43, but also an endoglucanase encoded by a DNA sequence isolated from strain CBS 101 43 and produced in a host organism transformed with said DNA sequence. The term "homologue" as used herein indicates a polypeptide encoded by DNA which hybπdizes to the same probe as the DNA coding for an endoglucanase enzyme specific for xyloglucan under certain specified conditions (such as presoakmg in 5xSSC and prehybndizmg for 1 h at -40°C in a solution of 5xSSC, 5xDenhardt's solution, and 50 μg of denatured sonicated calf thymus DNA, followed by hybπdization in the same solution supplemented with 50 μCi 32-P-dCTP labelled probe for 18 h at -40°C and washing three times in 2xSSC, 0.2% SDS at 40°C for 30 minutes). More specifically, the term is intended to refer to a DNA sequence which is at least 70% homologous to any of the sequences shown above encoding an endoglucanase specific for xyloglucan, including at least 75%>, at least 80%, at least 85%, at least 90%> or even at least 95% with any of the sequences shown above. The term is intended to include modifications of any of the DNA sequences shown above, such as nucleotide substitutions which do not give nse to another ammo acid sequence of the polypeptide encoded by the sequence, but which correspond to the codon usage of the host organism into which a DNA construct compnsmg any of the DNA sequences is introduced or nucleotide substitutions which do give nse to a different ammo acid sequence and therefore, possibly, a different ammo acid sequence and therefore, possibly, a different protein structure which might give nse to an endoglucanase mutant with different properties than the native enzyme. Other examples of possible modifications are insertion of one or more nucleotides into the sequence, addition of one or more nucleotides at either end of the sequence, or deletion of one or more nucleotides at either end or within the sequence. Endoglucanase specific for xyloglucan useful in the present invention preferably is one which has a XGU/BGU, XGU/CMU and or XGU/ AVIU ratio (as defined above) of more than 50, such as 75, 90 or 100.

Furthermore, the endoglucanase specific for xyloglucan is preferably substantially devoid of activity towards β-glucan and/or exhibits at the most 25% such as at the most 10%> or about 5%, activity towards carboxymethyl cellulose and or Avicell when the activity towards xyloglucan is 100%. In addition, endoglucanase specific for xyloglucan of the invention is preferably substantially devoid of transferase activity, an activity which has been observed for most endoglucanases specific for xyloglucan of plant ongin Endoglucanase specific for xyloglucan may be obtained from the fungal species A. aculeatus, as descπbed in WO 94/14953 Microbial endoglucanases specific for xyloglucan has also been descnbed in WO 94/14953. Endoglucanases specific for xyloglucan from plants have been descπbed, but these enzymes have transferase activity and therefore must be considered infeπor to microbial endoglucanses specific for xyloglucan whenever extensive degradation of xyloglucan is desirable. An additional advantage of a microbial enzyme is that it, in general, may be produced in higher amounts in a microbial host, than enzymes of other ongins.

The xyloglucanase, when present, is incorporated into the treating compositions of the invention preferably at a level of from 0.0001% to 2%, more preferably from 0.0005% to 0.1%, most preferred from 0.001% to 0.02% pure enzyme by weight of the composition.

The above-mentioned enzymes may be of any suitable ongm, such as vegetable, animal, bactenal, fungal and yeast ongm. Ongm can further be mesophihc or extremophihc (psychrophihc, psychrotrophic, thermophihc, barophihc, alkalophi c, acidophi c, halophihc, etc.). Punfied or non-puπfied forms of these enzymes may be used. Nowadays, it is common practice to modify wild-type enzymes via protein / genetic engineenng techniques in order to optimize their performance efficiency in the laundry detergent and/or fabnc care compositions of the invention. For example, the vanants may be designed such that the compatibility of the enzyme to commonly encountered ingredients of such compositions is increased. Alternatively, the vanant may be designed such that the optimal pH, bleach or chelant stability, catalytic activity and the like, of the enzyme vanant is tailored to suit the particular laundry application.

In particular, attention should be focused on amino acids sensitive to oxidation m the case of bleach stability and on surface charges for the surfactant compatibility. The isoelectπc point of such enzymes may be modified by the substitution of some charged amino acids, e.g. an increase m isoelectπc point may help to improve compatibility with anionic surfactants. The stability of the enzymes may be further enhanced by the creation of e.g. additional salt bndges and enforcing calcium binding sites to increase chelant stability.

Other suitable cleaning adjunct matenals that can be added are enzyme oxidation scavengers. Examples of such enzyme oxidation scavengers are ethoxylated tetraethylene polyamines. A range of enzyme matenals are also disclosed in WO 9307263 and WO 9307260 to

Genencor International, WO 8908694, and U.S. 3,553,139, January 5, 1971 to McCarty et al Enzymes are further disclosed in U S. 4,101,457, and m U.S. 4,507,219. Enzyme materials particularly useful for liquid detergent formulations, and their incorporation into such formulations, are disclosed in U.S. 4,261,868. Enzyme Stabilizers - Enzymes for use in detergents can be stabilized by various techniques. Enzyme stabilization techniques are disclosed and exemplified in U.S. 3,600,319, EP 199,405 and EP 200,586. Enzyme stabilization systems are also descnbed, for example, m U.S. 3,519,570. ~A useful Bacillus, sp. AC13 giving proteases, xylanases and cellulases, is descπbed m WO 9401532 The enzymes employed herein can be stabilized by the presence of water-soluble sources of calcium and/or magnesium ions in the finished compositions which provide such ions to the enzymes. Suitable enzyme stabilizers and levels of use are descnbed in U.S. Pat. Nos. 5,705,464, 5,710,115 and 5,576,282.

Builders - The detergent and laundry compositions descnbed herein preferably compπse one or more detergent builders or builder systems. When present, the compositions will typically compπse at least about 1% builder, preferably from about 5%, more preferably from about 10% to about 80%, preferably to about 50%, more preferably to about 30% by weight, of detergent builder. Lower or higher levels of builder, however, are not meant to be excluded.

Preferred builders for use m the detergent and laundry compositions, particularly dishwashing compositions, descnbed herein include, but are not limited to, water-soluble builder compounds, (for example polycarboxylates) as descnbed in U.S. Patent Nos. 5,695,679, 5,705,464 and 5,710,115. Other suitable polycarboxylates are disclosed in U.S. Patent

Nos. 4,144,226, 3,308,067 and 3,723,322. Preferred polycarboxylates are hydroxycarboxylates containing up to three carboxy groups per molecule, more particularly titrates.

Inorganic or P-contaming detergent builders include, but are not limited to, the alkali metal, ammonium and alkanolammonium salts of polyphosphates (exemplified by the tnpolyphosphates, pyrophosphates, and glassy polymenc meta-phosphates), phosphonates (see, for example, U.S. Patent Nos. 3,159,581; 3,213,030; 3,422,021; 3,400,148 and 3,422,137), phytic acid, silicates, carbonates (including bicarbonates and sesquicarbonates), sulphates, and alummosilicates. However, non-phosphate builders are required in some locales. Importantly, the compositions herein function surpπsmgly well even m the presence of the so-called "weak" builders (as compared with phosphates) such as citrate, or in the so-called "underbuilt" situation that may occur with zeolite or layered silicate builders.

Suitable silicates include the water-soluble sodium silicates with an Sι0₂:Na₂0 ratio of from about 1.0 to 2.8, with ratios of from about 1.6 to 2.4 being preferred, and about 2.0 ratio being most preferred. The silicates may be in the form of either the anhydrous salt or a hydrated salt. Sodium silicate with an Sι0₂:Na 0 ratio of 2.0 is the most preferred. Silicates, when present, are preferably present in the detergent and laundry compositions descπbed herein at a level of from about 5% to about 50% by weight of the composition, more preferably from about 10% to about 40% by weight.

Partially soluble or insoluble builder compounds, which are suitable for use in the detergent and laundry compositions, particularly granular detergent compositions, include, but are not limited to, crystalline layered silicates, preferably crystalline layered sodium silicates (partially water-soluble) as descπbed m U.S. Patent No. 4,664,839, and sodium alummosilicates (water-insoluble). When present in detergent and laundry compositions, these builders are typically present at a level of from about 1% to 80% by weight, preferably from about 10% to 70% by weight, most preferably from about 20% to 60% by weight of the composition. Crystalline layered sodium silicates having the general formula NaMSι_xθ2_x+ι -yH2θ wherein M is sodium or hydrogen, x is a number from about 1.9 to about 4, preferably from about 2 to about 4, most preferably 2, and y is a number from about 0 to about 20, preferably 0 can be used in the compositions descπbed herein. Crystalline layered sodium silicates of this type are disclosed in EP-A-0164514 and methods for their preparation are disclosed m DE-A- 3417649 and DE-A-3742043. The most preferred mateπal is delta-Na2Sιθ5, available from

Hoechst AG as NaSKS-6 (commonly abbreviated herein as "SKS-6"). Unlike zeolite builders, the Na SKS-6 silicate builder does not contain aluminum. NaSKS-6 has the delta-Na2Sιθ5 morphology form of layered silicate. SKS-6 is a highly preferred layered silicate for use m the compositions descnbed herein herein, but other such layered silicates, such as those having the general formula NaMSι_xθ2_x+ι-yH2θ wherein M is sodium or hydrogen, x is a number from 1.9 to 4, preferably 2, and y is a number from 0 to 20, preferably 0 can be used m the compositions descπbed herein. Vanous other layered silicates from Hoechst include NaSKS-5, NaSKS-7 and NaSKS-11, as the alpha, beta and gamma forms. As noted above, the delta-Na2Sιθ5 (NaSKS-6 form) is most preferred for use herein. Other silicates may also be useful such as for example magnesium silicate, which can serve as a cnspenmg agent in granular formulations, as a stabilizing agent for oxygen bleaches, and as a component of suds control systems.

The crystalline layered sodium silicate mateπal is preferably present in granular detergent compositions as a particulate m intimate admixture with a solid, water-soluble lomzable mateπal. The solid, water-soluble lomzable mateπal is preferably selected from organic acids, organic and inorganic acid salts and mixtures thereof.

Alummosihcate builders are of great importance in most currently marketed heavy duty granular detergent compositions, and can also be a significant builder ingredient in liquid detergent formulations. Alummosihcate builders have the empincal formula- [M_z(A10₂)_y]-xH₂0 wherein z and y are integers of at least 6, the molar ratio of z to y is in the range from 1.0 to about 0 5, and x is an integer from about 15 to about 264. Preferably, the alummosihcate builder is an alummosihcate zeolite having the unit cell formula: Na_z[(A10₂)_z(Sι0₂)_y] xH₂0 wherein z and y are at least 6; the molar ratio of z to y is from 1.0 to 0.5 and x is at least 5, preferably 7.5 to 276, more preferably from 10 to 264. The alummosihcate builders are preferably in hydrated form and are preferably crystalline, containing from about 10% to about 28%o, more preferably from about 18% to about 22% water in bound form. These alummosihcate ion exchange mateπals can be crystalline or amorphous in structure and can be naturally-occumng alummosilicates or synthetically denved. A method for producing alummosihcate ion exchange matenals is disclosed in U.S. 3,985,669. Preferred synthetic crystalline alummosihcate ion exchange mateπals useful herein are available under the designations Zeolite A, Zeolite B, Zeolite P, Zeolite X, Zeolite MAP and Zeolite HS and mixtures thereof. In an especially preferred embodiment, the crystalline alummosihcate ion exchange matenal has the formula:

Na₁₂[(Alθ2)i2(Sιθ2)i2]- H₂0 wherein x is from about 20 to about 30, especially about 27. This matenal is known as Zeolite A. Dehydrated zeolites (x = 0 - 10) may also be used herein. Preferably, the alummosihcate has a particle size of about 0.1-10 microns m diameter. Zeolite X has the formula:

Na8₆[(Alθ2)₈6(SιO₂)₁₀6]-276H2θ

Citrate builders, e.g., citπc acid and soluble salts thereof (particularly sodium salt), are polycarboxylate builders of particular importance for heavy duty liquid detergent formulations due to their availability from renewable resources and their biodegradability. Citrates can also be used in granular compositions, especially in combination with zeolite and/or layered silicate builders. Oxydisuccmates are also especially useful in such compositions and combinations

Also suitable in the detergent compositions descnbed herein are the 3,3-dιcarboxy-4- oxa-l,6-hexanedιoates and the related compounds disclosed in U.S. 4,566,984. Useful succmic acid builders include the C5-C20 alkyl and alkenyl succmic acids and salts thereof. A particularly preferred compound of this type is dodecenylsuccinic acid. Specific examples of succmate builders include- laurylsuccmate, mynstylsuccinate, palmitylsuccmate, 2- dodecenylsuccmate (preferred), 2-pentadecenylsuccmate, and the like. Laurylsuccmates are the preferred builders of this group, and are descπbed in European Patent Application 86200690.5/0,200,263, published November 5, 1986.

Fatty acids, e.g., C^-Cjg monocarboxyhc acids, can also be incorporated into the compositions alone, or m combination with the aforesaid builders, especially citrate and/or the succmate builders, to provide additional builder activity. Such use of fatty acids will generally result in a diminution of sudsmg, which should be taken into account by the formulator.

Dispersants - One or more suitable polyalkyleneimine dispersants may be incorporated into the laundry compositions of the present invention. Examples of such suitable dispersants can be found in European Patent Application Nos. 111,965, 111,984, and 112,592; U.S. Patent Nos. 4,597,898, 4,548,744, and 5,565,145. However, any suitable clay/soil dispersent or anti- redepostion agent can be used in the laundry compositions of the present invention.

In addition, polymenc dispersing agents which include polymenc polycarboxylates and polyethylene glycols, are suitable for use m the present invention. Unsaturated monomeπc acids that can be polymenzed to form suitable polymenc polycarboxylates include acrylic acid, maleic acid (or maleic anhydnde), fumanc acid, itaconic acid, acomtic acid, mesaconic acid, citracomc acid and methylenemalomc acid. Particularly suitable polymenc polycarboxylates can be denved from acrylic acid. Such acrylic acid-based polymers which are useful herein are the water- soluble salts of polymenzed acrylic acid. The average molecular weight of such polymers in the acid form preferably ranges from about 2,000 to 10,000, more preferably from about 4,000 to 7,000 and most preferably from about 4,000 to 5,000 Water-soluble salts of such acrylic acid polymers can include, for example, the alkali metal, ammonium and substituted ammonium salts. Soluble polymers of this type are known mateπals. Use of polyacrylates of this type in detergent compositions has been disclosed, for example, m U.S. 3,308,067.

Acryhc/maleic-based copolymers may also be used as a preferred component of the dispersing/anti-redeposition agent. Such mateπals include the water-soluble salts of copolymers of acrylic acid and maleic acid. The average molecular weight of such copolymers in the acid form preferably ranges from about 2,000 to 100,000, more preferably from about 5,000 to 75,000, most preferably from about 7,000 to 65,000. The ratio of acrylate to maleate segments in such copolymers will generally range from about 30: 1 to about 1 : 1, more preferably from about 10: 1 to 2.1. Water-soluble salts of such acrylic acid/maleic acid copolymers can include, for example, the alkali metal, ammonium and substituted ammonium salts. Soluble acrylate/maleate copolymers of this type are known matenals which are descnbed in European Patent Application No. 66915, published December 15, 1982, as well as in EP 193,360, published September 3, 1986, which also descnbes such polymers compnsmg hydroxypropylacrylate. Still other useful dispersing agents include the maleic/acryhc/vinyl alcohol terpolymers. Such mateπals are also disclosed m EP 193,360, including, for example, the 45/45/10 terpolymer of acryhc/maleic/vinyl alcohol.

Another polymenc matenal which can be included is polyethylene glycol (PEG). PEG can exhibit dispersing agent performance as well as act as a clay soil removal-antiredeposition agent. Typical molecular weight ranges for these purposes range from about 500 to about

100,000, preferably from about 1,000 to about 50,000, more preferably from about 1,500 to about

10,000.

Polyaspartate and polyglutamate dispersing agents may also be used, especially m conjunction with zeolite builders. Dispersing agents such as polyaspartate preferably have a molecular weight (avg.) of about 10,000.

Soil Release Agents - The compositions according to the present invention may optionally compπse one or more soil release agents. If utilized, soil release agents will generally compπse from about 0.01%, preferably from about 0.1 %>, more preferably from about 0.2%> to about 10%, preferably to about 5%, more preferably to about 3% by weight, of the composition. Non mitmg examples of suitable soil release polymers are disclosed m: U.S. Patent Nos. 5,728,671; 5,691,298; 5,599,782; 5,415,807; 5,182,043; 4,956,447; 4,976,879; 4,968,451; 4,925,577; 4,861,512; 4,877,896; 4,771,730; 4,711,730; 4,721,580; 4,000,093; 3,959,230; and 3,893,929; and European Patent Application 0 219 048. Further suitable soil release agents are descnbed in U.S. Patent Nos. 4,201,824;

4,240,918; 4,525,524; 4,579,681; 4,220,918; and 4,787,989; EP 279,134 A; EP 457,205 A; and DE 2,335,044.

Chelatmg Agents - The compositions of the present invention herein may also optionally contain a chelatmg agent which serves to chelate metal ions and metal impunties which would otherwise tend to deactivate the bleaching agent(s). Useful chelatmg agents can include amino carboxylates, phosphonates, amino phosphonates, polyfunctionally-substituted aromatic chelatmg agents and mixtures thereof. Further examples of suitable chelatmg agents and levels of use are descnbed in U.S. Pat. Nos. 5,705,464, 5,710,115, 5,728,671 and 5,576,282.

The compositions herein may also contain water-soluble methyl glycme diacetic acid (MGDA) salts (or acid form) as a chelant or co-builder useful with, for example, insoluble builders such as zeolites, layered silicates and the like.

If utilized, these chelatmg agents will generally compnse from about 0.1%. to about 15%, more preferably from about 0 1% to about 3.0% by weight of the detergent compositions herein Suds suppressor - Another optional ingredient is a suds suppressor, exemplified by sihcones, and sihca-sihcone mixtures Examples of suitable suds suppressors are disclosed in

U.S. Patent Nos. 5,707,950 and 5,728,671. These suds suppressors are normally employed at levels of from 0 001% to 2% by weight of the composition, preferably from 0.01% to 1%> by weight

Softening agents - Fabnc softening agents can also be incorporated into laundry detergent compositions in accordance with the present invention. Inorganic softening agents are exemplified by the smectite clays disclosed in GB-A-1 400 898 and m U.S. 5,019,292 Organic softening agents include the water insoluble tertiary am es as disclosed m GB-A-1 514 276 and EP-B-011 340 and their combination with mono C12-C14 quaternary ammonium salts are disclosed in EP-B-026 527 and EP-B-026 528 and di-long-chain amides as disclosed m EP-B-0 242 919. Other useful organic ingredients of fabnc softening systems include high molecular weight polyethylene oxide mateπals as disclosed m EP-A-0 299 575 and 0 313 146.

Particularly suitable fabnc softening agents are disclosed in U.S. Patent Nos. 5,707,950 and 5,728,673.

Levels of smectite clay are normally in the range from 2% to 20%, more preferably from 5% to 15% by weight, with the mateπal being added as a dry mixed component to the remainder of the formulation. Organic fabnc softening agents such as the water-insoluble tertiary ammes or dilong chain amide mateπals are incorporated at levels of from 0.5% to 5% by weight, normally from 1% to 3% by weight whilst the high molecular weight polyethylene oxide mateπals and the water soluble cationic matenals are added at levels of from 0.1% to 2%>, normally from 0.15% to 1.5% by weight. These mateπals are normally added to the spray dned portion of the composition, although in some instances it may be more convenient to add them as a dry mixed particulate, or spray them as molten liquid on to other solid components of the composition. Biodegradable quaternary ammonium compounds as descnbed in EP-A-040 562 and EP-

A-239 910 have been presented as alternatives to the traditionally used di-long alkyl chain ammonium chlondes and methyl sulfates.

Non-hmitmg examples of softener-compatible anions for the quaternary ammonium compounds and amme precursors include chloπde or methyl sulfate. Dye transfer inhibition - The detergent compositions of the present invention can also include compounds for inhibiting dye transfer from one fabnc to another of solubihzed and suspended dyes encountered dunng fabnc laundenng and conditioning operations involving colored fabncs. i Polymeric dye transfer inhibiting agents The detergent compositions according to the present invention can also compπse from 0 001% to 10 %, preferably from 0.01% to 2%, more preferably from 0.05% to 1% by weight of polymenc dye transfer inhibiting agents. Said polymenc dye transfer inhibiting agents are normally incorporated into detergent compositions in order to inhibit the transfer of dyes from colored fabπcs onto fabrics washed therewith. These polymers have the ability to complex or adsorb the fugitive dyes washed out of dyed fabπcs before the dyes have the opportunity to become attached to other articles in the wash.

Especially suitable polymenc dye transfer inhibiting agents are polyamme N-oxide polymers, copolymers of N-vmylpyrrohdone and N-vmyhmidazole, polyvmylpyrrohdone polymers, polyvmyloxazohdones and polyvmylimidazoles or mixtures thereof. Examples of such dye transfer inhibiting agents are disclosed in U.S. Patent Nos. 5,707,950 and 5,707,951.

Additional suitable dye transfer inhibiting agents include, but are not limited to, cross- linked polymers. Cross-linked polymers are polymers whose backbone are interconnected to a certain degree; these links can be of chemical or physical nature, possibly with active groups n the backbone or on branches; cross-linked polymers have been descnbed in the Journal of Polymer Science, volume 22, pages 1035-1039.

In one embodiment, the cross-linked polymers are made in such a way that they form a three-dimensional ngid structure, which can entrap dyes in the pores formed by the three- dimensional structure. In another embodiment, the cross-linked polymers entrap the dyes by swelling. Such cross-linked polymers are descπbed in the co-pending European patent application 94870213.9.

Addition of such polymers also enhances the performance of the enzymes according the invention. pH and Buffeπng Vaπation - Many of the detergent and laundry compositions descπbed herein will be buffered, i.e., they are relatively resistant to pH drop m the presence of acidic soils. However, other compositions herein may have exceptionally low buffeπng capacity, or may be substantially unbuffered. Techniques for controlling or varying pH at recommended usage levels more generally include the use of not only buffers, but also additional alkalis, acids, pH-jump systems, dual compartment containers, etc, and are well known to those skilled in the art. Other Mateπals - Detersive ingredients or adjuncts optionally included in the instant compositions can include one or more matenals for assisting or enhancing laundry performance, treatment of the substrate to be cleaned, or designed to improve the aesthetics of the compositions. Adjuncts which can also be included in compositions of the present invention, at their conventional art-established levels for use (generally, adjunct matenals compnse, in total, from about 30% to about 99.9%, preferably from about 70% to about 95%, by weight of the compositions), include other active ingredients such as non-phosphate builders, color speckles, silvercare, anti-tarmsh and or anti-corrosion agents-, dyes, fillers, germicides, alkalinity sources, hydrotropes, anti-oxidants, perfumes, solubihzmg agents, earners, processing aids, pigments, and pH control agents as described m U.S. Patent Nos. 5,705,464, 5,710,115, 5,698,504, 5,695,679, 5,686,014 and 5,646,101.

Methods of Laundry - In addition to the methods for laundry fabπcs descnbed herein, the invention herein also encompasses a laundenng pretreatment process for fabncs which have been soiled or stained compnsmg directly contacting said stams and/or soils with a highly concentrated form of the laundry composition set forth above pnor to washing such fabπcs using conventional aqueous washing solutions. Preferably, the laundry composition remains in contact with the soil/stam for a peπod of from about 30 seconds to 24 hours pnor to washing the pretreated soiled/stamed substrate in conventional manner. More preferably, pretreatment times will range from about 1 to 180 minutes. PRODUCT WITH INSTRUCTIONS FOR USE

The present invention also encompasses the inclusion of instructions on the use of the particulate solid containing compositions of the present invention with the packages containing the compositions herein or with other forms of advertising associated with the sale or use of the compositions. The instructions may be included in any manner typically used by consumer product manufactunng or supply companies. Examples include providing instructions on a label attached to the container holding the composition; on a sheet either attached to the container or accompanying it when purchased; or m advertisements, demonstrations, and/or other wntten or oral instructions which may be connected to the purchase or use of the compositions.

Specifically the instructions will include a descπption of the use of the composition, for instance, the recommended amount of composition to use m a washing machine to clean the fabnc; the recommended amount of composition to apply to the fabnc; if soaking or rubbing is appropnate .

The compositions of the present invention are preferably included m a product. The product preferably compπses a composition compnsmg one or more microspheres of the present invention and one or more particulate solids of the present invention, and optionally one or more cleaning adjunct mateπals, and further compπses instructions for using the product to launder fabπcs by contacting a fabnc in need of cleaning with an effective amount of the composition such that the composition cleans the fabnc. The following examples are meant to exemplify the microcapsules and detergent compositions of the present invention, but are not necessanly meant to limit or otherwise define the scope of the invention.

EXAMPLES

Abbreviations Used In Examples

Low Density Filler Particles

The following examples are formulations of the polymenc matenal compnsmg the polymenc expandable outer shell of the microspheres in accordance with the present invention. Components are indicated by weight (g). A blowing agent, not identified in the formulation examples, is preferably contained within the cavity of the microspheres.

Encapsulates

The following examples are formulations of the polymeric material compnsmg the polymenc expandable outer shell of the microspheres in accordance with the present invention. Components are indicated by weight (g). A blowing agent, not identified in the formulation examples, is preferably contained within the cavity of the microspheres.

Example 11 The following is a detergent composition in accordance with the present invention.

Parts Parts Parts

Neodol 23-5 21.5 21.5 21.5 n-BPP 18.5 18.5 18.5

Methyl sulfate salt of methyl quaternized polyethoxylated hexamethylenediamine 1.3 1.3 1.3

Microsphere 0.36 0.26 0.52

Na-citrate dihydrate 6.8 6.8 6.8

NaLAS 16.0 16.0 16.0

Na carbonate 10.0 10.0 10.0 brightener 0.2 0.2 0.2

Na percarbonate 12.0 12.0 12.0 bleach activator 6.0 6.0 6.0 thickening agent (CLASS) 2.0 1.0 0.5 enzymes 1.23 1.23 1.32

TiO2 0.5 0.5 0.5 suds suppressor 0.06 0.06 0.06 perfume 0.8 0.8 0.8

While particular embodiments of the subject invention have been descπbed, it will be obvious to those skilled in the art that vanous changes and modifications of the subject invention can be made without departing from the spmt and scope of the invention. It is intended to cover, in the appended claims, all such modifications that are withm the scope of the invention.

The compositions of the present invention can be suitably prepared by any process chosen by the formulator, non-limiting examples of which are descπbed m U.S. 5,691,297 Nassano et al, issued November 11, 1997; U.S. 5,574,005 Welch et al, issued November 12, 1996; U.S. 5,569,645 Dmmwell et al, issued October 29, 1996; U.S. 5,565,422 Del Greco et al, issued October 15, 1996; U.S. 5,516,448 Capeci et al, issued May 14, 1996; U.S. 5,489,392 Capeci et al, issued February 6, 1996; U.S. 5,486,303 Capeci et al, issued January 23, 1996 all of which are incorporated herein by reference.

In addition to the above examples, the compositions of the present invention can be formulated into any suitable laundry detergent composition, non-limiting examples of which are descπbed m U.S. 5,679,630 Baeck et al, issued October 21, 1997; U.S. 5,565,145 Watson et al, issued October 15, 1996; U.S. 5,478,489 Fredj et al, issued December 26, 1995; U.S. 5,470,507 Fredj et al, issued November 28, 1995; U.S. 5,466,802 Panandiker et al, issued November 14, 1995; U S. 5,460,752 Fredj et al, issued October 24, 1995; U.S. 5,458,810 Fredj et al, issued October 17, 1995; U.S. 5,458,809 Fredj et al, issued October 17, 1995; U.S. 5,288,431 Huber et al, issued February 22, 1994 all of which are incorporated herein by reference.

Having described the invention in detail with reference to preferred embodiments and the examples, it will be clear to those skilled in the art that vanous changes and modifications may be made without departing from the scope of the invention and the invention is not to be considered limited to what is descnbed m the specification.

Claims

WHAT IS CLAIMED IS:

1 A microsphere comprising a polymeric expandable outer shell made of a polymenc material that is soluble in an alkaline aqueous solution, wherein said shell defines a cavity containing a means for expanding the microsphere capable of increasing the microsphere cavity's volume; and optionally, but preferably a monomer selected from the group consisting of monoethylemcally unsaturated monomers; monomers which have at least two monoethylemcally unsaturated, non-conjugated double bindings; polar, water-soluble monoethylemcally unsaturated monomers; and optionally, but preferably one or more detergent ingredients.

2. The microsphere according to Claim 1 wherein said polymeric matenal comprises an anhydride selected from the group consisting of: ethylenically unsaturated monocarboxyhc acid anhydndes, preferably selected from the group consisting of: acrylic acid anhydπde; methacrylic acid anhydπde; ethylacryhc acid anhydride; allylacetic acid anhydnde; crotonic acid anhydπde, vmylacetic acid anhydnde and mixtures thereof; ethylenically unsaturated dicarboxyhc acid anhydndes, preferably are selected from the group consisting of: maleic acid anhydnde; C\-C\2 mono- and/or dialkyl maleic acid anhydnde; maleic acid monoaklyester anhydnde; itaconic acid anhydride; mesaconic acid anhydnde; fumanc acid anhydnde; citracomc acid anhydπde; methylenemalonic acid anhydnde; acomtic acid anhydπde and mixtures thereof, and mixtures thereof.

3 The microsphere according to Claim 1 wherein said shell is made of a material such that the density of the expanded microsphere is less than 0 4 g/mL.

4 The microsphere according to Claim 1 wherein the means for expanding said microsphere compnses a blowing agent, preferably selected from the group consisting of aliphatic hydrocarbons, chlorofluorocarbons, nitrogen, carbon dioxide, oxygen, tetraalkyl silanes and mixtures thereof, more preferably said blowing agent is an aliphatic hydrocarbon selected from the group consisting of: ethane, ethylene, propane, propene, butene, isobutene, isobutane, neopentane, isopentane, acetylene, hexane, heptane, propylene, n-butane, n-pentane, petroleum ether, halogemzed methane and mixtures thereof, contained within said cavity of said microsphere.

5 The microsphere according to Claim 1 wherein said detergent ingredients are selected from the group consisting of: surfactants, builders, bleaching agents, dye transfer inhibiting agents, chelants, dispersants, polysacchaπdes, oligosacchaπdes, softening agents, suds suppressors, earners, enzymes, enzyme stabilizing systems, polyacids, soil removal agents, anti- redeposition agents, hydrotropes, opacifiers, antioxidants, bacteπcides, dyes, perfumes, bπghteners, anti-encrustation agents and mixtures thereof.

6. A detergent composition compnsmg: (a) one or more microspheres according to Claim 1 , and

(b) one or more cleaning adjunct matenals.

7. The detergent composition according to Claim 6 wherein said one or more cleaning adjunct materials is selected from the group consisting of: surfactants, builders, bleaching agents, dye transfer inhibiting agents, chelants, dispersants, polysacchandes, ohgosacchandes, softening agents, suds suppressors, carriers, enzymes, enzyme stabilizing systems, polyacids, soil removal agents, anti-redeposition agents, hydrotropes, opacifiers, antioxidants, bacteπcides, dyes, perfumes, bπghteners, anti-encrustation agents and mixtures thereof.

8. The detergent composition according to Claim 6 wherein said detergent composition is in a form selected from the group consisting of: non-aqueous liquid laundry detergent compositions, aqueous liquid laundry detergent composition, gel laundry detergent compositions, granular laundry detergent compositions or powder laundry detergent compositions.

9. A product compnsmg the detergent composition according to Claim 6 wherein the product further compnses instructions for using said product to launder fabncs in need of cleaning by contacting said fabncs with an effective amount of said product such that the composition cleans said fabrics.

10. A method for laundenng fabncs compnsmg contacting a fabnc in need of cleaning with the laundry detergent composition according to Claim 6

11. A method for stabilizing a liquid laundry detergent composition compnsmg adding the microspheres according to Claim 1 to said composition

12. A method for inhibiting the formation of a clear top layer in a liquid laundry detergent composition comprising adding the particulate solids according to Claim 1 to said composition.

13 A method for reducing and/or preventing the deposit of residues on a fabric in need of laundering dunng laundering of the fabric with a liquid laundry detergent composition comprising adding the microspheres according to Claim 1 to said composition. WO 00/66704 PCT/USOO/l 1306

103

14. A method for making the microsphere of Claim 1 wherein said method compnses dispersing one part by volume of a mixture of one or more anhydrides and preferably one or more additional monomenc matenals and one or more blowing agents into at least 0.5 parts by volume of a nonsolvent aqueous medium compnsmg water and a water-dispersible, water-msoluble protective colloid.