WO2000013677A1 - Nanogel networks and biological agent composition thereof - Google Patents

Nanogel networks and biological agent composition thereof

Info

Publication number
WO2000013677A1
WO2000013677A1 PCT/US1999/019690 US9919690W WO0013677A1 WO 2000013677 A1 WO2000013677 A1 WO 2000013677A1 US 9919690 W US9919690 W US 9919690W WO 0013677 A1 WO0013677 A1 WO 0013677A1
Authority
WO
WIPO (PCT)
Prior art keywords
polymer
biological agent
acid
monomer
biological
Prior art date
Application number
PCT/US1999/019690
Other languages
French (fr)
Inventor
Alexander V. Kabanov
Sergey V. Vinogradov
Original Assignee
Supratek Pharma, Inc.
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Supratek Pharma, Inc. filed Critical Supratek Pharma, Inc.
Priority to EP99945266A priority Critical patent/EP1109539A1/en
Priority to AU57896/99A priority patent/AU5789699A/en
Priority to JP2000568486A priority patent/JP2002524579A/en
Priority to CA002342800A priority patent/CA2342800A1/en
Publication of WO2000013677A1 publication Critical patent/WO2000013677A1/en

Links

Classifications

    • B—PERFORMING OPERATIONS; TRANSPORTING
    • B82—NANOTECHNOLOGY
    • B82Y—SPECIFIC USES OR APPLICATIONS OF NANOSTRUCTURES; MEASUREMENT OR ANALYSIS OF NANOSTRUCTURES; MANUFACTURE OR TREATMENT OF NANOSTRUCTURES
    • B82Y5/00—Nanobiotechnology or nanomedicine, e.g. protein engineering or drug delivery
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K47/00—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
    • A61K47/50—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates
    • A61K47/69—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the conjugate being characterised by physical or galenical forms, e.g. emulsion, particle, inclusion complex, stent or kit
    • A61K47/6921—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the conjugate being characterised by physical or galenical forms, e.g. emulsion, particle, inclusion complex, stent or kit the form being a particulate, a powder, an adsorbate, a bead or a sphere
    • A61K47/6927—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the conjugate being characterised by physical or galenical forms, e.g. emulsion, particle, inclusion complex, stent or kit the form being a particulate, a powder, an adsorbate, a bead or a sphere the form being a solid microparticle having no hollow or gas-filled cores
    • A61K47/6929—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the conjugate being characterised by physical or galenical forms, e.g. emulsion, particle, inclusion complex, stent or kit the form being a particulate, a powder, an adsorbate, a bead or a sphere the form being a solid microparticle having no hollow or gas-filled cores the form being a nanoparticle, e.g. an immuno-nanoparticle
    • A61K47/6931—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the conjugate being characterised by physical or galenical forms, e.g. emulsion, particle, inclusion complex, stent or kit the form being a particulate, a powder, an adsorbate, a bead or a sphere the form being a solid microparticle having no hollow or gas-filled cores the form being a nanoparticle, e.g. an immuno-nanoparticle the material constituting the nanoparticle being a polymer
    • A61K47/6935—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the conjugate being characterised by physical or galenical forms, e.g. emulsion, particle, inclusion complex, stent or kit the form being a particulate, a powder, an adsorbate, a bead or a sphere the form being a solid microparticle having no hollow or gas-filled cores the form being a nanoparticle, e.g. an immuno-nanoparticle the material constituting the nanoparticle being a polymer the polymer being obtained otherwise than by reactions involving carbon to carbon unsaturated bonds, e.g. polyesters, polyamides or polyglycerol
    • A61K47/6937—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the conjugate being characterised by physical or galenical forms, e.g. emulsion, particle, inclusion complex, stent or kit the form being a particulate, a powder, an adsorbate, a bead or a sphere the form being a solid microparticle having no hollow or gas-filled cores the form being a nanoparticle, e.g. an immuno-nanoparticle the material constituting the nanoparticle being a polymer the polymer being obtained otherwise than by reactions involving carbon to carbon unsaturated bonds, e.g. polyesters, polyamides or polyglycerol the polymer being PLGA, PLA or polyglycolic acid
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K47/00—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
    • A61K47/30—Macromolecular organic or inorganic compounds, e.g. inorganic polyphosphates
    • A61K47/34—Macromolecular compounds obtained otherwise than by reactions only involving carbon-to-carbon unsaturated bonds, e.g. polyesters, polyamino acids, polysiloxanes, polyphosphazines, copolymers of polyalkylene glycol or poloxamers
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K47/00—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
    • A61K47/50—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates
    • A61K47/69—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the conjugate being characterised by physical or galenical forms, e.g. emulsion, particle, inclusion complex, stent or kit
    • A61K47/6921—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the conjugate being characterised by physical or galenical forms, e.g. emulsion, particle, inclusion complex, stent or kit the form being a particulate, a powder, an adsorbate, a bead or a sphere
    • A61K47/6927—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the conjugate being characterised by physical or galenical forms, e.g. emulsion, particle, inclusion complex, stent or kit the form being a particulate, a powder, an adsorbate, a bead or a sphere the form being a solid microparticle having no hollow or gas-filled cores
    • A61K47/6929—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the conjugate being characterised by physical or galenical forms, e.g. emulsion, particle, inclusion complex, stent or kit the form being a particulate, a powder, an adsorbate, a bead or a sphere the form being a solid microparticle having no hollow or gas-filled cores the form being a nanoparticle, e.g. an immuno-nanoparticle
    • A61K47/6931—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the conjugate being characterised by physical or galenical forms, e.g. emulsion, particle, inclusion complex, stent or kit the form being a particulate, a powder, an adsorbate, a bead or a sphere the form being a solid microparticle having no hollow or gas-filled cores the form being a nanoparticle, e.g. an immuno-nanoparticle the material constituting the nanoparticle being a polymer
    • A61K47/6935—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the conjugate being characterised by physical or galenical forms, e.g. emulsion, particle, inclusion complex, stent or kit the form being a particulate, a powder, an adsorbate, a bead or a sphere the form being a solid microparticle having no hollow or gas-filled cores the form being a nanoparticle, e.g. an immuno-nanoparticle the material constituting the nanoparticle being a polymer the polymer being obtained otherwise than by reactions involving carbon to carbon unsaturated bonds, e.g. polyesters, polyamides or polyglycerol
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K48/00—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
    • C—CHEMISTRY; METALLURGY
    • C08—ORGANIC MACROMOLECULAR COMPOUNDS; THEIR PREPARATION OR CHEMICAL WORKING-UP; COMPOSITIONS BASED THEREON
    • C08L—COMPOSITIONS OF MACROMOLECULAR COMPOUNDS
    • C08L101/00—Compositions of unspecified macromolecular compounds
    • C08L101/12—Compositions of unspecified macromolecular compounds characterised by physical features, e.g. anisotropy, viscosity or electrical conductivity
    • C08L101/14—Compositions of unspecified macromolecular compounds characterised by physical features, e.g. anisotropy, viscosity or electrical conductivity the macromolecular compounds being water soluble or water swellable, e.g. aqueous gels

Definitions

  • This invention is in the area of combinatorial drug delivery, or combinatorial formulation.
  • This invention relates to combinatorial drug delivery, or combinatorial
  • the invention reduces the time and cost required for creating
  • the invention thus relates to novel drug delivery and drug release systems
  • the dispersed polymer networks combine the properties of both polymer gels
  • Polymer networks can be loaded by both low molecular
  • the invention provides a method of identifying a biological agent
  • composition of choice to create a composition that will render a biological agent
  • the invention also relates to biological compositions of having polymer
  • Dispersed polymer networks are capable of
  • crossing cell membranes and being transported to a target site inside a cell.
  • polymer network particles can be physically or chemically coupled with arge ng mo ecu es prov ng or s e spec c e very an recogn on n e
  • polymer network carriers provides for tremendous versatility of properties with
  • the longevity of circulation in the blood can be
  • biodistribution in the body can be varied to achieve site-specific drug
  • This invention also provides for a method of identifying biological agent
  • compositions that can be applied to pharmaceutics and biopharmaceutics
  • living organism or cell can be improved through formulation.
  • Biological agents suitable for use in accordance with the invention include
  • agents useful for diagnostics or imaging or that can act on a cell, organ or organism to create a change in the functioning of the cell, organ or organism.
  • the invention can be used in combination with high throughput screening
  • Backbone Used in graft copolymer nomenclature to describe the chain onto which the graft is formed.
  • Biological agent An agent that is useful for diagnosing or imaging or that can act on a cell, organ or organism, including but not limited to drugs (pharmaceuticals) to create a change in the functioning of the cell, organ or organism.
  • Biological property Any property of biological agent or biological agent composition that affects the action of this biological agent or biological agent composition during interaction with a biological system.
  • Block copolymer A combination of two or more chains of constitutionally or configurationally different features linked in a linear fashion.
  • Branched polymer A combination of two or more chains linked to each other, in which the end of at least one chain is bonded at some point along the other chain.
  • composition library Plurality of compositions of biological agents with polymer networks.
  • Configuration Organization of atoms along the polymer chain, which can be interconverted only by the breakage and reformation of primary chemical bonds.
  • Conterminous link A polymer cross-link in which a polymer chain is linked at both ends to the same or constitutionally or configurationally different chain or chains.
  • Copolymer Polymer that is derived from more than one species of monomer.
  • Cross-link A structure bonding two or more polymer chains together.
  • Dendrimer Regularly branched polymer in which branches start from one or more centers.
  • Dispersion Particulate matter distributed throughout a continuous medium.
  • Drug candidate A substance with biological activity potentially useful for therapy.
  • Interpenetrating network An intimate combination of at least two polymer networks at least one of which is synthesized in the immediate presence of the other.
  • Graft copolymer A combination of two or more chains of constitutionally or configurationally different features, one of which serves as a backbone main chain, and at least one of which is bonded at some points along the backbone and constitutes a side chain.
  • Homopolvmer Polymer that is derived from one species of monomer.
  • Link A covalent chemical bond between two atoms, including bond between two monomeric units, or between two polymer chains.
  • Nanogel A polymer network dispersion with sub- micron particle size.
  • Network A three-dimensional polymer structure, where all the chains are connected through cross-links.
  • Network basis plurality of cross-linked polymer networks differing in at least one of the polymer fragment constitutional, configurational or conformational feature.
  • Parent database Computer database containing information on known polymer networks.
  • Polymer blend An intimate combination of two or more polymer chains of constitutionally or configurationally different features, which are not bonded to each other.
  • Polymer fragment A portion of polymer molecule in which the monomeric units have at least one constitutional or configurational feature absent from adjacent portions.
  • Repeating unit Monomeric unit linked into a polymer chain.
  • Semi-interpenetrating Used herein to describe an intimate combination of at least one non cross-linked polymer and at least one polymer network at least one of which is synthesized in the immediate presence of the other.
  • Star block copolymer Three or more chains of different constitutional or configurational features linked together at one end through a central moiety.
  • Star polymer Three or more chains linked together at one end through a central moiety.
  • Surfactant Surface active agent that is adsorbed at interface.
  • Virtual library A list of polymer networks potentially useful with the biological agent.
  • the invention relates to networks of cross- linked polymer fragments wherein the fragments comprise:
  • At least one polycation fragment which is a cationic homopolymer or copolymer comprising at least three cationic amino acids or at least three aminoalkylene monomers, said monomers being selected from the group consisting of at least one of:
  • R 1 is hydrogen, alkyl of 2 to 8 carbon atoms, an A monomer, or a B monomer
  • each of R 2 and R 3 taken independently of the other, is the same or different straight or branched chain alkanediyl group of the formula:
  • z has a value of from 2 to 8;
  • R 4 is hydrogen satisfying one bond of the depicted geminally bonded carbon atom
  • R 5 is hydrogen, alkyl of 2 to 8 carbon atoms, an A monomer, or a B monomer;
  • R 6 is hydrogen, alkyl of 2 to 8 carbon atoms, an A monomer, or a B monomer;
  • R 7 is a straight or branched chain alkanediyl group of the formula:
  • R 8 is hydrogen, alkyl of 2 to 8 carbon atoms, an A monomer, or a B monomer; and (b) at least one nonionic homopolymer or copolymer comprising at least three the same or different repeating units containing at least one atom selected from the group consisting of oxygen and nitrogen.
  • the invention provides fine dispersions of the networks with a sub-micron
  • polymer fragments is between about 20 and about 100,000. More preferably,
  • the degree of polymerization is between about 30 and about 10,000, still more
  • the preferred polycation fragments forming the polymer networks include
  • polyamines e.g., spermine, polyspermine
  • polyethyleneimine polypropyleneimine, polybutileneimine, polypentyleneimine,
  • polycation fragments also include aliphatic, heterocyclic or
  • Particularly preferred polycation fragments comprise a plurality of cationic
  • networks of the invention can be branched.
  • copolymers are branched.
  • the cationic fragment of these copolymers was
  • polycation is polyethyleneimine represented by the formula:
  • dendrimers for example, polyamidoamines or
  • the polycation fragments have several positively ionizable groups and a
  • polycation fragments will be any polycation fragment.
  • the polycation fragments will be any polycation fragment.
  • aminopentylene and aminohehhylene repeating units or by mixtures of at least
  • aminopentylene and aminohexylene repeating units are most preferred.
  • polycationic fragments that utilize a (NCH 2 CH 2 ),
  • Polycation fragments comprising a -N-R 0 - repeating unit are also preferred.
  • R° is preferably an ethylene, propylene, butylene, pentylene, or hexylene which
  • R° includes a DNA intercalating group such as an ethidium bromide
  • Such intercalating groups can increase the affinity of the polymer for
  • R° Preferred substitutions on R° include alkyl of 1-6 carbons,
  • hydroxy, hydroxyalkyl wherein the alkyl has 1-6 carbon atoms, alkoxy having 1-6 carbon atoms, an alkyl carbonyl group having 2-7 carbon atoms,
  • alkoxycarbonyl wherein the alkoxy has 1-6 carbon atoms, alkoxycarbonylalkyl
  • alkoxy and alkyl each independently has 1-6 carbon atoms
  • alkylcarboxyalkyl wherein each alkyl group has 1-6 carbon atoms, aminoalkyl
  • alkyl group has 1-6 carbon atoms, alkylamino or dialkylamino
  • each alkyl group independently has 1-6 carbon atoms, mono- or di-
  • alkylaminoalkyl wherein each alkyl independently has 1-6 carbon atoms
  • chloro chloroalkyl wherein the alkyl has from 1-6 carbon atoms, fluoro,
  • fluoroalkyl wherein the alkyl has from 1-6 carbon atoms, cyano, or cyano alkyl
  • alkyl has from 1-6 carbon atoms or a carboxyl group. More
  • R° is ethylene, propylene or butylene.
  • nonionic polymer fragments comprise water-soluble
  • polymer fragment is a polyethylene oxide, a copolymer of ethylene oxide and
  • propylene oxide a polysaccharide, a polyacrylamide, a polygycerol, a
  • polyvinylalcohol a polyvinyl-pyrrolidone, a polyvinylpyridine N-oxide, a
  • polyacroylmorpholine or the derivatives thereof.
  • nonionic polymer fragments are particularly preferred:
  • each of m and j has a value of from 3 to about 50,000,000.
  • fragments are the block copolymers of ethylene oxide and propylene oxide
  • x, y, z, i and j have values from about 2 to about 800, preferably
  • orientation of the isopropylene radicals within the B block will be random.
  • polyoxyethylene block copolymers can also be designed with hydrophilic
  • hydrophobic block can be a mixture of
  • the diamine-linked pluronic of formula (IV) can also be a member of the
  • R is an alkylene of 2 to 6 carbons, a -
  • R 3 and R 4 are hydrogen, then one R 5 and R 6 is hydrogen and the other is
  • At least one of the monomers in hydrophilic block might be
  • link means covalent bond between two atoms
  • cross-link means a structure bonding two or more
  • the polymer network of the current invention can be any polymer network of the current invention.
  • polymer fragments in the networks can be conterminous, i.e., polymer cross ⁇
  • polymer networks can be produced by covalently cross-linking the polycation
  • the nonionic fragments by the polycation fragments by the polycation fragments.
  • the polymer for example, the polymer
  • networks can be synthesized by reacting polyoxyethylene having reactive
  • example is covalent attachment of polyspermine to polyvinylalcohol chains
  • the network can also be obtained
  • the networks can also combine
  • polymer networks of the current invention can also be interpenetrating or semi-interpenetrating and can non-
  • Polymer gels can be synthesized by co-polymerization of the monomers
  • pre-formed polymer fragments For example, cross-linked polymer gels or
  • the linking group thus may be formed either by reactively involving a terminal
  • a carboxylic acid group can be activated as with N,N'-
  • Alcohols can be
  • Alkyl halides can be any organic compound that can be used as urethane linkages or activated to produce ethers or esters.
  • Alkyl halides can be any organic compound that can be used as urethane linkages or activated to produce ethers or esters.
  • a terminal or pendant hydroxy group can be oxidized to form the corre- sponding aldehyde or ketone. This aldehyde or ketone then is allowed to react
  • a terminal or pendant hydroxyl group on the polymer can be
  • the bromoacetyl ester of a polymer fragment also can be
  • an activated derivative thereof such as an acid chloride or anhydride.
  • bromoacetyl ester also can be allowed to react with a cyanide salt to form a
  • pendant hydroxyl group also can be allowed to react with 1 , 1 '-carbonyl-jb/s- imidazole and this intermediate in turn allowed to react with an amino precursor
  • a terminal or pendant hydroxyl also can be allowed to react with a cyclic
  • anhydride such as succinic anhydride to yield a half-ester which, in turn, is
  • a terminal or pendant hydroxyl group also can be allowed to react with 1 ,4-
  • pendant epoxide function is allowed to react with an amino precursor.
  • the polymer fragment terminating in an amino group also can be treated
  • polymer fragment terminating in an amino group also can be allowed to react
  • alkanoic acid or fluorinated alkanoic acid preferably an activated
  • an amino precursor can be treated with an ⁇ , ⁇ -
  • linking groups thus can simply involve a simple functional group while others
  • a spacer unit such as a polymethylene chain between two func ⁇
  • linking group comprises such a polymethylene chain
  • linkages which are not symmetrical, such as -CONH- or -
  • NHCOO- can be present in the reverse orientation; e.g., -NHCO- and
  • the size of the polymer networks is one major parameter determining their size
  • Nanogel polymer networks are nontoxic, can
  • cross biological barriers including but not limited to the blood-brain barrier and
  • nanogel networks are from about 20 nm to about
  • nanogel particles shall have these sizes in a swollen state in aqueous
  • properties of the nanogel networks are determined solely by their size and
  • this invention is not limited to a certain synthesis or purification
  • Nanoparticles and nanospheres can
  • oil oil and "oil-in-water” microemulsions as well as normal and reverse surfactant
  • micelles have proven to be particularly useful for preparation of particles with
  • Methods of nanoparticle preparation include but are not limited to
  • nanoparticle chemistries provide for a wide spectrum of rigid polymer structures, which are suitable for the encapsulation of drugs, drug delivery and
  • nanogel polymer networks combine
  • porous materials that can be loaded with a variety of biological agents
  • nanogel networks proceed in the whole volume of the network rather on its
  • Nanogel networks of the current invention are soluble and do
  • loading capacity of nanogel networks can be as high as several grams or
  • nanoparticles which usually have
  • the polymer network is
  • polycation and nonionic fragments including hydrophobic-hydrophilic block
  • copolymers enables formulating the nanogel networks with a broader range of
  • nanogel networks by changing the polymer fragment structure is
  • the polymeric species can be transported in the body to a disease site, cross
  • biological barriers including but not limited to the blood-brain barrier and
  • intestinal epithelium enter cells, cross cell membranes and be transported to
  • nanogel network is unique and unmatched by other delivery systems in this
  • targeting molecule refers to any molecule, atom, or ion linked to the polymer networks of the current invention
  • compositions of the current invention in the body or cell are compositions of the current invention in the body or cell.
  • molecule will frequently comprise an antibody, fragment of antibody or chimeric
  • antibody molecules typically with specificity for a certain cell surface antigen. It
  • glycolipids could serve to target a polysaccharide receptor. It could also be, for
  • the targeting molecules can also be polynucleotide,
  • polypeptide peptide, peptidomimetic, carbohydrates including polysaccharides,
  • Targeting molecules can be used to
  • biospecific groups providing site-directed transport into a cell (in particular, exit
  • compositions comprising the
  • the polymer networks of the current invention and a suitable targeting molecule.
  • the targeting molecule can be covalently linked to any of the polymer
  • the targeting molecule can be any organic or organic compound that can be used as a targeting molecule.
  • the targeting molecule can be any organic or organic compound that can be used as a targeting molecule.
  • Such targeting molecules can be linked to the
  • any chemical entity e.g., molecule, atom or ion capable of specific binding
  • the receptor molecule is any chemical capable
  • the targeting molecule become attached to
  • the polymer networks ad a result of binding between the ligand and receptor.
  • biotin or the derivative thereof can be covalently linked to the polymer networks of the current
  • biotin can be linked to both the polymer networks and
  • targeting molecule and the latter can be linked through avidin, which has four
  • biotin-binding centers are biotin-binding centers. Additionally, more complex constructs comprising biotin
  • the invention provides for the polymer networks
  • biotin molecules or derivatives thereof linked to at least one polycation with biotin molecules or derivatives thereof linked to at least one polycation or
  • nonionic polymer fragment of both polycation and nonionic polymer fragments are nonionic polymer fragments of both polycation and nonionic polymer fragments.
  • constructs for example, can comprise ligands and/or receptors that are
  • polynucleotide polypeptide, peptidomimetic, carbohydrates including
  • the of the current invention can also have a targeting group having affinity for a
  • targeting molecules can provide for the site specific delivery and recognition in the body.
  • the hydrophobic group can be, among other things, a lipid
  • fatty acyl group such as a fatty acyl group.
  • it can be an ionic or nonionic homopolymer, copolymer, block copolymer, graft copolymer, dendrimer or
  • the longevity of circulation in blood can be varied from very long
  • Biodistribution can be varied to achieve site-specific drug delivery and release
  • rate or release can be varied from seconds to days and weeks, etc.
  • compositions that are most efficient and safe ⁇ i.e., have best "therapeutic
  • the present invention thus relates to a method of identifying a
  • biological agent composition of choice comprising:
  • compositions of polymer networks with a biological agent (b) preparing compositions of polymer networks with a biological agent
  • compositions of said polymer networks with a biological agent for biological properties using at least one of the following: a cell model, animal, plant or other biological model; measurement of a chemical or physical property in a test tube; or a theoretical model, and
  • compositions with desired biological properties (d) identifying said compositions with desired biological properties.
  • compositions of polymer networks are used in the broad sense to include
  • composition composition, concentration, pH, temperature and the like as well as creation of
  • the invention does not require that all or any polymer networks are
  • the plurality of polymer networks can be constructed "on paper"
  • polymer networks with biological agents can be presented as a database.
  • Such databases can contain information on the structure of polymer networks,
  • biological agent compositions including physicochemical properties, biological
  • biological property means any property of
  • RNA specific receptors, enzymes or other molecules, resistance to metabolic enzymes, chemical stability, toxicity, membrane transport, transport into, out,
  • test refers to evaluation
  • Testing can be done using a
  • identification can be carried out or simulated virtually ⁇ i.e., by computer).
  • compositions typically testing of the compositions involves evaluation of the biological
  • compositions using a screening assay.
  • the plurality of polymer networks of the current invention is termed the plurality of polymer networks of the current invention.
  • composition library a biological agent is termed the "composition library.”
  • the invention proposes that within a basis of the polymer networks there will be at least one chemical entity that will form with a certain
  • biological agent a composition with desired biological properties.
  • biological agent compositions by sorting them for "positive” and "negative”
  • compositions according to the initially defined criteria Normally, one or more
  • agent compositions This includes physico-chemical tests such as the
  • composition libraries are screened in accordance with the invention.
  • composition libraries are provided.
  • biological agent solubility including but not limiting light absorption, fluorescent,
  • Such enzymes include proteases, amino acids, amino acids, amino acids, amino acids, amino acids, amino acids, amino acids, amino acids, amino acids, amino acids, amino acids, amino acids, amino acids, amino acids, amino acids, amino acids, amino acids, amino acids, amino acids, amino acids, amino acids, amino acids, amino acids, amino acids, amino acids, amino acids, amino acids, amino acids, amino acids, amino acids, amino acids, amino acids, amino acids, amino acids, amino acids, amino acids, amino acids, amino acids, amino acids, amino acids, amino acids, amino acids, amino acids, amino acids, amino acids, amino acids, amino acids, amino acids, amino acids, amino acids, amino acids, amino acids, amino acids, amino acids, amino acids, amino acids, amino acids, amino acids, amino acids, amino acids, amino acids, amino acids, amino acids, amino acids, amino acids, amino acids, amino acids, amino acids, amino acids, amino acids, amino acids, amino acids, amino acids, amino acids, amino acids, amino acids, amino acids, amino acids, amino acids, amino acids, amino acids, amino acids,
  • nucleases nucleases, redox enzymes, transferases, etc.
  • redox enzymes transferases, etc.
  • composition libraries are generated and screened to protect biological agent
  • the screening can include treatment of the biological agent with isolated enzymes, their combinations or enzymatic complexes existing in isolated fractions of cells or tissues, followed by analysis
  • the screening can be any suitable biological agent level in the analyzed sample.
  • the screening can be any suitable biological agent level in the analyzed sample.
  • agent level including but not limiting HPLC, LC-MS, GC-MS, radioisotope
  • the reticuloendothelial system by the reticuloendothelial system. According to the present invention, the reticuloendothelial system.
  • composition libraries can be prepared and screened to reduce the biological
  • the screening methods can be based upon direct
  • albumin low density and ultralow density lipopolyproteins, and the like. Also,
  • the screening can also be based on biological
  • composition satisfies the present invention.
  • libraries of such biological agents can be prepared and screened to increase
  • the screening methods include, but are not limited to
  • polarized epithelial cell monolayers for example, Caco-2 or Caco-4 cell
  • brain microvessel endothelial tissue that is also known as blood brain barrier
  • composition libraries can be generated and screened for compositions
  • BBMEC brain microvessel endothelial cells
  • procedures also include administration of the biological agent in a whole
  • composition libraries can be generated
  • compositions that can improve biological agent
  • Verity of screening methods can be used to determine whether a transmembraneous properties. Verity of screening methods can be used to determine whether a transmembraneous properties. Verity of screening methods can be used to determine whether a transmembraneous properties. Verity of screening methods can be used to determine whether a transmembraneous properties. Verity of screening methods can be used to determine whether a transmembraneous properties. Verity of screening methods can be used to
  • liposomes analysis of the biological agent uptake in cells including, cell lines,
  • the libraries of biological agent composition can be also screened using
  • agents apoptosis assays such as TONEL staining
  • proliferation assays such as thymidine DNA incorporation rate analysis, MTT, XTT and colony formation
  • compositions including but not limiting analyses of activity of specific enzymes
  • composition thereof can be used to screen composition libraries for the best
  • the starting information for identifying the desired biological agent composition includes (i) the drug structure, (ii) the database of
  • the starting data also accumulated data on polymer networks, if available.
  • the starting data also accumulated data on polymer networks, if available.
  • polymer networks are virtually assembled by combining structures of polymer
  • a plurality of virtually designed network is a virtual network base.
  • fragments include but are not limited to chemical structures of the repeating
  • network property can be based on any known or expected relationship between the properties of the polymer fragments and the polymer network
  • biological agent for example, drug candidate
  • actually synthesized model
  • desired properties include but are not limited to parent databases comprising a
  • the analysis includes review and classification of the
  • the biological agent of this invention is an agent
  • nucleic acids include but are not limited to nucleic acids, polynucleotides, antibacterial
  • agents antiviral agents, antifungal agents, antiparasitic agents, tumoricidal or
  • anti-cancer agents proteins, toxins, enzymes, hormones, neurotransmitters,
  • glycoproteins immunoglobulins, immunomodulators, dyes, radiolabels, radio- opaque compounds, fluorescent compounds, polysaccharides, cell receptor
  • binding molecules binding molecules, anti-inflammatories, anti-glaucomic agents, mydriatic
  • this invention permits to significantly improve therapeutic drugs by decreasing
  • non-steroidal anti-inflammatories such as
  • indomethacin indomethacin, salicylic acid acetate, ibuprofen, sulindac, piroxicam, and
  • naproxen antiglaucomic agents such as timolol or pilocarpine
  • neurotransmit- neurotransmit-
  • ters such as acetylcholine, anesthetics such as dibucaine, neuroleptics such as
  • phenothiazines for example compazine, thorazine, promazine,
  • chlorpromazine acepromazine, aminopromazine, perazine, prochlorperazine,
  • thioxanthenes for example chlorprothixene and tiotixene
  • butyrophenones for example haloperidol, moperone, trifluoperidol
  • benzamides for example sulpiride and tiapride
  • tranquilizers such as
  • glycerol derivatives for example mephenesin and methocarbamol
  • propanediols for example meprobamate
  • diphenylmethane derivatives for example
  • hypnotics for example zolpdem
  • beta-blockers for example propranolol, acebutonol,
  • antidepressants such as dibenzazepines (for example
  • imipramine dibenzocycloheptenes (for example, amtiriptyline)
  • dibenzocycloheptenes for example, amtiriptyline
  • tetracyclics for example, mianserine
  • MAO inhibitors for example
  • phenylehtylamine derivatives for example amphetamines, dexamphetamines,
  • ethanols for example clofenciclan, cyprodenate, aminorex, and mazindol
  • GABA-mimetics for example, progabide
  • alkaloids for example codergocrine
  • anti-Parkinsonism agents for example L-
  • cholinergics for example citicoline and physostigmine
  • vasodilators for example citicoline and physostigmine
  • brain and tumor imaging agents including type I and type II
  • free radical scavenger drugs including type I and type II
  • anticoagulants including type I and type II
  • ionotropic drugs including type I and type II
  • neuropeptides such as
  • anti-neoplastic agents such as paclitaxel, daunorubicin, doxorubicin,
  • antibacterial agents such as aminoglycosides including gentamicin,
  • antiviral compounds such as rifampicin, 3'-azido-3'-deoxythymidine (AZT), and
  • acylovir antifungal agents such as azoles including fluconazole, macrolides
  • anti-parastic compounds such as amphotericin B, and candicidin; anti-parastic compounds such as
  • antimonials include without limitation vinca alkaloids,
  • bleomycin-type antibiotics such as
  • antifolates such as methotrexate, aminopterin, and dideaza ⁇
  • compositions also can utilize a variety of polypeptides such as
  • antibodies such as diphtheria toxin, peptide hormones, such as colony
  • erythropoietin and thyroid hormone
  • lipoproteins such as ⁇ -lipoprotein
  • proteoglycans such as hyaluronic acid
  • glycoproteins such as gonadotropin
  • cytokines such as the interferons or
  • hormone receptors such as the estrogen receptor.
  • compositions also can be used with enzyme inhibiting agents such as
  • reverse transcriptase inhibitors reverse transcriptase inhibitors, protease inhibitors, angiotensin converting
  • nonpeptide structures such as finasteride, quinapril, ramipril, lisinopril,
  • Such agents can be administered alone or in combination therapy; e.g., a
  • Suitable biological agents are viral genomes and
  • viruses including the lipid and protein coat. This accounts for the possibility of
  • retroviruses adenoviruses, herpes-virus, Pox-virus used as complete viruses
  • the suitable biological agents include oxygen transporters (e.g., porphines,
  • the suitable biological agents further include the agents used in
  • diagnostics visualization methods such as magnetic resonance imaging (e.g., magnetic resonance imaging
  • gadolinium (III) diethylenetriamine pentaacetic acid may be a chelating
  • agent may further include an alpha-, beta-, or gamma-emitting radionuclide
  • the biological agent may
  • diagnostic agent which may include a paramagnetic or
  • the paramagnetic elements include but are not limited to
  • the invention can be also used to identify useful fibrinolitic compositions
  • enzymes such as streptokinase, urokinase, tissue plasminogen activator
  • circulation in particular, microcirculation, respiratory distress syndrome, as well
  • compositions for reducing tissue damage during angioplasty procedures are as compositions for reducing tissue damage during angioplasty procedures. Further, the compositions identified using this invention including these to treat
  • This invention is also suitable for transplantation of organs.
  • This invention is also suitable for transplantation of organs.
  • compositions of antiinfective compounds as well as modulators
  • the adjuvants suitable for use in this invention include but are not limited
  • suitable mineral adjuvants include aluminum compounds such as aluminum
  • the suitable bacterial adjuvants include but
  • the suitable adjuvants include without limitation small immunogenes,
  • the antigenes that can be used in the present invention are:
  • the suitable antigens include but are not limited to natural,
  • hormones or tumor antigens used in prophylactic or therapeutic vaccines.
  • antigens include components produced by enzymatic cleavage or can be compounds produced by recombinant DNA technique.
  • Viral antigens include components produced by enzymatic cleavage or can be compounds produced by recombinant DNA technique.
  • HIV include but are not limited to HIV, rotavirus, influenza, foot and mouth disease,
  • hepatitis A hepatitis A
  • hepatitis B hepatitis C
  • measles distemper
  • enterovirus species Mengo virus, paramixovirus, avian infectious bronchitis
  • Suitable bacterial antigens include but are not limited to Bordetella
  • antigens include infections such as Rocky mountain
  • trypanosomes and fungus such as Cryptococcus neoformans.
  • peptide antigens include subunits of recombinant proteins (such as herpes).
  • alphavirus alphavirus, adenovirus and the like
  • proteins such as diphteria toxoid, tetanus
  • hepatitis B influenza hemagglutinin and the like
  • synthetic peptides e.g.
  • Suitable polysaccharide and oligosaccharide antigens originate from pneumococcus, haemphilis influenza, neisseria meningitides, Pseudomonas
  • compositions The invention also provides
  • compositions comprising polymer network and at least one surfactant.
  • Surfactants are useful for improving solubility of biological agents, changing

Abstract

Copolymer networks having at least one cross-linked polyamine polymer fragment and at least one nonionic water-soluble polymer fragment, and compositions thereof, having at least one suitable biological agent.

Description

NANOGEL NETWORKS AND BIOLOGICAL AGENT COMPOSITION THEREOF
Field of the Invention
This invention is in the area of combinatorial drug delivery, or combinatorial formulation.
Background of the Invention
The conventional design of new drugs can be extremely difficult. For a
new drug to be effective, it must be precisely matched to its molecular target.
Moreover, once such a molecule is discovered, the new drug candidate must
be soluble, bioavailable, nontoxic, and resistant to metabolic enzymes.
Modifications to such a new molecule, necessary to satisfy these requirements,
often have an adverse effect on the drug's therapeutic efficacy. Because of
these complexities, conventional drug design can be a very costly, time-
consuming process.
Recent advances in combinatorial chemistry technology have provided
improved throughput in the design of new molecules. These developments
markedly reduce the time and cost necessary in designing a desired molecule.
However, the problem of making such molecules soluble, bioavailable,
resistant to metabolic enzymes, and capable of penetrating through
membranes often remains unsolved. The drug delivery industry has addressed some of these problems by
incorporating drugs in carriers. In the case of drug delivery assisted products,
the time of development is shortened to approximately seven years, and the
average cost is significantly decreased. Unfortunately, many drug delivery
systems still have several serious limitations in view of the problems discussed
above.
Summary of the Invention
This invention relates to combinatorial drug delivery, or combinatorial
formulation. The invention reduces the time and cost required for creating
desired drug compounds, which are not only immediately ready for clinical trial,
but also possess a number of important characteristics increasing the
probability of the ultimate success. In contrast to combinatorial chemistry,
however, the invention does not discover new drug structures per se or alter
the desirable drug characteristics, but instead provides optimal compositions of
a desired drug solving the drug's problems relating to solubility, bioavailability,
resistance to metabolic enzymes, toxicity, membrane transport, and site
specific delivery. Using a biological agent molecule as a starting point, the
invention identifies new composition with characteristics sought for the optimal
performance of the selected molecule.
Detailed Description of the Invention
The invention thus relates to novel drug delivery and drug release systems
that address the above problems. These systems involve new chemical molecules having polymer networks
of cross-linked polyamine polymer fragments and nonionic polymer fragments.
The dispersed polymer networks combine the properties of both polymer gels
and colloidal particles. Polymer networks can be loaded by both low molecular
mass and polymer biological agents including small molecules, oligo- and
polysaccharides, polypeptides and proteins, polynucleotides such as RNA or
DNA, and the like.
The invention provides a method of identifying a biological agent
composition of choice to create a composition that will render a biological agent
soluble, bioavailable, resistant to metabolic enzymes, non-toxic, freely traveling
through membranes and into cells, or having desired release characteristics in
the body. By using polymer networks which differ in the length and structure of
polymer fragments and preparing composition libraries, the invention has the
ability to rapidly complex and identify the compositions of biological agents with
the desired properties.
The invention also relates to biological compositions of having polymer
networks and biological agents. Dispersed polymer networks are capable of
being transported in the body to a disease site, crossing biological barriers
(including the blood-brain barrier and intestinal epithelium), entering cells,
crossing cell membranes, and being transported to a target site inside a cell.
These polymer network particles can be physically or chemically coupled with arge ng mo ecu es prov ng or s e spec c e very an recogn on n e
body.
The use of polymer fragments with dual functionality in polymer networks,
such as polyamine polymers and nonionic water-soluble or water-swellable
polymers, permits great variation in the properties of these systems by varying
the lengths and/or chemical structure of the polymer fragments. This design of
polymer network carriers provides for tremendous versatility of properties with
simple chemical structures and permits optimized drug delivery and drug
release for enhanced performance with a variety of drugs and drug delivery
applications. Particularly, the longevity of circulation in the blood can be
varied, biodistribution in the body can be varied to achieve site-specific drug
delivery and release, and the rate of release can be varied from seconds to
days and weeks, etc. This versatility of the polymer networks permits selection
of drug compositions that are most efficient and safe {i.e., have the best
"therapeutic index") for a very broad variety of drugs.
This invention also provides for a method of identifying biological agent
compositions that can be applied to pharmaceutics and biopharmaceutics
diagnostics and imaging, immunology, veterinary, agriculture, and other areas
where the properties of biological agents exhibited during interaction with a
living organism or cell can be improved through formulation.
Biological agents suitable for use in accordance with the invention include
agents useful for diagnostics or imaging, or that can act on a cell, organ or organism to create a change in the functioning of the cell, organ or organism.
This includes, but is not limited to pharmaceutical agents, genes, vaccines,
herbicides and the like.
The invention can be used in combination with high throughput screening
of actual composition libraries, and can further utilize mathematical concepts,
which have been found to be beneficial in combinatorial chemistry.
Definitions
As used herein, the terms below have the following meaning:
Backbone: Used in graft copolymer nomenclature to describe the chain onto which the graft is formed.
Biological agent: An agent that is useful for diagnosing or imaging or that can act on a cell, organ or organism, including but not limited to drugs (pharmaceuticals) to create a change in the functioning of the cell, organ or organism.
Biological property: Any property of biological agent or biological agent composition that affects the action of this biological agent or biological agent composition during interaction with a biological system.
Block copolymer: A combination of two or more chains of constitutionally or configurationally different features linked in a linear fashion.
Branched polymer: A combination of two or more chains linked to each other, in which the end of at least one chain is bonded at some point along the other chain.
Chain: A polymer molecule formed by covalent linking of monomeric units. Composition library: Plurality of compositions of biological agents with polymer networks. Configuration: Organization of atoms along the polymer chain, which can be interconverted only by the breakage and reformation of primary chemical bonds.
Conformation: Arrangements of atoms and substituents of the polymer chain brought about by rotations about single bonds.
Conterminous: At both ends or at points along the chain.
Conterminous link: A polymer cross-link in which a polymer chain is linked at both ends to the same or constitutionally or configurationally different chain or chains.
Copolymer: Polymer that is derived from more than one species of monomer.
Cross-link: A structure bonding two or more polymer chains together.
Dendrimer: Regularly branched polymer in which branches start from one or more centers.
Dispersion: Particulate matter distributed throughout a continuous medium.
Drug candidate: A substance with biological activity potentially useful for therapy.
Interpenetrating network: An intimate combination of at least two polymer networks at least one of which is synthesized in the immediate presence of the other.
Graft copolymer: A combination of two or more chains of constitutionally or configurationally different features, one of which serves as a backbone main chain, and at least one of which is bonded at some points along the backbone and constitutes a side chain.
Homopolvmer: Polymer that is derived from one species of monomer. Link: A covalent chemical bond between two atoms, including bond between two monomeric units, or between two polymer chains.
Nanogel: A polymer network dispersion with sub- micron particle size.
Network: A three-dimensional polymer structure, where all the chains are connected through cross-links.
Network basis: plurality of cross-linked polymer networks differing in at least one of the polymer fragment constitutional, configurational or conformational feature.
Parent database: Computer database containing information on known polymer networks.
Polymer blend: An intimate combination of two or more polymer chains of constitutionally or configurationally different features, which are not bonded to each other.
Polymer fragment: A portion of polymer molecule in which the monomeric units have at least one constitutional or configurational feature absent from adjacent portions.
Repeating unit: Monomeric unit linked into a polymer chain. Semi-interpenetrating: Used herein to describe an intimate combination of at least one non cross-linked polymer and at least one polymer network at least one of which is synthesized in the immediate presence of the other.
Side chain: The grafted chain in a graft copolymer.
Star block copolymer: Three or more chains of different constitutional or configurational features linked together at one end through a central moiety.
Star polymer: Three or more chains linked together at one end through a central moiety. Surfactant: Surface active agent that is adsorbed at interface.
Virtual library: A list of polymer networks potentially useful with the biological agent.
In a preffered embodiment, the invention relates to networks of cross- linked polymer fragments wherein the fragments comprise:
(a) at least one polycation fragment which is a cationic homopolymer or copolymer comprising at least three cationic amino acids or at least three aminoalkylene monomers, said monomers being selected from the group consisting of at least one of:
(/) at least one tertiary amino monomer of the formula:
Figure imgf000010_0001
A.
and the quaternary salts of said tertiary amino monomer, and
(/'/) at least one secondary amino monomer of the formula:
Figure imgf000010_0002
B.
and the acid addition and quaternary salts of said secondary amino monomer,
in which: R1 is hydrogen, alkyl of 2 to 8 carbon atoms, an A monomer, or a B monomer;
each of R2 and R3, taken independently of the other, is the same or different straight or branched chain alkanediyl group of the formula:
"( ZH22)
in which z has a value of from 2 to 8;
R4 is hydrogen satisfying one bond of the depicted geminally bonded carbon atom; and
R5 is hydrogen, alkyl of 2 to 8 carbon atoms, an A monomer, or a B monomer;
R6 is hydrogen, alkyl of 2 to 8 carbon atoms, an A monomer, or a B monomer;
R7 is a straight or branched chain alkanediyl group of the formula:
— (C2zHn;2z
in which z has a value of from 2 to 8; and
R8 is hydrogen, alkyl of 2 to 8 carbon atoms, an A monomer, or a B monomer; and (b) at least one nonionic homopolymer or copolymer comprising at least three the same or different repeating units containing at least one atom selected from the group consisting of oxygen and nitrogen.
The invention provides fine dispersions of the networks with a sub-micron
range of particle size ("nanogels"). This invention further provides biological compositions comprising the
nanogel networks of cross-linked polymer fragments defined herein ("polymer
networks") and a suitable biological agent or agents.
The polycation and nonionic polymer fragments independently of each
other can be linear polymers, randomly branched polymers, block copolymers,
graft copolymers, star polymer, star block copolymer, dendrimers or have other
architecture including but not limited to combinations of the above listed
structures. The degree of polymerization of the polycation and nonionic
polymer fragments is between about 20 and about 100,000. More preferably,
the degree of polymerization is between about 30 and about 10,000, still more
preferably, between about 30 and about 1 ,000.
The preferred polycation fragments forming the polymer networks include
but are not limited to polyamines (e.g., spermine, polyspermine,
polyethyleneimine, polypropyleneimine, polybutileneimine, polypentyleneimine,
polyhexyleneimine and copolymers thereof), copolymers of tertiary amines and
secondary amines, partially or completely quatemized amines, polyvinyl
pyridine and the quaternary ammonium salts of said polycation fragments.
These preferred polycation fragments also include aliphatic, heterocyclic or
aromatic ionenes (Rembaum et al. Polymer letters, 1968, 6; 159; Tsutsui, T.,
Development in ionic polymers-2, Wilson A.D. and Prosser, H.J. (eds.) Applied
Science Publishers, London, new York, vol. 2, pp. 167-187, 1986). Particularly preferred polycation fragments comprise a plurality of cationic
repeating units of formula -N-R0, wherein R° is a straight chain aliphatic group
of 2 to 6 carbon atoms, which may be substituted. Each -NHR°- repeating unit
in an polycation fragment can be the same or different from another -NHR°-
repeating unit in the fragment. The polycation fragments in the polymer
networks of the invention can be branched. For example, polyspermine-based
copolymers are branched. The cationic fragment of these copolymers was
synthesized by condensation of 1 ,4-dibromobutane and N-(3-aminopropyl)-1 ,3-
propanediamine. This reaction yields highly branched polymer products with
primary, secondary, and tertiary amines. An example of branched polycations
are products of the condensation reactions between polyamines containing at
least 2 nitrogen atoms and alkyl halides containing at least 2 halide atoms
(including bromide or chloride). In particular, the branched polycations are
produced as a result of polycondensation. An example of this reaction is the
reaction between N-(3-aminiopropyl)-1 ,3-propanediamine and 1 ,4-
dibromobutane, producing polyspermine. Another example of a branched
polycation is polyethyleneimine represented by the formula:
(NHCH2CH2)x[N(CH2CH2)CH2CH2]y
Additionally, dendrimers, for example, polyamidoamines or
poiypropyleneimines of various generations (Tomalia et al. Angew. Chem., Int.
Ed. Engl. 29:138 (1990)) can be also used as polycation fragments in the
current invention. The polycation fragments have several positively ionizable groups and a
net positive charge at physiologic pH. Preferably, the polycation fragments will
have at least about 3 positive charges at physiologic pH, more preferably, at 25
least about 6, still more preferably, at least about 12. Also preferred are
polymers or fragments that, at physiologic pH, can present positive charges
with about a distances between the charges of about 2 A to about 1θA. The
distances established by ethtyleneimine, aminopropylene, aminobutylene,
aminopentylene and aminohehhylene repeating units, or by mixtures of at least
two of the group including ethyleneimine, aminopropylene, aminobutilene,
aminopentylene and aminohexylene repeating units are most preferred.
Accordingly, for instance, polycationic fragments that utilize a (NCH2CH2),
(NCH2CH2CH2), (NCH2CH2CH2CH2), (NCH2CH2CH2CH2CH2), and
(NCH2CH2CH2CH2CH2CH2) repeating unit, or a mixture of at least two of the
group including (NCH2CH2), (NCH2CH2CH2), (NCH2CH2CH2CH2),
(NCH2CH2CH2CH2CH2), and (NCH2CH2CH2CH2CH2CH2) repeating units, are
preferred.
Polycation fragments comprising a -N-R0- repeating unit are also preferred.
R° is preferably an ethylene, propylene, butylene, pentylene, or hexylene which
can be modified. In a preferred embodiment, in at least one of the repeating
units, R° includes a DNA intercalating group such as an ethidium bromide
group. Such intercalating groups can increase the affinity of the polymer for
nucleic acid. Preferred substitutions on R° include alkyl of 1-6 carbons,
hydroxy, hydroxyalkyl, wherein the alkyl has 1-6 carbon atoms, alkoxy having 1-6 carbon atoms, an alkyl carbonyl group having 2-7 carbon atoms,
alkoxycarbonyl wherein the alkoxy has 1-6 carbon atoms, alkoxycarbonylalkyl
wherein the alkoxy and alkyl each independently has 1-6 carbon atoms,
alkylcarboxyalkyl wherein each alkyl group has 1-6 carbon atoms, aminoalkyl
wherein the alkyl group has 1-6 carbon atoms, alkylamino or dialkylamino
where each alkyl group independently has 1-6 carbon atoms, mono- or di-
alkylaminoalkyl wherein each alkyl independently has 1-6 carbon atoms,
chloro, chloroalkyl wherein the alkyl has from 1-6 carbon atoms, fluoro,
fluoroalkyl wherein the alkyl has from 1-6 carbon atoms, cyano, or cyano alkyl
wherein the alkyl has from 1-6 carbon atoms or a carboxyl group. More
preferably, R° is ethylene, propylene or butylene.
It is preferred that nonionic polymer fragments comprise water-soluble
polymers, which are nontoxic and nonimmunogenic. The preferred nonionic
polymer fragment is a polyethylene oxide, a copolymer of ethylene oxide and
propylene oxide, a polysaccharide, a polyacrylamide, a polygycerol, a
polyvinylalcohol, a polyvinyl-pyrrolidone, a polyvinylpyridine N-oxide, a
copolymer of vinylpyridine N-oxide and vinylpyridine, a polyoxazoline, or a
polyacroylmorpholine or the derivatives thereof.
The following nonionic polymer fragments are particularly preferred:
Figure imgf000015_0001
a block copolymer of
Figure imgf000016_0001
Figure imgf000016_0002
Figure imgf000016_0003
Figure imgf000016_0004
Figure imgf000016_0005
Figure imgf000017_0001
or
Figure imgf000017_0002
in which each of m and j has a value of from 3 to about 50,000,000.
In one preferred embodiment of the present invention the nonionic polymer
fragments are the block copolymers of ethylene oxide and propylene oxide
having the formulas:
HO- H2O- -CH2CH2O-f-H
Figure imgf000017_0003
x
(I)
Figure imgf000017_0004
OO
CH, CH,
HO- CHCH2O- -CH2CH2O- -CHCH2O- Η y
(III)
or,
R1 R , 1 p2 r r
H[OCH2CH2].- [OCHCH]. [CHCHO].- [CH2CH20]j H
\
H[OCH2CH2] - [O [CH2CH20] . H
Figure imgf000018_0001
(IV)
H
H
Figure imgf000018_0002
(IV-A)
in which x, y, z, i and j have values from about 2 to about 800, preferably
from about 5 to about 200, more preferably from about 5 to about 80, and
wherein for each R1, R2 pair, one is hydrogen and the other is a methyl group. Formulas (I) through (III) are oversimplified in that, in practice, the
orientation of the isopropylene radicals within the B block will be random. This
random orientation is indicated in formula (IV), which is more complete. Such
poly(oxyethylene)-poly(oxypropylene) compounds have been described by
Santon, Am. Perfumer Cosmet. 72(4):54-58 (1958); Schmolka, Loc. cit.
82(7):25 (1967); Schick, Non-ionic Surfactants, pp. 300-371 (Dekker, NY,
1967). A number of such compounds are commercially available under such
generic trade names as "poloxamers", "pluronics" and "synperonics." Pluronic
polymers within the B-A-B formula are often referred to as "reversed" pluronics,
"pluronic R" or "meroxapol". The "polyoxamine" polymer of formula (IV) is
available from BASF (Wyandotte, Ml) under the tradename Tetronic™. The
order of the polyoxyethylene and polyoxypropylene blocks represented in
formula (XVII) can be reversed, creating Tetronic R™, also available from
BASF. See, Schmolka, J. Am. Oil Soc, 59:110 (1979). Polyoxypropylene-
polyoxyethylene block copolymers can also be designed with hydrophilic
blocks comprising a random mix of ethylene oxide and propylene oxide
repeating units. To maintain the hydrophilic character of the block, ethylene
oxide will predominate. Similarly, the hydrophobic block can be a mixture of
ethylene oxide and propylene oxide repeating units. Such block copolymers
are available from BASF under the tradename Pluradot™.
The diamine-linked pluronic of formula (IV) can also be a member of the
family of diamine-linked polyoxyethylene-polyoxypropylene polymers of
formula:
Figure imgf000020_0001
(V) wherein the dashed lines represent symmetrical copies of the polyether
* extending off the second nitrogen, R is an alkylene of 2 to 6 carbons, a -
cycloalkylene of 5 to 8 carbons or phenylene, for R1 and R2, either (a) both are
hydrogen or (b) one is hydrogen and the other is methyl, for R3 and R4 either
(a) both are hydrogen or (b) one is hydrogen and the other is methyl, if both of
R3 and R4 are hydrogen, then one R5 and R6 is hydrogen and the other is
methyl, and if one of R3 and R4 is methyl, then both of R5 and R6 are hydrogen.
Those of ordinary skill in the art will recognize, in light of the discussion
herein, that even when the practice of the invention is confined for example, to
poly(oxyethylene)-poly(oxypropylene) compounds, the above exemplary
formulas are too confining. Thus, the units making up the first block need not
consist solely of ethylene oxide. Similarly, not all of the second type block
need consist solely of propylene oxide units. Instead, the blocks can
incorporate monomers other than those defined in formulas (I) - (V), so long as
the parameters of this first embodiment are maintained. Thus, in the simplest
of examples, at least one of the monomers in hydrophilic block might be
substituted with a side chain group as previously described. The term "link" used herein means covalent bond between two atoms,
including bond between two monomeric units, or between two polymer chains.
The term "cross-link" used herein means a structure bonding two or more
polymer chains together. The polymer network of the current invention can be
produced by covalent linkage of one polymer fragment to at least two other
polymer fragments having the same or different structure. The linkage of the
polymer fragments in the networks can be conterminous, i.e., polymer cross¬
link in which a polymer chain is linked at both ends to the same or
constitutionally or configurationally different chain or chains. The conterminous
polymer networks can be produced by covalently cross-linking the polycation
fragments by nonionic fragments or pendant groups or vise versa cross-linking
the nonionic fragments by the polycation fragments. For example, the polymer
networks can be synthesized by reacting polyoxyethylene having reactive
groups at two ends with primary amino groups of polyethyleneimine. Another
example is covalent attachment of polyspermine to polyvinylalcohol chains
having activated pendant hydroxyl groups. The network can also be obtained
by cross-linking the pendant groups of polymer fragments. For example,
linking the pendant amino groups of polylysine to the pendant hydroxyl groups
of polyvinylalcohol can produce such network. The networks can also combine
conterminous and non-conterminous linkage. Such network can be produced,
for example, by linking primary and secondary amino groups of
polyethyleneimine and polyvinylalcohol. Without wishing to limit this invention
to a particulate theory it is believed that the polymer networks of the current invention can also be interpenetrating or semi-interpenetrating and can non-
covalently trap polymers and other molecules present during their synthesis.
Those of ordinary skill in the art will recognize, in light of the discussion herein,
that numerous types of polymer network architecture described in literature can
be used in the current invention. See, for example, Sperling, Introduction to
Physical Polymer Science, 2d Edition. Johen Wiley, New York, 1992.
Polymer gels can be synthesized by co-polymerization of the monomers
that form the polycation and nonionic polymer fragments or polymerization of
the monomer that forms one polymer fragment in the presence of another
fragment. Numerous examples of such synthesis are available in the literature.
For example, polymerizing epoxides with polyalkylenepolyamines produced
polymer beads, see U.S. Patent No. 4,189,539. Cationic microgel dispersions
were produced by cross-linking polyepoxide-amine reaction products with
polyepoxide cross-linking agent, see U.S. Patent No. 5,096,556. Carboxylic
acid containing microgel particles were prepared by polymerizing in aqueous
emulsion a monomer mixture containing carboxylic acid monomers and vinyl
monomers, see U.S. Patent No. 4,560,714.
Another approach to synthesizing polymer network involves cross-linking of
pre-formed polymer fragments. For example, cross-linked polymer gels or
films were prepared by cross-linking homopolymers and copolymers of
acrylamide, N-substituted acrylamine or N-substituted methacrylamide with
polyamines or polyols. See U.S. Patent No. 5,280,078. Linking can be accomplished by a number of reactions, many of which
have been described generally in conjugate chemistry, in particular, for
synthesizing block and graft copolymers, and various polymer conjugates.
See, for example, Seymour et al. In Self-Assembling Complexes for Gene
Delivery. From Laboratory to Clinical Trial, Kabanov et al. (eds.), John Wiley,
Chichester (1998); U.S. Patent Nos. 5,593,658, 5,567,410, and 5,656,611.
These reactions can involve, for example, a terminal or pendant hydroxyl group
on one polymer fragment, e.g. R5-O-(C2H4O)-H, in which R5 is hydrogen or a
blocking group such as alkyl, and an appropriate group on another polymer
fragment, the two being joined directly or indirectly; i.e., through a third
component. Alternatively a terminal or pendant group can be converted to
some other functional group, as for example amino, which then is allowed to
react with either with the next polymer fragment or another linking component.
The linking group thus may be formed either by reactively involving a terminal
or pendant group of a polymer fragment or by replacing the terminal or pendant
group. For example, a carboxylic acid group can be activated as with N,N'-
dicyclohexylcarbodiimide and then allowed to react with an amino or hydroxy
group to form an amide or ether respectively. Anhydrides and acid chlorides
will produce the same links with amines and alcohols. Alcohols can be
activated by carbonyldiimidazole and then linked to amines to produce
urethane linkages or activated to produce ethers or esters. Alkyl halides can
be converted to amines or allowed to react with an amine, diamines, alcohols,
or diol. A terminal or pendant hydroxy group can be oxidized to form the corre- sponding aldehyde or ketone. This aldehyde or ketone then is allowed to react
with a precursor carrying a terminal or pendant amino group to form an imine
which, in turn, is reduced, as with sodium borohydrate to form the secondary
amine. See Kabanov et al., J. Contr. Release, 22:141 (1992); Meth. Enzymol.
XLVII, Hirs & Timasheff, Eds., Acad. Press, 1977. The linkage thereby formed
is the group -NH-, replacing the terminal or pendant hydroxyl group of the
polymer fragment.
Alternatively, a terminal or pendant hydroxyl group on the polymer can be
allowed to react with bromoacetyl chloride to form a bromoacetyl ester which in
turn is allowed to react with an amine precursor to form the -NH-CH2-C(O)-
linkage. Immobilized Enzymes, Berezin et al. (eds.), MGU, Moscow, 1976, i.e.,
-NH-CH2-C(0)-. The bromoacetyl ester of a polymer fragment also can be
allowed to react with a diaminoalkane of the formula NH2-CQH2c?-NH2 which in
turn is allowed to react with an carboxy group on another polymer fragment, or
an activated derivative thereof such as an acid chloride or anhydride. The
bromoacetyl ester also can be allowed to react with a cyanide salt to form a
cyano intermediate. See e.g., Sekiguchi et al., J. Biochem., 85, 75 (1979);
Tuengler et al., Biochem. Biophys. Ada, 484, 1 (1977); Browne et al. BBRC,
67, 126 (1975); and Hunter et al., JACS 84, 3491 (1962). This cyano
intermediate then can be converted to an imido ester, for instance by treatment
with a solution of methanol and hydrogen chloride, which is allowed to reacted
with a amine precursor to form a -NH-C(NH2 +)CH2C(0)- linkage. A terminal or
pendant hydroxyl group also can be allowed to react with 1 , 1 '-carbonyl-jb/s- imidazole and this intermediate in turn allowed to react with an amino precursor
to form a -NH-C(O)0- linkage. See Bartling er a/., Nature 243, 342 (1973).
A terminal or pendant hydroxyl also can be allowed to react with a cyclic
anhydride such as succinic anhydride to yield a half-ester which, in turn, is
allowed to react with a precursor having terminal or pendant amino group using
conventional condensation techniques for forming peptide bonds such as
dicyclohexylcarbodiimide, diphenylchlorophosphonate, or 2-chloro-4,6-
dimethoxy-1 ,3,5-triazine. See e.g., Means et al., Chemical Modification of
Proteins, Holden-Day (1971). Thus formed is the -NHC(0)(CH2)(7C(0)0-
linkage.
A terminal or pendant hydroxyl group also can be allowed to react with 1 ,4-
butanediol diglycidyl ether to form an intermediate having a terminal or pendant
epoxide function linked to the polymer through an ether bond. The terminal or
pendant epoxide function, in turn, is allowed to react with an amino precursor.
Pitha et al., Eur. J. Biochem., 94:11 (1979); Elling and Kula, Biotech. Appl.
Biochem., 13:354 (1991); Stark and Holmberg, Biotech. Bioeng., 34:942
(1989).
Halogenation of a terminal or pendant hydroxyl group permits subsequent
reaction with an alkanediamine such as 1 ,6-hexanediamine. The resulting
product then is allowed to react with carbon disulfide in the presence of
potassium hydroxide, followed by the addition of proprionyl chloride to generate
a isothiocyanate which in turn is allowed to react with an amino precursor to yield a -N-C(S)-N-(CH2)6-NH- linkage. See Means et al., Chemical Modification
of Proteins, Holden-Day (1971). The polymer chain terminating in an amino
group also can be treated with phosgene and then another polymer fragment
containing amino group to form an urea linkage. See Means et al., Chemical
Modification of Proteins, Holden-Day (1971).
The polymer fragment terminating in an amino group also can be treated
with dimethyl ester of an alkane dicarboxylic acid and the product allowed to
react with an amino precursor to produce a -N-C(NH2 +)-(CH2)4-C(NH2 +)-N-
linkage. See Lowe et al., Affinity Chromatography, Wiley & Sons (1974). The
polymer fragment terminating in an amino group also can be allowed to react
with an alkanoic acid or fluorinated alkanoic acid, preferably an activated
derivative thereof such as an acid chloride or anhydride, to form a linking group
-CONH-. Alternatively an amino precursor can be treated with an α,ω-
diisocyanoalkane to produce a -NC(0)NH(CH2)6NHC(0)-N- linkage. See
Means et al. Chemical Modification of Proteins, Holden-Day (1971). Some
linking groups thus can simply involve a simple functional group while others
may comprise a spacer unit such as a polymethylene chain between two func¬
tional groups. When the linking group comprises such a polymethylene chain,
it can have as few as two methylene units but preferably contains more; e.g.,
six or more methylene units. The above descriptions exemplify typical
strategies for the formation of linkages between the fragments of the polymer
networks of the current invention. These procedures parallel those, which are
known to form conjugates of biologically active agents and other agents, including the general conjugation met ods described by Means et al.,
Chemical Modification of Proteins, Holden-Day (1971); Glazer et al., Chemical
Modification of Proteins, Elsevier, New York (1975J; Immunotechnology
Catalog & Handbook, Pierce Chemical Co.; and Polyethylene Glycol
Derivatives Catalog, Shearwater Polymers, Inc. (1994). It also will be
appreciated that linkages which are not symmetrical, such as -CONH- or -
NHCOO-, can be present in the reverse orientation; e.g., -NHCO- and
-OCONH-, respectively.
The size of the polymer networks is one major parameter determining their
usefulness in biological compositions. After administration in the body large
particles are eliminated by the reticuloendothelial system and cannot be easily
transported to the disease site (see, for example, Kabanov et al., J. Contr.
Release, 22, 141 (1992); Volkheimer. Pathologe 14: 247 (1993); Kwon and
Kataoka, Adv. Drug. Del. Rev. 16:295 (1995). Also, the transport of large
particles in the cell and intracellular delivery is limited or insignificant. See,
e.g., Labhasetwar et al. Adv. Drug Del. Res. 24:63 (1997). It was
demonstrated that aggregated cationic species with a size from 500 nm to over
1 μm are ineffective in cell transfection, see Kabanov et al., Self-Assembling
Complexes for Gene Delivery. From Laboratory to Clinical Trial, Kabanov et al.
(eds.), John Wiley, Chichester (1998) and references cited. Large particles,
particularly, those positively charged exhibit high toxicity in the body, in part
due to adverse effects on liver and embolism. See e.g., Volkheimer. Pathologe
14:247 (1993); Khopade et al Pharmazie 51 :558 (1996); Yamashita et al., Vet. Hum. Toxicol., 39:71 (1997). Nanogel polymer networks are nontoxic, can
enter into small capillaries in the body, transport in the body to a disease site,
cross biological barriers (including but not limited to the blood-brain barrier and
intestinal epithelium), absorb into cell endocytic vesicles, cross cell membranes
and transport to the target site inside the cell. The particles in that size range
are believed to be more efficiently transferred across the arterial wall compared
to larger size microparticles, see Labhasetwar et al., Adv. Drug Del. Res. 24:63
(1997). Without wishing to be bound by any particular theory it is also believed
that because of high surface to volume ratio, the small size is essential for
successful targeting of such particles using targeting molecules. Further, it is
also believed the nanogel size ranges are preferred for the optimal
performance of the polymer networks in the combinatorial formulations. The
preferred range of the size of nanogel networks is from about 20 nm to about
600 nm, more preferred from about 50 nm to about 250 nm, still more preferred
from about 70 nm to about 150 nm.
While not wishing to be bound by any specific theory, it is further believed
that nanogel particles shall have these sizes in a swollen state in aqueous
solutions. The preferred range of size of the nanogel networks of the current
invention is much less that that of the previously described dispersed and
water-swollen cationic microgels and beads can be produced. See, for
example, U.S. Patent Nos. 4,189,539 and 5,096,556. It is also believed that maintaining the particle size distribution in the
preferred range and thorough purification from larger particles is essential for
the efficiency and safety of the nanogel networks. It is recognized that useful
properties of the nanogel networks are determined solely by their size and
structure and are independent of the method used for their preparation.
Therefore, this invention is not limited to a certain synthesis or purification
procedures, but rather encompasses new and novel chemical entities useful in
biological agent compositions.
Those of ordinary skill in the art will recognize, in light of the discussion
herein, that even when the practice of the invention is confined, for example, to
certain nanogel networks there are numerous methods of particle preparation
and dispersion that will yield the nanogel networks with the desired
characteristics. Thus any method resulting in nanogel species with the desired
characteristics is suitable for preparation of the polymer networks and
biological agent compositions thereof. Many such useful methods can be
found in nanotechnologies and nanoparticle chemistry. See, for example,
Hrkach et al. Biomaterials, 18:27 (1997). Nanoparticles and nanospheres can
be synthesized in aqueous and non-aqueous emulsions under the appropriate
conditions and then separated by size exclusion chromatography, membrane
filtration, ultracentrifugation or similar technique. See, for example, Bertling, et
al., Appl. Biochem., 13, 390 (1991); Lukowski et al., Int. J. Pharm., 84, 23
(1992); Pirker er a/., Int. J. Pharm., 128, 189 (1996); Peracchia, et al. J. Contr.
Re/., 46, 223 (1997); Zobel et al. Antisense Nucl. Acid Drug Dev. 7, 483 (1997); Ferdous, et al. J. Contr. Rel. 50, 71 (1998); and literature cited. The "water-in-
oil" and "oil-in-water" microemulsions as well as normal and reverse surfactant
micelles have proven to be particularly useful for preparation of particles with
the preferred size distribution. See, for example, Abakumova, et al., Dokl.
Acad. Nauk SSSR, 283, 136 (1985); Khmelnitsky, et al., Eur. J. Biochem., 210,
751 (1992). Methods of nanoparticle preparation include but are not limited to
emulsification-solvent evaporation technique, multiple emulsion solvent
evaporation technique, phase inversion, coacervation, salting out, spray drying,
emulsion and micro-emulsion polymerization, and the like. See Labhasetwar,
In Self-Assembling Complexes for Gene Delivery. From Laboratory to Clinical
Trial, Kabanov et al. (eds.), John Wiley, Chichester (1998). By varying
conditions of reaction, including the type and dispersity of the media, addition
of surfactants, temperature, and ratio of reagents the size of the particles can
be controlled.
Various nanoparticles were proposed recently as versatile carriers for
pharmaceutical agents. See, e.g., Sharma et al. Oncology Research 8, 281
(1996); Zobel et al. Antisense Nucl. Acid Drug Dev. 7, 483 (1997); de Verdiere
et al. Br. J. Cancer 76, 198 (1997); Hussein et al. Pharm. Res. 14, 613 (1997);
Alyautdin et al. Pharm. Res. 14, 325 (1997); Hrkach et al. Biomaterials, 18, 27
(1997); Torchilin, J. Microencapsulation 15, 1 (1988); Labhasetwar, Self-
Assembling Complexes for Gene Delivery. From Laboratory to Clinical Trial,
Kabanov et al. (eds.), John Wiley, Chichester (1998); and literature cited. The
nanoparticle chemistries provide for a wide spectrum of rigid polymer structures, which are suitable for the encapsulation of drugs, drug delivery and
controlled release. Some major problems of these carriers include
aggregation, low drug loading capacity and restricted control of the drug
release kinetics.
Due to their unique architecture, nanogel polymer networks combine
properties of cross-linked polymer gels and dispersed colloidal particles. They
are porous materials that can be loaded with a variety of biological agents,
including small molecules and polymers, at a very high biological agent to
polymer network ratio. The immobilization of the biological agents in the
nanogel networks proceed in the whole volume of the network rather on its
surface and under certain conditions can be accompanied by the micro-
collapse of the network providing for additional masking and protection of the
biological agent. Nanogel networks of the current invention are soluble and do
not aggregate after complete neutralization of the polycation charges. The
loading capacity of nanogel networks can be as high as several grams or
several dozen grams per one gram of the polymer network. This is much
higher compared to the loading capacity achieved with nanoparticles. See,
Labhasetwar et al. Adv. Drug Del. Res. 24:63 (1997). In contrast to
conventional drug delivery particles such as nanoparticles (which usually have
to be prepared in the presence of the biological agent) the polymer network is
loaded with the biological agent after this network its synthesized. This greatly
simplifies the preparation and use of the biological agent composition of this
invention and permits using same batches of nanogel network with many different biological agents and compositions. The combination of the
polycation and nonionic fragments including hydrophobic-hydrophilic block
copolymers enables formulating the nanogel networks with a broader range of
biological agents compared to most other particulate drug delivery and
controlled release systems. Also, combination of polycation and nonionic
polymer fragments in the polymer networks of the current invention provides for
much greater versatility and property range compared to conventional drug
delivery systems. The possibility to change the structure and porosity of
nanogel networks by changing the polymer fragment structure is
unprecedented for any particulate delivery system. Also, due to the small size
the polymeric species can be transported in the body to a disease site, cross
biological barriers including but not limited to the blood-brain barrier and
intestinal epithelium, enter cells, cross cell membranes and be transported to
the target site inside cell.
It is further believed that the combination of the useful properties of
nanogel network is unique and unmatched by other delivery systems in this
size range.
It will in some circumstances be desirable to incorporate in the nanogel
networks of the current invention, by noncovalent association or covalent
conjugation, targeting molecules. See for example, Kabanov et al., J.
Controlled Release, 22:141 (1992), the contents of which are hereby
incorporated by reference. The term "targeting molecule" refers to any molecule, atom, or ion linked to the polymer networks of the current invention
that enhance binding, transport, accumulation, residence time, bioavailability or
modify biological activity of the polymer networks or biologically active
compositions of the current invention in the body or cell. The targeting
molecule will frequently comprise an antibody, fragment of antibody or chimeric
antibody molecules typically with specificity for a certain cell surface antigen. It
could also be, for instance, a hormone having a specific interaction with a cell
surface receptor, or a drug having a cell surface receptor. For example,
glycolipids could serve to target a polysaccharide receptor. It could also be, for
instance, enzymes, lectins, and polysaccharides. Low molecular mass ligands,
such as folic acid and derivatives thereof are also useful in the context of the
current invention. The targeting molecules can also be polynucleotide,
polypeptide, peptidomimetic, carbohydrates including polysaccharides,
derivatives thereof or other chemical entities obtained by means of
combinatorial chemistry and biology. Targeting molecules can be used to
facilitate intracellular transport of the particles of the invention, for instance
transport to the nucleus, by using, for example, fusogenic peptides as targeting
molecules described by Soukchareun et al., Bioconjugate Chem., 6, 43, (1995)
or Arar et al., Bioconjugate Chem., 6, 43 (1995), caryotypic peptides, or other
biospecific groups providing site-directed transport into a cell (in particular, exit
from endosomic compartments into cytoplasm, or delivery to the nucleus).
Included within the scope of the invention are compositions comprising the
polymer networks of the current invention and a suitable targeting molecule. The targeting molecule can be covalently linked to any of the polymer
fragments of the polymer networks identified herein, including cationic and
nonionic polymer fragments. For instance, the targeting molecule can be
linked to the free-terminal or pendant groups of the nonionic fragments of the
particles of the invention. Such targeting molecules can be linked to the
terminal or pendant -OH end group of the polymer fragments, and the terminal
or pendant -NH2 group of the polymers, or the terminal or pendant -COOH end
group of the polymers or the like.
It will in some circumstances be desirable to incorporate targeting
molecules through ligand-receptor construct, in which (/) the ligand molecule is
any chemical entity (e.g., molecule, atom or ion) capable of specific binding
with the receptor molecule, (/'/) the receptor molecule is any chemical capable
of specific binding to the ligand molecule, (///) the ligand or receptor molecules
or both the ligand and receptor molecules are incorporated in the polymer
networks of the current invention or targeting molecules or both polymer
networks and targeting molecules, by noncovalent association or covalent
conjugation, so that after mixing targeting molecules and polymeric species
with ligand and receptor molecules attached to them or adding either free
ligand or receptor or both ligand and receptor to the mixture of targeting
molecules and polymer networks, the targeting molecule become attached to
the polymer networks ad a result of binding between the ligand and receptor.
Useful examples of such construct are the constructs using biotin as the ligand
and avidin or streptavidin as the receptor. For example, biotin or the derivative thereof can be covalently linked to the polymer networks of the current
invention and avidin (or streptavidin) can be covalently linked to the targeting
molecule. Alternatively, biotin can be linked to both the polymer networks and
targeting molecule and the latter can be linked through avidin, which has four
biotin-binding centers. Additionally, more complex constructs comprising biotin
and avidin can be used for incorporating targeting molecules in polymer
networks of the current invention.
In a preferred embodiment, the invention provides for the polymer networks
with biotin molecules or derivatives thereof linked to at least one polycation or
nonionic polymer fragment of both polycation and nonionic polymer fragments.
Those of ordinary skill in the art will recognize, in light of the discussion herein,
that even when the practice of the invention is confined for example, to biotin-
avidin or biotin-streptavidin constructs or the similar constructs, there are
numerous ways available providing for the design of the ligand-receptor
constructs with the desired characteristics pursuant to this invention. Such
constructs, for example, can comprise ligands and/or receptors that are
polynucleotide, polypeptide, peptidomimetic, carbohydrates including
polysaccharides, derivatives thereof or other chemical entities obtained by
means of combinatorial chemistry and biology.
The targeting molecules that can be associated with the polymer networks
of the current invention can also have a targeting group having affinity for a
cellular site and a hydrophobic group. Such targeting molecules can provide for the site specific delivery and recognition in the body. The targeting
molecule will spontaneously associate with the particles and be "anchored"
thereto through the hydrophobic group. These targeting adducts will typically
comprise about 1% or less of the polymers in a final composition. In the
targeting molecule, the hydrophobic group can be, among other things, a lipid
group such as a fatty acyl group. Alternately, it can be an ionic or nonionic homopolymer, copolymer, block copolymer, graft copolymer, dendrimer or
other natural or synthetic polymer.
The use of the polymer fragments with dual nonionic and cationic
functionality in polymer networks of the current invention permits varying of the
properties of these systems by changing the lengths and/or chemical structure
of these polymer fragments within a very broad range. This design of polymer
networks allows for tremendous versatility of properties with simple chemical
structures and permits optimization of drug delivery and drug release systems
for enhanced performance with a variety of drugs and drug delivery situations.
Particularly, the longevity of circulation in blood can be varied from very long
circulating network dispersions to dispersions rapidly accumulating in organs.
Biodistribution can be varied to achieve site-specific drug delivery and release,
and the rate or release can be varied from seconds to days and weeks, etc.
The versatility of these polymer networks permits selecting biological agent
compositions that are most efficient and safe {i.e., have best "therapeutic
index") for a very broad variety of biological agents. Therefore, this invention
also provides for a method of identifying biological agent compositions that can be useful in pharmaceutics and biopharmaceutics, diagnostics and imaging,
immunology, veterinary, agriculture, and other areas where the properties of
biological agents exhibited during interaction with a living organism or cell can
be improved by formulation.
Due to the complex relationship between the biological properties and
biological agent compositions, the current methods for discovery and
optimization of a useful biological agent composition is often time-consuming
and requires numerous trials. In one embodiment, therefore, the invention
provides for a rational combinatorial method for identifying a useful biological
agent composition by determining which copolymer of the basis possesses the
desired properties with a certain biological agent.
The present invention thus relates to a method of identifying a
biological agent composition of choice comprising:
(a) preparing a plurality of polymer networks, said networks differing in at least one of the polymer fragment constitutional, configurational or conformational feature;
(b) preparing compositions of polymer networks with a biological agent;
(c) testing at least some said compositions of said polymer networks with a biological agent for biological properties using at least one of the following: a cell model, animal, plant or other biological model; measurement of a chemical or physical property in a test tube; or a theoretical model, and
(d) identifying said compositions with desired biological properties. The terms "preparing a plurality of polymer networks" and "preparing
compositions of polymer networks" are used in the broad sense to include
design of theoretical models for computational analysis. This includes mixing
of the biological agent and the carrier under specific conditions of solvent
composition, concentration, pH, temperature and the like as well as creation of
a parent database of polymer networks and databases on biological agents
alone, including but not limited to chemical structure and biological properties.
The invention does not require that all or any polymer networks are
synthesized, or that all or any of biological agent compositions are actually
formulated. The plurality of polymer networks can be constructed "on paper"
and then tested in a computer database. Similarly, the compositions of the
polymer networks with biological agents can be presented as a database.
Such databases can contain information on the structure of polymer networks,
constitution, architecture and properties of the polymer fragments, properties of
biological agent compositions, including physicochemical properties, biological
activity, mechanism of action, disease target, initial screening results, and
known or expected problems to their use.
The term "biological property" as used herein means any property of
biological agent or biological agent composition that affects the action of this
biological agent or biological agent composition during interaction with a
biological system. This includes, but is not limited to solubility, stability,
mechanical properties, spectral properties, binding with plasma proteins, DNA,
RNA, specific receptors, enzymes or other molecules, resistance to metabolic enzymes, chemical stability, toxicity, membrane transport, transport into, out,
within and across target cells, tissues or organs, bioavailability,
pharmacokinetics, site specific delivery, specific enzymatic activities, activation
or suppression of gene expression, total DNA, RNA and protein biosynthesis,
cell proliferation and differentiation, apoptosis, hormone and polypeptide
secretion; bioavailability, pharmacokineticts, pharmacodynamics, efficacy,
toxicity, therapeutic index and the like.
The term "testing" (of the compositions) as used herein refers to evaluation
of the useful properties of the compositions. Testing can be done using a
variety of computational methods, so that part of or all process of the
identification can be carried out or simulated virtually {i.e., by computer).
Typically testing of the compositions involves evaluation of the biological
property of the compositions using a screening assay.
The plurality of polymer networks of the current invention is termed the
"network basis." The plurality of compositions of these polymer networks with
a biological agent is termed the "composition library."
The ability of the polymer networks of the invention to capture and release
biological agents, interact with various systems of cell and organism affecting
biological properties or otherwise interact modifying the biological response
with respect to a certain biological agent depends on the lengths (number of
repeating units) of the polycation and nonionic fragments, their structure, and
conformation. The invention proposes that within a basis of the polymer networks there will be at least one chemical entity that will form with a certain
biological agent a composition with desired biological properties.
Screening Assays and Composition Identification. The screening assays
of this invention are analytical tests, useful in characterizing and selecting
biological agent compositions by sorting them for "positive" and "negative"
compositions according to the initially defined criteria. Normally, one or more
screening assays are required to identify a preferable biological agent
composition.
Depending upon the task, varieties of in vitro cell-free and cell-based, as
well as in vivo screening assays can be used to select preferred biological
agent compositions. This includes physico-chemical tests such as the
characterization of solubility, stability, size, rheology, mechanics, spectral
properties, release kinetics, binding with plasma proteins, DNA, RNA, specific
receptors, enzymes or other molecules, chemical stability, transport-related
tests such as analyses of transport into, out of, within, and through target cells,
tissues or organs, functional tests such as analyses of specific enzymatic
activities, activation or suppression of gene expression, total DNA, RNA and
protein biosynthesis, cell proliferation and differentiation assays, apoptosis
analysis, hormone and polypeptide secretion assays; in vivo pharmacological
tests, such as pharmaco-kineticts, bioavailability, pharmacodynamics of
biological agent, its efficacy, toxicity and therapeutic index. Since composition libraries are screened in accordance with the invention,
high-throughput and ultra-high-throughput screening assays are preferred.
Depending upon the specific properties of the biological agent and obstacles to
biological agent use, various combinations of the screening assays can be
applied to identify a biological agent composition.
Many biological agents have limited solubility in aqueous solutions.
Therefore, they often cannot be administered at required doses in the body
without specifically selected and optimized delivery systems for improving
biological agent solubility. In one embodiment, composition libraries are
generated and screened to improve biological agent solubility in aqueous
solutions. In the related screening system, solubility of the biological agent
alone is determined and compared to that of a biological agent formulated with
the selected carriers. A variety of methods can be used to determine the
biological agent solubility including but not limiting light absorption, fluorescent,
spectrophotometry, circular dichroism, calorimetry, NMR, ESR,
chromatography; mass spectrometry and the like.
One of the most common problems related to the limited performance of
biological agents is their insufficient stability, which is often related to their high
sensitivity to metabolic enzymes. Such enzymes include proteases,
nucleases, redox enzymes, transferases, etc. In one preferred embodiment,
composition libraries are generated and screened to protect biological agent
from degradation by metabolic enzymes. The screening can include treatment of the biological agent with isolated enzymes, their combinations or enzymatic complexes existing in isolated fractions of cells or tissues, followed by analysis
of the native biological agent level in the analyzed sample. The screening can
also be based on the biological agent administration in a whole organism
followed by sampling and analysis of the native biological agent level in the
sample, or by continuous monitoring of the native biological agent level in the
body. Verity of methods could be used for detection of the native biological
agent level including but not limiting HPLC, LC-MS, GC-MS, radioisotope
methods, NMR, various bioassays, etc.
Another common obstacle that limits biological agent effectiveness is
insufficient circulation time in the body due to clearance of the biological agent
by the reticuloendothelial system. According to the present invention, the
composition libraries can be prepared and screened to reduce the biological
agent clearance. The screening methods can be based upon direct
measurement of the biological agent binding with serum proteins such as
albumin, low density and ultralow density lipopolyproteins, and the like. Also,
these screening methods can use the analysis of the biological agent
phagocytosis by isolated cell populations such as macrophages,
polymorphonulear cells, etc. The screening can also be based on biological
agent administration in a whole organism followed by sampling and analysis of
the native biological agent level in the sample, or by continuos monitoring of
the native biological agent level in the body. Combinations of the above
procedures can also be used. Reduced efficacy of the biological agent is also often caused by its low
bioavailability. For example, most polypeptides and proteins, polynucleotides,
as well as many low molecular weight pharmaceutical drugs are not effective
when administered orally. An important factor that limits oral bioavailability of
the above pharmaceutical agents is their reduced adsorption through small
intestinal epithelial tissue. According to the present invention, the composition
libraries of such biological agents can be prepared and screened to increase
biological agent oral bioavailability. The screening methods include, but are
not limited to the measurement of the biological agent transport across
polarized epithelial cell monolayers, for example, Caco-2 or Caco-4 cell
monolayers. Another bioavailability-related problem is low efficacy of central
nervous system agents, which caused by limited transport of the agents across
brain microvessel endothelial tissue that is also known as blood brain barrier
(BBB). Composition libraries can be generated and screened for compositions
that increase biological agent transport across BBB. The screening methods
for this assay can be based on the measurement of the biological agent
transport across polarized endothelial cell monolayers, such as primary bovine
brain microvessel endothelial cells (BBMEC), human primary and immortalized
brain microvessel endothelial cells, etc. The bioavailability screening
procedures also include administration of the biological agent in a whole
organism followed by sampling and analysis of the native biological agent level
in the sample, or by continuos monitoring of the native biological agent level in
the body. Combinations of the above procedures can also be used. Depending on the nature of the biological agent, the efficacy of its transport
can be measured by various methods including but not limited to fluorescence,
absorption or other spectroscopy, radioisotope methods, various bio- or
immunoassays, etc.
Biological activity of many biological agents is often significantly reduced
due to insufficient efficacy of the biological agent transport through the cell
membrane. To resolve this problem, composition libraries can be generated
and screened for compositions that can improve biological agent
transmembraneous properties. Verity of screening methods can be used to
evaluate the efficacy of biological agent transport through the membrane.
These methods include but not limited by those based on analysis of the
biological agent transport across artificial membranes such as lipid bilayers and
liposomes, analysis of the biological agent uptake in cells including, cell lines,
primary cell cultures, bacterial strains and isolates, etc. Depending on the
biological agent nature, the efficacy of its transport can be measured by
various methods including but not limited fluorescent, absorption or other
spectroscopy, radioisotope methods, various bio- or immunoassays, etc.
The libraries of biological agent composition can be also screened using
direct measurement of the biological agent biological activity. Depending on
the biological agent properties, verity of screening methods can be used to
analyze biological agent biological effect. For example, for many anticancer
agents apoptosis assays, such as TONEL staining; proliferation assays, such as thymidine DNA incorporation rate analysis, MTT, XTT and colony formation
assays can be used to evaluate efficacy of the selected compositions. Cell
adhesion based methods could be used for evaluation of immune modulating
compositions.
Depending on the nature of the biological agent, more specific screening
methods could be used to evaluate efficacy of the biological agent
compositions including but not limiting analyses of activity of specific enzymes
that are known to be direct or indirect targets for particular biological agent;
analysis of signal transduction events (such as tyrosine phosphorylation,
association or dissociation of SH2 and/or SH3 signaling proteins, changes in
second messenger levels, etc.) that are involved in the biological agent
mechanism of action; analyses of specific gene expression (by using
hybridization, RT-PCR and/or protein expression assays) that known to
involved in the biological agent mechanism of action.
In general, any assay that relates to biological activity, transport,
pharmacokinetics, stability or other useful property of a biological agent and
composition thereof can be used to screen composition libraries for the best
performing composition with pre-selected biological agent.
The screening and identification of the biological agent compositions
pursuant this invention can use a virtual library. Without wishing to be limited
to any particular computational analysis, the use of the virtual library is
exemplified as follows. The starting information for identifying the desired biological agent composition includes (i) the drug structure, (ii) the database of
available polymer fragments for synthesis of polymer networks, and (iii)
accumulated data on polymer networks, if available. The starting data also
includes the selection of desirable biological properties, which identify the
preferred biological agent composition for the given biological agent. New
polymer networks are virtually assembled by combining structures of polymer
fragments stored in computer database. The combination is subjected to the
rules of the bond formation as if a new compound is synthesized as a result of
a chemical reaction yielding a polymer network of a specific molecular
architecture. A plurality of virtually designed network is a virtual network base.
The physicochemical and biological properties of each network of this base is
then predicted in relation to its specific constitutional, configurational, or
conformational features using the properties of separate polymer fragments and or model polymer networks that were actually synthesized and
characterized in the experiment. The properties of the isolated polymer
fragments include but are not limited to chemical structures of the repeating
units, lengths, QSAR parameters derived from the structures, physicochemical
and biological parameters available from experiments or derived from
experimental data. Exemplary properties of polymer fragments include
molecular weight, volume, surface, hydrophobicity, hydration energy,
partitioning coefficients, ionization degree, etc. The prediction of the polymer
network property can be based on any known or expected relationship between the properties of the polymer fragments and the polymer network
property.
Without wishing to be limited to a particulate theory, it is believed that
interpolation or extrapolation of any previously accumulated data on properties
of polymer networks gives the predicted values. At this stage, the data on the
experimentally determined biological properties of the compositions of the
biological agent, for example, drug candidate, and actually synthesized model
polymer networks are used in the computerized analysis. The predicted
properties of the polymer networks and their compositions with biological
agents are then compared to the desired values, and the score of fit is
calculated. Finally, the virtual polymer networks from the base are classified
according their score, and the best compositions are identified.
Without wishing to be limited by a particular theory, it is believed that
possible elements in the identification of the biological agent composition with
desired properties include but are not limited to parent databases comprising a
large variety of chemical templates, exploratory virtual library of carriers,
computational analysis predicting chemical and physical properties of biological
agent compositions, validated polymer network chemistries (including solid-
phase and solution-phase chemistries) and high throughput screening.
The results of screening are analyzed to determine the compositions with
the desired properties. The analysis includes review and classification of the
data obtained from testing composition using high throughput screening or otherwise to drawing conclusions from the classified data. Analysis identifies
the compositions with desired biological properties answering to a set of criteria
questions including but not limited to the following: (/) is any of composition
good enough to be a final product {ii) do the data from testing support creation
of new library for new testing cycle, and the like. The computational analysis
includes the use of computer program, which analyzes structures of new
polymer networks in the virtual library, predicts their interaction with the drug
candidate and selects the most promising compositions.
Biological agents The polymer networks and compositions of this invention
are useful in pharmaceutics and biopharmaceutics, diagnostics and imaging,
immunology, veterinary, agriculture, and other areas where the properties of
biological agents exhibited during interaction with a living organism or cell can
be improved by formulation. The biological agent of this invention is an agent
that is useful for diagnostics or imaging or that can act on a cell, organ or
organism to create a change in the functioning of the cell, organ or organism,
including but not limited to pharmaceutical drugs, immunoadjuvants, vaccines
genes, herbicides and the like. Such biological agents are represented by
wide variety of agents that are used in diagnostics, therapy, immunization or
otherwise are applied to combat human and animal disease. Such agents
include but are not limited to nucleic acids, polynucleotides, antibacterial
agents, antiviral agents, antifungal agents, antiparasitic agents, tumoricidal or
anti-cancer agents, proteins, toxins, enzymes, hormones, neurotransmitters,
glycoproteins, immunoglobulins, immunomodulators, dyes, radiolabels, radio- opaque compounds, fluorescent compounds, polysaccharides, cell receptor
binding molecules, anti-inflammatories, anti-glaucomic agents, mydriatic
compounds and local anesthetics.
Special classes of biological agents that can be used in this invention
include pharmaceutical drugs. Many drugs are rapidly cleared from the body
or are degraded by the body's defense mechanisms. These problems, plus
toxic side effects, seriously limit drug efficacy by reducing time available to the
drug to reach its target and by limiting the amount of drug which can safely be
given to the patient. In addition many drugs do not readily penetrate tissues or
effectively seek out and concentrate in appropriate cells to maximize their
therapeutic effect. The use of the biological agent compositions pursuant to
this invention permits to significantly improve therapeutic drugs by decreasing
in their side effects, and increase in therapeutic action.
The biological agents with which the present compositions can be used
include but are not limited to non-steroidal anti-inflammatories such as
indomethacin, salicylic acid acetate, ibuprofen, sulindac, piroxicam, and
naproxen, antiglaucomic agents such as timolol or pilocarpine, neurotransmit-
ters such as acetylcholine, anesthetics such as dibucaine, neuroleptics such as
the phenothiazines (for example compazine, thorazine, promazine,
chlorpromazine, acepromazine, aminopromazine, perazine, prochlorperazine,
trifluoperazine, and thioproperazine), rauwolfia alkaloids (for example,
resperine and deserpine), thioxanthenes (for example chlorprothixene and tiotixene), butyrophenones (for example haloperidol, moperone, trifluoperidol,
timiperone, and droperidol), diphenylbutylpiperidines (for example pimozde),
and benzamides (for example sulpiride and tiapride); tranquilizers such as
glycerol derivatives (for example mephenesin and methocarbamol),
propanediols (for example meprobamate), diphenylmethane derivatives (for
example orphenadrine, benzotrapine, and hydroxyzine), and benzodiazepines
(for example chlordiazepoxide and diazepam); hypnotics (for example zolpdem
and butoctamide); beta-blockers (for example propranolol, acebutonol,
metoprolol, and pindolol); antidepressants such as dibenzazepines (for
example, imipramine), dibenzocycloheptenes (for example, amtiriptyline), and
the tetracyclics (for example, mianserine); MAO inhibitors (for example
phenelzine, iproniazid, and selegeline); psychostimulants such as
phenylehtylamine derivatives (for example amphetamines, dexamphetamines,
fenproporex, phentermine, amfeprramone, and pemoline) and dimethylamino-
ethanols (for example clofenciclan, cyprodenate, aminorex, and mazindol);
GABA-mimetics (for example, progabide); alkaloids (for example codergocrine,
dihydroergocristine, and vincamine); anti-Parkinsonism agents (for example L-
dopamine and selegeline); agents utilized in the treatment of Altzheimer's
disease, cholinergics (for example citicoline and physostigmine); vasodilators
(for example pentoxifyline); and cerebro active agents (for example pyritinol
and meclofenoxate). These agents include also DNA topoisomerase inhibitors
(including type I and type II), brain and tumor imaging agents, free radical scavenger drugs, anticoagulants, ionotropic drugs, and neuropeptides such as
endorphins.
The biological agent compositions also can be used advantageously with
anti-neoplastic agents such as paclitaxel, daunorubicin, doxorubicin,
carminomycin, 4'-epiadriamycin, 4-demethoxy-daunomycin, 11-
deoxydaunorubicin, 13-deoxy-daunorubicin, adriamycin-14-benzoate,
adriamycin-14-actanoate, adriamycin-14-naphthaleneacetate, vinblastine,
vincristine, mitomycin C, N-methyl mitomycin C, bleomycin A2,
dideazatetrahydrofolic acid, aminopterin, methotrexate, cholchicine and
cisplatin, antibacterial agents such as aminoglycosides including gentamicin,
antiviral compounds such as rifampicin, 3'-azido-3'-deoxythymidine (AZT), and
acylovir; antifungal agents such as azoles including fluconazole, macrolides
such as amphotericin B, and candicidin; anti-parastic compounds such as
antimonials. These biological agents include without limitation vinca alkaloids,
such as vincristine and vinblastine, mitomycin-type antibiotics, such as
mitomycin C and N-methyl mitomycin, bleomycin-type antibiotics such as
bleomycin A2, antifolates such as methotrexate, aminopterin, and dideaza¬
tetrahydrofolic acid, taxanes, anthracycline antibiotics and others.
The compositions also can utilize a variety of polypeptides such as
antibodies, toxins such as diphtheria toxin, peptide hormones, such as colony
stimulating factor, and tumor necrosis factors, neuropeptides, growth hormone,
erythropoietin, and thyroid hormone, lipoproteins such as μ-lipoprotein, proteoglycans such as hyaluronic acid, glycoproteins such as gonadotropin
hormone, immunomodulators or cytokines such as the interferons or
interleukins, hormone receptors such as the estrogen receptor.
The compositions also can be used with enzyme inhibiting agents such as
reverse transcriptase inhibitors, protease inhibitors, angiotensin converting
enzymes, 5μ-reductase, and the like. Typical of these agents are peptide and
nonpeptide structures such as finasteride, quinapril, ramipril, lisinopril,
saquinavir, ritonavir, indinavir, nelfinavir, zidovudine, zalcitabine,
allophenylnorstatine, kynostatin, delaviridine, b/s-tetrahydrofuran ligands (see,
for example Ghosh et al., J. Med. Chem. 1996, 39:3278), and didanosine.
Such agents can be administered alone or in combination therapy; e.g., a
combination therapy utilizing saquinavir, zalcitabine, and didanosine,
zalcitabine, and zidovudine. See, for example, Collier et al., Antiviral Res.
1996, 29:99.
Included among the suitable biological agents are viral genomes and
viruses (including the lipid and protein coat). This accounts for the possibility of
using our invention with a variety of viral vectors in gene delivery (e.g.
retroviruses, adenoviruses, herpes-virus, Pox-virus) used as complete viruses
of their parts. See, for example, Hodgson, Biotechnology, 1995, 13: 222.
The suitable biological agents include oxygen transporters (e.g., porphines,
porphirines and their complexes with metal ions), coenzymes and vitamins
(e.g., NAD/NADH, vitamins B12, chlorophylls), and the like. The suitable biological agents further include the agents used in
diagnostics visualization methods, such as magnetic resonance imaging (e.g.,
gadolinium (III) diethylenetriamine pentaacetic acid), and may be a chelating
group (e.g., diethylenetriamine pentaacetic acid, triethylenetriamine
pentaacetic acid, ethylenediamine-tetraacetic acid, 1 ,2-diaminocyclo-hexane-
N,N,N',N'-tetraaceticacid, N,N'-di(2-hydroxybenzyl) ethylene diamine), N-(2-
hydroxyethyl) ethylene diamine triacetic acid and the like). Such biological
agent may further include an alpha-, beta-, or gamma-emitting radionuclide
(e.g., galliun 67, indium 111 , technetium 99). The suitable biological agents
are also iodine containing radiopaque molecules. The biological agent may
also be a diagnostic agent, which may include a paramagnetic or
superparamagnetic element, or combination of paramagnetic element and
radionuclide. The paramagnetic elements include but are not limited to
gadolinium (III), dysporsium (III), holmium (III), europium (III) iron (III) or
manganese (II).
The invention can be also used to identify useful fibrinolitic compositions
with enzymes such as streptokinase, urokinase, tissue plasminogen activator
or other fibrinolitic enzyme that is effective in dissolving blood clots and
reestablishing and maintaining blood flow through trombosed coronary or other
blood vessels. Also this invention is used to identify useful compositions for
treating burns, circulatory diseases in which there is an acute impairment of
circulation, in particular, microcirculation, respiratory distress syndrome, as well
as compositions for reducing tissue damage during angioplasty procedures. Further, the compositions identified using this invention including these to treat
myocardial damage, ischemic tissue, tissue damaged by reperfusion injury,
stroke, sickle cell anemia and hypothermia. These compositions are especially
useful for treating vascular obstructions caused by abnormal cells which is an
often complication during malaria and leukemia and are suitable as a perfusion
medium for transplantation of organs. This invention is also suitable for
identifying the compositions of antiinfective compounds, as well as modulators
of immune response, and improved adjuvants, antigenes and vaccines.
The adjuvants suitable for use in this invention include but are not limited
to adjuvants of mineral, bacterial, plant, synthetic or host product origin. The
suitable mineral adjuvants include aluminum compounds such as aluminum
particles and aluminum hydroxide. The suitable bacterial adjuvants include but
are not limited to muramyl dipeptides, lipid A, Bordetella pertussis, Freund's
Complete Adjuvant, lipopolysaccharides and its various derivatives, and the
like. The suitable adjuvants include without limitation small immunogenes,
such as synthetic peptide of malaria, polysaccharides, proteins, bacteria and
viruses. The antigenes that can be used in the present invention are
compounds which, when introduced into a mammal will result in formation of
antibodies. The suitable antigens include but are not limited to natural,
recombinant, or synthetic products derived from viruses, bacteria, fungi,
parasites and other infectious agents, as well as autoimmune disease,
hormones or tumor antigens used in prophylactic or therapeutic vaccines.
These antigens include components produced by enzymatic cleavage or can be compounds produced by recombinant DNA technique. Viral antigens
include but are not limited to HIV, rotavirus, influenza, foot and mouth disease,
herpes simplex, Epstein Barr virus, Chicken pox, pseudorabies, rabies,
hepatitis A, hepatitis B, hepatitis C, measles, distemper, Venezuelan equine
encephalomyelitis, Rota virus, polyoma tumor virus, Feline leukemia virus,
reovirus, respiratory synticial virus, Lassa fever virus, canine parvovirus, bovine
pappiloma virus, tick borne encephalitis, rinderpest, human rhinovirus species,
enterovirus species, Mengo virus, paramixovirus, avian infectious bronchitis
virus. Suitable bacterial antigens include but are not limited to Bordetella
pertussis, Brucella abortis, Escherichia coli, salmonella species, salmonella
typhi, streptococci, cholera, shigella, pseudomonas, tuberculosis, leprosy and
the like. Also suitable antigens include infections such as Rocky mountain
spotted fever and thyphus, parasites such as malaria, schystosomes and
trypanosomes, and fungus such as Cryptococcus neoformans. The protein
and peptide antigens include subunits of recombinant proteins (such as herpes
simplex, Epstein Barr virus, hepatitis B, pseudorabies, flavivirus, Denge, yellow
fever, Neissera gonorrhoeae, malaria, trypanosome surface antigen,
alphavirus, adenovirus and the like), proteins (such as diphteria toxoid, tetanus
toxoid, meningococcal outer membrane protein, streptococcal M protein,
hepatitis B, influenza hemagglutinin and the like), synthetic peptides (e.g.
malaria, influenza, foot and mouth disease virus, hepatitis B, hepatitis C).
Suitable polysaccharide and oligosaccharide antigens originate from pneumococcus, haemphilis influenza, neisseria meningitides, Pseudomonas
aeruginosa, Klebsiella pneumoniae, pneumococcus.
Surfactant-containing compositions The invention also provides
compositions comprising polymer network and at least one surfactant.
Surfactants are useful for improving solubility of biological agents, changing
properties (e.g. particle size, aggregation stability, bioavailability, cell transport)
of the polymer networks and compositions of the current invention, improving
shelf life and the like. Without wishing to limit this invention to a particulate
theory it is believed that surfactants can alter the conformation of the polymer
fragments by interacting with them. Such alteration occurs during interaction of
the polycation fragments of the polymer networks with anionic surfactants
resulting in the collapse of these fragments and condensation of the nanogel
particles. For example, the polyoxyethylene-polyethyleneimine networks
interact with sodium dodecylsulfate. Another example is interaction of nonionic
and ionic amphiphilic surfactants with nonionic fragments, e.g.
polyoxyethylene-polyoxypropylene fragments. Also anionic surfactants can
interact with nonionic fragments, e.g. alkylsufates interacting with
polyoxyethylene. The addition of surfactant to the polymer network containing
compositions can be used to vary in a controllable manner the porosity and
stability of the network, adjust the size of the nanogel particles, and modify
variety of properties of the polymer networks and the biological agent
compositions thereof that are relevant to the effects on a living organism or
cell. In this respect the surfactants can be used in the context of the embodiment of present invention providing the combinatorial method of
identifying a biological agent composition. In this case the polymer networks
can be mixed with one or several surfactants at the same or different
concentrations to provide the network basis in which the conformation of the
polymer fragments differ from each other as a result of the interactions with the
said surfactants.
The surfactants are defined herein in a most general sense as surface
active agents that are adsorbed at interface (see, for example, Martin, Physical
Pharmacy, 4th edn., p. 370 et seq., Lea & Febiger, Philadelphia, London,
1993). These surface active agents in particular decrease the surface tension
at the air-water interface in aqueous solutions (see, for example, Martin,
Physical Pharmacy, 4th edn., p. 370 et seq., Lea & Febiger, Philadelphia,
London, 1993) and include without limitation micelle forming amphiphiles,
soaps, lipids, surface active drugs and other surface active biological agents,
and the like (see, for example, Martin, Physical Pharmacy, 4th edn., Lea &
Febiger, Philadelphia, London, 1993; Marcel Dekker, New York, Basel, 1979;
Atwood and Florence, J. Pharm. Pharmacol. 1971 , 23:242S; Atwood and
Florence, J. Pharm. Sci. 1974, 63:988; Florence and Attwood, Physicochemical
Principles of Pharmacy, 2nd edn., p.180 et seq., Chapman and Hall, New York,
1988; Hunter, Introduction to Modern Colloid Science, p. 12 et seq., Oxford
University Press, Oxford, 1993). The surfactant can be (/) cationic (including
those used in various transfection cocktails), {ii) nonionic (e.g., Pluronic or Tetronic), {Hi) zwitterionic (including betains and phospholipids), or (/V) anionic
(e.g., salts of fatty acids).
The cationic surfactants that can be used in the present biological agent
compositions include but are not limited to primary amines (e.g., hexylamine,
heptylamine, octylamine, decylamine, undecylamine, dodecylamine,
pentadecyl amine, hexadecyl amine, oleylamine, stearylamine, diamino-
propane, diaminobutane, diaminopentane, diaminohexane, diaminoheptane,
diaminooctane, diaminononane, diaminodecane, diaminododecane), seconda¬
ry amines (e.g., N,N-distearylamine), tertiary amines (e.g., N,N',N'-
polyoxyethylene(10)-N-tallow-1 ,3-diaminopropane), quaternary amine salts
{e.g., dodecyltrimethylammonium bromide, hexadecyltrimethylammonium
bromide, alkyltrimethylammonium bromide, tetradecyltrimethylammonium
bromide, benzalkonium chloride, cetyldimethylethylammonium bromide,
dimethyldioctadecyl ammonium bromide, methylbenzethonium chloride,
decamethonium chloride, methyl mixed trialkyl ammonium chloride, methyl
trioctylammonium chloride), 1 ,2-diacyl-3-(trimethylammonio)propane (acyl
group = dimyristoyl, dipalmitoyl, distearoyl, dioleoyl), 1 ,2-diacyl-3-(dimethy-
lammonio)propane (acyl group = dimyristoyl, dipalmitoyl, distearoyl, dioleoyl),
1 ,2-dioleoyl-3-(4'-trimethylammonio) butanoyl-sn-glycerol, 1 ,2-dioleoyl-3-
succinyl-sπ-glycerol choline ester, cholesteryl (4'-trimethylammonio)
butanoate), N-alkyl pyridinium and quinaldinium salts (e.g., cetylpyridinium
halide, N-alkylpiperidinium salts, dialkyldimetylammonium salts, dicationic
bolaform electrolytes (C12Me6; C12Bu6), dialkylglycetylphosphorylcholine, lysolecithin), cholesterol hemisuccinate choline ester, lipopolyamines (e.g.,
dioctadecylamidoglycylspermine (DOGS), dipalmitoyl phosphatidylethanol-
amidospermine (DPPES), N'-octadecylsperminecarboxamide hydroxytrifluoro¬
acetate, N',N"-dioctadecylsperminecarboxamide hydroxytrifluoroacetate, N'-
nonafluoropentadecylosperminecarboxamide hydroxytrifluoroacetate, N',N"-
dioctyl(sperminecarbonyl)glycinamide hydroxytrifluoroacetate, N'-(heptadeca-
fluorodecyl)-N'-(nonafluoropentadecyl)-sperminecarbonyl)glycinamede
hydroxytrifluoroacetate, N'-[3,6,9-trioxa-7-(2'-oxaeicos-11 '-enyl)heptaeicos-18-
enyl]sperminecarboxamide hydroxytrifluoroacetate, N'-(1 ,2-dioleoyl-sπ-glycero-
3-phosphoethanoyl)spermine carboxamide hydroxytrifluoroacetate) (see, for
example, Behr et. al., Proc. Natl. Acad. Sci. 1989, 86:6982; Remy et al.,
Bioconjugate Chem. 1994, 5:647), 2,3-dio!eyloxy-N-[2(spermine-carboxa-
mido)ethyl]-N,N-dimethyl-1-propanaminiumtrifluoroacetate (DOSPA) (see, for
example, Ciccarone et al., Focus 1993, 15:80), NINl,Nll lNlll-tetramethyl-
N,N, lNll INl,l-tetrapalmitylspermine (TM-TPS) (Lukow et al., J. Virol. 1993,
67:4566), N-[1-(2,3-dioleyloxy)propyl]-N,N,N-trimethylamonium chloride
(DOTMA) (see, for example, Feigner, et al., Proc. Natl. Acad. Sci. USA 1987,
84:7413; Ciccarone et al., Focus 1993, 15:80), dimethyl dioctadecylammonium
bromide (DDAB) (see, for example, Whitt et al., Focus 1991, 13:8), 1 ,2-
dioleoyl-3-dimethyl-hydroxyethyl ammonium bromide (DORI) (see, for example,
Feigner et al., J. Biol. Chem. 1994, 269:2550), 1 ,2-dioleyloxypropyl-3-dimethyl-
hydroxyethyl ammonium bromide (DORIE) (see, for example, Feigner et al., J.
Biol. Chem. 1994, 269:2550), 1 ,2-dioleyloxypropyl-3-dimethyl-hydroxypropyl ammonium bromide (DORIE-HP) (see, for example, Feigner et al., J. Biol.
Chem. 1994, 269:2550), 1 ,2-dioleyloxypropyl-3-dimethyl-hydroxybutyl
ammonium bromide (DORIE-HB) (see, for example, Feigner et al., J. Biol.
Chem. 1994, 269:2550), 1 ,2-dioleyloxypropyl-3-dimethyl-hydroxypentyl
ammonium bromide (DORIE-HPe) (see, for example, Feigner et al., J. Biol.
Chem. 1994, 269:2550), 1 ,2-dimyristyloxypropyl-3-dimethyl-hydroxyethyl
ammonium bromide (DMRIE) (see, for example, Feigner et al., J. Biol. Chem.
1994, 269:2550), 1 ,2-dipalmitoyloxypropyl-3-dimethyl-hydroxyethyl ammonium bromide (DPRIE) (see, for example, Feigner et al., J. Biol. Chem. 1994,
269:2550), 1 ,2-distearoyloxypropyl-3-dimethyl-hydroxyethyl ammonium
bromide (DSRIE) (see, for example, Feigner et al., J. Biol. Chem. 1994,
269:2550), N,N-dimethyl-N-[2-(2-methyl-4-(1 ,1 ,3,3-tetramethylbutyl)-phenoxy]-
ethoxy)ethyl]-benzenemethanaminium chloride (DEBDA), N-[1-(2,3-
dioleyloxy)propyl]-N,N,N,-trimethylammonium methylsulfate (DOTAB), lipopoly-
L(or D)-lysine (see, for example, Zhou, et al., Biochim. Biophys. Acta 1991 ,
1065:8), poly(L (or D)-lysine conjugated to N-glutarylphosphatidylethanolamine
lysine (see, for example, Zhou, et al., Biochim. Biophys. Acta 1991 , 1065:8),
didodecyl glutamate ester with pendant amino group (C12GluPhCnN+) (see, for
example, Behr, Bioconjugate Chem. 1994, 5:382), ditetradecyl glutamate ester
with pendant amino group (C14GluCnN+) (see, foe example, Behr, Bioconjugate
Chem. 1994, 5:382), 9-(N',N"-dioctadecylglycinamido)acridine (see, for
example, Remy et al., Bioconjugate Chem. 1994, 5:647), ethyl 4-[[N-[3-
bis(octadecylcarbamoyl)-2-oxapropylcarbonyl]glycinamido]pyrrole-2-carbox- amido]-4-pyrrole-2-carboxylate (see, for example, Remy et al., Bioconjugate
Chem. 1994, 5:647), N',N'-dioctadecylornithylglycinamide
hydroptrifluoroacetate (see, for example, Remy et al., Bioconjugate Chem.
1994, 5:647), cationic derivatives of cholesterol (e.g., cholesteryl-3β-oxysuccin-
amidoethylenetrimethylammonium salt, cholesteryl-3β-oxysuccinamido-
ethylenedimethylamine, cholesteryl-3β-carboxyamidoethylenetrimethyl-
ammonium salt, cholesteryl-3β-carboxyamidoethylenedimethylamine, 3β[N-
(N'.N'-dimethylaminoetane-carbomoyl] cholesterol) (see, for example, Singhal
and Huang, In Gene Therapeutics, Wolff, Ed., p. 118 et seq., Birkhauser,
Boston, 1993), pH-sensitive cationic lipids (e.g., 4-(2,3-bis-palmitoyloxy-propyl)-
1 -methyl-1 H-imidazole, 4-(2,3-bis-oleoyloxy-propyl)-1 -methyl-1 H-imidazole,
cholesterol-(3-imidazol-1-yl propyl) carbamate, 2,3-bis-palmitoyl-propyl-pyridin-
4-yl-amine) and the like (see, for example, Budker, et al. Nature Biotechnology
1996, 14:760).
Especially useful in the context of gene delivery and other applications are
the compositions with the mixtures of cationic surfactant and nonionic
surfactants including but not limited to dioloeoyl phosphatidylethanolamine
(DOPE), dioleoyl phosphatidylcholine (DOPC) (see, for example, Feigner, et
al., Proc. Natl. Acad. Sci. USA 1987; Singhal and Huang, In Gene
Therapeutics, Wolff, Ed., p. 118 et seq., Birkhauser, Boston, 1993). This
includes, in particular, commercially available cationic lipid compositions
including but not limited to LipofectAMINE™, Lipofectine , DMRIE-C, CellFICTIN™, LipofectACE™, Transfectam reagents (see, for example,
Ciccarone et al., Focus 1993, 15:80; Lukow et al., J. Virol. 1993, 67:4566;
Behr, Bioconjugate Chem. 1994, 5:382; Singhal and Huang, In Gene
Therapeutics, Wolff, Ed., p. 118 et seq., Birkhauser, Boston, 1993; GIBCO-
BRL Co.; Promega Co., Sigma Co) and other cationic lipid compositions used
for transfection of cells (see, for example, Feigner et al., J. Biol. Chem. 1994,
269:2550; Budker, et al. Nature Biotechnology 1996, 14:760).
The anionic surfactants that can be used in the present biological agent
compositions include but are not limited to alkyl sulfates, alkyl sulfonates, fatty
acid soap including salts of saturated and unsaturated fatty acids and
derivatives (e.g., arachidonic acid, 5,6-dehydroarachidonic acid, 20-
hydroxyarachidonic acid, 20-trifluoro arachidonic acid, docosahexaenoic acid,
docosapentaenoic acid, docosatrienoic acid, eicosadienoic acid, 7,7-dimethyl-
5,8-eicosadienoic acid, 7,7-dimethyl-5,8-eicosadienoic acid, 8,11-eicosadiynoic
acid, eicosapentaenoic acid, eicosatetraynoic acid, eicosatrienoic acid,
eicosatriynoic acid, eladic acid, isolinoleic acid, linoelaidic acid, linoleic acid,
linolenic acid, dihomo-γ-linolenic acid, γ-linolenic acid, 17-octadecynoic acid,
oleic acid, phytanic acid, stearidonic acid, 2-octenoic acid, octanoic acid,
nonanoic acid, decanoic acid, undecanoic acid, undecelenic acid, lauric acid,
myristoleic acid, myristic acid, palmitic acid, palmitoleic acid, heptadecanoic
acid, stearic acid, nonanedecanoic acid, heneicosanoic acid, docasanoic acid,
tricosanoic acid, tetracosanoic acid, c/s-15-tetracosenoic acid, hexacosanoic
acid, heptacosanoic acid, octacosanoic acid, triocantanoic acid), salts of hydroxy-, hydroperoxy-, polyhydroxy-, epoxy- fatty acids (see, for example,
Ingram and Brash, Lipids 1988, 23:340; Honn et al., Prostaglandins 1992,
44:413; Yamamoto, Free Radic. Biol. Med. 1991 , 10:149; Fitzpatrick and
Murphy, Pharmacol. Rev. 1989, 40:229; Muller et al., Prostaglandins 1989,
38:635; Falgueyret et al., FEBS Lett. 1990, 262:197; Cayman Chemical Co.,
1994 Catalog, pp. 78-108), salts of carboxylic acids (e.g., valeric acid, trans-
2,4-pentadienoic acid, hexanoic acid, frat.s-2-hexenoic acid, rat.s-3-hexenoic
acid, 2,6-heptadienoic acid, 6-heptenoic acid, heptanoic acid, pimelic acid,
suberic acid, sebacicic acid, azelaic acid, undecanedioic acid,
decanedicarboxylic acid, undecanedicarboxyiic acid, dodecanedicarboxylic
acid, hexadecanedioic acid, docasenedioic acid, tetracosanedioic acid, agaricic
acid, aleuritic acid, azafrin, bendazac, benfurodil hemisuccinate,
benzylpenicillinic acid, p-(benzylsulfonamido)benzoic acid, biliverdine,
bongkrekic acid, bumadizon, caffeic acid, calcium 2-ethylbutanoate, capobenic
acid, carprofen, cefodizime, cefmenoxime, cefixime, cefazedone, cefatrizine,
cefamandole, cefoperazone, ceforanide, cefotaxime, cefotetan, cefonicid,
cefotiam, cefoxitin, cephamycins, cetiridine, cetraric acid, cetraxate,
chaulmoorgic acid, chlorambucil, indomethacin, protoporphyrin IX, protizinic
acid), prostanoic acid and its derivatives (e.g., prostaglandins) (see, for
example, Nelson et al., C&EN 1982, 30-44; Frolich, Prostaglandins, 1984,
27:349; Cayman Chemical Co., 1994 Catalog, pp. 26-61), leukotrienes and
lipoxines (see for example, Samuelsson et al., Science 1987, 237:1171 ;
Cayman Chemical Co., 1994 Catalog, pp. 64-75), alkyl phosphates, O- phosphates (e.g., benfotiamine), alkyl phosphonates, natural and synthetic
lipids (e.g., dimethylallyl pyrophosphate ammonium salt, S-famesylthioacetic
acid, farnesyl pyrophosphate, 2-hydroxymyristic acid, 2-fluorpalmitic acid,
inositoltrphosphates, geranyl pyrophosphate, geranygeranyl pyrophosphate, α-
hydroxyfarnesyl phosphonic acid, isopentyl pyrophoshate, phosphatidylserines,
cardiolipines, phosphatidic acid and derivatives, lysophosphatidic acids,
sphingolipids and like), synthetic analogs of lipids such as sodium-dialkyl
sulfosuccinate (e.g., Aerosol OT ), n-alkyl ethoxylated sulfates, n-alkyl
monothiocarbonates, alkyl- and arylsulfates (asaprol, azosulfamide, p-
(benzylsulfona ideo)benzoic acid, cefonicid, CHAPS), mono- and dialkyl
dithiophosphates, N-alkanoyl-N-methylglucamine, perfluoroalcanoate, cholate
and desoxycholate salts of bile acids, 4-chloroindoleacetic acid, cucurbic acid,
jasmonic acid, 7-epi jasmonic acid, 12-oxo phytodienoic acid, traumatic acid,
tuberonic acid, abscisic acid, acitertin, and the like.
Preferred cationic and anionic surfactants also include fluorocarbon and
mixed fluorocarbon-hydrocarbon surfactants. See, for example, Mukerjee, P.
Coll. Surfaces A: Physicochem. Engin. Asp. 1994, 84: 1 ; Guo et al. J. Phys.
Chem., 1991 , 95: 1829; Guo et al. J. Phys. Chem., 1992, 96: 10068. The list
of such surfactants that are useful in current inventions includes but is not
limited to the salts of perfluorocarboxylic acids (e.g., pentafluoropropionic acid,
heptafluorobutyric acid, nonanfluoropentanoic acid, tridecafluoroheptanoic
acid, pentadecafluorooctanoic acid, heptadecafluorononanoic acid,
nonadecafluorodecanoic acid, perfluorododecanoic acid, perfluorotetradecanoic acid, hexafluoroglutaric acid, perfluoroadipic acid,
perfluorosuberic acid, perfluorosebacicic acid), double tail hybrid surfactants
(CmF2m+ι)(CnH 2n+1)CH-OSO3Na (see, for example, Guo et al. J. Phys.
Chem.1992, 96: 6738, Guo et al. J. Phys. Chem 992, 96: 10068; Guo et al. J.
Phys. Chem .1992, 96: 10068), fluoroaliphatic phosphonates, fluoroaliphatic
sulphates, and the like)
The biological agent compositions of this invention may additionally contain
nonionic or zwitterionic surfactants including but not limited to phospholipids
(e.g. phosphatidylethanolamines, phosphatidylglycerols, phosphatidylinositols,
diacyl phosphatidyl-cholines, di-O-alkyl phosphatidylcholines, platelet-
activating factors, PAF agonists and PAF antagonists,
lysophosphatidylcholines, lysophosphatidylethanolamines, lysophosphatidylglycerols, lysophosphatidylinositols, lyso-platelet-activating
factors and analogs, and the like), saturated and unsaturated fatty acid
derivatives (e.g., ethyl esters, propyl esters, cholesteryl esters, coenzyme A
esters, nitrophenyl esters, naphtyl esters, monoglycerids, diglycerids, and
triglycerids, fatty alcohols, fatty alcohol acetates, and the like),
lipopolysaccharides, glyco- and shpingolipids (e.g. ceramides, cerebrosides,
galactosyldiglycerids, gangliosides, lactocerebrosides, lysosulfatides,
psychosines, shpingomyelins, sphingosines, sulfatides), chromophoric lipids
(neutral lipids, phospholipids, cerebrosides, sphingomyelins), cholesterol and
cholesterol derivatives, n-alkylphenyl polyoxyethylene ether, n-alkyl polyoxy¬
ethylene ethers (e.g., Triton™), sorbitan esters (e.g. Span™), polyglycol ether surfactants (Tergitol™), polyoxyethylenesorbitan (e.g., Tween™), polysorbates,
polyoxyethylated glycol monoethers (e.g., Brij™, polyoxylethylene 9 lauryl
ether, polyoxylethylene 10 ether, polyoxylethylene 10 tridecyl ether), lubrol,
copolymers of ethylene oxide and propylene oxide (e.g., Pluronic™, Pluronic R
™, Teronic™, Pluradot™), alkyl aryl polyether alcohol (Tyloxapol™),
perfluoroalkyl polyoxylated amides, N,N-bis[3-D-gluconamidopropyl]cholamide,
decanoyl-N-methylglucamide, n-decyl α-D-glucopyranozide, n-decyl β-D-gluco¬
pyranozide, n-decyl β-D-maltopyranozide, n-dodecyl β-D-glucopyranozide, n-
undecyl β-D-glucopyranozide, n-heptyl β-D-glucopyranozide, n-heptyl β-D-
thioglucopyranozide, n-hexyl β-D-glucopyranozide, n-nonanoyl β-D-
glucopyranozide 1-monooleyl-rac-glycerol, nonanoyl-N-methylglucamide, n-
dodecyl α-D-maltoside, n-dodecyl β-D-maltoside, N,N-bis[3-gluconamidepropyl-
]deoxycholamide, diethylene glycol monopentyl ether, digitonin, heptanoyl-N-
methylglucamide, heptanoyl-N-methylglucamide, octanoyl-N-methylglucamide,
n-octyl β-D-glucopyranozide, n-octyl α-D-glucopyranozide, n-octyl β-D-
thiogalactopyranozide, n-octyl β-D-thioglucopyranozide, betaine
(R1R2R3N+R'C02 ", where R1R2R3R' hydrocarbon chains), sulfobetaine
(R1R2R3N+R'S03 "), phoshoplipids (e.g. dialkyl phosphatidylcholine), 3-[(3-
cholamidopropyl)-dimethylammonio]-2-hydroxy-1-propanesulfonate, 3-[(3-chol-
amidopropyl)-dimethylammonio]-1-propanesulfonate, N-decyl-N,N-dimethyl-3-
ammonio-1-propanesulfonate, N-dodecyl-N,N-dimethyl-3-ammonio-1-propane-
sulfonate, N-hexadecyl-N,N-dimethyl-3-ammonio-1-propanesulfonate, N-
octadecyl-N,N-dimethyl-3-ammonio-1-propanesulfonate, N-octyl-N,N-dimethyl- 3-ammonio-1-propanesulfonate, N-tetradecyl-N,N-dimethyl-3-ammonio-1-
propanesulfonate, and dialkyl phosphatitidyl-ethanolamine.
Polymer Blends The polymer networks and the compositions thereof can
be blended with various natural and synthetic polymers to improve stability,
bioavailability, shelf-life and other properties that are relevant to the effects on
the living organism and cell. Such natural and synthetic polymers can be
cationic, anionic or nonionic include but are not limited to homopolymers,
copolymers, block copolymers, graft copolymers or dendrimers of ethylene
oxide, propylene oxide, butylene oxide, carbohydrates, acrylamide, acrylic
esters, methacrylamide, N-(2-hydroxypropyl)methacrylamide, vinyl alcohol,
vinyl pyrrolidone, vinyltriazole, vinylpyridine and its N-oxide, ortho esters, amino
acids, nucleic acids, acrylic acid, methacrylic acid, heparin, phosphate, malic
acid, lactic acid, carboxylated dextran, alkylene imine, ethyleneimine,
amidoamines, vinylpyridinium salts, ionenes methacrylates, dimethylaminoethyl
methacrylate, trimethylamonioethyl methacrylate and the like.
The polymer networks and compositions thereof can be administered orally,
topically, rectally, vaginally, by pulmonary route by use of an aerosol, or
parenterally, i.e. intramuscularly, subcutaneously, intraperitoneallly or
intravenously. The polymer networks and compositions thereof can be
administered alone, or it can be combined with a pharmaceutically-acceptable
carrier or excipient according to standard pharmaceutical practice. For the oral
mode of administration, the polymer networks and compositions thereof can be used in the form of tablets, capsules, lozenges, troches, powders, syrups,
elixirs, aqueous solutions and suspensions, and the like. In the case of tablets,
carriers that can be used include lactose, sodium citrate and salts of
phosphoric acid. Various disintegrants such as starch, and lubricating agents
such as magnesium stearate, sodium lauryl sulfate and talc, are commonly
used in tablets. For oral administration in capsule form, useful diluents are
lactose and high molecular weight polyethylene glycols. When aqueous
suspensions are required for oral use, the polymer networks and compositions
thereof can be combined with emulsifying and suspending agents. If desired,
certain sweetening and/or flavoring agents can be added. For parenteral
administration, sterile solutions of the polymer networks and compositions
thereof are usually prepared, and the pH of the solutions are suitably adjusted
and buffered. For intravenous use, the total concentration of solutes should be
controlled to render the preparation isotonic. For ocular administration,
ointments or droppable liquids may be delivered by ocular delivery systems
known to the art such as applicators or eye droppers. Such compositions can
include mucomimetics such as hyaluronic acid, chondroitin sulfate,
hydroxypropyl methylcellulose or poly(vinyl alcohol), preservatives such as
sorbic acid, EDTA or benzylchronium chloride, and the usual quantities of
diluents and/or carriers. For pulmonary administration, diluents and/or carriers
will be selected to be appropriate to allow the formation of an aerosol. The following examples will serve to further typify the nature of the invention
but should not be construed as a limitation on the scope thereof, which is
defined solely by the appended claims.
EXAMPLE 1 Synthesis of nanogel networks from polyethyleneimine and polyfethylene
glycol)
A. Bis-carbonyldiimidazole-activated poly(ethylene glycol) was
synthesized by treating poly(ethylene glycol), M.W. 4,600, (Aldrich) with 10-fold
excess of 1 ,1 '-carbonyldiimidazole. A solution of 1.8 g (10 mmol) of 1 ,1'-
carbonyldimidazole in 10 ml of anhydrous acetonitrile is added in small portions
to 8.0 g (1 mmol) of poly(ethylene glycol) in 20 ml of anhydrous acetonitrile with
constant stirring. Reaction was carried out in for 17 hrs at 40°C. Then the
reaction mixture was diluted by water and dialyzed against water for 24 hrs.
Products were obtained after lyophilization as white solids with near
quantitative yields.
B. "Emulsion-evaporation" technique was used for the synthesis of
Nanogel I. 2.4 g of bis-activated poly(ethylene glycol), MW 4,800 was
dissolved in 10 ml of of dichloromethane and suspended into 200 ml of water.
To the intensively stirred suspension 80 ml of 2% solution of
polyethyleneimine, MW 25,000, (Aldrigh) in water was added dropwise. The
resulting milky suspension was then sonicated for 30 min at 25°C in ultrasonic
cleaner water bath at 80 W. Dichloromethane was removed by rotor
evaporation in vacuo at 40°C, and the suspension became transparent during this procedure. Solution was left for 17 hrs at 4°C for cross-linking reaction to
complete and large debris were separated by centrifugation for 5 min at
12,000g. Resulting suspension of Nanogel I particles was separated by gel-
permeation chromatography.
EXAMPLE 2
Synthesis of nanogel networks from polyethyleneimine and polv(ethylene glycol)
Following the procedure of Example 1 but substituting 2.4 g of bis-
activated poly(ethylene glycol), MW 4,800 for 4.1 g of bis-activated
poly(ethylene glycol), MW 8,000 there is obtained Nanogel II.
EXAMPLE 3 Synthesis of nanogel networks from polyethyleneimine, Pluronic F38 and
poly(ethylene glycol)
A. 24g (3 mmol) of Pluronic F38 (BASF Co.) were dried by co-evaporation
with anhydrous pyridine in vacuo and dissolved in 50 ml of anhydrous
acetonitrile. Then 0.51g (1.5 mmol) of 4,4'-dimethoxytrityl chloride in 30 ml of
anhydrous pyridine was added to this solution dropwise under continuous
stirring during 30 min. The mixture was allowed to stand for additional 2 h at
room temperature, then the solvents were evaporated in vacuo. The residue
was dissolved in 50 ml of dichloromethane, extracted with 5% sodium
bicarbonate (2x30 ml), and applied on the Silicagel column (3x45 cm, 40-60
μm). Stepwise elution with dichloromethane-methanol solutions separated a
slightly yellow mono-4,4'-dimethoxytrityl-derivative of Pluronic F38 with an yield about 75-85%. The side product of the reaction (10-15 % yield) was the bis-
4,4'-dimethoxytrityl-derivative of Pluronic F38.
B. 1.5 g of mono-4,4'-dimethoxytrityl-derivative of Pluronic F38 obtained in
A was activated by 0.25g of 1 ,1 '-carbonyldiimidazole in 10 ml of anhydrous
acetonitrile for 3 hrs at room temperature. The solvent was evaporated in
vacuo, the residue redissolved in water and dialyzed through Membra-Cel MD-
25-03.5 membrane with cutoff 3500 Da against water. Desalted solution was
concentrated in vacuo and then reacted with polyethyleneimine, Mw. 2,000,
(Aldrich) in methanol-water solution for 24 h at room temperature at a molar
ratio of Pluronic F38 to free amino groups of polyethyleneimine 0.3:1.0. The
conjugate obtained was purified by gel-permeation column chromatography on
Sephadex-50 (fine) (Pharmacia) in water and then by reverse phase
chromatography on semi-preparative column (Vydac C18 5 μm, 10 mm x 25
cm) in acetonitrile concentration gradient. This yields a grafted
polyethyleneimine block copolymer at 40% yield in which 9% of free amino
groups are substituted with Pluronic F38 as determined by fluorescamine
method as described by Weigele et al. (J. Amer. Chem. Soc, 1972, 94:5927).
C. 50 ml of 6% solution of bis-activated poly(ethylene glycol), MW 4,800,
obtained as described in Part A of Example 1 was added to 3% solution of
Pluronic F38-polyethyleneimine (MW 2 kDa) conjugate in 100 ml of 0.2 M
sodium bicarbonate, pH 9. After 30 min incubation at the room temperature
under constant stirring the mixture was charged to semi-permeable membrane
bag, cutoff 3,500 and dialyzed against water for 17 hrs at 25°C. Nanogel III suspension was concentrated in vacuo and was fractionated by gel-permeation
chromatography.
EXAMPLE 4 Synthesis of nanogel networks from polyethyleneimine. Pluronic F123 and
polv(ethylene glycol)
Nanogel IV is obtained by following the procedure of Example 3 but
substituting 2.4g of bis-activated poly(ethylene glycol), MW 4,800 for 1.7g of
bis-activated poly(ethylene glycol), MW 1 ,700 and 1.5g of mono-4,4'-
dimethoxytrityl-derivative of Pluronic F38 for the same amount of mono-4,4'-
dimethoxytrityl-derivative of Pluronic F123.
EXAMPLE 5 Fractionation of nanogel particles and size determination
Suspensions of the nanogel particles obtained in Examples 1-4 were each
concentrated in vacuo and redissolved in 0.1 M ammonium acetate, pH 7, to
prepare solutions containing ca. 0.25g of crude product/ml. 10 ml of each
nanogel solution was applied on the column (2.5 x 85 cm) with Sepharose CL-
2B and eluted by 0.1 M ammonium acetate, pH 7, at flow rate 1 ml/min. A
refractive index detector was used to visualize the eluted products. High-
molecular weight products were collected and concentrated in vacuo then
redissolved in water and lyophilized. The dimensions of the nanogel particles
were determined after resuspension using "ZetaPlus" Zeta Potential Analyzer
(Brookhaven Instrument Co.) with 15 mV solid state laser operated at a laser wavelength of 635 nm and equipped with the Multi Angle Option. The results
of the particle purification using gel-filtration were compared with those of
ultracentrifugation and dialysis. Ultracentrifugation as a method of separation
of nanogels from reaction solution was used only for Nanogel 1. Recovery of
high-molecular weight material by this method was quite a low (about 7-12%),
presumably because of low density and hydrophility of synthesized gels.
Typically, only large particles (ca. 310 nm) could be separated from suspension
during centrifugation at 45,000 g for 1 hr. Dialysis in semi-permeable
membrane bags with cutoff up to 50 kDa did not permit the complete removal
of lower-molecular weight components of reaction mixture. Only preparative
gel-permeation chromatography was able to produce pure and easily analyzed
polymeric fractions.
In the Nanogel II preparation, the first peak (6 ml/tube, fractions 9-14)
contained 0.1 g; the second peak (fractions 15-24) contained 1.05 g; and the
third peak (fractions 25-30) contained 1.09 g of polymeric products. Chemical
analysis of peaks 2 and 3 resulted in the following nitrogen content: 9.52%
(peak 2) and 9.1% (peak 3). Molecular ratio of poly(ethylene glycol) to
polyethyleneimine determined from the nitrogen content data for the peak 2
equaled 7.5. Particle sizes were 224 nm (peak 1), 119 nm (peak 2) and 26 nm
(peak 3). Total content of chargeable nitrogen measured by potentiometric
titration was equal to 3.3 μmol/mg for the peak (peak 2).
In the Nanogel III preparation, peak 1 (5 ml/tube, fractions 22-27)
contained 1.5 g, and peak 2 (fraction 28-33) contained 0.8 g of polymeric products. Chemical analysis of peak 1 resulted in % nitrogen 13.02, which
corresponds to poly(ethylene glycol)/Pluronic F38 to polyethyleneimine ratio of
1.5. Particle size was 254 nm (peak 1) and 236 nm (peak 2). Total content of
chargeable nitrogen in peak 1 measured by potentiometric titration was equal
4.9 μmol/mg.
In the Nanogel IV preparation, one main peak was obtained containing
particles with the average effective diameter of 33 nm.
Transition electron microphotographs obtained for nanogel samples using
uranyl acetate staining showed mainly spherical particles with highly developed
surface and size distribution in the range from 0.08 (Nanogel III and IV) to
0.22-0.29 (Nanogel I and II).
EXAMPLE 6 Preparation of NanoGel compositions with sodium dodecylsulfate
A suspension of Nanogel 1 was prepared in phosphate buffer pH 7.4 by
sonication of 1 mg/ml Nanogel 1 sample for 30 min at 25°C. 50 mM solution of
sodium dodecylsulfate was added dropwise to the suspension of Nanogel 1.
The particle size at various charge ratios:
Z./+ = [surfactant]/[chargeable nitrogen]
was measured using "ZetaPlus" Zeta Potential Analyzer (Brookhaven
Instrument Co.) with 15 mV solid state laser operated at a laser wavelength of
635 nm. Before each measurement the Nanogel 1 suspension was incubated
for 10 min. at 25°C. The results at different Z/+ are as follows:
Figure imgf000075_0001
aAfter 48 hour incubation.
At the charge neutralization point (Z/+= 1) a clear suspension was obtained
with no sign of aggregation and with effective diameter ca. 125 nm, which is
2.5 times less than initial non-loaded Nanogel 1 particles. The particle size at Z
/+ = 1 did not change after 48 h incubation.
EXAMPLE 7 Preparation and characterization of nanogel compositions with oligonucleotide
10 mg/ml suspension of Nanogel II (peak 2) described in Example 5 was
obtained by resuspension of lyophilized Nanogel II sample in phosphate
buffered saline (PBS), sonication for 30 min at 25°C and filtration through 0.45
urn disposable filter. Oligonucleotide solutions were prepared at 8-10 mg/ml
concentration in PBS and filtered through 0.22 urn disposable filter. The
calculated volume of the polynucleotide solution was added dropwise into the
stirred suspension of Nanogel II (peak 2) to obtain 10 uM stock solution and
final mixture was incubated for 1 hr at 37°C. The particle size at various charge
ratios Z/+ = [phosphate]/[chargeable nitrogen] was measured using "ZetaPlus"
Zeta Potential Analyzer (Brookhaven Instrument Co.). The results are as
follows:
Figure imgf000075_0002
Figure imgf000076_0001
The nanogel particles are formed with effective diameter ca. 80 to 160 nm.
Minimal size is observed at Z./+ = 0.4. The nanogel loading capacity with
respect to oligonucleotide was ca. 80 to 160 nmol/mg (ca. 0.8 to mg/mg).
EXAMPLE 8 Preparation and characterization of nanogel compositions with DNA
Salmon sperm DNA solution (1 mg/ml) was prepared in PBS and filtered
through 0.22 um disposable filter. The calculated volume of this solution was
added dropwise at constant stirring to the suspension of Nanogel II (peak 2)
prepared as described in Example 7. Incubation for 4 hrs at 37°C or 17 hrs at
4°C was necessary to reach the maximum loading of 0.5-0.7 mg of DNA per
mg of Nanogel II. The final suspensions were filtered through 0.45 um
disposable filter. The particles were formed with effective diameter 240-270nm
as determined using "ZetaPlus" Zeta Potential Analyzer (Brookhaven
Instrument Co.).
EXAMPLE 9 Preparation and characterization of nanogel compositions with insulin
Insulin solution (1 mg/ml) was prepared in 50 mM sodium bicarbonate, pH
8.5, and filtered through 0.22 um disposable filter. The calculated volume of
this solution was added dropwise to the Nanogel I suspension prepared as
described in Example 7. The mixture was incubated for 1-17 hrs at 4°C and the particle size was measured using "ZetaPlus" Zeta Potential Analyzer
(Brookhaven Instrument Co.). The nanogel loading capacity with respect to
insulin was ca. 0.25 to 0.3 mg/mg. Loaded Nanogels I were condensed up to
effective diameter 112 nm at the maximum insulin loading. Further
condensation of loaded nanogel particles was observed when the pH was
decreased from pH 7 to pH 2; at pH 2 the particle effective diameter was ca. 95
nm.
EXAMPLE 10 Blending of nanogel with polvacrylic acid
One percent aqueous solution of the polyacrylic acid sodium salt, MW
30,000, (Aldrich) was prepared and filtered through 0.22 μm disposable filter.
This solution was added dropwise to the Nanogel I suspension prepared as
described in the Example 7. This resulted in the the condensation of loaded
nanogel particles with the effective diameter of the particles reaching 1 10-120
nm as determined using "ZetaPlus" Zeta Potential Analyzer (Brookhaven
Instrument Co.).
The oligonucleotide and insulin loaded nanogel particles prepared as
described in examples 7 and 9 respectively were used in these experiments.
EXAMPLE 1 1
Cvtotoxicitv of nanogels particles
Cytotoxicity of free and oligonucleotide-loaded nanogel particles was
determined using confluent KBv monolayers were grown in DMEM supplemented with 10% fetal bovine serum and 1g/ml vinblastine. Cells were
treated by Nanogel II (peak II) and Nanogel II (peak II) loaded with
phosphorothioate oligonucleotide 20-mer at Z = 2 every 12-hours for 48 hours.
After the treatment the cells were cultivated another 48 hours at 37°C and 5%
C02. After that, the drug cytotoxic activity was determined using the MTT (3-
(4,5-dimethylthiazol-2-yl)2,5-diphenyl tetrazolium bromide) assay (Ferrari, et
al., J. Immunol. Methods 131 , 165, 1990). In a control experiment it was
shown that oligonucleotide alone does not produce cytotoxic effect at the
concentrations used in nanogel formulations. The results were as follows:
Figure imgf000078_0001
The cytotoxicity of the nanogel thus decreases after loading with
oligonucleotide.
EXAMPLE 12 Cytotoxicity of nanogels particles
Cytotoxicity of the Nanogel I and Nanogel II particles was compared using
confluent KBv monolayers were grown in DMEM supplemented with 10% fetal
bovine serum and 1 ug/ml vinblastine. Cells were treated by Nanogel I and
Nanogel II every 12-hours for 48 hours. After the treatment the cells were
cultivated another 48 hours at 37°C and 5% C02. Next, the drug cytotoxic activity was determined using the MTT (3-(4,5-dimethylthiazol-2-yl)2,5-diphenyl tetrazolium bromide) assay (Ferrari, et al., J. Immunol. Methods 131 , 165,
1990). The results were as follows:
Figure imgf000079_0001
Nanogel I, having larger particle size (310 nm), is thus also more toxic
compared to Nanogel II having smaller particle size (120 nm).
EXAMPLE 13 Transport of nanogel loaded with oligonucleotide in Caco-2 cells
The effects of nanogels on the transport of oligonucleotides in cells were
characterized using the monolayers of human intestinal epithelum Caco-2,
which are commonly used as an in vitro model of the intestinal barrier for oral
delivery (Nerurkar et al., Pharm. Res., 1996, 13: 528). A 1 % suspension of the
Nanogel II (peak 2) was loaded with the fluorecein-labeled oligonucleotide
phosphorothioate 20-mer at Z = 2 in PBS solution. KBV cell monolayers were
grown on polycarbonate membrane filters and then placed in "Side-by-Side"
diffusion chambers. Samples containing 0.02% loaded Nanogel II suspension
were placed into the donor chamber and the transport across cell monolayers
was measured at 37°C by sampling the solution in the reciever chamber at various time intervals. The oligonucleotide concentration in the reciever
chamber was determined determined by measuring fluorescence of the cell
lysates with a Shimadzu RF5000 fluorescent spectrophotometer (488 nm
excitation; 510 nm emission). The oligonucleotide transport in the Nanogel II
formulation was increased ca. 20 times compared to the transport of the free
oligonucleotide. Maximum transport increase was observed during the first 60
min (11.5% compared to 0.5% for free oligonucleotide). Quantitation of the
oligonucleotide using HPLC-analysis with UV-detection has given the similar
results. Integration of HPLC peaks corresponding to the main oligonucleotide
its degradation products in the receiver chamber after 6 hour incubation
allowed to determine degradation of the oligonucleotide in the Nanogel II
formulation. The results were as follows:
Figure imgf000080_0001
Incorporation of oligonucleotides into the nanogel formulation results in
increased protection against nuclease degradation in Caco-2 cells.
EXAMPLE 14 Effect of oligonucleotides in nanogels on cells
The multidrug resistant KBv cell line (vinblastine resistant human
epidermoid carcinoma) which expresses high levels of glycoprotein P (P-gp) efflux pump (Gervasoni, et al. Cancer Research, 1991 , 51 , 4955) can be used
to evaluate the effects of the antisense oligonucleotides in nanogel
formulations on rhodamine 123. Rhodamine 123 is a specific probe for the
effects on the P-gp efflux system, which is commonly used for evaluation of the
P-gp efflux function in cancer and normal cells (Jancis, et al., Mol. Pharmacol.
1993, 43, 51 ; Lee, et al., Mol. Pharmacol., 1994, 46, 627). Phosphorothioate
antisense oligonucleotide 20-mer, TCCTCCATTGCGGTCCCCTT,
complementary to sites 435-454 of the human mdrl-mRNA were used in the
experiments on KBv cell cultures. Cells were treated with 0.2-2 uM free
oligonucleotide or oligonucleotide in the Nanogel II (peak 2) (Z./+ = 0.5, Z./+ =
0.7) suspensions every 12-hours for 48 hours, and then allowed to grow for
another 24 hours at 37°C and 5% C02. The cells were then washed by the
fresh medium and rhodamine 123 uptake in the cells was studied using the
following protocol. The uptake of rhodamine 123 in KBv cell monolayers in
presence and absence of the block copolymers is examined at 37°C over a
period of 60 minutes. The culture media was removed from the KBv monolay¬
ers and replaced with an assay buffer having the following composition: NaCI
(122 mM), NaHC03 (25 mM), glucose (10 mM), KCI (3 mM), MgS04 (1.2 mM),
K2HP04 (0.4 mM), CaCI2 (1.4 mM) and HEPES (10 mM). After a thirty-minute
pre-incubation at 37°C, the assay buffer is removed from the monolayers and
3.2 μM rhodamine in the assay buffer is added to the monolayers for 90 min¬
utes. The medium was then removed and cell monolayers were washed three
times with 0.5 ml ice-cold PBS. The KBv monolayers were solubilized in 1.0% Triton X-100 (0.5 ml) and aliquots removed for determining cell-associated
rhodamine fluorescence and protein content. Rhodamine 123 fluorescence
was determined at λex = 488 nm and λem = 550 nm using a Shimadzu 5000
spectrophotometer. Protein content was determined using the Pierce BCA
method. The concentration of rhodamine in the KBv lyzate solution was
quantitatively determined by construction of standard curves. The results are
as follows:
Figure imgf000082_0001
The results with rhodamine 123 are indicative of the effects of the
oligonucleotide incorporated into nanogel on the P-gp efflux system in
multidrug resistant cells.

Claims

What is Claimed
1. A polymer network comprising a plurality of cross-linked polymer fragments wherein the polymer fragments comprise:
(a) at least one polycationic fragment which is a cationic homopolymer or copolymer comprising at least three cationic amino acids or at least three
aminoalkylene monomers, the monomers being selected from the group consisting of at least one of:
(0 at least one tertiary amino monomer of the formula:
Figure imgf000083_0001
A.
and the quaternary salts of the tertiary amino monomer, and (/'/) at least one secondary amino monomer of the formula:
Figure imgf000083_0002
B.
and the acid addition and quaternary salts of the secondary amino
monomer, in which 1 R is hydrogen, alkyl of 2 to 8 carbon atoms, an A monomer, or a B
monomer;
2 3 each of R and R , taken independently of the other, is the same or different straight or branched chain alkanediyl group of the formula:
(C H2z)
in which z has a value of from 2 to 8;
R is hydrogen satisfying one bond of the depicted geminally bonded
carbon atom; and
5 R is hydrogen, alkyl of 2 to 8 carbon atoms, an A monomer, or a B
monomer;
R is hydrogen, alkyl of 2 to 8 carbon atoms, an A monomer, or a B
monomer;
R is a straight or branched chain alkanediyl group of the formula-
-(CZH
in which z has a value of from 2 to 8; and o
R is hydrogen, alkyl of 2 to 8 carbon atoms, an A monomer, or a B
monomer; and (b) at least one nonionic homopolymer or copolymer comprising at least three
of the same or different repeating units containing at least one atom selected
from the group consisting of oxygen and nitrogen
2. The polymer network according to claim 1 wherein the network size is between about 20 nm and about 600 nm.
3 The polymer network according to claim 1 wherein the network size is between about 50 nm and about 250 nm.
4. The polymer network according to claim 1 wherein the network size is between about 70 nm and about 150 nm.
5 A composition comprising the polymer network of claim 1 and a biological agent
6 The composition according to claim 5 wherein the biological agent is selected from the group consisting of polynucleotides, viral vectors, and viruses
7 The composition according to claim 5 wherein the biological agent is selected
from the group consisting of peptides and proteins
8 The composition according to claim 5 wherein the biological agent is selected
from the group consisting of immunoglobulins, immunomodulators, immunoadjuvants,
immunogens, antigens, and vaccines
9 The composition according to claim 5 wherein the biological agent is selected from the group consisting of dyes, radiolabels, radio-opaque compounds, and
fluorescent compounds
10 A pharmaceutical composition comprising the polymer network according to
claim 1 and a pharmaceutically acceptable carrier
11. A composition comprising the polymer network of claim 1 and a targeting
molecule.
12. A method of immunizing an organism comprising administering to said organism an effective amount of a polymer network according to claim 1 , and a
biological agent.
13. A method of treating an organism in need of treatment comprising administering to said organism an effective amount of the polymer network composition of claim 1
and a biological agent.
14. A method of identifying a desired cross-linked polymer network comprising:
(a) preparing a plurality of cross-linked polymer fragment networks
according to claim 1 ; and
(b) preparing a plurality of compositions of polymer networks with a
biological agent;
(c) testing at least one of said cross-linked polymer networks a biological
agent for desired biological properties; and
(d) identifying said compositions with desired biological properties.
PCT/US1999/019690 1998-09-03 1999-08-26 Nanogel networks and biological agent composition thereof WO2000013677A1 (en)

Priority Applications (4)

Application Number Priority Date Filing Date Title
EP99945266A EP1109539A1 (en) 1998-09-03 1999-08-26 Nanogel networks and biological agent composition thereof
AU57896/99A AU5789699A (en) 1998-09-03 1999-08-26 Nanogel networks and biological agent composition thereof
JP2000568486A JP2002524579A (en) 1998-09-03 1999-08-26 Nanogel network and biologic composition thereof
CA002342800A CA2342800A1 (en) 1998-09-03 1999-08-26 Nanogel networks and biological agent composition thereof

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US09/146,651 1998-09-03
US09/146,651 US6333051B1 (en) 1998-09-03 1998-09-03 Nanogel networks and biological agent compositions thereof

Publications (1)

Publication Number Publication Date
WO2000013677A1 true WO2000013677A1 (en) 2000-03-16

Family

ID=22518351

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US1999/019690 WO2000013677A1 (en) 1998-09-03 1999-08-26 Nanogel networks and biological agent composition thereof

Country Status (6)

Country Link
US (1) US6333051B1 (en)
EP (1) EP1109539A1 (en)
JP (1) JP2002524579A (en)
AU (1) AU5789699A (en)
CA (1) CA2342800A1 (en)
WO (1) WO2000013677A1 (en)

Cited By (8)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP1365716A1 (en) * 2001-02-16 2003-12-03 Expression Genetics, Inc. Biodegradable cationic copolymers of poly(alkylenimine) and poly(ethylene glycol) for the delivery of bioactive agents
EP1731133A1 (en) * 2005-06-10 2006-12-13 3M Espe AG Composition containing a prepolymer and a crosslinker, process for producing and use thereof
US8992983B2 (en) 2010-08-30 2015-03-31 Pulmatrix, Inc. Respirably dry powder comprising calcium lactate, sodium chloride and leucine
US9061352B2 (en) 2010-08-30 2015-06-23 Pulmatrix, Inc. Dry powder formulations and methods for treating pulmonary diseases
US9433576B2 (en) 2010-09-29 2016-09-06 Pulmatrix, Inc. Cationic dry powders
US9642798B2 (en) 2010-09-29 2017-05-09 Pulmatrix, Inc. Monovalent metal cation dry powders for inhalation
US9737518B2 (en) 2013-04-01 2017-08-22 Pulmatrix Operating Company, Inc. Tiotropium dry powders
US10589039B2 (en) 2012-02-29 2020-03-17 Pulmatric Operating Company, Inc. Methods for producing respirable dry powders

Families Citing this family (50)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP1109919A2 (en) 1998-08-27 2001-06-27 Massachusetts Institute Of Technology Rationally designed heparinases derived from heparinase i and ii
US7056504B1 (en) 1998-08-27 2006-06-06 Massachusetts Institute Of Technology Rationally designed heparinases derived from heparinase I and II
CA2370539C (en) * 1999-04-23 2009-01-06 Massachusetts Institute Of Technology System and method for notating polymers
CA2402160C (en) * 2000-03-08 2012-02-14 Massachusetts Institute Of Technology Heparinase iii and uses thereof
AU2001292618A1 (en) 2000-09-12 2002-03-26 Massachusetts Institute Of Technology Methods and products related to low molecular weight heparin
AU2440802A (en) 2000-10-18 2002-04-29 Massachusetts Inst Technology Methods and products related to pulmonary delivery of polysaccharides
US7060498B1 (en) 2001-11-28 2006-06-13 Genta Salus Llc Polycationic water soluble copolymer and method for transferring polyanionic macromolecules across biological barriers
JP2005522454A (en) * 2002-02-14 2005-07-28 リサーチ　ディベロップメント　ファンデーション Lung metastasis suppression by aerosol delivery of p53 gene and anticancer compound
US20030180250A1 (en) * 2002-03-22 2003-09-25 Council Of Scientific And Industrial Research Compositions and complexes containing a macromolecular compound as potential anti-inflammatory agents
EP1490083A1 (en) * 2002-03-29 2004-12-29 The Regents of the University of California Microgel particles for the delivery of bioactive materials
ATE466281T1 (en) * 2002-05-07 2010-05-15 Univ New York State Res Found ßHIGH THROUGPUTß METHOD TO LABEL BIOMOLECULE DELIVERY FORMULATIONS
DE60324225D1 (en) * 2002-06-14 2008-12-04 Rohm & Haas Colorants, dispersants and dispersions containing polymeric nanoparticles
FR2844512B1 (en) * 2002-09-17 2005-06-24 Centre Nat Rech Scient NOVEL COPOLYMER-BASED COMPOUNDS AND THEIR APPLICATIONS
WO2005044224A2 (en) * 2003-05-02 2005-05-19 Case Western Reserve University Drug delivery system based on polymer nanoshells
US7332527B2 (en) 2003-05-16 2008-02-19 Board Of Regents Of The University Of Nebraska Cross-linked ionic core micelles
CN1859926B (en) * 2003-06-30 2011-02-09 坎基股份有限公司 Polymer encapsulation of adenoviruses
US20050084513A1 (en) * 2003-10-21 2005-04-21 Board Of Regents Nanocoating for improving biocompatibility of medical implants
US7385012B2 (en) * 2003-11-03 2008-06-10 Ilypsa, Inc. Polyamine polymers
US7608674B2 (en) * 2003-11-03 2009-10-27 Ilypsa, Inc. Pharmaceutical compositions comprising cross-linked small molecule amine polymers
US7449605B2 (en) * 2003-11-03 2008-11-11 Ilypsa, Inc. Crosslinked amine polymers
US7459502B2 (en) * 2003-11-03 2008-12-02 Ilypsa, Inc. Pharmaceutical compositions comprising crosslinked polyamine polymers
US7335795B2 (en) * 2004-03-22 2008-02-26 Ilypsa, Inc. Crosslinked amine polymers
US7767768B2 (en) * 2003-11-03 2010-08-03 Ilypsa, Inc. Crosslinked amine polymers
WO2005069886A2 (en) * 2004-01-16 2005-08-04 Northwestern University Sparsely cross-linked nanogels: a novel polymer structure for microchannel dna sequencing
US20050196343A1 (en) * 2004-02-27 2005-09-08 Molecular Therapeutics, Inc. Degradable nanoparticles
US8153111B2 (en) * 2004-06-18 2012-04-10 Ceramoptec Industries, Inc. Photo-triggered release of active substances from dendrimer-photosensitizer complexes
US8057821B2 (en) * 2004-11-03 2011-11-15 Egen, Inc. Biodegradable cross-linked cationic multi-block copolymers for gene delivery and methods of making thereof
CA2608752A1 (en) * 2005-05-18 2006-11-23 Pulmatrix Inc. Formulations for alteration of biophysical properties of mucosal lining
US20070237821A1 (en) * 2006-04-10 2007-10-11 Eastman Kodak Company Nanogel-based contrast agents for optical molecular imaging
US20080095699A1 (en) * 2006-10-20 2008-04-24 Shiying Zheng Imaging contrast agents using nanoparticles
US8021689B2 (en) * 2006-02-21 2011-09-20 Ecole Polytechnique Federale de Lausanne (“EPFL”) Nanoparticles for immunotherapy
US8349349B2 (en) * 2006-02-28 2013-01-08 Covidien Lp Tissue adhesives and sealants and method for their use
US8835513B2 (en) 2006-02-28 2014-09-16 Covidien Lp Drug delivery devices
WO2007100882A2 (en) * 2006-02-28 2007-09-07 Tyco Healthcare Group Lp Tissue adhesives and sealants and methods for their use
US9644039B2 (en) 2006-03-24 2017-05-09 The Regents Of The University Of California Acid-degradable and bioerodible modified polyhydroxylated materials
US8124598B2 (en) 2006-09-14 2012-02-28 Sharon Sageman 7-keto DHEA for psychiatric use
US20080114096A1 (en) * 2006-11-09 2008-05-15 Hydromer, Inc. Lubricious biopolymeric network compositions and methods of making same
US20100160274A1 (en) * 2007-09-07 2010-06-24 Sharon Sageman 7-KETO DHEA for Psychiatric Use
US8323696B2 (en) * 2008-08-29 2012-12-04 Ecole Polytechnique Federale De Lausanne Nanoparticles for immunotherapy
US9284188B2 (en) 2010-09-03 2016-03-15 The Regents Of The University Of California Cytosolic delivery of materials with endosome-disrupting colloids
WO2012138730A1 (en) 2011-04-04 2012-10-11 Board Of Regents Of The University Of Nebraska Drug delivery compositions and methods
CA2848740A1 (en) * 2011-09-16 2013-03-21 Mingxing Wang Amphiphilic cationic polymers for the delivery of therapeutic agents
WO2013082299A1 (en) 2011-11-29 2013-06-06 Als Therapy Development Institute Targeting of t-lymphocytes to treat amyotrophic lateral sclerosis
US9161756B2 (en) 2012-03-16 2015-10-20 Covidien Lp Closure tape dispenser
US9572580B2 (en) 2012-03-16 2017-02-21 Covidien Lp Closure tape dispenser
WO2017223471A1 (en) * 2016-06-24 2017-12-28 Chandran Preethi Salt responsive nanogels and nanoparticles
KR101823490B1 (en) * 2016-09-08 2018-01-30 한국과학기술연구원 Oxamide nanogel, a preparation method of the same and use thereof
CN109350746B (en) * 2018-10-19 2021-07-23 塔里木大学 Preparation method of 1-deoxynojirimycin sustained release preparation with mulberry leaf polysaccharide as carrier
US11357542B2 (en) 2019-06-21 2022-06-14 Covidien Lp Valve assembly and retainer for surgical access assembly
CN114230788B (en) * 2021-12-16 2023-08-29 中国石油大学(华东) Multivalent polyanion oily sewage purifying agent and preparation method thereof

Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1996000295A1 (en) * 1994-06-27 1996-01-04 The Johns Hopkins University Targeted gene delivery system
US5529777A (en) * 1993-07-12 1996-06-25 Virus Research Institute Hydrogel microencapsulated vaccines
US5545423A (en) * 1991-11-25 1996-08-13 Vivorx, Inc. Cytoprotective, biocompatible, retrievable macrocapsule containment systems for biologically active materials
US5578442A (en) * 1992-03-23 1996-11-26 Vivorx, Inc. Graft copolymers of polycationic species and water-soluble polymers, and use therefor
US5589466A (en) * 1989-03-21 1996-12-31 Vical Incorporated Induction of a protective immune response in a mammal by injecting a DNA sequence

Family Cites Families (16)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4172066A (en) 1974-06-21 1979-10-23 The Dow Chemical Company Cross-linked, water-swellable polymer microgels
US4059552A (en) 1974-06-21 1977-11-22 The Dow Chemical Company Cross-linked water-swellable polymer particles
US4189539A (en) 1978-06-28 1980-02-19 The Dow Chemical Company Reaction product of an epoxide and a polyalkylenepolyamine in bead form and a method for preparing same
US4227982A (en) 1979-05-31 1980-10-14 Desoto, Inc. Electrodeposition of aqueous dispersions of copolymers of polyethylenically unsaturated epoxy-amine adducts
DE3014733A1 (en) 1980-04-17 1981-10-29 Akzo Gmbh, 5600 Wuppertal WATER DISPERSIBLE CATIONIC RESINS
US4420574A (en) 1981-07-20 1983-12-13 Ppg Industries, Inc. Ungelled polyepoxide-polyoxyalkylenepolyamine resins, aqueous dispersions thereof, and their use in cationic electrodeposition
US5280078A (en) 1981-11-27 1994-01-18 Gregor Harry P Homopolymers and copolymers of acrylamide N-substituted acrylamide or N-substituted methacrylamide solid state cross-linked with polyamines or polyols
US4560714A (en) 1982-12-16 1985-12-24 Celanese Corporation Water-swellable crosslinked polymeric microgel particles and aqueous dispersions of organic film-forming resins containing the same
NL8401362A (en) 1984-04-27 1985-11-18 Tno METHOD OF COOPERATING PARTICULAR MATERIALS WITH A POLYMER IN ORDER TO ENABLE THE REGULATED DELIVERY OF THESE MATERIALS TO THE ENVIRONMENT AND THEREFORE OBTAINED COVERED MATERIAL.
JPS6341570A (en) 1986-08-06 1988-02-22 Nippon Paint Co Ltd Electrodeposition coating composition
DE3785732T2 (en) 1986-11-28 1993-10-21 Nippon Paint Co Ltd Dispersion of cationic microgel particles and coating composition thereof.
US5300541A (en) 1988-02-04 1994-04-05 Ppg Industries, Inc. Polyamine-polyepoxide gas barrier coatings
US5096556A (en) 1990-06-25 1992-03-17 Ppg Industries, Inc. Cationic microgels and their use in electrodeposition
DE69332952T2 (en) 1992-09-04 2004-02-19 The General Hospital Corp., Boston Biocompatible polymers containing diagnostic and therapeutic units
IL128775A (en) * 1994-03-07 2001-05-20 Dow Chemical Co Composition comprising a dendritic polymer in complex with at least one unit of biological response modifier and a process for the preparation thereof
WO1996018669A1 (en) 1994-12-16 1996-06-20 Ppg Industries, Inc. Epoxy-amine barrier coatings with aryloxy or aryloate groups

Patent Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5589466A (en) * 1989-03-21 1996-12-31 Vical Incorporated Induction of a protective immune response in a mammal by injecting a DNA sequence
US5545423A (en) * 1991-11-25 1996-08-13 Vivorx, Inc. Cytoprotective, biocompatible, retrievable macrocapsule containment systems for biologically active materials
US5578442A (en) * 1992-03-23 1996-11-26 Vivorx, Inc. Graft copolymers of polycationic species and water-soluble polymers, and use therefor
US5529777A (en) * 1993-07-12 1996-06-25 Virus Research Institute Hydrogel microencapsulated vaccines
WO1996000295A1 (en) * 1994-06-27 1996-01-04 The Johns Hopkins University Targeted gene delivery system

Cited By (15)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP1365716A1 (en) * 2001-02-16 2003-12-03 Expression Genetics, Inc. Biodegradable cationic copolymers of poly(alkylenimine) and poly(ethylene glycol) for the delivery of bioactive agents
EP1365716A4 (en) * 2001-02-16 2009-05-20 Expression Genetics Inc Biodegradable cationic copolymers of poly(alkylenimine) and poly(ethylene glycol) for the delivery of bioactive agents
EP1731133A1 (en) * 2005-06-10 2006-12-13 3M Espe AG Composition containing a prepolymer and a crosslinker, process for producing and use thereof
US7700666B2 (en) 2005-06-10 2010-04-20 3M Espe Ag Composition containing a prepolymer and a crosslinker, process for producing and use thereof
US9233158B2 (en) 2010-08-30 2016-01-12 Pulmatrix, Inc. Dry powder formulations and methods for treating pulmonary diseases
US9061352B2 (en) 2010-08-30 2015-06-23 Pulmatrix, Inc. Dry powder formulations and methods for treating pulmonary diseases
US8992983B2 (en) 2010-08-30 2015-03-31 Pulmatrix, Inc. Respirably dry powder comprising calcium lactate, sodium chloride and leucine
US9433576B2 (en) 2010-09-29 2016-09-06 Pulmatrix, Inc. Cationic dry powders
US9642798B2 (en) 2010-09-29 2017-05-09 Pulmatrix, Inc. Monovalent metal cation dry powders for inhalation
US9744130B2 (en) 2010-09-29 2017-08-29 Pulmatrix Operating Company, Inc. Cationic dry powders
US10376465B2 (en) 2010-09-29 2019-08-13 Pulmatrix Operating Company, Inc. Monovalent metal cation dry powders for inhalation
US11173115B2 (en) 2010-09-29 2021-11-16 Pulmatrix Operating Company, Inc. Monovalent metal cation dry powders for inhalation
US10589039B2 (en) 2012-02-29 2020-03-17 Pulmatric Operating Company, Inc. Methods for producing respirable dry powders
US10806871B2 (en) 2012-02-29 2020-10-20 Pulmatrix Operating Company, Inc. Inhalable dry powders
US9737518B2 (en) 2013-04-01 2017-08-22 Pulmatrix Operating Company, Inc. Tiotropium dry powders

Also Published As

Publication number Publication date
US6333051B1 (en) 2001-12-25
AU5789699A (en) 2000-03-27
JP2002524579A (en) 2002-08-06
EP1109539A1 (en) 2001-06-27
CA2342800A1 (en) 2000-03-16

Similar Documents

Publication Publication Date Title
US6333051B1 (en) Nanogel networks and biological agent compositions thereof
US6696089B2 (en) Nanogel networks including polyion polymer fragments and biological agent compositions thereof
Spicer et al. Peptide and protein nanoparticle conjugates: versatile platforms for biomedical applications
US6093391A (en) Peptide copolymer compositions
Jain et al. The development, characterization and in vivo anti-ovarian cancer activity of poly (propylene imine)(PPI)-antibody conjugates containing encapsulated paclitaxel
Jain et al. Dendrimer toxicity: Let's meet the challenge
Jain et al. Comparison of avidin, neutravidin, and streptavidin as nanocarriers for efficient siRNA delivery
Yameen et al. Insight into nanoparticle cellular uptake and intracellular targeting
Messerschmidt et al. Targeted lipid-coated nanoparticles: delivery of tumor necrosis factor-functionalized particles to tumor cells
US20080267876A1 (en) Nanoparticles for Targeted Delivery of Active Agent
US20150353676A1 (en) Polymeric nanoparticles and a process of preparation thereof
Agarwal et al. Cationic ligand appended nanoconstructs: a prospective strategy for brain targeting
Dubey et al. Understanding the pharmaceutical aspects of dendrimers for the delivery of anticancer drugs
Qu et al. Targeted delivery of doxorubicin via CD147-mediated ROS/pH dual-sensitive nanomicelles for the efficient therapy of hepatocellular carcinoma
US20190192686A1 (en) Targeted nanodroplet emulsions for treating cancer
Warren et al. Amphiphilic cationic nanogels as brain-targeted carriers for activated nucleoside reverse transcriptase inhibitors
Guo et al. Hydroxycamptothecin nanorods prepared by fluorescently labeled oligoethylene glycols (OEG) codendrimer: antitumor efficacy in vitro and in vivo
Li et al. Regulation of protein corona on liposomes using albumin-binding peptide for targeted tumor therapy
Gao et al. Polypeptide nanoparticles with pH-sheddable PEGylation for improved drug delivery
Kharwade et al. Toxicity and surface modification of dendrimers: a critical review
Androvic et al. Cyclotriphosphazene-based star copolymers as structurally tunable nanocarriers with programmable biodegradability
US6316505B1 (en) Pharmaceutical compositions comprising fluorinated co-polymers
EP1005651A1 (en) Methods of identifying biological agent compositions
JP2002504123A (en) Composition for delivering biological material and method for producing the same
Fujii et al. Zwitterionic amino acid polymer-grafted core-crosslinked particle toward tumor delivery

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): AE AL AM AT AU AZ BA BB BG BR BY CA CH CN CU CZ DE DK EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MD MG MK MN MW MX NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT UA UG US UZ VN YU ZA ZW

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): GH GM KE LS MW SD SL SZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
DFPE Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101)
ENP Entry into the national phase

Ref document number: 2342800

Country of ref document: CA

Ref country code: CA

Ref document number: 2342800

Kind code of ref document: A

Format of ref document f/p: F

WWE Wipo information: entry into national phase

Ref document number: 1999945266

Country of ref document: EP

ENP Entry into the national phase

Ref country code: JP

Ref document number: 2000 568486

Kind code of ref document: A

Format of ref document f/p: F

WWP Wipo information: published in national office

Ref document number: 1999945266

Country of ref document: EP

REG Reference to national code

Ref country code: DE

Ref legal event code: 8642