WO1999065502A1 - Oligonucleotides for enhanced modulation of protein kinase c expression - Google Patents

Abstract

Compositions and methods are provided for modulating the expression of protein kinase C. Oligonucleotides are provided which are targeted to nucleic acids encoding PKC. The oligonucleotides are from 5 to 50 nucleotides in length and in one preferred embodiment are from 12 to 18 nucleotides in length. The oligonucleotides may be chimeric oligonucleotides and in a preferred embodiment comprise at least one 2'-O-methoxyethyl modification. Pharmaceutical compositions comprising the oligonucleotides of the invention are also provided. Methods of inhibiting protein kinase C expression and methods of treating conditions associated with expression of protein kinase C using oligonucleotides of the invention are disclosed.

Description

OLIGONUCLEOTIDES FOR ENHANCED MODULATION OF PROTEIN KINASE C EXPRESSION

FIELD OF THE INVENTION

This invention relates to compositions and methods for modulation of the expression of protein kinase C. In particular, this invention relates to antisense oligonucleotides specifically hybridizable with nucleic acids encoding protein kinase C. These oligonucleotides have been found to modulate the expression of protein kinase C. These compositions and methods can be used diagnostically or therapeutically.

BACKGROUND OF THE INVENTION The phosphorylation of proteins plays a key role in the transduction of extracellular signals into the cell. The enzymes, called kinases, which effect such phosphorylations are targets for the action of growth factors, hormones, and other agents involved in cellular metabolism, proliferation and differentiation. One of the major signal transduction pathways involves the enzyme protein kinase C (PKC), which is known to have a critical influence on cell proliferation and differentiation. PKC is activated by diacylglycerols (DAGs), which are metabolites released in signal transduction. Interest in PKC was stimulated by the finding that PKC is the major, and perhaps only, cellular receptor through which a class of tumor-promoting agents called phorbol esters exert their pleiotropic effects on cells (Gescher et al., Anti-Cancer Drug Design 4:93-105 (1989)). Phorbols capable of tumor production can mimic the effect of DAG in activating PKC, suggesting that these tumor promoters act through PKC and that activation of this enzyme is at least partially responsible for the resulting tumorigenesis (Parker et al., Science 233:853-866 (1986)).

Experimental evidence indicates that PKC plays a role in growth control in colon cancer. It is believed that specific bacteria in the intestinal tract convert lipids to DAG, thus activating PKC and altering cell proliferation. This may explain the correlation between high dietary fat and colon cancer (Weinstein, Cancer Res. (Suppl.) 51:5080s-5085s (1991)). It has also been demonstrated that a greater proportion of the PKC in the colonic mucosa of patients with colorectal cancer is in an activated state compared to that of patients without cancer (Sakanoue et al, Int. J. Cancer 48:803-806 (1991)).

Increased tumorigenicity is also correlated with overexpression of PKC in cultured cells inoculated into nude mice. A mutant form of PKC induces highly malignant tumor cells with increased metastatic potential. Sphingosine and related inhibitors of PKC activity have been shown to inhibit tumor cell growth and radiation-induced transformation in vivo (Endo et al., Cancer Research 51 :1613-1618 (1991); Borek et al., Proc. Natl. Acad. Sci. 88:1953-1957 (1991)). A number of experimental or clinically useful anti-cancer drugs show modulatory effects on PKC. Therefore, inhibitors of PKC may be important cancer- preventive or therapeutic agents. PKC has been suggested as a plausible target for more rational design of conventional anti-cancer drugs (Gescher, A. and Dale, I.L., Anti-Cancer Drug Design, 4:93-105 (1989)).

Experiments also indicate that PKC plays an important role in the pathophysiology of hypeφroliferative skin disorders such as psoriasis and skin cancer. Psoriasis is characterized by inflammation and hypeφroliferation of the epidermis and decreased differentiation of cells. Various studies indicate a role for PKC in causing these symptoms. PKC stimulation in cultured keratinocytes can be shown to cause hypeφroliferation. Inflammation can be induced by phorbol esters and is regulated by PKC. DAG is implicated in the involvement of PKC in dermato logical diseases, and is formed to an increased extent in psoriatic lesions.

Inhibitors of PKC have been shown to have both anti-proliferative and anti- inflammatory effects in vitro. Some anti-psoriasis drugs, such as cyclosporine A and anthralin, have been shown to inhibit PKC. Inhibition of PKC has been suggested as a therapeutic approach to the treatment of psoriasis (Hegemann, L. and G. Mahrle, Pharmacology of the Skin, H. Mukhtar, ed., p. 357-368, CRC Press, Boca Raton, FL, 1992).

The oligonucleotides of the invention are believed to be useful in the therapeutic treatment of diseases associated with PKC. Such diseases include hypeφroliferative and inflammatory conditions including psoriasis, tumors and cancers such as, for example, glioblastoma, bladder cancer, skin cancer, breast cancer, lung cancer and colon cancer.

PKC is not a single enzyme, but a family of enzymes. At the present time at least ten isoforms (isozymes) of PKC have been identified: the "conventional" isoforms α, β, and γ, the "novel" isoforms δ, ε, η, θ and μ, and the "atypical" isoforms ζ and λ (i). These isozymes have distinct patterns of tissue and organ localization (see Nishizuka, FASEB J. 9:484-496 (1995) for review) and may serve different physiological functions.

It is presently believed that different PKC isozymes may be involved in various disease processes depending on the organ or tissue in which they are expressed. For example, in psoriatic lesions there is an alteration in the ratio between PKC-α and PKC-β, with preferential loss of PKC-β compared to normal skin (Hegemann, L. and G. Mahrle, Pharmacology of the Skin, H. Mukhtar, ed., p. 357-368, CRC Press, Boca Raton, FL, 1992).

Although numerous compounds have been identified as PKC inhibitors (see

Hidaka and Hagiwara, Trends in Pharm. Sci. 8:162-164 (1987) for review), few have been found which inhibit PKC specifically. While the quinoline sulfonamide derivatives such as l-(5-isoquinolinesulfonyl)-2-methylpiperazine (H-7) inhibit PKC at micromolar concentrations, they exhibit similar enzyme inhibition kinetics for PKC and the CAMP- dependent and cGMP-dependent protein kinases. Staurosporine, an alkaloid product of Streptomyces sp., and its analogs, are the most potent in vitro inhibitors of PKC identified to date. However, they exhibit only limited selectivity among different protein kinases (Gescher, Anti-Cancer Drug Design 4:93-105 (1989)). Certain ceramides and sphingosine derivatives have been shown to have PKC inhibitory activity and to have promise for therapeutic uses, however, there remains a long-felt need for specific inhibitors of the enzymes.

There is also a desire to inhibit specific PKC isozymes, both as a research tool and in diagnosis and treatment of diseases which may be associated with particular isozymes.

Godson et al. (J. Biol. Chem. 268: 11946-11950 (1993)) disclosed use of stable transfection of antisense PKC-α cDNA in cytomegalovirus promotor-based expression vectors to specifically decrease expression of PKC-α protein by approximately 70%. It was demonstrated that this inhibition caused a loss of phospholipase A₂-mediated arachidonic acid release in response to the phorbol ester PMA. Attempts by the same researchers at inhibiting PKC activity with oligodeoxynucleotides were ultimately unsuccessful due to degradation of oligonucleotides. Ahmad et al. disclose that transfection of the human glioblastoma cell line, U-87, with vectors expressing antisense RNA to PKC-α inhibits growth of the glioblastoma cells in vitro and in vivo (Ahmad et al., Neurosurg. 35:904-908 (1994)). Diaz-Meco Conde et al. disclose a peptide corresponding to the pseudo-substrate region of PKC-ζ and oligonucleotides antisense to this isozyme (WO Application 93/20101). Alvaro et al. have identified a novel mutant form of PKC associated with tumors and disclose oligonucleotide sequences complementary to the mutant form (WO Application 94/29455).

SUMMARY OF THE INVENTION

In accordance with the present invention, oligonucleotides of reduced length are provided that are specifically hybridizable with a nucleic acid that encodes PKC-α and are capable of inhibiting PKC-α expression. This relationship is commonly denominated as "antisense". The oligonucleotides typically contain one or more modifications to improve oligonucleotide stability, binding affinity or potency and may be chimeric oligonucleotides. In a preferred embodiment the oligonucleotides comprise at least one 2'-O-methoxyethyl modification. The oligonucleotides are less than about 19 nucleotides long and in one embodiment are fifteen nucleotides long (15-mers). These oligonucleotides are believed to be useful therapeutically, diagnostically and as research reagents and are believed to be particularly useful for their ability to decrease the expression of PKC in an isoform-specific manner.

Also provided are methods for modulating the expression of PKC-α using the oligonucleotides of the invention. These methods are believed to be useful both therapeutically and diagnostically as a consequence of the relationship between PKC-α and inflammation and hypeφroliferation. Other aspects of the invention are directed to methods for diagnostics and treatment of conditions associated with PKC-α.

DETAILED DESCRIPTION OF THE INVENTION

The present invention employs oligonucleotides for use in inhibiting the function of nucleic acid molecules encoding PKC, ultimately modulating the amount of PKC produced. This is accomplished by providing oligonucleotides which specifically hybridize with nucleic acids, preferably mRNA, encoding PKC.

This relationship between an oligonucleotide and its complementary nucleic acid target to which it hybridizes is commonly referred to as "antisense". "Targeting" an oligonucleotide to a chosen nucleic acid target, in the context of this invention, is a multistep process. The process usually begins with identifying a nucleic acid sequence whose function is to be modulated. This may be, as examples, a cellular gene (or mRNA made from the gene) whose expression is associated with a particular disease state, or a foreign nucleic acid from an infectious agent. In the present invention, the target is a nucleic acid encoding PKC, such as, for example, a PKC gene or mRNA expressed from a PKC gene. PKC mRNAs are presently the preferred targets. The targeting process also includes determination of a site or sites within the nucleic acid sequence for the oligonucleotide interaction to occur such that modulation of gene expression will result.

In accordance with this invention, persons of ordinary skill in the art will understand that messenger RNA includes not only the information to encode a protein using the three letter genetic code, but also associated ribonucleotides which form a region known to such persons as the 5'-untranslated region, the 3 '-untranslated region, the 5' cap region and intron/exon junction ribonucleotides. Thus, oligonucleotides may be formulated in accordance with this invention which are targeted wholly or in part to these associated ribonucleotides as well as to the informational ribonucleotides. The oligonucleotide may therefore be specifically hybridizable with a transcription initiation site region, a translation initiation codon region, a 5' cap region, an intron exon junction, coding sequences, a translation termination codon region or sequences in the 5'- or 3 '-untranslated region. Since, as is known in the art, the translation initiation codon is typically 5'-AUG (in transcribed mRNA molecules; 5'-ATG in the corresponding DNA molecule), the translation initiation codon is also referred to as the "AUG codon," the "start codon" or the "AUG start codon." A minority of genes have a translation initiation codon having the RNA sequence 5'-GUG, 5'-UUG or 5'-CUG, and 5'-AUA, 5'-ACG and 5'-CUG have been shown to function in vivo. Thus, the terms "translation initiation codon" and "start codon" can encompass many codon sequences, even though the initiator amino acid in each instance is typically methionine (in eukaryotes) or formylmethionine (prokaryotes). It is also known in the art that eukaryotic and prokaryotic genes may have two or more alternative start codons, any one of which may be preferentially utilized for translation initiation in a particular cell type or tissue, or under a particular set of conditions. In the context of the invention, "start codon" and "translation initiation codon" refer to the codon or codons that are used in vivo to initiate translation of an mRNA molecule transcribed from a gene encoding PKC, regardless of the sequence(s) of such codons. It is also known in the art that a translation termination codon (or "stop codon") of a gene may have one of three sequences, i.e., 5'-UAA, 5'-UAG and 5'-UGA (the corresponding DNA sequences are 5'-TAA, 5 '-TAG and 5'-TGA, respectively). The terms "start codon region" and "translation initiation codon region" refer to a portion of such an mRNA or gene that encompasses from about 25 to about 50 contiguous nucleotides in either direction (i.e., 5' or 3') from a translation initiation codon. This region is a preferred target region. Similarly, the terms "stop codon region" and "translation termination codon region" refer to a portion of such an mRNA or gene that encompasses from about 25 to about 50 contiguous nucleotides in either direction (i.e., 5' or 3') from a translation termination codon. This region is a preferred target region. The open reading frame (ORF) or "coding region," which is known in the art to refer to the region between the translation initiation codon and the translation termination codon, is also a region which may be targeted effectively. Other preferred target regions include the 5' untranslated region (5'-UTR), known in the art to refer to the portion of an mRNA in the 5' direction from the translation initiation codon, and thus including nucleotides between the 5' cap site and the translation initiation codon of an mRNA or corresponding nucleotides on the gene) and the 3' untranslated region (3'-UTR), known in the art to refer to the portion of an mRNA in the 3' direction from the translation termination codon, and thus including nucleotides between the translation termination codon and 3' end of an mRNA or corresponding nucleotides on the gene). mRNA splice sites may also be preferred target regions, and are particularly useful in situations where aberrant splicing is implicated in disease, or where an oveφroduction of a particular mRNA splice product is implicated in disease. Aberrant fusion junctions due to rearrangements or deletions may also be preferred targets.

Once the target site or sites have been identified, oligonucleotides are chosen which are sufficiently complementary to the target, i.e., hybridize sufficiently well and with sufficient specificity, to give the desired modulation.

"Hybridization", in the context of this invention, means hydrogen bonding, also known as Watson-Crick base pairing, between complementary bases, usually on opposite nucleic acid strands or two regions of a nucleic acid strand. Guanine and cytosine are examples of complementary bases which are known to form three hydrogen bonds between them. Adenine and thymine are examples of complementary bases which form two hydrogen bonds between them.

"Specifically hybridizable" and "complementary" are terms which are used to indicate a sufficient degree of complementarity such that stable and specific binding occurs between the DNA or RNA target and the oligonucleotide.

It is understood that an oligonucleotide need not be 100% complementary to its target nucleic acid sequence to be specifically hybridizable. An oligonucleotide is specifically hybridizable when binding of the oligonucleotide to the target interferes with the normal function of the target molecule to cause a loss of utility, and there is a sufficient degree of complementarity to avoid non-specific binding of the oligonucleotide to non-target sequences under conditions in which specific binding is desired, i.e., under physiological conditions in the case of in vivo assays or therapeutic treatment or, in the case of in vitro assays, under conditions in which the assays are conducted.

Hybridization of antisense oligonucleotides with mRNA interferes with one or more of the normal functions of mRNA. The functions of mRNA to be interfered with include all vital functions such as, for example, translocation of the RNA to the site of protein translation, translation of protein from the RNA, splicing of the RNA to yield one or more mRNA species, and catalytic activity which may be engaged in by the RNA.

The overall effect of interference with mRNA function is modulation of PKC expression. In the context of this invention "modulation" means either inhibition or stimulation. Inhibition of PKC gene expression is presently the preferred form of modulation. This modulation can be measured in ways which are routine in the art, for example by Northern blot assay of mRNA expression as taught in the examples of the instant application or by Western blot or ELISA assay of protein expression. Effects on cell proliferation or tumor cell growth can also be measured, as taught in the examples of the instant application. The oligonucleotides of this invention can be used in diagnostics, therapeutics, prophylaxis, and as research reagents and in kits. Since the oligonucleotides of this invention hybridize to nucleic acids encoding PKC, sandwich, colorimetric and other assays can easily be constructed to exploit this fact. Furthermore, since the oligonucleotides of this invention hybridize specifically to nucleic acids encoding particular isozymes of PKC, such assays can be devised for screening of cells and tissues for particular PKC isozymes. Such assays can be utilized for diagnosis of diseases associated with various PKC forms. Provision of means for detecting hybridization of oligonucleotide with a PKC gene or mRNA can routinely be accomplished. Such provision may include enzyme conjugation, radiolabelling or any other suitable detection systems. Kits for detecting the presence or absence of PKC may also be prepared.

The present invention is also suitable for diagnosing abnormal proliferative states in tissue or other samples from patients suspected of having a hypeφroliferative disease such as cancer or psoriasis. The ability of the oligonucleotides of the present invention to inhibit cell proliferation may be employed to diagnose such states. A number of assays may be formulated employing the present invention, which assays will commonly comprise contacting a tissue sample with an oligonucleotide of the invention under conditions selected to permit detection and, usually, quantitation of such inhibition. In the context of this invention, to "contact" tissues or cells with an oligonucleotide or oligonucleotides means to add the oligonucleotide(s), usually in a liquid carrier, to a cell suspension or tissue sample, either in vitro or ex vivo, or to administer the oligonucleotide(s) to cells or tissues within an animal. Similarly, the present invention can be used to distinguish PKC-associated tumors, particularly tumors associated with PKC-α, from tumors having other etiologies, in order that an efficacious treatment regime can be designed.

The oligonucleotides of this invention may also be used for research puφoses. Thus, the specific hybridization exhibited by the oligonucleotides may be used for assays, purifications, cellular product preparations and in other methodologies which may be appreciated by persons of ordinary skill in the art.

In the context of this invention, the term "oligonucleotide" refers to an oligomer or polymer of ribonucleic acid or deoxyribonucleic acid. This term includes oligonucleotides composed of naturally-occurring nucleobases, sugars and covalent intersugar (backbone) linkages as well as oligonucleotides having non-naturally-occurring portions which function similarly. Such modified or substituted oligonucleotides are often preferred over native forms because of desirable properties such as, for example, enhanced cellular uptake, enhanced binding to target and increased stability in the presence of nucleases.

Specific examples of some preferred modified oligonucleotides envisioned for this invention include those containing phosphorothioates, phosphotriesters, methyl phosphonates, short chain alkyl or cycloalkyl intersugar linkages or short chain heteroatomic or heterocyclic intersugar linkages. Most preferred are oligonucleotides with phosphorothioates and those with CH₂-NH-O-CH₂, CH₂-N(CH₃)-O-CH₂ (known as a methylene(methylimino) or MMI backbone), CH₂-O-N(CH₃)-CH₂, CH₂-N(CH₃)-N(CH₃)-CH₂ and O-N(CH₃)-CH₂-CH₂ backbones, wherein the native phosphodiester backbone is represented as O-P-O-CH₂). Also preferred are oligonucleotides having moφholino backbone structures (Summerton and Weller, U.S. Patent 5,034,506). Further preferred are oligonucleotides with NR-C(*)-CH₂-CH₂, CH₂-NR-C(*)-CH₂, CH₂-CH₂-NR-C(*), C(*)-NR- CH₂-CH₂ and CH₂-C(*)-NR-CH₂ backbones, wherein "*" represents O or S (known as amide backbones; DeMesmaeker et al, WO 92/20823, published November 26, 1992). In other preferred embodiments, such as the peptide nucleic acid (PNA) backbone, the phosphodiester backbone of the oligonucleotide is replaced with a polyamide backbone, the nucleobases being bound directly or indirectly to the aza nitrogen atoms of the polyamide backbone (Nielsen et al, Science, 1991, 254, 1497; U.S. Patent No. 5,539,082). Other preferred modified oligonucleotides may contain one or more substituted sugar moieties comprising one of the following at the 2' position: OH, SH, SCH₃, F, OCN, OCH₃OCH₃, OCH₃O(CH₂)„CH₃, O(CH₂)_nNH₂ or O(CH₂)_nCH₃ where n is from 1 to about 10; C, to C₁₀ lower alkyl, alkoxyalkoxy, substituted lower alkyl, alkaryl or aralkyl; Cl; Br; CN; CF₃; OCF₃; O-, S-, or N-alkyl; O-, S-, or N-alkenyl; SOCH₃; SO₂CH₃; ONO₂; NO₂; N₃; NH₂; heterocycloalkyl; heterocycloalkaryl; aminoalkylamino; poly alky lamino; substituted silyl; an RNA cleaving group; a reporter group; an intercalator; a group for improving the pharmacokinetic properties of an oligonucleotide; or a group for improving the pharmacodynamic properties of an oligonucleotide and other substituents having similar properties. A preferred modification includes 2'-O-methoxyethyl (which can be written as 2'-O-CH₂CH₂OCH₃, and is also known in the art as 2'-O-(2-methoxyethyl) or 2'-methoxyethoxy) (Martin et al, Helv. Chim. Acta, 1995, 78, 486). Other preferred modifications include 2'-methoxy (2'-O-CH₃), 2'-propoxy (2'- OCH₂CH₂CH₃) and 2'-fluoro (2'-F). Similar modifications may also be made at other positions on the oligonucleotide, particularly the 3' position of the sugar on the 3' terminal nucleotide and the 5' position of the 5' terminal nucleotide. Oligonucleotides may also have sugar mimetics such as cyclobutyls in place of the pentofuranosyl group. The oligonucleotides of the invention may additionally or alternatively include nucleobase modifications or substitutions. As used herein, "unmodified" or "natural" nucleobases include adenine (A), guanine (G), thymine (T), cytosine (C) and uracil (U). Modified nucleobases include nucleobases found only infrequently or transiently in natural nucleic acids, e.g., hypoxanthine, 6-methyladenine, 5-methylcytosine, 5- hydroxymethylcytosine (HMC), glycosyl HMC and gentiobiosyl HMC, as well synthetic nucleobases, e.g., 5-bromouracil, 5-hydroxymethyluracil, 8-azaguanine, 7-deazaguanine, N⁶(6-aminohexyl)adenine and 2,6-diaminopurine (Kornberg, A., DNA Replication, 1974, W.H. Freeman & Co., San Francisco, 1974, pp. 75-77; Gebeyehu, G., et al, Nucleic Acids Res., 1987, 75, 4513). Another preferred additional or alternative modification of the oligonucleotides of the invention involves chemically linking to the oligonucleotide one or more lipophilic moieties which enhance the cellular uptake of the oligonucleotide. Such lipophilic moieties may be linked to an oligonucleotide at several different positions on the oligonucleotide. Some preferred positions include the 3' position of the sugar of the 3' terminal nucleotide, the 5' position of the sugar of the 5' terminal nucleotide, and the 2' position of the sugar of any nucleotide. The N⁶ position of a purine nucleobase may also be utilized to link a lipophilic moiety to an oligonucleotide of the invention (Gebeyehu, G., etal, Nucleic Acids Res., 1987, 15, 4513). Such lipophilic moieties include but are not limited to a cholesteryl moiety (Letsinger et al, Proc. Natl Acad. Sci. USA, 1989, 86, 6553), cholic acid (Manoharan et al, Bioorg. Med. Chem. Let., 1994, 4, 1053), a thioether, e.g., hexyl-S-tritylthiol (Manoharan et al, Ann. N. Y. Acad. Sci., 1992, 660, 306; Manoharan et al, Bioorg. Med. Chem. Let., 1993, 3, 2765), a fhiocholesterol (Oberhauser et al, Nucl Acids Res., 1992, 20, 533), an aliphatic chain, e.g., dodecandiol or undecyl residues (Saison-Behmoaras et al, EMBO J., 1991, 10, 111; Kabanov et al, FEBSLett., 1990, 259, 327; Svinarchuk et al, Biochimie, 1993, 75, 49), aphospholipid, e.g., di-hexadecyl-rac-glycerol ortriethylammonium 1,2-di-O-hexadecyl-r c- glycero-3-H-phosphonate (Manoharan et al, Tetrahedron Lett., 1995, 36, 3651 ; Shea et al, Nucl. Acids Res., 1990, 18, 3777), a polyamine or a polyethylene glycol chain (Manoharan et al, Nucleosides & Nucleotides, 1995, 14, 969), or adamantane acetic acid (Manoharan et al, Tetrahedron Lett., 1995, 36, 3651), a palmityl moiety (Mishra et al, Biochim. Biophys. Acta, \ 995 , 1264, 229), or an octadecylamine or hexylamino-carbonyl-oxycholesterol moiety (Crooke et al, J. Pharmacol. Exp. Ther., 1996, 277, 923). Oligonucleotides comprising lipophilic moieties, and methods for preparing such oligonucleotides, as disclosed in U.S. Patents No. 5,138,045, No. 5,218,105 and No. 5,459,255, the contents of which are hereby incoφorated by reference in their entirety.

The present invention also includes oligonucleotides which are chimeric oligonucleotides. "Chimeric" oligonucleotides or "chimeras," in the context of this invention, are oligonucleotides which contain two or more chemically distinct regions, each made up of at least one nucleotide. These oligonucleotides typically contain at least one region wherein the oligonucleotide is modified so as to confer upon the oligonucleotide increased resistance to nuclease degradation, increased cellular uptake, and/or increased binding affinity for the target nucleic acid. An additional region of the oligonucleotide may serve as a substrate for enzymes capable of cleaving RNA:DNA or RNA:RNA hybrids. By way of example, RNase H is a cellular endonuclease which cleaves the RNA strand of an RNA:DNA duplex. Activation of RNase H, therefore, results in cleavage of the RNA target, thereby greatly enhancing the efficiency of antisense inhibition of gene expression. Cleavage of the RNA target can be routinely detected by gel electrophoresis and, if necessary, associated nucleic acid hybridization techniques known in the art. This RNAse H-mediated cleavage of the RNA target is distinct from the use of ribozymes to cleave nucleic acids. Ribozymes are not comprehended by the present invention.

Examples of chimeric oligonucleotides include but are not limited to "gapmers," in which three distinct regions are present, normally with a central region flanked by two regions which are chemically equivalent to each other but distinct from the gap. A preferred example of a gapmer is an oligonucleotide in which a central portion (the "gap") of the oligonucleotide serves as a substrate for RNase H and is preferably composed of 2'- deoxynucleotides, while the flanking portions (the 5' and 3' "wings") are modified to have greater affinity for the target RNA molecule but are unable to support nuclease activity (e.g., 2'-fluoro- or 2'-O-methoxyethyl- substituted). Other chimeras include "wingmers," also known in the art as "hemimers," that is, oligonucleotides with two distinct regions. In a preferred example of a wingmer, the 5' portion of the oligonucleotide serves as a substrate for RNase H and is preferably composed of 2'-deoxynucleotides, whereas the 3' portion is modified in such a fashion so as to have greater affinity for the target RNA molecule but is unable to support nuclease activity (e.g., 2'-fluoro- or 2'-O-methoxyethyl- substituted), or vice- versa.

In one embodiment, the oligonucleotides of the present invention contain a 2'- O-methoxyethyl (2'-O-CH₂CH₂OCH₃) modification on the sugar moiety of at least one nucleotide. This modification has been shown to increase both affinity of the oligonucleotide for its target and nuclease resistance of the oligonucleotide. According to the invention, one, a plurality, or all of the nucleotide subunits of the oligonucleotides of the invention may bear a 2'-O-methoxyethyl (-O-CH₂CH₂OCH₃) modification. Oligonucleotides comprising a plurality of nucleotide subunits having a 2'-O-methoxyethyl modification can have such a modification on any of the nucleotide subunits within the oligonucleotide, and may be chimeric oligonucleotides. Aside from or in addition to 2'-O-methoxyethyl modifications, oligonucleotides containing other modifications which enhance antisense efficacy, potency or target affinity are also preferred. Chimeric oligonucleotides comprising one or more such modifications are presently preferred. Through use of such modifications, active oligonucleotides have been identified which are shorter than conventional "first generation" oligonucleotides active against PKC. Oligonucleotides in accordance with this invention are from 5 to 50 nucleotides in length, more preferably 12 to 25, more preferably 12 to 20, most preferably 12 to 18. In one highly preferred embodiment the oligonucleotides are 15 nucleotides in length. In the context of this invention it is understood that oligonucleotides in accordance with this invention encompass non-naturally occurring oligomers as hereinbefore described, having from 5 to 50 monomers. The oligonucleotides used in accordance with this invention may be conveniently and routinely made through the well-known technique of solid phase synthesis. Equipment for such synthesis is sold by several vendors including Applied Biosystems. Any other means for such synthesis may also be employed; the actual synthesis of the oligonucleotides is well within the talents of the routineer. It is well known to use similar techniques to prepare oligonucleotides such as the phosphorothioates and 2'-alkoxy or 2'- alkoxyalkoxy derivatives, including 2'-O-methoxyethyl oligonucleotides (Martin, P., Helv. Chim. Acta, 1995, 78, 486-504). It is also well known to use similar techniques and commercially available modified amidites and controlled-pore glass (CPG) products such as biotin, fluorescein, acridine or psoralen-modified amidites and/or CPG (available from Glen Research, Sterling VA) to synthesize fluorescently labeled, biotinylated or other conjugated oligonucleotides.

The antisense compounds of the present invention include bioequivalent compounds, including pharmaceutically acceptable salts and prodrugs. This is intended to encompass any pharmaceutically acceptable salts, esters, or salts of such esters, or any other compound which, upon administration to an animal including a human, is capable of providing (directly or indirectly) the biologically active metabolite or residue thereof.

Accordingly, for example, the disclosure is also drawn to pharmaceutically acceptable salts of the nucleic acids of the invention and prodrugs of such nucleic acids.

"Pharmaceutically acceptable salts" are physiologically and pharmaceutically acceptable salts of the nucleic acids of the invention: i.e., salts that retain the desired biological activity of the parent compound and do not impart undesired toxico logical effects thereto (see, for example, Berge et al, "Pharmaceutical Salts," J. ofPharma Sci., 1977, 66: 1 , which is incoφorated herein by reference in its entirety).

For oligonucleotides, examples of pharmaceutically acceptable salts include but are not limited to (a) salts formed with cations such as sodium, potassium, ammonium, magnesium, calcium, polyamines such as spermine and spermidine, etc.; (b) acid addition salts formed with inorganic acids, for example hydrochloric acid, hydrobromic acid, sulfuric acid, phosphoric acid, nitric acid and the like; (c) salts formed with organic acids such as, for example, acetic acid, oxalic acid, tartaric acid, succinic acid, maleic acid, fumaric acid, gluconic acid, citric acid, malic acid, ascorbic acid, benzoic acid, tannic acid, palmitic acid, alginic acid, polyglutamic acid, naphthalenesulfonic acid, methanesulfonic acid, p- toluenesulfonic acid, naphthalenedisulfonic acid, polygalacturonic acid, and the like; and (d) salts formed from elemental anions such as chlorine, bromine, and iodine.

The oligonucleotides of the invention may additionally or alternatively be prepared to be delivered in a "prodrug" form. The term "prodrug" indicates a therapeutic agent that is prepared in an inactive form that is converted to an active form (i.e., drug) within the body or cells thereof by the action of endogenous enzymes or other chemicals and/or conditions. In particular, prodrug versions of the oligonucleotides of the invention are prepared as SATE ((S-acetyl-2-thioethyl) phosphate) derivatives according to the methods disclosed in WO 93/24510 to Gosselin et al., published December 9, 1993, which is incoφorated herein by reference in its entirety.

For therapeutic or prophylactic treatment, oligonucleotides are administered in accordance with this invention. Oligonucleotide compounds of the invention may be formulated in a pharmaceutical composition, which may include pharmaceutically acceptable carriers, thickeners, diluents, buffers, preservatives, surface active agents, neutral or cationic lipids, lipid complexes, liposomes, penetration enhancers, carrier compounds and other pharmaceutically acceptable carriers or excipients and the like in addition to the oligonucleotide. Such compositions and formulations are comprehended by the present invention.

Pharmaceutical compositions comprising the oligonucleotides of the present invention may include penetration enhancers in order to enhance the alimentary delivery of the oligonucleotides. Penetration enhancers may be classified as belonging to one of five broad categories, i.e., fatty acids, bile salts, chelating agents, surfactants and non-surfactants (Lee et al, Critical Reviews in Therapeutic Drug Carrier Systems, 1991, S.91-192; Muranishi, Critical Reviews in Therapeutic Drug Carrier Systems, 1990, 7:1). One or more penetration enhancers from one or more of these broad categories may be included. Compositions comprising oligonucleotides and penetration enhancers are disclosed in co- pending U.S. patent application Serial No. 08/886,829 to Teng et al., filed July 1, 1997, which is herein incoφorated by reference in its entirety.

The compositions of the present invention may additionally contain other adjunct components conventionally found in pharmaceutical compositions, at their art-established usage levels. Thus, for example, the compositions may contain additional compatible pharmaceutically-active materials such as, e.g., antipruritics, astringents, local anesthetics or anti-inflammatory agents, or may contain additional materials useful in physically formulating various dosage forms of the composition of present invention, such as dyes, flavoring agents, preservatives, antioxidants, opacifiers, thickening agents and stabilizers. However, such materials, when added, should not unduly interfere with the biological activities of the components of the compositions of the invention.

Regardless of the method by which the oligonucleotides of the invention are introduced into a patient, colloidal dispersion systems may be used as delivery vehicles to enhance the in vivo stability of the oligonucleotides and/or to target the oligonucleotides to a particular organ, tissue or cell type. Colloidal dispersion systems include, but are not limited to, macromolecule complexes, nanocapsules, microspheres, beads and lipid-based systems including oil-in-water emulsions, micelles, mixed micelles, liposomes and lipid:oligonucleotide complexes of uncharacterized structure. A preferred colloidal dispersion system is a plurality of liposomes. Liposomes are microscopic spheres having an aqueous core surrounded by one or more outer layers made up of lipids arranged in a bilayer configuration (see, generally, Chonn et al, Current Op. Biotech., 1995, 6, 698). Liposomal antisense compositions are prepared according to the disclosure of co-pending U.S. patent application Serial No. 08/961,469 to Hardee et al, filed October 31, 1997, incoφorated herein by reference in its entirety. The pharmaceutical compositions of the present invention may be administered in a number of ways depending upon whether local or systemic treatment is desired and upon the area to be treated. Administration may be topical (including ophthalmic, vaginal, rectal, intranasal, epidermal and transdermal), oral or parenteral. Parenteral administration includes intravenous drip, subcutaneous, intraperitoneal or intramuscular injection, pulmonary administration, e.g., by inhalation or insufflation, or intracranial, e.g., intrathecal or intraventricular, administration. For oral administration, it has been found that oligonucleotides with at least one 2'-substituted ribonucleotide are particularly useful because of their absoφtion and distribution characteristics. U.S. Patent 5,591,721 issued to Agrawal et al. Oligonucleotides with at least one 2'-O-methoxyethyl modification are believed to be particularly useful for oral administration. Modes of administering oligonucleotides are disclosed in co-pending U.S. patent application Serial No. 08/961,469 to Hardee et al., filed October 31, 1997, herein incoφorated by reference in its entirety.

Formulations for topical administration may include transdermal patches, ointments, lotions, creams, gels, drops, suppositories, sprays, liquids and powders. Conventional pharmaceutical carriers, aqueous, powder or oily bases, thickeners and the like may be necessary or desirable. Coated condoms, gloves and the like may also be useful.

Compositions for oral administration include powders or granules, suspensions or solutions in water or non-aqueous media, capsules, sachets or tablets. Thickeners, flavoring agents, diluents, emulsifiers, dispersing aids or binders may be desirable.

Compositions for parenteral administration may include sterile aqueous solutions which may also contain buffers, diluents and other suitable additives.

The formulation of therapeutic compositions and their subsequent administration is believed to be within the skill of those in the art. Dosing is dependent on severity and responsiveness of the disease state to be treated, with the course of treatment lasting from several days to several months, or until a cure is effected or a diminution of the disease state is achieved. Optimal dosing schedules can be calculated from measurements of drug accumulation in the body of the patient. Persons of ordinary skill can easily determine optimum dosages, dosing methodologies and repetition rates. Optimum dosages may vary depending on the relative potency of individual oligonucleotides, and can generally be estimated based on EC₅₀s found to be effective in in vitro and in vivo animal models. In general, dosage is from 0.01 μg to 100 g per kg of body weight, and may be given once or more daily, weekly, monthly or yearly, or even once every 2 to 20 years. Persons of ordinary skill in the art can easily estimate repetition rates for dosing based on measured residence times and concentrations of the drug in bodily fluids or tissues. Following successful treatment, it may be desirable to have the patient undergo maintenance therapy to prevent the recurrence of the disease state, wherein the oligonucleotide is administered in maintenance doses, ranging from 0.01 μg to 100 g per kg of body weight, once or more daily, to once every 20 years.

Thus, in the context of this invention, by "therapeutically effective amount" is meant the amount of the compound which is required to have a therapeutic effect on the treated mammal. This amount, which will be apparent to the skilled artisan, will depend upon the type of mammal, the age and weight of the mammal, the type of disease to be treated, perhaps even the gender of the mammal, and other factors which are routinely taken into consideration when treating a mammal with a disease. A therapeutic effect is assessed in the mammal by measuring the effect of the compound on the disease state in the animal. For example, if the disease to be treated is psoriasis, a reduction or ablation of the skin plaque is an indication that the administered dose has a therapeutic effect. Similarly, in mammals being treated for cancer, therapeutic effects are assessed by measuring the rate of growth or the size of the tumor, or by measuring the production of compounds such as cytokines, production of which is an indication of the progress or regression of the tumor. We have previously identified oligonucleotides which are able to inhibit PKC expression in vitro, in animals and in human xenografts in animals. One such oligonucleotide, ISIS 3521, is presently in clinical trials and has shown antitumor activity in patients with ovarian and lung cancer and lymphoma that were refractory to standard cancer chemotherapy. McGraw et al, 1997, Anti-Cancer Drug Design 12:315-326; Stewart, A., 1997, Molecular Medicine Today, August 1997, p. 324. This compound is a 20-mer (i.e., 20 nucleotides in length) phosphorothioate oligodeoxynucleotide. We have now found that antisense oligonucleotides of reduced length can effectively inhibit expression of PKC, and thus exhibit enhanced activity on a per-gram basis.

The following examples illustrate the present invention and are not intended to limit the same.

EXAMPLES

Example 1 : Oligonucleotide synthesis

Unmodified oligodeoxynucleotides were synthesized on an automated DNA synthesizer (Applied Biosystems model 380B) using standard phosphoramidite chemistry with oxidation by iodine, β-cyanoethyldiisopropyl-phosphoramidites were purchased from Applied Biosystems (Foster City, CA). For phosphorothioate oligonucleotides, the standard oxidation bottle was replaced by a 0.2 M solution of ³H- 1 ,2-benzodithiole-3-one 1 , 1 -dioxide in acetonitrile for the stepwise thiation of the phosphite linkages. The thiation cycle wait step was increased to 68 seconds and was followed by the capping step. 2'-methoxy oligonucleotides were synthesized using 2'-methoxy β- cyanoethyldiisopropyl-phosphoramidites (Chemgenes, Needham MA) and the standard cycle for unmodified oligonucleotides, except the wait step after pulse delivery of tetrazole and base was increased to 360 seconds. Other 2'-alkoxy oligonucleotides were synthesized by a modification of this method, using appropriate 2'-modified amidites such as those available from Glen Research, Inc., Sterling, VA.

2'-fluoro oligonucleotides were synthesized as described in Kawasaki et al. , J. Med. Chem. 1993, 36, 831. Briefly, the protected nucleoside N⁶-benzoyl-2'-deoxy-2'- fluoroadenosine was synthesized utilizing commercially available 9-β-D- arabinofuranosyladenine as starting material and by modifying literature procedures whereby the 2'-"-fluoro atom is introduced by a S_N2-displacement of a 2'-β-O-trifyl group. Thus N⁶- benzoyl-9-β-D-arabinofuranosyladenine was selectively protected in moderate yield as the 3',5'-ditetrahydropyranyl (THP) intermediate. Deprotection of the THP and N⁶-benzoyl groups was accomplished using standard methodologies and standard methods were used to obtain the 5'-dimethoxytrityl- (DMT) and 5'-DMT-3'-phosphoramidite intermediates. The synthesis of 2'-deoxy-2'-fluoroguanosine was accomplished using tetraisopropyldisiloxanyl (TPDS) protected 9-β-D-arabinofuranosylguanine as starting material, and conversion to the intermediate diisobutyrylarabinofuranosylguanosine. Deprotection of the TPDS group was followed by protection of the hydroxyl group with THP to give diisobutyryl di-THP protected arabinofuranosylguanine. Selective O-deacylation and triflation was followed by treatment of the crude product with fluoride, then deprotection of the THP groups. Standard methodologies were used to obtain the 5'-DMT- and 5'-DMT-3'- phosphoramidites.

Synthesis of 2'-deoxy-2'-fluorouridine was accomplished by the modification of a literature procedure in which 2, 2'-anhydro- 1 -β-D-arabinofuranosyluracil was treated with 70% hydrogen fluoride-pyridine. Standard procedures were used to obtain the 5'-DMT and 5 '-DMT-3 '-phosphoramidites. 2'-deoxy-2'-fluorocytidine was synthesized via amination of 2'-deoxy-2'- fluorouridine, followed by selective protection to giveN⁴-benzoyl-2'-deoxy-2'-fluorocytidine. Standard procedures were used to obtain the 5'-DMT and 5'-DMT-3'phosphoramidites.

Oligonucleotides having methylene(methylimino) backbones are synthesized according to U.S. Patent 5,378,825, which is coassigned to the assignee of the present invention and is incoφorated herein in its entirety. Other nitrogen-containing backbones are synthesized according to WO 92/20823 which is also coassigned to the assignee of the present invention and incoφorated herein in its entirety.

Oligonucleotides having amide backbones are synthesized according to De Mesmaeker et al,Acc. Chem. Res., 1995, 28, 366. The amide moiety is readily accessible by simple and well-known synthetic methods and is compatible with the conditions required for solid phase synthesis of oligonucleotides.

Oligonucleotides with moφholino backbones are synthesized according to U. S . Patent 5,034,506 (Summerton and Weller). Peptide-nucleic acid (PNA) oligomers are synthesized according to P.E.

Nielsen et al., Science 1991, 254, 1497.

After cleavage from the controlled pore glass column (Applied Biosystems) and deblocking in concentrated ammonium hydroxide at 55°C for 18 hours, the oligonucleotides are purified by precipitation twice out of 0.5 M NaCl with 2.5 volumes ethanol. Synthesized oligonucleotides were analyzed by polyacrylamide gel electrophoresis on denaturing gels and judged to be at least 85% full length material. The relative amounts of phosphorothioate and phosphodiester linkages obtained in synthesis were periodically checked by ¹P nuclear magnetic resonance spectroscopy, and for some studies oligonucleotides were purified by HPLC, as described by Chiang et al. , J. Biol Chem. , 1991, 266, 18162. Results obtained with HPLC-purified material were similar to those obtained with non-HPLC purified material.

Oligonucleotides having 2'-O-CH₂CH₂OCH₃ modified nucleotides were synthesized according to the method of Martin. Helv. Chim. Ada 1995, 78,486-504. All 2'-O- CH₂CH₂OCH₃-cytosines were 5-methyl cytosines, synthesized as follows: 5-Methyl cytosine monomers:

2,2'-Anhydro 1 - -D-arabinofuranosyl)-5-methyluridine1 : 5-Methyluridine (ribosylthymine, commercially available through Yamasa, Choshi, Japan) (72.0 g, 0.279 M), diphenylcarbonate (90.0 g, 0.420 M) and sodium bicarbonate (2.0 g, 0.024 M) were added to DMF (300 mL). The mixture was heated to reflux, with stirring, allowing the evolved carbon dioxide gas to be released in a controlled manner. After 1 hour, the slightly darkened solution was concentrated under reduced pressure. The resulting syrup was poured into diethylether (2.5 L), with stirring. The product formed a gum. The ether was decanted and the residue was dissolved in a minimum amount of methanol (ca. 400 mL). The solution was poured into fresh ether (2.5 L) to yield a stiff gum. The ether was decanted and the gum was dried in a vacuum oven (60 °C at 1 mm Hg for 24 h) to give a solid which was crushed to a light tan powder (57 g, 85% crude yield). The material was used as is for further reactions.

2'-O-Methoxyethyl-5-methyluridine:

2,2'-Anhydro-5-methyluridine (195 g, 0.81 M), tris(2-methoxyethyl)borate (231 g, 0.98 M) and 2-methoxyethanol (1.2 L) were added to a 2 L stainless steel pressure vessel and placed in a pre-heated oil bath at 160°C. After heating for 48 hours at 155-160°C, the vessel was opened and the solution evaporated to dryness and triturated with MeOH (200 mL). The residue was suspended in hot acetone (1 L). The insoluble salts were filtered, washed with acetone (150 mL) and the filtrate evaporated. The residue (280 g) was dissolved in CH₃CN (600 mL) and evaporated. A silica gel column (3 kg) was packed in CH₂Cl₂/acetone/MeOH (20:5:3) containing 0.5% Et₃NH. The residue was dissolved in CH₂C1₂ (250 mL) and adsorbed onto silica (150 g) prior to loading onto the column. The product was eluted with the packing solvent to give 160 g (63%>) of product.

2'-O-Methoxyethyl-5'-O-dimethoxytrityl-5-methyluridine:

2'-O-Methoxyethyl-5-methyluridine (160 g, 0.506 M) was co-evaporated with pyridine (250 mL) and the dried residue dissolved in pyridine (1.3 L). A first aliquot of dimethoxytrityl chloride (94.3 g, 0.278 M) was added and the mixture stirred at room temperature for one hour. A second aliquot of dimethoxytrityl chloride (94.3 g, 0.278 M) was added and the reaction stirred for an additional one hour. Methanol (170 mL) was then added to stop the reaction. HPLC showed the presence of approximately 70% product. The solvent was evaporated and triturated with CH₃CN (200 mL). The residue was dissolved in CHC1₃ (1.5 L) and extracted with 2x500 mL of saturated NaHCO₃ and 2x500 mL of saturated NaCl. The organic phase was dried over Na₂SO₄, filtered and evaporated. 275 g of residue was obtained. The residue was purified on a 3.5 kg silica gel column, packed and eluted with EtOAc/Hexane/ Acetone (5:5:1) containing 0.5% Et₃NH. The pure fractions were evaporated to give 164 g of product. Approximately 20 g additional was obtained from the impure fractions to give a total yield of 183 g (57%).

3'-O-Acetyl-2'-O-methoxyethyl-5'-O-dimethoxytrityl-5-methyluridine:

2'-O-Methoxyethyl-5'-O-dimethoxytrityl-5-methyluridine (106 g, 0.167 M), DMF/pyridine (750 mL of a 3:1 mixture prepared from 562 mL of DMF and 188 mL of pyridine) and acetic anhydride (24.38 mL, 0.258 M) were combined and stirred at room temperature for 24 hours. The reaction was monitored by tic by first quenching the tic sample with the addition of MeOH. Upon completion of the reaction, as judged by tic, MeOH (50 mL) was added and the mixture evaporated at 35 °C. The residue was dissolved in CHC1₃ (800 mL) and extracted with 2x200 mL of saturated sodium bicarbonate and 2x200 mL of saturated NaCl. The water layers were back extracted with 200 mL of CHC1₃. The combined organics were dried with sodium sulfate and evaporated to give 122 g of residue (approx.90% product). The residue was purified on a 3.5 kg silica gel column and eluted using EtOAc/Hexane(4:l). Pure product fractions were evaporated to yield 96 g (84%).

3'-O-Acetyl-2'-O-methoxyethyl-5'-O-dimethoxytrityl-5-methyl-4-triazoleuridine:

A first solution was prepared by dissolving 3'-O-acetyl-2'-O-methoxyethyl-5'- O-dimethoxytrityl-5-methyluridine (96 g, 0.144 M) in CH₃CN (700 mL) and set aside. Triethylamine (189 mL, 1.44 M) was added to a solution of triazole (90 g, 1.3 M) in CH₃CN (1 L), cooled to -5°C and stirred for 0.5 h using an overhead stirrer. POCl₃ was added dropwise, over a 30 minute period, to the stirred solution maintained at 0-10°C, and the resulting mixture stirred for an additional 2 hours. The first solution was added dropwise, over a 45 minute period, to the later solution. The resulting reaction mixture was stored overnight in a cold room. Salts were filtered from the reaction mixture and the solution was evaporated. The residue was dissolved in EtOAc (1 L) and the insoluble solids were removed by filtration. The filtrate was washed with 1x300 mL of NaHCO₃ and 2x300 mL of saturated NaCl, dried over sodium sulfate and evaporated. The residue was triturated with EtOAc to give the title compound.

2'-O-Methoxyethyl-5 '-O-dimethoxytrityl-5 -methylcytidine : A solution of 3'-O-acetyl-2'-O-methoxyethyl-5'-O-dimethoxytrityl-5-methyl-4- triazoleuridine (103 g, 0.141 M) in dioxane (500 mL) and NH₄OH (30 mL) was stirred at room temperature for 2 hours. The dioxane solution was evaporated and the residue azeotroped with MeOH (2x200 mL). The residue was dissolved in MeOH (300 mL) and transferred to a 2 liter stainless steel pressure vessel. MeOH (400 mL) saturated with NH₃ gas was added and the vessel heated to 100° C for 2 hours (tic showed complete conversion). The vessel contents were evaporated to dryness and the residue was dissolved in EtOAc (500 mL) and washed once with saturated NaCl (200 mL). The organics were dried over sodium sulfate and the solvent was evaporated to give 85 g (95%) of the title compound.

N⁴-Benzoyl-2'-O-methoxyethyl-5'-O-dimethoxytrityl-5-methylcvtidine: 2'-O-Methoxyethyl-5'-O-dimethoxytrityl-5-methylcytidine (85 g, 0.134 M) was dissolved in DMF (800 mL) andbenzoic anhydride (37.2 g, 0.165 M) was added with stirring. After stirring for 3 hours, tic showed the reaction to be approximately 95% complete. The solvent was evaporated and the residue azeotroped with MeOH (200 mL). The residue was dissolved in CHC1₃ (700 mL) and extracted with saturated NaHCO₃ (2x300 mL) and saturated NaCl (2x300 mL), dried over MgSO₄ and evaporated to give a residue (96 g). The residue was chromatographed on a 1.5 kg silica column using EtOAc/Hexane (1 :1) containing 0.5% Et₃NH as the eluting solvent. The pure product fractions were evaporated to give 90 g (90%) of the title compound.

N⁴-Benzoyl-2'-O-methoxyethyl-5'-O-dimethoxytrityl-5-methylcytidine-3'-amidite: N⁴-Benzoyl-2'-O-methoxyethyl-5'-O-dimethoxytrityl-5-methylcytidine (74 g,

0.10 M) was dissolved in CH₂C1₂ (1 L). Tetrazole diisopropylamine (7.1 g) and 2- cyanoethoxy-tetra(isopropyl)phosphite (40.5 mL, 0.123 M) were added with stirring, under a nitrogen atmosphere. The resulting mixture was stirred for 20 hours at room temperature (tlc showed the reaction to be 95% complete). The reaction mixture was extracted with saturated NaHCO₃ (1x300 mL) and saturated NaCl (3x300 mL). The aqueous washes were back-extracted with CH₂C1₂ (300 mL), and the extracts were combined, dried over MgSO₄ and concentrated. The residue obtained was chromatographed on a 1.5 kg silica column using EtOAc\Hexane (3:1) as the eluting solvent. The pure fractions were combined to give 90.6 g (87%>) of the title compound.

Example 2: Cell culture and treatment with phorbol esters and oligonucleotides

PKC protein half-lives have been reported to vary from 6.7 hours to over 24 hours (Young et al., Biochem. J. 244:775-779 (1987); Ballester et al., J. Bio Chem. 260: 15194-15199 (1985)). These long half-lives make inhibiting steady-state levels of PKC-α an unwieldy approach when screening antisense oligonucleotides, due to the long incubation times which would be required. We have therefore made use of the ability of phorbol esters to reversibly lower intracellular levels of PKC. Treatment of cells with phorbol esters causes an initial activation of kinase activity, followed by a down-regulation of PKC. For PKC-α this down-regulation has been shown to be a direct consequence of an increased rate of proteo lysis of the kinase with no apparent change in synthetic rate.

We determined that in human lung carcinoma (A549) cells, treatment with the phorbol ester 12,13-dibutyrate (PDBu), using a modification of the method of Krug et al, (Krug et al, J. Biol. Chem. 262:11852-11856 (1987)) lowered cellular levels of PKC-α, without affecting PKC-α mRNA levels, and that this effect was reversible. The basis of the assay to screen for potency of oligonucleotides targeting PKC-α is to initially lower PKC-α protein levels by chronic treatment with PDBu, remove PDBu by extensively washing the cells (hence allowing the cells to synthesize fresh PKC-α protein), and incubate the cells with oligonucleotides intended to inhibit the resynthesis of new PKC-α protein. Procedure: A549 cells (obtained from the American Type Culture Collection,

Bethesda MD) were grown to confluence in 6-well plates (Falcon Labware, Lincoln Park, NJ) in Dulbecco's modified Eagle's medium (DME) containing 1 g glucose/liter and 10% fetal calf serum (FCS, Irvine Scientific, Santa Ana, CA). Cells were treated with 500 nM PDBu (Sigma Chem. Co., St. Louis, MO) for 12-16 hours (overnight). Cells were then washed three times in DME at 37 °C. Example 3: Northern blot analysis of PKC mRNA levels after treatment of A549 cells with antisense oligonucleotides of reduced length

A549 cells were treated with phosphorothioate oligonucleotides at 200 nM for four hours in the presence of the cationic lipids DOTMA/DOPE, washed and allowed to recover for an additional 20 hours. Total RNA was extracted and 20μg of each was resolved on 1.2% gels and transferred to nylon membranes. These blots were probed with a ³²P radiolabeled PKC-α cDNA probe and then stripped and reprobed with a radiolabeled G3PDH probe to confirm equal RNA loading. Each oligonucleotide (3520, 3521 , 3522 and 3527) was used in duplicate. The two major PKC-α transcripts (8.5 kb and 4.0 kb) were examined and quantified with a Phosphorlmager (Molecular Dynamics, Sunnyvale CA).

A series of 15-mer oligonucleotides targeted to human PKC-α were designed using the cDNA sequence published by Finkenzeller et al., Nucl. Acids Res. 18:2183 (1990); Genbank accession number X52479; incoφorated herein as SEQ ID NO:48. These were designed as chimeric oligonucleotides of the type sometimes referred to in the art as "hemimers" or "wingmers," with the first 8 nucleotides at the 5' end being 2'-deoxynucleotides and the remaining 7 nucleotides being 2'-O-methoxyethyl. The intersugar linkages are phosphorothioates throughout and all 2'-O-methoxyethylcytidines have 5-methyl-cytosine bases (5-meC). These compounds are shown in Table 1. Nucleotides shown in bold are 2'-O- methoxyethyl. Activity is expressed as percent inhibition of PKC-α mRNA levels compared to control (no oligo). Nucleotide numbers in "Target site" column correspond to those of SEQ ID NO:48 (Genbank accession number x52479).

Table 1

15- -mers targeted to PKC-α:

ISIS # Sequence Target region Target site %Inhib'n SEO ID NO:

14095 ACCACCTCTTGCTCC 5' UTR 0001-0015 8 1

14096 TGAAGAAGCGCGCGA Coding 0146-0160 68 2

14097 TTGAACTTGTGCTTG Coding 0327-0341 56 3

14098 GCCCCCTCTTCTCAG Coding 0494-0508 2 4

14099 TTCATTCTTGGGATC Coding 0634-0648 0 5

14100 CATCCACTGGCCGGC Coding 0834-0848 16 6

14101 TGCCTGAGTTCCATG Coding 0921-0935 0 7

14102 CAGGATTTTGATTGC Coding 1123-1137 0 8

14103 TCCGATGGAAATCTC Coding 1363-1377 30 9

14104 ACTCCATCCATCATG Coding 1491-1505 0 10

14105 GCATGCTCTCTCACG Coding 1797-1811 33 11

14106 CGCTGGTGAGTTTCA Stop/3' UTR 2044-2058 19 12

14107 AGGATTCACTTCCAC 3' UTR 2096-2110 6 13

14108 CCGTGGCCTTAAAAT 3' UTR 2121-2135 22 14

14109 CCCTACAATTTTCAG 3' UTR 2161-2175 4 15

141 10 GAGACCCTGAACAGT 3' UTR 2197-2211 17 16

Oligonucleotides 14096 and 14097 (SEQ ID NO: 2 and 3) gave greater than 50% inhibition of PKC-α mRNA levels in this assay (at 200 nM dose) and are therefore preferred.

A second set of 15-mer oligonucleotides was synthesized to attempt to optimize the activity observed with ISIS 14096 (SEQ ID NO: 2). Oligonucleotides were targeted to the region of PKC-α mRNA immediately around the target region of ISIS 14096. These compounds were also designed as chimeric oligonucleotides with the first 8 nucleotides at the 5' end being 2'-deoxynucleotides and the remaining 7 nucleotides being 2'-O-methoxyethyl. The intersugar linkages are phosphorothioates throughout and all 2'-O-methoxyethylcytidines have 5-methyl-cytosine bases (5-meC). These compounds are shown in Table 2. Nucleotides shown in bold are 2'-O-methoxyethyl. Activity is expressed as percent inhibition of PKC-α mRNA levels compared to control (no oligo).

Table 2

Additional 15-mers targeted to ISIS 14096 target region

ISIS# Sequence % Inhibition SEO ID NO:

14863 GCGCGATGAATTT ΓGGAA 77 17

14864 AGCGCGCGATGAATT 79 18

14865 AGAAGCGCGCGATGA 71 19

14096 TGAAGAAGCGCGCGA 63 2

14868 GCTTGAAGAAGCGCG 61 20

14867 GCTGCTTGAAGAAGC 0 21 14866 TGGGCTGCTTGAAGA 36 22

Oligonucleotides 14864, 14865, 14096 and 14068 (SEQ ID NO: 18, 19, 2 and 20) gave greater than 50% inhibition of PKC-α mRNA levels in this assay (at 200 nM dose) and are therefore preferred. Of these, SEQ ID NO: 18 and 19 gave greater than 70% inhibition of PKC-α expression.

A third set of 15-mer oligonucleotides was synthesized to attempt to optimize the activity observed with ISIS 14097 (SEQ ID NO: 3). Oligonucleotides were targeted to the region of PKC-α mRNA immediately around the target region of ISIS 14097. These compounds were also designed as chimeric oligonucleotides with the first 8 nucleotides at the 5' end being 2'-deoxynucleotides and the remaining 7 nucleotides being 2'-O-methoxyethyl. The intersugar linkages are phosphorothioates throughout and all 2'-O-methoxyethylcytidines have 5-methyl-cytosine bases (5-meC). These compounds are shown in Table 3. Nucleotides shown in bold are 2'-O-methoxyethyl. Activity is expressed as percent inhibition of PKC-α mRNA levels compared to control (no oligo).

Table 3

Additional 15-mers targeted to ISIS 14097 target region

ISIS # Sequence % Infi bition 5 SEO ID NO: 14857 TGCTTGCTCCTGGGG 72 23

14858 TTGTGCTTGCTCCTG 34 24

14859 AACTTGTGCTTGCTC 73 25

14097 TTGAACTTGTGCTTG 59 3

14860 ATTTTGAACTTGTGC 53 26

14861 TGGATTTTGAACTTG 0 27

14862 GTGTGGATTTTGAAC 0 28

Oligonucleotides 14857, 14859, 14097 and 14860 (SEQ ID NO: 23, 25, 3 and 26) gave greater than 50% inhibition of PKC-α mRNA levels in this assay (at 200 nM dose) and are therefore preferred. Of these, SEQ ID NOs: 23 and 25 gave greater than 70% inhibition of PKC-α expression. ISIS 14864 (SEQ ID NO: 18) and ISIS 14859 (SEQ ID NO: 25) were compared to ISIS 3521 (5'-GTTCTCGCTGGTGAGTTTCA, SEQ ID NO: 29), the 20-mer phosphorothioate oligodeoxynucleotide which has previously been shown to inhibit PKC-α in vitro and in vivo and which is presently in human clinical trials. Dose response curves were generated for inhibition of PKC-α mRNA levels by these three compounds. IC₅₀s were calculated from this assay to be approximately 50 nM for ISIS 14859, 100 nM for ISIS 3521 and 110 nM for ISIS 14864. Thus, the 15-mers 14859 and 14864 are considered to have activity which is comparable to or better than ISIS 3251 for reduction of PKC-α mRNA levels, and are highly preferred. Example 4: U-87 human glioblastoma cell culture and subcutaneous xenografts into nude mice

ISIS 14864 (SEQ ID NO: 18) was compared to ISIS 3521 (SEQ ID NO: 29) and chimeric 2'-MOE oligonucleotides ISIS 12723 and ISIS 14193, both of which also have SEQ ID NO: 29. These compounds are shown in Table 4. Intersugar (backbone) linkages are shown for all compounds since these vary. All 2'-methoxyethyl cytidines are 5-methyl cytidines.

Table 4

Additional oligonucleotides targeted to human PKC-α bold= 2'-O-methoxyethyl; s= P=S linkage, o= P=O linkage ISIS # Sequence SEO ID NO:

3521 GsTsTsCsTsCsGsCsTsGsGsTsGsAsGsTsTsTsCsA 29

12723 GoToToCoToCsGsCsTsGsGsTsGsAsGoToToToCoA 29

14193 GsTsTsCsTsCsGsCsTsGsGsTsGsAsGsTsTsTsCsA 29

14864 AsGsCsGsCsGsCsGsAsTsGsAsAsTsT 18

The U-87 human glioblastoma cell line was obtained from the ATCC (Rockville

MD) and maintained in Iscove's DMEM medium supplemented with heat-inactivated 10% fetal calf serum. Nude mice received 1 mm fragments of U-87 tumor by trocar. Three weeks after implantation, or when tumors reached 100 mm³, oligonucleotide treatment was begun. Mice were injected intraperitoneally with ISIS 3521, ISIS 12723, ISIS 14193 or ISIS 14864, at a dosage of 2 mg/kg, daily for 28 consecutive days or until tumor burden required sacrificing the animals (10% of body weight). Tumor volumes were measured on days 2, 8, 13, 18 and 23. On day 23, ISIS 3521 had reduced tumor volume by 39% compared to saline control. ISIS 12723 had reduced tumor volume by 45%; this compound is therefore preferred. ISIS 14193 and ISIS 14864 had reduced tumor volume by 95% and 96%, respectively, both compared to saline control. These two compounds are therefore highly preferred. By day 28, the number of mice alive in each group were: saline control, 0/8; ISIS 3521, 2/8; ISIS 12723, 1/7; ISIS 14193, 5/7 and ISIS 14864, 5/7. The number of sites that were tumor-free were: ISIS 3521, 0/16; ISIS 12723, 1/14; ISIS 14193, 3/14 and ISIS 14864, 5/14. Tumor growth rates after oligonucleotide treatment were also measured. Compared to saline controls, tumor growthrates (mnvVday) were reduced by 30% by ISIS 3521, 39% by ISIS 12723, 76% by ISIS 14193 and 82% by ISIS 14864. Thus ISIS 14193 (SEQ ID NO: 29) and ISIS 14864 (SEQ ID NO: 18) are highly preferred embodiments of the present invention.

Example 5: Shortened oligonucleotides targeted to the ISIS 3521 target region

ISIS 3521 (5'-GTTCTCGCTGGTGAGTTTCA, SEQ ID NO: 29) is a 20-mer targeted to the stop codon and 3' untranslated region (nucleotides 2044-2063 of SEQ ID NO: 48; Genbank accession number x52479) of human PKC-α which has been shown to reduce PKC-α expression in vitro and in vivo. Dean et al. (1994) J. Biol. Chem.269:16416, McGraw et al. (1997) Anti-Cancer Drug Design (1997) 12:315-326. We subsequently deleted one nucleotide from the 3' end of this sequence and either one or two nucleotides from the 5' end. The resulting compounds are shown in Table 5. In some cases these are chimeras of the "gapmer" type with a deoxy gap and 2'-O-propyl wings.

Table 5

Chimeric 2'-O-propyl/deoxy P=S oligonucleotides targeted to PKC-α 3'-UTR bold= 2'-O-propyl; s= P=S linkage, o= P=O linkage

OLIGO # SEQUENCE SEO ID NO:

6632 TsTsCs TsCsGs CsTsGs GsTsGs AsGsTs TsTsC 31

6653 TsTsCs TsCsGs CsTsGs GsTsGs AsGsTs TsTsC 31

6665 ToToCo TsCsGs CsTsGs GsTsGs AsGsTo ToToC 31 7082 TsCsTs CsGsCs TsGsGs TsGsAs GsTsTs TsC 32

7083 TsCsTs CsGsCs TsGsGs TsGsAs GsTsTs TsC 32

7084 ToCoTo CsGsCs TsGsGs TsGsAs GsToTo ToC 32

Oligonucleotides 6632 and 6653 reduced PKC-α mRNA levels by approximately 90% and oligonucleotides 7082 and 7083 reduced PKC-α mRNA levels by 65-70%.

Example 6: Oligonucleotide 15-mers targeted to the ISIS 3521 and 3527 target regions

ISIS 3521 (5'-GTTCTCGCTGGTGAGTTTCA, SEQ ID NO: 29) and ISIS 3527 (GAGACCCTGAACAGTTGATC; SEQ ID NO: 30) are 20-mers targeted to the 3' untranslated region of human PKC-α. ISIS 3521 is targeted to nucleotides 2044-2063 of SEQ ID NO: 48 (Genbank accession number x52479), overlapping the stop codon. ISIS 3527 is targeted to nucleotides 2192-2211 of SEQ ID NO: 48. Both have been shown to reduce PKC- α expression. Dean et al. (1994) J. Biol. Chem.269: 16416, McGraw et al. (1997) Anti-Cancer Drug Design (1997) 12:315-326. A series of 15mer oligonucleotides were designed to target the ISIS 3521 and the ISIS 3527 target sites. These are shown in Tables 6 and 7. The ISIS 3521 and 3527 sequences, respectively, are shown to aid in comparing target sequence locations. These compounds were chimeric oligonucleotides with the first 8 nucleotides at the 5' end being 2'-deoxynucleotides and the remaining 7 nucleotides being 2'-O-methoxyethyl. The intersugar linkages are phosphorothioates throughout and all 2'-O-methoxyethylcytidines have 5-methyl-cytosine bases (5-meC). Nucleotides shown in bold are 2'-O-methoxyethyls. Activity is expressed as percent inhibition of PKC-α mRNA levels compared to control (no oligo). Oligonucleotide concentration was 200 nM.

Table 6 Inhibition of PKC-α mRNA levels by 15mer oligonucleotides targeted to the ISIS 3521 target region

ISIS # Sequence % Inhibition SEO ID NO:

3521 GTTCTCGCTGGTGAGTTTCA 29

14881 GAGTTTCATACTGCA 12 33 14880 GTGAGTTTCATACTG 12 34

14879 TGGTGAGTTTCATAC 10 35

14878 GCTGGTGAGTTTCAT 20 36

14106 CGCTGGTGAGTTTCA 38 37

14877 TCGCTGGTGAGTTTC 19 38 14876 TCTCGCTGGTGAGTT 31 39

14875 GTTCTCGCTGGTGAG 71 40

ISIS 14875 gave over 70%> inhibition of PKC-α expression in this experiment and is therefore preferred. Table 7

Inhibition of PKC-α mRNA levels by 15mer oligonucleotides targeted to the ISIS 3527 target region

ISIS # Sequence % Inhibition SEO ID NO: 3527 GAGACCCTGAACAGTTGATC 30

14110 GAGACCCTGAACAGT 23 41

14869 GACCCTGAACAGTTG 23 42

14870 CCCTGAACAGTTGAT 24 43

14871 CTGAACAGTTGATCA 28 44 14872 GAACAGTTGATCACA 3 45

14873 ACAGTTGATCACATT 25 46

14874 AGTTGATCACATTTG 10 47 When taken together, these examples demonstrate that, suφrisingly, oligonucleotides of reduced length can retain excellent activity for inhibition of PKC expression. Oligonucleotides which demonstrate the ability to reduce PKC expression include ISIS 14096 and 14097 (SEQ ID NO: 2 and 3), 14864, 14865 and 14068 (SEQ ID NO: 18, 19 and 20), 14857, 14859, 14097 and 14860 (SEQ ID NO: 23, 25, 3 and 26) and 14875 (SEQ ID NO: 40). Of these, SEQ ID NO: 18, 19, 23, 25 and 40 gave greater than 70% inhibition of PKC expression.

Example 7: Additional oligonucleotides targeted to human PKC-α

Additional oligonucleotides targeted to the ISIS 3527 region have also been synthesized. The sequences of these compounds, which were made as phosphorothioate ohgodeoxynucleotides, are shown in Table 8. Additional short oligonucleotides targeted to other regions of the human PKC-α mRNA are also shown in Table 8. These were also synthesized as phosphorothioate ohgodeoxynucleotides. The target site of each oligonucleotide on the human PKC-α mRNA target (Finkenzeller et al, Genbank locus HSPKCA1, accession number X52479)is indicated by the nucleotide number of the 5' most nucleotide on GenBank listing HSPKCA1, accession number X52479, to which the oligonucleotide hybridizes. Table 8

Additional oligonucleotides targeted to human PKC-α ISIS # Sequence Length Target site SEO IDNO:

3527 GAGACCCTGAACAGTTGATTCC 2200 22119922 3300

4921 AGACCCTGAACA 1122 22119999 4499

4922 AGAGACCCTGAACAG 15 2198 50

4936 CCCTGAACAGTTGATC 16 2192 51

4937 AAGAGAGAGACCCTGA 16 2202 52

4995 GAGAGACCCTGAACAGTT 18 2196 53

4997 CTGAACAGTTGATC 14 2192 54

5030 AAGAGAGAGACCCTGAAC 18 2200 55

5031 AAGAGAGAGACCCT 14 2204 56

5032 GAGAGAGACCCTGAACAG 18 2198 57

5046 GAGACCCTGAACAGTTGA 18 2194 58

5047 GAGAGACCCTGAACAG 16 2198 59

5048 GAGACCCTGAACAG 14 2198 60

5061 AGAGACCCTGAACAGT 16 2197 61

5062 GAGACCCTGAACAGTT 16 2196 62

6439 GGGAGGGCTGGG 12 2080 63

6554 GCGGGGAGGGCT 12 2083 64

6512 GCCGTGGCCTTA 1122 22112255 65

6513 GCCGTGGCCTTAA 1133 22112244 66 6438 TTTGTTCTCGCTGG 1144 22005533 67

6437 CTTCCACTGCGGGG 1144 2008»9y 6 o8o 6514 TCAGACACAAGCCG 1144 22113333 69

Claims

What is claimed is:

1. An antisense oligonucleotide 5 to 50 nucleotides in length which is targeted to a nucleic acid encoding a human protein kinase C and which is capable of modulating expression of the human protein kinase C.

2. The oligonucleotide of claim 1 specifically hybridizable with a 5' untranslated region, coding region, stop codon region or 3' untranslated region of the nucleic acid encoding protein kinase C.

3. The antisense oligonucleotide of claim 1 which is targeted to human protein kinase C-α.

4. The antisense oligonucleotide of claim 3 which is from about 12 to about 20 nucleotides in length.

5. The antisense oligonucleotide ofclaim 4 comprising SEQ ID NO: 2, 3, 18, 19, 20, 23, 25, 26, 31, 32 or 40.

6. The antisense oligonucleotide of claim 4 which is from about 12 to about 15 nucleotides in length.

7. The antisense oligonucleotide ofclaim 6 comprising SEQ ID NO: 2, 3, 18, 19, 20, 23, 25, 26 or 40.

8. The oligonucleotide ofclaim 1 wherein at least one of the nucleotides contains a modification on the 2' position of the sugar.

9. The antisense oligonucleotide ofclaim 1 which is a chimeric oligonucleotide.

10. An antisense oligonucleotide consisting of SEQ ID NO: 18.

11. The antisense oligonucleotide of claim 10 wherein each intersugar linkage is a phosphorothioate linkage and wherein the first eight nucleotides at the 5' end of the oligonucleotide are 2'-deoxynucleotides and the remaining seven nucleotides are 2'-O- CH₂CH₂OCH₃ nucleotides, and wherein each 2'-O-CH₂CH₂OCH₃ cytidine nucleotide is a 5- methyl cytidine.

12. An antisense oligonucleotide consisting of SEQ ID NO: 25.

13. The antisense oligonucleotide of claim 12 wherein each intersugar linkage is a phosphorothioate linkage and wherein the first eight nucleotides at the 5' end of the oligonucleotide are 2'-deoxynucleotides and the remaining seven nucleotides are 2'-O- CH₂CH₂OCH₃ nucleotides, and wherein each 2'-O-CH₂CH₂OCH₃ cytidine nucleotide is a 5- methyl cytidine.

14. A pharmaceutical composition comprising a therapeutically effective amount of the oligonucleotide of claim 1.

15. A pharmaceutical composition comprising a therapeutically effective amount of the oligonucleotide ofclaim 10.

16. A pharmaceutical composition comprising a therapeutically effective amount of the oligonucleotide ofclaim 12.

17. A method of inhibiting human protein kinase C expression in cells comprising contacting the cells with the oligonucleotide of claim 1.

18. A method of inhibiting human protein kinase C expression in cells comprising contacting the cells with the oligonucleotide ofclaim 10.

19. A method of inhibiting human protein kinase C expression in cells comprising contacting the cells with the oligonucleotide ofclaim 12.

20. The method ofclaim 17 wherein the cells are cancer cells.

21. The method of claim 18 wherein the cells are cancer cells.

22. The method ofclaim 19 wherein the cells are cancer cells.

23. A method of treating a condition associated with expression of protein kinase C comprising administering to a human, or cells, tissues, or a bodily fluid thereof, a therapeutically effective amount of the oligonucleotide of claim 1.

24. A method of treating a condition associated with expression of protein kinase C comprising administering to a human, or cells, tissues, or a bodily fluid thereof, a therapeutically effective amount of the oligonucleotide of claim 10.

25. A method of treating a condition associated with expression of protein kinase C comprising administering to a human, or cells, tissues, or a bodily fluid thereof, a therapeutically effective amount of the oligonucleotide of claim 12.

26. The method of claim 23 wherein said condition is an inflammatory or hypeφroliferative disorder.

27. The method of claim 24 wherein said condition is an inflammatory or hypeφroliferative disorder.

28. The method of claim 25 wherein said condition is an inflammatory or hypeφroliferative disorder.

29. The method of claim 26 wherein the condition is cancer or psoriasis.

30. The method of claim 27 wherein the condition is cancer or psoriasis.

1. The method of claim 28 wherein the condition is cancer or psoriasis.