WO1999051744A2 - A interleukin-1 receptor antagonist and uses thereof - Google Patents
A interleukin-1 receptor antagonist and uses thereof Download PDFInfo
- Publication number
- WO1999051744A2 WO1999051744A2 PCT/US1999/004291 US9904291W WO9951744A2 WO 1999051744 A2 WO1999051744 A2 WO 1999051744A2 US 9904291 W US9904291 W US 9904291W WO 9951744 A2 WO9951744 A2 WO 9951744A2
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- polypeptide
- protein
- seq
- polynucleotide
- sequence
- Prior art date
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/52—Cytokines; Lymphokines; Interferons
- C07K14/54—Interleukins [IL]
- C07K14/545—IL-1
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K38/00—Medicinal preparations containing peptides
Definitions
- the present invention provides novel polynucleotides and proteins encoded by such polynucleotides, along with therapeutic, diagnostic and research utilities for these polynucleotides and proteins.
- the cytokine Interleukin-l is a key mediator in the inflammatory response (for reviews, see Dinarello (1991) Blood 77: 1627-1652; Dinarello et al. (1993) New England J. Med. 328:106-113; Dinarello (1994) FASEB J. 8:1314-1325).
- the importance of Interleukin-l in inflammation has been demonstrated by the ability of the highly specific Interleukin-l receptor antagonist protein to relieve inflammatory conditions (for review, see Dinarello (1991) Blood 77: 1627-1652; Dinarello et al. (1993) New England J. Med. 328:106-113; Dinarello (1994) FASEB J. 8:1314-1325; Dinarello (1993) Immunol.
- compositions of the present invention include novel isolated polypeptides, in particular, novel Interleukin-l Receptor Antagonist proteins, isolated polynucleotides encoding such polypeptides, including recombinant DNA molecules, cloned genes or degenerate variants thereof, especially naturally occurring variants such as allelic variants, and antibodies that specifically recognize one or more epitopes present on such polypeptides.
- the isolated polynucleotides of the invention further include, but are not limited to a polynucleotide comprising the nucleotide sequence of the genomic clone SEQ ID NOS: 7 or 8; a polynucleotide assembled from one or more of the exons of SEQ ID NOS: 7 or 8; a polynucleotide assembled from one or more of the introns of SEQ ID NOS: 7 or 8; a polynucleotide assembled from one or more of the exons of SEQ ID NOS: 7 or 8 and one or more of the introns of SEQ ID NOS: 7 or 8; a polynucleotide comprising the full length protein coding sequence of SEQ ID NOS: 7 or 8; a polynucleotide comprising the nucleotide sequence of the mature protein coding sequence of SEQ ID NOS: 7 or 8; or a polynucleotide.
- polypeptides of the present invention further include, but are not limited to, a polypeptide comprising the amino acid sequence encoded by the cDNA insert of clone pIL- lHy273 deposited with the American Type Culture Collection (ATCC; 10801 University Boulevard., Manassas, Virginia, 20110-2209, U.S.A.); a full length protein of SEQ ID NO: 3 or 5 assembled from the amino acid sequence encoded by the cDNA insert of clone pIL-lHy273; or, a mature protein coding sequence of SEQ ID NO: 3 or 5 assembled from the amino acid sequence encoded by cDNA insert of clone pIL- 1 Hy273.
- ATCC American Type Culture Collection
- 10801 University Boulevard., Manassas, Virginia, 20110-2209, U.S.A. a full length protein of SEQ ID NO: 3 or 5 assembled from the amino acid sequence encoded by the cDNA insert of clone pIL-lH
- Protein compositions of the present invention may further comprise an acceptable carrier, such as a hydrophilic, e ⁇ , pharmaceutically acceptable, carrier.
- an acceptable carrier such as a hydrophilic, e ⁇ , pharmaceutically acceptable, carrier.
- polypeptides and polynucleotides of the invention can be utilized, for example, as part of methods for the prevention and/or treatment of disorders involving sepsis, acute pancreatitis, endotoxic shock, cytokine induced shock, rheumatoid arthritis, chronic inflamatory arthitis, pancreatic cell damage from diabetes mellitus type 1, graft versus host disease, inflamatory bowel disease, inflamation associated with pulmonary disease, other autoimmune disease or inflamatory disease, an antiproliferative agent such as for acute or chronic mylegenous leukemia or in the prevention of premature labor secondary to intrauterine infections.
- the methods of the present invention further relate to methods for detecting the presence of the polynucleotides or polypeptides of the invention in a sample. Such methods can, for example, be utilized as part of prognostic and diagnostic evaluation of disorders as recited above and for the identification of subjects exhibiting a predisposition to such conditions. Furthermore, the invention provides methods for evaluating the efficacy of drugs, and monitoring the progress of patients, involved in clinical trials for the treatment of disorders as recited above. The invention also provides methods for the identification of compounds that modulate the expression of the polynucleotides and/or polypeptides of the invention. Such methods can be utilized, for example, for the identification of compounds that can ameliorate symptoms of disorders as recited above. Such methods can include, but are not limited to, assays for identifying compounds and other substances that interact with (e.g., bind to) the polypeptides of the invention.
- the methods of the invention also include methods for the treatment of disorders as recited above which may involve the administration of such compounds to individuals exhibiting symptoms or tendencies related to disorders as recited above.
- the invention encompasses methods for treating diseases or disorders as recited above by administering compounds and other substances that modulate the overall activity of the target gene products. Compounds and other substances can effect such modulation either on the level of target gene expression or target protein activity.
- FIG. 1 shows the sequence alignment of SEQ ID NO. 3 with human (SEQ ID NO. 8), mouse (SEQ ID NO. 9), rat (SEQ ID NO. 10) and rabbit Interleukin-l receptor antagonist (SEQ ID NO. 11).
- FIG. 3 shows the amino acid sequences which correspond to nucleotides 1 through 240 of SEQ ID NO. 2. These sequences are designated as SEQ ID NO. 3.
- FIG. 4 shows the sequence alignment of receptor binding regions of human Interleukin- 1 beta (SEQ ID NO. 12) and human Interleukin-l receptor antagonist (SEQ ID NO. 13)aligned with a cognate region of SEQ ID NO.3 (amino acids 13 through 30 of SEQ ID NO.3). Residues conserved among all three domains are shown in boldface.
- FIG. 8 shows SEQ ID NO. 6 which represents an extension (the underlined sequence) of the nucleic acid sequence corresponding to SEQ ID NO. 4 and is described in Example 7.
- FIGS 9 9A-C show the genomic sequence corresponding to SEQ ID Nos. 1, 2, and 4 6.
- the isolation of the genomic clone (SEQ ID NO: 7 ) from which this sequence was derived is described in Example 8.
- Ambiguous positions are designated as follows: R indicates A or G; M indicates A or C; W indicates A or T; Y indicates C or T; S indicates C or G; K indicates G or T; V indicates A or C or G; H indicates A or C or T; D indicates A or G or T; B indicates C or G or T; and N indicates any of the four bases.
- FIGS 10A-C show a genomic clone (SEQ ID NO: 8) which is a ⁇ extension of the genomic sequence presented in Figure 9A-C (SEQ ID NO: 7).
- SEQ ID NO: S includes the the . extended sequence shown in SEQ ID NO: 6 for the Interleukin-l Receptor Antagonist extensionclothnted in SEQ ID NO: 6.
- the isolation of this genomic clone (SEQ ID NO:7 ) from which this sequence was derived is described in Example 11.
- R indicates A or G
- M indicates A oi C
- W indicates A or T
- Y indicates C or T
- S indicates C or G
- K indicates G 0 or T
- V indicates A or C or G
- H indicates A or C or T
- D indicates A or G 01 T
- B indicates C or G or T
- N indicates any of the four bases.
- nucleotide sequence refers to a heteropolymer of nucleotides or the sequence of these nucleotides.
- nucleic acid and “polynucleotide” are also used interchangeably herein to refer to a heteropolymer of nucleotides.
- oligonucleotide fragment or a “polynucleotide fragment”, “portion,” or “segment” is a stretch of polypeptide nucleotide residues which is long enough to use in 5 polymerase chain reaction (PCR) or various hybridization procedures to identify or amplify identical or related parts of mRNA or DNA molecules.
- PCR polymerase chain reaction
- oligonucleotides or "nucleic acid probes” are prepared based on the polynucleotide sequences provided in the present invention. Oligonucleotides comprise portions of such a polynucleotide sequence having at least about 15 nucleotides and usually at least about 20 nucleotides. Nucleic acid probes comprise portions of such a polynucleotide sequence having fewer nucleotides than about 6 kb, usually fewer than about 1 kb. After appropriate testing to eliminate false positives, these probes may, for example, be used to determine whether specific mRNA molecules are present in a cell or tissue or to isolate similar nucleic acid sequences from chromosomal DNA as described by Walsh et al. (Walsh, P.S. et al., 1992, PCR Methods Appl 1:241-250).
- probes includes naturally occurring or recombinant or chemically synthesized single- or double-stranded nucleic acids. They may be labeled by nick translation, Klenow fill-in reaction, PCR or other methods well known in the art. Probes of the present invention, their preparation and/or labeling are elaborated in Sambrook, J. et al., 1989, Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory, NY; or Ausubel, F.M. et al., 1989, Current Protocols in Molecular Biology, John Wiley & Sons, New York NY, both of which are incorporated herein by reference in their entirety.
- additional exemplary stringent hybridization conditions include washing in 6xSSC/0.05% sodium pyrophosphate at 37°C (for 14-base oligos), 48°C (for 17-base oligos), 55°C (for 20-base oligos), and 60°C (for 23-base oligos).
- Polypeptides or proteins expressed in most bacterial cultures e.g., E coli, will be free of glycosylation modifications; polypeptides or proteins expressed in yeast will have a glycosylation pattern in general different from those expressed in mammalian cells.
- recombinant protein when expressed without a leader or transport sequence, it may include an N-terminal methionine residue. This residue may or may not be subsequently cleaved from the expressed recombinant protein to provide a final product.
- recombinant expression system means host cells which have stably integrated a recombinant transcriptional unit into chromosomal DNA or carry the recombinant transcriptional unit extrachromosomally.
- Recombinant expression systems as defined herein will express heterologous polypeptides or proteins upon induction of the regulatory elements linked to the DNA segment or synthetic gene to be expressed.
- This term also means host cells which have stably integrated a recombinant genetic element or elements having a regulatory role in gene expression, for example, promoters or enhancers.
- Recombinant expression systems as defined herein will express polypeptides or proteins endogenous to the cell upon induction of the regulatory elements linked to the endogenous DNA segment or gene to be expressed.
- the cells can be prokaryotic or eukaryotic.
- ORF open reading frame
- EMF expression modulating fragment
- EMFs include, but are not limited to, promoters, and promoter modulating sequences (inducible elements).
- One class of EMFs are fragments which induce the expression or an operably linked ORF in response to a specific regulatory factor or physiological event.
- an "uptake modulating fragment,” UMF means a series of nucleotides which mediate the uptake of a linked DNA fragment into a cell.
- UMFs can be readily identified using known UMFs as a target sequence or target motif with the computer- based systems described below.
- UMF The presence and activity of a UMF can be confirmed by attaching the suspected UMF to a marker sequence.
- the resulting nucleic acid molecule is then incubated with an appropriate host under appropriate conditions and the uptake of the marker sequence is determined.
- a UMF will increase the frequency of uptake of a linked marker sequence.
- active refers to those forms of the polypeptide which retain the biologic and/or immunologic activities of any naturally occurring polypeptide.
- naturally occurring polypeptide refers to polypeptides produced by cells that have not been genetically engineered and specifically contemplates various polypeptides arising from post-translational modifications of the polypeptide including, but not limited to, acetylation, carboxylation, glycosylation, phosphorylation, lipidation and acylation.
- derivative refers to polypeptides chemically modified by such techniques as ubiquitination, labeling (e.g., with radionuclides or various enzymes), pegylation
- recombinant variant refers to any polypeptide differing from naturally occurring polypeptides by amino acid insertions, deletions, and substitutions, created using recombinant DNA techniques.
- Guidance in determining which amino acid residues may be replaced, added or deleted without abolishing activities of interest, such as cellular trafficking, may be found by comparing the sequence of the particular polypeptide with that of homologous peptides and minimizing the number of amino acid sequence changes made in regions of high homology.
- amino acid "substitutions” are the result of replacing one amino acid with another amino acid having similar structural and/or chemical properties, i.e., conservative amino acid replacements.
- Nonpolar (hydrophobic) amino acids include alanine, leucine, isoleucine, valine, proline, phenylalanine, tryptophan, and methionine
- polar neutral amino acids include glycine, serine, threonine, cysteine, tyrosine, asparagine, and glutamine
- positively charged (basic) amino acids include arginine, lysine, and histidine
- negatively charged (acidic) amino acids include aspartic acid and glutamic acid.
- “Insertions” or “deletions” are typically in the range of about 1 to 5 amino acids. The variation allowed may be experimentally determined by systematically making insertions, deletions, or substitutions of amino acids in a polypeptide molecule using recombinant DNA techniques and assaying the resulting recombinant variants for activity.
- insertions, deletions or non- conservative alterations can be engineered to produce altered polypeptides.
- Such alterations can, for example, alter one or more of the biological functions or biochemical characteristics of the polypeptides of the invention.
- such alterations may change polypeptide characteristics such as ligand-binding affinities, interchain affinities, or degradation/turnover rate.
- such alterations can be selected so as to generate polypeptides that are better suited for expression, scale up and the like in the host cells chosen for expression.
- cysteine residues can be deleted or substituted with another amino acid residue in order to eliminate disulfide bridges.
- substantially equivalent can refer both to nucleotide and amino acid sequences, for example a mutant sequence, that varies from a reference sequence by one or more substitutions, deletions, or additions, the net effect of which does not result in an adverse functional dissimilarity between the reference and subject sequences.
- a substantially equivalent sequence varies from one of those listed herein by no more than about 20% (Le., the number of individual residue substitutions, additions, and/or deletions in a substantially equivalent sequence, as compared to the corresponding reference sequence, divided by the total number of residues in the substantially equivalent sequence is about 0.2 or less).
- Such a sequence is said to have 80% sequence identity to the listed sequence.
- a substantially equivalent e.g..
- mutant, sequence of the invention varies from a listed sequence by no more than 10% (90% sequence identity); in a variation of this embodiment, by no more than 5% (95% sequence identity); and in a further variation of this embodiment, by no more than 2% (98% sequence identity).
- Substantially equivalent, e.g.. mutant, amino acid sequences according to the invention generally have at least 95% sequence identity with a listed amino acid sequence, whereas substantially equivalent nucleotide sequence of the invention can have lower percent sequence identities, taking into account, for example, the redundancy or degeneracy of the genetic code.
- sequences having substantially equivalent biological activity and substantially equivalent expression characteristics are considered substantially equivalent.
- nucleic acid sequences encoding such substantially equivalent sequences can routinely be isolated and identified via standard hybridization procedures well known to those of skill in the art.
- an expression vector may be designed to contain a "signal or leader sequence" which will direct the polypeptide through the membrane of a cell.
- a signal or leader sequence may be naturally present on the polypeptides of the present invention or provided from heterologous protein sources by recombinant DNA techniques.
- a polypeptide "fragment,” “portion,” or “segment” is a stretch of amino acid residues of at least about 5 amino acids, often at least about 7 amino acids, typically at least about 9 to 13 amino acids, and, in various embodiments, at least about 17 or more amino acids. To be active, any polypeptide must have sufficient length to display biologic and/or immunologic activity.
- purified denotes that the indicated nucleic acid or polypeptide is present in the substantial absence of other biological macromolecules, e.g. , polynucleotides, proteins, and the like.
- the polynucleotide or polypeptide is purified such that it constitutes at least 95% by weight, more preferably at least 99.8% by weight, of the indicated biological macromolecules present (but water, buffers, and other small molecules, especially molecules having a molecular weight of less than 1000 daltons, can be present).
- intermediate fragment means a nucleic acid between 5 and 1000 bases in length, and preferably between 10 and 40 bp in length.
- secreted includes a protein that is transported across or through a membrane, including transport as a result of signal sequences in its amino acid sequence when it is expressed in a suitable host cell.
- Stecreted proteins include without limitation proteins secreted wholly (e.g., soluble proteins) or partially (e.g., receptors) from the cell in which they are expressed.
- “Secreted” proteins also include without limitation proteins which are transported across the membrane of the endoplasmic reticulum.
- Stecreted” proteins are also intended to include proteins containing non-typical signal sequences (e.g.
- fragments may be fused to carrier molecules such as immunoglobulins for many purposes, including increasing the valency of protein binding sites.
- fragments of the protein may be fused through "linker" sequences to the Fc portion of an immunoglobulin.
- linker For a bivalent form of the protein, such a fusion could be to the Fc portion of an IgG molecule.
- Other immunoglobulin isotypes may also be used to generate such fusions.
- a protein- IgM fusion would generate a decavalent form of the protein of the invention.
- the present invention also provides genes corresponding to the cDNA sequences disclosed herein.
- the corresponding genes can be isolated in accordance with known methods using the sequence information disclosed herein. Such methods include the preparation of probes or primers from the disclosed sequence information for identification and/or amplification of genes in appropriate genomic libraries or other sources of genomic materials.
- Species homologs of the disclosed polynucleotides and proteins are also provided by the present invention. Species homologs may be isolated and identified by making suitable probes or primers from the sequences provided herein and screening a suitable nucleic acid source from the desired species.
- the invention also encompasses allelic variants of the disclosed polynucleotides or proteins; that is, naturally-occurring alternative forms of the isolated polynucleotide which also encode proteins which are identical, homologous or related to that encoded by the polynucleotides.
- compositions of the present invention include isolated polynucleotides. including recombinant DNA molecules, cloned genes or degenerate variants thereof, especially naturally occurring variants such as allelic variants, novel isolated polypeptides, and antibodies that specifically recognize one or more epitopes present on such polypeptides.
- Species homologs of the disclosed polynucleotides and proteins are also provided by the present invention, Species homologs may be isolated and identified by making suitable probes or primers from the sequences provided herein and screening a suitable nucleic acid source from the desired species.
- the invention also encompasses allelic variants of the disclosed polynucleotides or proteins; that is, naturally- occurring alternative forms of the isolated polvnucleotide which also encode proteins which are identical, homologous or related to that encoded by the polynucleotides. 6.2 NUCLEIC ACIDS OF THE INVENTION
- the isolated polynucleotides of the invention include, but are not limited to, a polynucleotide encoding a polypeptide comprising the amino acid sequence of SEQ ID NOS: 3 or 5.
- the isolated polynucleotides of the invention further include, but are not limited to a polynucleotide comprising the nucleotide sequence of SEQ ID NOS: 1, 2, 4, or 6; a polynucleotide comprising the full length protein coding sequence of SEQ ID NOS: 1, 2, 4, or 6, and; a polynucleotide comprising the nucleotide sequence of the mature protein coding sequence of SEQ ID NOS : 1 , 2, 4, or 6.
- the polynucleotides of the present invention also include, but are not limited to, a polynucleotide that hybridizes to the complement of the nucleotide sequence of SEQ ID NOS: 1, 2, 4, or 6 under stringent hybridization conditions; a polynucleotide which is an allelic variant of any polynucleotide recited above; a polynucleotide which encodes a species homologue of any of the proteins recited above; or a polynucleotide that encodes a polypeptide comprising a specific domain or truncation of the polypeptide of SEQ ID NOS: 1, 2, 4, or 6.
- the isolated polynucleotides of the invention further include, but are not limited to a polynucleotide comprising the nucleotide sequence of the genomic clone SEQ ID NOS: 7 or 8; a polynucleotide assembled from one or more of the exons of SEQ ID NOS: 7 or 8 (e.g., alternative splicing) ; a polynucleotide assembled from one or more of the introns of SEQ ID NOS: 7 or 8; a polynucleotide assembled from one or more of the exons of SEQ ID NOS: 7 or 8 and one or more of the introns of SEQ ID NOS: 7 or 8; a polynucleotide comprising the full length protein coding sequence of SEQ ID NOS: 7 or 8; a polynucleotide comprising the nucleotide sequence of the mature protein coding sequence of SEQ ID NOS: 7 or 8.
- the polynucleotides of the present invention also include, but are not limited to, a polynucleotide that hybridizes to the complement of the nucleotide sequence of SEQ ID NOS: 7 or 8 under stringent hybridization conditions; a polynucleotide that hybridizes to the complement of any one of the introns or exons of SEQ ID NOS: 7 or 8 under stringent hybridization conditions; a polynucleotide which is an allelic variant of any polynucleotide recited above; a polynucleotide which encodes a species homologue of any of the proteins recited above; or a polynucleotide that encodes a polypeptide comprising a specific domain or truncation of the polypeptide of SEQ ID NOS: 7 or 8.
- the polynucleotides of the present invention still further include, but are not limited to, a polynucleotide comprising the nucleotide sequence of the cDNA insert of clone pIL-lHy deposited with the American Type Culture Collection (ATCC; 10801 University Boulevard., Manassas, Virginia, 20110-2209, U.S.A.); a polynucleotide comprising a nucleotide sequence encoding the amino acid sequence of SEQ ID NO: 3 or 5 which polynucleotide is assembled from the cDNA insert of clone pIL-lHy273; a polynucleotide comprising the full length protein coding sequence of SEQ ID NO: 3 or 5 which polynucleotide is assembled from the cDNA insert of clone pIL-lHy273;or, a polynucleotide comprising the nucleotide sequence of the mature protein coding sequence of SEQ ID NO
- the polynucleotides of the invention additionally include the complement of any of the polynucleotides recited above.
- the polynucleotides of the invention also provide polynucleotides including nucleotide sequences that are substantially equivalent to the polynucleotides recited above.
- Polynucleotides according to the invention can have at least about 80%, more typically at least about 90%, and even more typically at least about 95%, sequence identity to a polynucleotide recited above.
- the invention also provides the complement of the polynucleotides including a nucleotide sequence that has at least about 80%, more typically at least about 90%, and even more typically at least about 95%, sequence identity to a polynucleotide encoding a polypeptide recited above.
- the polynucleotide can be DNA (genomic, cDNA, amplified, or synthetic) or RNA. Methods and algorithms for obtaining such polynucleotides are well known to those of skill in the art and can include, for example, methods for determining hybridization conditions which can routinely isolate polynucleotides of the desired sequence identities.
- a polynucleotide according to the invention can be joined to any of a variety of other nucleotide sequences by well-established recombinant DNA techniques (see Sambrook J et al. (1989) Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory, NY).
- Useful nucleotide sequences for joining to polypeptides include an assortment of vectors, e.g., plasmids, cosmids, lambda phage derivatives, phagemids, and the like, that are well known in the art. Accordingly, the invention also provides a vector including a polynucleotide of the invention and a host cell containing the polynucleotide.
- the vector contains an origin of replication functional in at least one organism, convenient restriction endonuclease sites, and a selectable marker for the host cell.
- Vectors according to the invention include expression vectors, replication vectors, probe generation vectors, and sequencing vectors.
- a host cell according to the invention can be a prokaryotic or eukaryotic cell and can be a unicellular organism or part of a multicellular organism. The sequences falling within the scope of the present invention are not limited to the specific sequences herein described, but also include allelic variations thereof.
- Allelic variations can be routinely determined by comparing the sequence provided in SEQ ID NOS: 1, 2, 4, 6, or 7, a representative fragment thereof, or a nucleotide sequence at least 99.9% identical to SEQ ID NOS: 1, 2, 4, 6, or 7, with a sequence from another isolate of the same species.
- the invention includes nucleic acid molecules coding for the same amino acid sequences as do the specific ORFs disclosed herein. In other words, in the coding region of an ORF, substitution of one codon for another which encodes the same amino acid is expressly contemplated. Any specific sequence disclosed herein can be readily screened for errors by resequencing a particular fragment, such as an ORF, in both directions (i.e., sequence both strands).
- the present invention further provides recombinant constructs comprising a nucleic acid having the sequence of SEQ ID NOS: 1, 2, 4, 6, or 7, or a fragment thereof.
- the recombinant constructs of the present invention comprise a vector, such as a plasmid or viral vector, into which a nucleic acid having the sequence of SEQ ID NOS: 1, 2, 4, 6, or 7 or 8or a fragment thereof is inserted, in a forward or reverse orientation.
- the vector may further comprise regulatory sequences, including for example, a promoter, operably linked to the ORF.
- the vector may further comprise a marker sequence or heterologous ORF operably linked to the EMF or UMF.
- a marker sequence or heterologous ORF operably linked to the EMF or UMF.
- Bacterial pBs, phagescript, PsiX174, pBluescript SK, pBs KS, pNH8a, pNH16a, pNH18a, pNH46a (Stratagene); pTrc99A, pKK223-3, pKK233-3, pDR540, pRIT5 (Pharmacia).
- Eukaryotic pWLneo, pSV2cat, pOG44, PXTI, pSG (Stratagene) pSVK3, pBPV, pMSG, pSVL (Pharmacia).
- the isolated polynucleotide of the invention may be operably linked to an expression control sequence such as the pMT2 or pED expression vectors disclosed in Kaufman et al., Nucleic Acids Res. 19, 4485-4490 (1991), in order to produce the protein recombinantly.
- an expression control sequence such as the pMT2 or pED expression vectors disclosed in Kaufman et al., Nucleic Acids Res. 19, 4485-4490 (1991)
- Many suitable expression control sequences are known in the art. General methods of expressing recombinant proteins are also known and are exemplified in R. Kaufman, Methods in Enzymology 185, 537-566 (1990).
- operably linked means that the isolated polynucleotide of the invention and an expression control sequence are situated within a vector or cell in such a way that the protein is expressed by a host cell which has been transformed (transfected) with the ligated polynucleotide/expression control sequence.
- Promoter regions can be selected from any desired gene using CAT (chloramphenicol transferase) vectors or other vectors with selectable markers.
- CAT chloramphenicol transferase
- Two appropriate vectors are pKK232-8 and pCM7.
- Particular named bacterial promoters include lad, lacZ, T3, T7, gpt, lambda P R , and trc.
- Such promoters can be derived from operons encoding glycolytic enzymes such as 3 -phosphogly cerate kinase (PGK), a- factor, acid phosphatase, or heat shock proteins, among others.
- PGK 3 -phosphogly cerate kinase
- the heterologous structural sequence is assembled in appropriate phase with translation initiation and termination sequences, and preferably, a leader sequence capable of directing secretion of translated protein into the periplasmic space or extracellular medium.
- the heterologous sequence can encode a fusion protein including an N-terminal identification peptide imparting desired characteristics, e.g., stabilization or simplified purification of expressed recombinant product.
- polynucleotide sequences which encode the novel nucleic acids, or functional equivalents thereof may be used to generate recombinant DNA molecules that direct the expression of that nucleic acid, or a functional equivalent thereof, in appropriate host cells.
- the nucleic acid sequences of the invention are further directed to sequences which encode variants of the described nucleic acids.
- These amino acid sequence variants may be prepared by methods known in the art by introducing appropriate nucleotide changes into a native or variant polynucleotide. There are two variables in the construction of amino acid sequence variants: the location of the mutation and the nature of the mutation.
- Amino acid sequence deletions generally range from about 1 to 30 residues, preferably about 1 to 10 residues, and are typically contiguous.
- Amino acid insertions include amino- and/or carboxyl-terminal fusions ranging in length from one to one hundred or more residues, as well as intrasequence insertions of single or multiple amino acid residues. Intrasequence insertions may range generally from about 1 to 10 amino residues, preferably from 1 to 5 residues.
- terminal insertions include the heterologous signal sequences necessary for secretion or for intracellular targeting in different host cells.
- PCR may also be used to create amino acid sequence variants of the novel nucleic acids.
- primer(s) that differs slightly in sequence from the corresponding region in the template DNA can generate the desired amino acid variant.
- PCR amplification results in a population of product DNA fragments that differ from the polynucleotide template encoding the polypeptide at the position specified by the primer. The product DNA fragments replace the corresponding region in the plasmid and this gives the desired amino acid variant.
- the present invention further provides host cells genetically engineered to contain the polynucleotides of the invention.
- host cells may contain nucleic acids of the invention introduced into the host cell using known transformation, transfection or infection methods.
- the present invention still further provides host cells genetically engineered to express the polynucleotides of the invention, wherein such polynucleotides are in operative association with a regulatory sequence heterologous to the host cell which drives expression of the polynucleotides in the cell.
- Any host/vector system can be used to express one or more of the ORFs of the present invention.
- These include, but are not limited to, eukaryotic hosts such as HeLa cells, Cv-1 cell, COS cells, and Sf9 cells, as well as prokaryotic host such as E coli and B subtilis.
- the most preferred cells are those which do not normally express the particular polypeptide or protein or which expresses the polypeptide or protein at low natural level.
- Mature proteins can be expressed in mammalian cells, yeast, bacteria, or other cells under the control of appropriate promoters. Cell-free translation systems can also be employed to produce such proteins using RNAs derived from the DNA constructs of the present invention.
- mammalian cell culture systems can also be employed to express recombinant protein.
- mammalian expression systems include the COS-7 lines of monkey kidney fibroblasts, described by Gluzman, Cell 23:115 (1981), and other cell lines capable of expressing a compatible vector, for example, the C127, 3T3, CHO, HeLa and BHK cell tines.
- Mammalian expression vectors will comprise an origin of replication, a suitable promoter and also any necessary ribosome binding sites, polyadenylation site, splice donor and acceptor sites, transcriptional termination sequences, and 5' flanking nontranscribed sequences.
- Mammalian host cells include, for example, monkey COS cells, Chinese Hamster Ovary (CHO) cells, human kidney 293 cells, human epidermal A431 cells, human Colo205 cells, 3T3 cells, CV-1 cells, other transformed primate cell lines, normal diploid cells, cell strains derived from in vitro culture of primary tissue, primary explants, HeLa cells, mouse L cells, BHK, HL-60, U937, HaK or Jurkat cells.
- monkey COS cells Chinese Hamster Ovary (CHO) cells
- human kidney 293 cells human epidermal A431 cells
- human Colo205 cells human Colo205 cells
- CV-1 cells other transformed primate cell lines
- normal diploid cells cell strains derived from in vitro culture of primary tissue, primary explants, HeLa cells, mouse L cells, BHK, HL-60, U937, HaK or Jurkat cells.
- yeast eukaryotes
- prokaryotes such as bacteria.
- yeast strains include Saccharomyces cerevisiae, Schizosaccharomyces pombe, Kluyveromyces strains, Candida, or any yeast strain capable of expressing heterologous proteins.
- Potentially suitable bacterial strains include Escherichia coli, Bacillus subtilis, Salmonella typhimurium, or any bacterial strain capable of expressing heterologous proteins. If the protein is made in yeast or bacteria, it may be necessary to modify the protein produced therein, for example by phosphorylation or glycosylation of the appropriate sites, in order to obtain the functional protein. Such covalent attachments may be accomplished using known chemical or enzymatic methods.
- cells and tissues may be engineered to express an endogenous gene comprising the polynucleotides of the invention under the control of inducible regulatory elements, in which case the regulatory sequences of the endogenous gene may be replaced by homologous recombination.
- gene targeting can be used to replace a gene's existing regulatory region with a regulatory sequence isolated from a different gene or a novel regulatory sequence synthesized by genetic engineering methods.
- regulatory sequences may be comprised of promoters, enhancers, scaffold-attachment regions, negative regulatory elements, transcriptional initiation sites, regulatory protein binding sites or combinations of said sequences.
- sequences which affect the structure or stability of the RNA or protein produced may be replaced, removed, added, or otherwise modified by targeting, including polyadenylation signals.
- the targeting event may be a simple insertion of the regulatory sequence, placing the gene under the control of the new regulatory sequence, e.g.. inserting a new promoter or enhancer or both upstream of a gene.
- the targeting event may be a simple deletion of a regulatory element, such as the deletion of a tissue-specific negative regulatory element.
- the targeting event may replace an existing element; for example, a tissue-specific enhancer can be replaced by an enhancer that has broader or different cell-type specificity than the naturally occurring elements.
- the naturally occurring sequences are deleted and new sequences are added.
- the identification of the targeting event may be facilitated by the use of one or more selectable marker genes that are contiguous with the targeting DNA, allowing for the selection of cells in which the exogenous DNA has integrated into the host cell genome.
- the identification of the targeting event may also be facilitated by the use of one or more marker genes exhibiting the property of negative selection, such that the negatively selectable marker is linked to the exogenous DNA, but configured such that the negatively selectable marker flanks the targeting sequence, and such that a correct homologous recombination event with sequences in the host cell genome does not result in the stable integration of the negatively selectable marker.
- Markers useful for this purpose include the Herpes Simplex Virus thymidine kinase (TK) gene or the bacterial xanthine-guanine phosphoribosyl-transferase (gpt) gene.
- TK Herpes Simplex Virus thymidine kinase
- gpt bacterial xanthine-guanine phosphoribosyl-transferase
- the gene targeting or gene activation techniques which can be used in accordance with this aspect of the invention are more particularly described in U.S. Patent No. 5,272,071 to Chappel; U.S. Patent No. 5,578,461 to Sherwin et al.; International Application No. PCT/US92/09627 (WO93/09222) by Selden et al.; and International Application No. PCT/US90/06436 (WO91/06667) by Skoultchi et al., each of which is incorporated by reference herein in its entirety.
- the isolated polypeptides of the invention include, but are not limited to, a polypeptide comprising the amino acid sequence of SEQ ID NOS:3 or 5; a full length protein coding sequence of SEQ ID NOS: 3 or 5; a mature protein coding sequence of SEQ ID NOS: 3 or 5, or ; a polypetide encoded by one or more of the exons of SEQ ID NOS: 7 or 8.
- the invention also relates to methods for producing a polypeptide comprising growing a culture of the cells of the invention in a suitable culture medium, and purifying the protein from the culture.
- the methods of the invention include a process for producing a polypeptide in which a host cell containing a suitable expression vector that includes a polynucleotide of the invention is cultured under conditions that allow expression of the encoded polypeptide.
- the polypeptide can be recovered from the culture, conveniently from the culture medium, and further purified.
- Preferred embodiments include those in which the protein produced by such process is a full length or mature form of the protein.
- the invention further provides a polypeptide including an amino acid sequence that is substantially equivalent to SEQ ID NOS: 3 or 5.
- polypeptides and proteins of the present invention can alternatively be purified from cells which have been altered to express the desired polypeptide or protein.
- a cell is said to be altered to express a desired polypeptide or protein when the cell, through genetic manipulation, is made to produce a polypeptide or protein which it normally does not produce or which the cell normally produces at a lower level.
- One skilled in the art can readily adapt procedures for introducing and expressing either recombinant or synthetic sequences into eukaryotic or prokaryotic cells in order to generate a cell which produces one of the polypeptides or proteins of the present invention.
- the purified polypeptides can be used in in vitro binding assays which are well known in the art to identify molecules which bind to the polypeptides. These molecules include but are not limited to, for e.g., small molecules, molecules from combinatorial libraries, antibodies or other proteins.
- the protein of the invention may be prepared by culturing transformed host cells under culture conditions suitable to express the recombinant protein.
- the resulting expressed protein may then be purified from such culture (i.e., from culture medium or cell extracts) using known purification processes, such as gel filtration and ion exchange chromatography.
- the purification of the protein may also include an affinity column containing agents which will bind to the protein; one or more column steps over such affinity resins as concanavalin A-agarose, heparin-toyopearl.RTM.
- RP- HPLC reverse-phase high performance liquid chromatography
- hydrophobic RP-HPLC media e.g., silica gel having pendant methyl or other aliphatic groups
- Some or all of the foregoing purification steps, in various combinations, can also be employed to provide a substantially homogeneous isolated recombinant protein.
- the protein thus purified is substantially free of other mammalian proteins and is defined in accordance with the present invention as an "isolated protein.
- moieties which may be fused to Interleukin-l Receptor Antagonist or an analog include, for example, targeting moieties which provide for the delivery of polypeptide to pancreatic cells, e.g., antibodies to pancreatic cells, antibodies to immune cells such as T-cells, monocytes, dendritic cells, granulocytes, etc., as well as receptor and ligands expressed on pancreatic orjmmune cells.
- moieties which may be fused to Interleukin-l Receptor Antagonist include therapeutic agents which are used for treatment, for example, immunosuppressive drugs such as cyclosporin, SK506, azathioprine, CD3 antibodies and steroids.
- Interleukin-l Receptor Antagonist may be fused to immunostimulants, immune modulators, and other cytokines such as alpha or beta interferon.
- the polynucleotides provided by the present invention can be used by the research community for various purposes.
- the polynucleotides can be used to express recombinant protein for analysis, characterization or therapeutic use; as markers for tissues in which the corresponding protein is preferentially expressed (either constitutively or at a particular stage of tissue differentiation or development or in disease states); as molecular weight markers on Southern gels; as chromosome markers or tags (when labeled) to identify chromosomes or to map related gene positions; to compare with endogenous DNA sequences in patients to identify potential genetic disorders; as probes to hybridize and thus discover novel, related DNA sequences; as a source of information to derive PCR primers for genetic fingerprinting; as a probe to "subtract-out" known sequences in the process of discovering other novel polynucleotides; for selecting and making oligomers for attachment to a "gene chip” or other support, including for examination of expression patterns; to raise anti-protein antibodies using DNA immunization techniques;
- the protein binds or potentially binds to another protein (such as, for example, in a receptor-ligand interaction)
- the protein can be used to identify the other protein with which binding occurs or to identify inhibitors of the binding interaction. Proteins involved in these binding interactions can also be used to screen for peptide or small molecule inhibitors or agonists of the binding interaction. Any or all of these research utilities are capable of being developed into reagent grade or kit format for commercialization as research products.
- Assays for T-cell or thymocyte proliferation include without limitation those described in: Current Protocols in Immunology, Ed by J. E. Coligan, A. M. Kruisbeek, D. H. Margulies, E. M. Shevach, W. Strober, Pub. Greene Publishing Associates and Wiley- Interscience (Chapter 3, In Vitro assays for Mouse Lymphocyte Function 3.1-3.19; Chapter 7, Immunologic studies in Humans); Takai et al., J. Immunol. 137:3494-3500, 1986; Bertagnolli et al, J. Immunol.
- Assays for cytokine production and/or proliferation of spleen cells, lymph node cells or thymocytes include, without limitation, those described in: Polyclonal T cell stimulation, Kruisbeek, A. M. and Shevach, E. M. In Current Protocols in Immunology. J. E. e.a. Coligan eds. Vol 1 pp. 3.12.1-3.12.14, John Wiley and Sons, Toronto. 1994; and Measurement of mouse and human interleukin .gamma., Schreiber, R. D. In Current Protocols in Immunology. J. E. e.a. Coligan eds. Vol 1 pp. 6.8.1-6.8.8, John Wiley and Sons, Toronto. 1994.
- Assays for T-cell clone responses to antigens include, without limitation, those described in: Current Protocols in Immunology, Ed by J. E. Coligan, A. M. Kruisbeek, D. H. Margulies, E. M. Shevach, W Strober, Pub. Greene Publishing Associates and Wiley-Interscience (Chapter 3, In Vitro assays for Mouse Lymphocyte Function; Chapter 6, Cytokines and their cellular receptors; Chapter 7, Immunologic studies in Humans); Weinberger et al., Proc. Natl. Acad. Sci.
- Autoimmune disorders which may be treated using a protein of the present invention include, for example, connective tissue disease, multiple sclerosis, systemic lupus erythematosus, rheumatoid arthritis, autoimmune pulmonary inflammation, Guillain-Barre syndrome, autoimmune thyroiditis, insulin dependent diabetes mellitis, myasthenia gravis, graft- versus-host disease and autoimmune inflammatory eye disease.
- a protein of the present invention may also to be useful in the treatment of allergic reactions and conditions, such as asthma (particularly allergic asthma) or other respiratory problems.
- Other conditions, in which immune suppression is desired may also be treatable using a protein of the present invention.
- T cells may be inhibited by suppressing T cell responses or by inducing specific tolerance in T cells, or both.
- Immunosuppression of T cell responses is generally an active, non-antigen-specific, process which requires continuous exposure of the T cells to the suppressive agent.
- Tolerance which involves inducing non- responsiveness or anergy in T cells, is distinguishable from immunosuppression in that it is generally antigen-specific and persists after exposure to the tolerizing agent has ceased. Operationally, tolerance can be demonstrated by the lack of a T cell response upon reexposure to specific antigen in the absence of the tolerizing agent.
- Down regulating or preventing one or more antigen functions (including without limitation B lymphocyte antigen functions (such as, for example, B7)), e.g., preventing high level lymphokine synthesis by activated T cells, will be useful in situations of tissue, skin and organ transplantation and in graft- versus-host disease (GVHD).
- B lymphocyte antigen functions such as, for example, B7
- GVHD graft- versus-host disease
- blockage of T cell function should result in reduced tissue destruction in tissue transplantation.
- rejection of the transplant is initiated through its recognition as foreign by T cells, followed by an immune reaction that destroys the transplant.
- a molecule which inhibits or blocks interaction of a B7 lymphocyte antigen with its natural ligand(s) on immune cells such as a soluble, monomeric form of a peptide having B7-2 activity alone or in conjunction with a monomeric form of a peptide having an activity of another B lymphocyte antigen (e.g., B7-1, B7-3) or blocking antibody
- B7 lymphocyte antigen e.g., B7-1, B7-3 or blocking antibody
- Blocking B lymphocyte antigen function in this matter prevents cytokine synthesis by immune cells, such as T cells, and thus acts as an immunosuppressant.
- the lack of costimulation may also be sufficient to anergize the T cells, thereby inducing tolerance in a subject.
- Induction of long- term tolerance by B lymphocyte antigen-blocking reagents may avoid the necessity of repeated administration of these blocking reagents.
- GVHD can be assessed using animal models that are predictive of efficacy in humans.
- appropriate systems which can be used include allogeneic cardiac grafts in rats and xenogeneic pancreatic islet cell grafts in mice, both of which have been used to examine the immunosuppressive effects of CTLA4Ig fusion proteins in vivo as described in Lenschow et al., Science 257:789-792 (1992) and Turka et al, Proc. Natl. Acad. Sci USA, 89: 11102- 11105 (1992).
- murine models of GVHD see Paul ed., Fundamental Immunology, Raven Press, New York, 1989, pp. 846-847) can be used to determine the effect of blocking B lymphocyte antigen function in vivo on the development of that disease.
- Blocking antigen function may also be therapeutically useful for treating autoimmune diseases.
- Many autoimmune disorders are the result of inappropriate activation of T cells that are reactive against self tissue and which promote the production of cytokines and autoantibodies involved in the pathology of the diseases.
- Preventing the activation of autoreactive T cells may reduce or eliminate disease symptoms.
- Administration of reagents which block costimulation of T cells by disrupting receptor:ligand interactions of B lymphocyte antigens can be used to inhibit T cell activation and prevent production of autoantibodies or T cell-derived cytokines which may be involved in the disease process.
- blocking reagents may induce antigen-specific tolerance of autoreactive T cells which could lead to long-term relief from the disease.
- the efficacy of blocking reagents in preventing or alleviating autoimmune disorders can be determined using a number of well- characterized animal models of human autoimmune diseases. Examples include murine experimental autoimmune encephalitis, systemic lupus erythmatosis in MRL/lpr/lpr mice or NZB hybrid mice, murine autoimmune collagen arthritis, diabetes mellitus in NOD mice and BB rats, and murine experimental myasthenia gravis (see Paul ed., Fundamental Immunology, Raven Press, New York, 1989, pp. 840-856). Upregulation of an antigen function (preferably a B lymphocyte antigen function), as a means of up regulating immune responses, may also be useful in therapy.
- an antigen function preferably a B lymphocyte antigen function
- Upregulation of immune responses may be in the form of enhancing an existing immune response or eliciting an initial immune response.
- enhancing an immune response through stimulating B lymphocyte antigen function may be useful in cases of viral infection.
- systemic viral diseases such as influenza, the common cold, and encephalitis might be alleviated by the administration of stimulatory forms of B lymphocyte antigens systemically.
- anti-viral immune responses may be enhanced in an infected patient by removing T cells from the patient, costimulating the T cells in vitro with viral antigen-pulsed APCs either expressing a peptide of the present invention or together with a stimulatory form of a soluble peptide of the present invention and reintroducing the in vitro activated T cells into the patient.
- Another method of enhancing anti-viral immune responses would be to isolate infected cells from a patient, transfect them with a nucleic acid encoding a protein of the present invention as described herein such that the cells express all or a portion of the protein on their surface, and reintroduce the transfected cells into the patient.
- the infected cells would now be capable of delivering a costimulatory signal to, and thereby activate, T cells in vivo.
- a gene encoding an antisense construct which blocks expression of an MHC class II associated protein, such as the invariant chain can also be cotransfected with a DNA encoding a peptide having the activity of a B lymphocyte antigen to promote presentation of tumor associated antigens and induce tumor specific immunity.
- a T cell mediated immune response in a human subject may be sufficient to overcome tumor-specific tolerance in the subject.
- T-cell-dependent immunoglobulin responses and isotype switching include, without limitation, those described in: Maliszewski, J. Immunol. 144:3028-3033, 1990; and Assays for B cell function: In vitro antibody production, Mond, J. J. and Brunswick, M. In Current Protocols in Immunology. J. E. e.a. Coligan eds. Vol 1 pp. 3.8.1-3.8.16, John Wiley and Sons, Toronto. 1994.
- lymphocyte survival/apoptosis (which will identify, among others, proteins that prevent apoptosis after superantigen induction and proteins that regulate lymphocyte homeostasis) include, without limitation, those described in: Darzynkiewicz et al., Cytometry 13:795-808, 1992; Gorczyca et al., Leukemia 7:659-670, 1993; Gorczyca et al, Cancer Research 53:1945-1951, 1993; Itoh et al., Cell 66:233-243, 1991; Zacharchuk, Journal of Immunology 145:4037-4045, 1990; Zamai et al., Cytometry 14:891-897, 1993; Gorczyca et al., International Journal of Oncology 1 :639-648, 1992.
- Assays for proteins that influence early steps of T-cell commitment and development include, without limitation, those described in: Antica et al., Blood 84:111-117, 1994; Fine et al., Cellular Immunology 155:111-122, 1994; Galy et al., Blood 85:2770-2778, 1995; Toki et al., Proc. Nat. Acad Sci. USA 88:7548-7551, 1991.
- Assays for stem cell survival and differentiation include, without limitation, those described in: Methylcellulose colony forming assays, Freshney, M. G. In Culture of Hematopoietic Cells. R. I. Freshney, et al. eds. Vol pp. 265-268, Wiley-Liss, Inc., New York, N.Y. 1994; Hirayama et al, Proc. Natl. Acad. Sci. USA 89:5907-5911, 1992; Primitive hematopoietic colony forming cells with high proliferative potential, McNiece, I. K. and Briddell, R. A.
- a protein of the present invention also may have utility in compositions used for bone, cartilage, tendon, ligament and/or nerve tissue growth or regeneration, as well as for wound healing and tissue repair and replacement, and in the treatment of burns, incisions and ulcers.
- a protein of the present invention which induces cartilage and/or bone growth in circumstances where bone is not normally formed, has application in the healing of bone fractures and cartilage damage or defects in humans and other animals.
- Such a preparation employing a protein of the invention may have prophylactic use in closed as well as open fracture reduction and also in the improved fixation of artificial joints. De novo bone formation induced by an osteogenic agent contributes to the repair of congenital, trauma induced, or oncologic resection induced craniofacial defects, and also is useful in cosmetic plastic surgery.
- a protein of the present invention which induces tendon/ligament-like tissue or other tissue formation in circumstances where such tissue is not normally formed, has application in the healing of tendon or ligament tears, deformities and other tendon or ligament defects in humans and other animals.
- Such a preparation employing a tendon/ligament-like tissue inducing protein may have prophylactic use in preventing damage to tendon or ligament tissue, as well as use in the improved fixation of tendon or ligament to bone or other tissues, and in repairing defects to tendon or ligament tissue.
- a protein of the present invention may also be useful for gut protection or regeneration and treatment of lung or liver fibrosis, reperfusion injury in various tissues, and conditions resulting from systemic cytokine damage.
- a protein of the present invention may also be useful for promoting or inhibiting differentiation of tissues described above from precursor tissues or cells; or for inhibiting the growth of tissues described above.
- one or more cells expressing a cytokine receptor are contacted with the protein of the invention.
- a cytokine receptor e.g., Interleukin-l Type I or Type II Receptors
- cells that may be contacted with the protein of the invention include, but are not limited to, mammalian cells such as fibroblasts and T-cells.
- the novel protein of the invention acts as an antagonist for a cytokine receptor (e.g. -the Interleukin-I Receptor) so that the biological activities of that receptor are inhibited.
- novel Interleukin-l Receptor Antagonist of the invention has numerous applications in a variety of therapeutic methods. Examples of therapeutic applications include, but are not limited to, those exemplified below. 6.6.1 SEPSIS
- the compounds can be formulated readily by combining the active compounds with pharmaceutically acceptable carriers well known in the art.
- Such carriers enable the compounds of the invention to be formulated as tablets, pills, dragees, capsules, liquids, gels, syrups, slurries, suspensions and the like, for oral ingestion by a patient to be treated.
- Pharmaceutical preparations for oral use can be obtained solid excipient, optionally grinding a resulting mixture, and processing the mixture of granules, after adding suitable auxiliaries, if desired, to obtain tablets or dragee cores.
- Dyestuffs or pigments may be added to the tablets or dragee coatings for identification or to characterize different combinations of active compound doses.
- the compounds for use according to the present invention are conveniently delivered in the form of an aerosol spray presentation from pressurized packs or a nebuliser, with the use of a suitable propellant, e.g., dichlorodifluoromethane, trichlorofluoromethane, dichlorotetrafluoroethane, carbon dioxide or other suitable gas.
- a suitable propellant e.g., dichlorodifluoromethane, trichlorofluoromethane, dichlorotetrafluoroethane, carbon dioxide or other suitable gas.
- the dosage unit may be determined by providing a valve to deliver a metered amount.
- Capsules and cartridges of, e.g., gelatin for use in an inhaler or insufflator may be formulated containing a powder mix of the compound and a suitable powder base such as lactose or starch.
- the compounds may be formulated for parenteral administration by injection, e.g., by bolus injection or continuous infusion.
- Formulations for injection may be presented in unit dosage form, e.g., in ampoules or in multi-dose containers, with an added preservative.
- the compositions may take such forms as suspensions, solutions or emulsions in oily or aqueous vehicles, and may contain formulatory agents such as suspending, stabilizing and/or dispersing agents.
- Certain organic solvents such as dimethylsulfoxide also may be employed, although usually at the cost of greater toxicity.
- the compounds may be delivered using a sustained-release system, such as semipermeable matrices of solid hydrophobic polymers containing the therapeutic agent.
- sustained-release materials have been established and are well known by those skilled in the art.
- Sustained- release capsules may, depending on their chemical nature, release the compounds for a few weeks up to over 100 days.
- additional strategies for protein stabilization may be employed.
- the pharmaceutical compositions also may comprise suitable solid or gel phase carriers or excipients.
- the various pharmaceutical compositions used to practice the method of the present invention should contain about 0.01 ⁇ g to about 100 mg (preferably about 0.1 ⁇ g to about 10 mg, more preferably about 0.1 ⁇ g to about 1 mg) of protein of the present invention per kg body weight.
- the therapeutic method includes administering the composition topically, systematically, or locally as an implant or device.
- the therapeutic composition for use in this invention is, of course, in a pyrogen-free, physiologically acceptable form.
- compositions suitable for use in the present invention include compositions wherein the active ingredients are contained in an effective amount to achieve its intended purpose. More specifically, a therapeutically effective amount means an amount effective to prevent development of or to alleviate the existing symptoms of the subject being treated. Determination of the effective amounts is well within the capability of those skilled in the art, especially in light of the detailed disclosure provided herein.
- the therapeutically effective dose can be estimated initially from cell culture assays. For example, a dose can be formulated in animal models to achieve a circulating concentration range that includes the IC50 as determined in cell culture (i.e., the concentration of the test compound which achieves a half-maximal inhibition of the
- C-proteinase activity Such information can be used to more accurately determine useful doses in humans.
- the dosage of such compounds lies preferably within a range of circulating concentrations that include the ED50 with little or no toxicity.
- the dosage may vary within this range depending upon the dosage form employed and the route of administration utilized.
- the exact formulation, route of administration and dosage can be chosen by the individual physician in view of the patient's condition. See, e.g., Fingl et al., 1975, in "The Pharmacological Basis of Therapeutics", Ch. 1 p.1.
- Dosage amount and interval may be adjusted individually to provide plasma levels of the active moiety which are sufficient to maintain the C-proteinase inhibiting effects, or minimal effective concentration (MEC).
- Dosage intervals can also be determined using MEC value.
- Compounds should be administered using a regimen which maintains plasma levels above the MEC for 10-90% of the time, preferably between 30-90% and most preferably between 50-90%.In cases of local administration or selective uptake, the effective local concentration of the drug may not be related to plasma concentration.
- compositions may, if desired, be presented in a pack or dispenser device which may contain one or more unit dosage forms containing the active ingredient.
- the pack may, for example, comprise metal or plastic foil, such as a blister pack.
- the pack or dispenser device may be accompanied by instructions for administration.
- Compositions comprising a compound of the invention formulated in a compatible pharmaceutical carrier may also be prepared, placed in an appropriate container, and labelled for treatment of an indicated condition.
- ANTIBODIES Another aspect of the invention is an antibody that specifically binds the polypeptide of the invention.
- Such antibodies can be either monoclonal or polyclonal antibodies, as well fragments thereof and humanized forms or fully human forms, such as those produced in transgenic animals.
- the invention further provides a hybridoma that produces an antibody according to the invention.
- Antibodies of the invention are useful for detection and/or purification of the polypeptides of the invention.
- Hybridomas secreting the desired antibodies are cloned and the class and subclass is determined using procedures known in the art (Campbell, A.M., Monoclonal Antibody Technology: Laboratory Techniques in Biochemistry and Molecular Biology, Elsevier Science Publishers, Amsterdam, The Netherlands (1984)). Techniques described for the production of single chain antibodies (U.S. Patent 4,946,778) can be adapted to produce single chain antibodies to proteins of the present invention.
- antibody containing antiserum is isolated from the immunized animal and is screened for the presence of antibodies with the desired specificity using one of the above-described procedures.
- the present invention further provides the above-described antibodies in delectably labeled form.
- Antibodies can be delectably labeled through the use of radioisotopes, affinity labels (such as biotin, avidin, etc.), enzymatic labels (such as horseradish peroxidase, alkaline phosphatase, etc.) fluorescent labels (such as FITC or rhodamine, etc.), paramagnetic atoms, etc. Procedures for accomplishing such labeling are well-known in the art, for example, see (Sternberger, L.A.
- the labeled antibodies of the present invention can be used for in vitro, in vivo, and in situ assays to identify cells or tissues in which a fragment of the polypeptide of interest is expressed.
- the antibodies may also be used directly in therapies or other diagnostics.
- the present invention further provides the above-described antibodies immobilized on a solid support.
- Such solid supports include plastics such as polycarbonate, complex carbohydrates such as agarose and sepharose, acrylic resins and such as polyacrylamide and latex beads. Techniques for coupling antibodies to such solid supports are well known in the art (Weir, D.M. et al, "Handbook of Experimental Immunology “ 4th Ed., Blackwell Scientific Publications, Oxford, England, Chapter 10 (1986); Jacoby, W.D. et al, Meth. Enzym. 34 Academic Press, N.Y. (1974)).
- the immobilized antibodies of the present invention can be used for in vitro, in vivo, and in situ assays as well as for immuno-affinity purification of the proteins of the present invention.
- a nucleotide sequence of the present invention can be recorded on computer readable media.
- computer readable media refers to any medium which can be read and accessed directly by a computer. Such media include, but are not limited to: magnetic storage media, such as floppy discs, hard disc storage medium, and magnetic tape; optical storage media such as CD-ROM; electrical storage media such as RAM and ROM; and hybrids of these categories such as magnetic/optical storage media.
- magnetic storage media such as floppy discs, hard disc storage medium, and magnetic tape
- optical storage media such as CD-ROM
- electrical storage media such as RAM and ROM
- hybrids of these categories such as magnetic/optical storage media.
- recorded refers to a process for storing information on computer readable medium.
- a skilled artisan can readily adopt any of the presently known methods for recording information on computer readable medium to generate manufactures comprising the nucleotide sequence information of the present invention.
- a variety of data storage structures are available to a skilled artisan for creating a computer readable medium having recorded thereon a nucleotide sequence of the present invention.
- the choice of the data storage structure will generally be based on the means chosen to access the stored information.
- a variety of data processor programs and formats can be used to store the nucleotide sequence information of the present invention on computer readable medium.
- the sequence information can be represented in a word processing text file, formatted in commercially-available software such as WordPerfect and Microsoft Word, or represented in the form of an ASCII file, stored in a database application, such as DB2, Sybase, Oracle, or the like.
- a skilled artisan can readily adapt any number of dataprocessor structuring formats (e.g.
- nucleotide sequence information of the present invention By providing the nucleotide sequence of SEQ ID NOS:l, 2, 4, 6 or 7 or a representative fragment thereof, or a nucleotide sequence at least 99.9% identical to SEQ ID NOS:l, 2 , 4, 5, 6 or 7 or 8in computer readable form, a skilled artisan can routinely access the sequence information for a variety of purposes.
- Computer software is publicly available which allows a skilled artisan to access sequence information provided in a computer readable medium. The examples which follow demonstrate how software which implements the BLAST (Altschul et al, J. Mol. Biol.
- ORFs open reading frames
- Such ORFs may be protein encoding fragments and may be useful in producing commercially important proteins such as enzymes used in fermentation reactions and in the production of commercially useful metabolites.
- a computer-based system refers to the hardware means, software means, and data storage means used to analyze the nucleotide sequence information of the present invention.
- the minimum hardware means of the computer-based systems of the present invention comprises a central processing unit (CPU), input means, output means, and data storage means.
- CPU central processing unit
- input means input means
- output means output means
- data storage means any one of the currently available computer-based systems are suitable for use in the present invention.
- the computer-based systems of the present invention comprise a data storage means having stored therein a nucleotide sequence of the present invention and the necessary hardware means and software means for supporting and implementing a search means.
- data storage means refers to memory which can store nucleotide sequence information of the present invention, or a memory access means which can access manufactures having recorded thereon the nucleotide sequence information of the present invention.
- search means refers to one or more programs which are implemented on the computer-based system to compare a target sequence or target structural motif with the sequence information stored within the data storage means. Search means are used to identify fragments or regions of a known sequence which match a particular target sequence or target motif. A variety of known algorithms are disclosed publicly and a variety of commercially available software for conducting search means are and can be used in the computer-based systems of the present invention.
- a target sequence can be any nucleic acid or amino acid sequence of six or more nucleotides or two or more amino acids.
- EMBL MacPattern
- BLASTN BLASTN
- BLASTA NPOLYPEPTIDEIA
- a skilled artisan can readily recognize that any one of the available algorithms or implementing software packages for conducting homology searches can be adapted for use in the present computer-based systems.
- a "target sequence" can be any nucleic acid or amino acid sequence of six or more nucleotides or two or more amino acids.
- the most preferred sequence length of a target sequence is from about 10 to 100 amino acids or from about 30 to 300 nucleotide residues.
- searches for commercially important fragments, such as sequence fragments involved in gene expression and protein processing may be of shorter length.
- a target structural motif refers to any rationally selected sequence or combination of sequences in which the sequence(s) are chosen based on a three-dimensional configuration which is formed upon the folding of the target motif.
- target motifs include, but are not limited to, enzyme active sites and signal sequences.
- Nucleic acid target motifs include, but are not limited to, promoter sequences, hairpin structures and inducible expression elements (protein binding sequences).
- fragments of the present invention can be used to control gene expression through triple helix formation or antisense DNA or RNA, both of which methods are based on the binding of a polynucleotide sequence to DNA or RNA.
- Polynucleotides suitable for use in these methods are usually 20 to 40 bases in length and are designed to be complementary to a region of the gene involved in transcription (triple helix - see Lee et al, Nucl Acids Res. 3:173 (1979); Cooney et al, Science 15241:456 (1988); and Dervan et al, Science 25TA360 (1991)) or to the mRNA itself (antisense - Olmno, J. Neurochem. 56:560 (1991); Oligodeoxynucleotides as Antisense Inhibitors of Gene
- the present invention further provides methods to identify the presence or expression of one of the ORFs of the present invention, or homolog thereof, in a test sample, using a nucleic acid probe or antibodies of the present invention.
- methods for detecting a polynucleotide of the invention can comprise contacting a sample with a compound that binds to and forms a complex with the polynucleotide for a period sufficient to form the complex, and detecting the complex, so that if a complex is detected, a polynucleotide of the invention is detected in the sample.
- Such methods can also comprise contacting a sample under stringent hybridization conditions with nucleic acid primers that anneal to a polynucleotide of the invention under such conditions, and amplifying annealed polynucleotides, so that if a polynucleotide is amplified, a polynucleotide of the invention is detected in the sample.
- methods for detecting a polypeptide of the invention can comprise contacting a sample with a compound that binds to and forms a complex with the polypeptide for a period sufficient to form the complex, and detecting the complex, so that if a complex is detected, a polypeptide of the invention is detected in the sample.
- such methods comprise incubating a test sample with one or more of the antibodies or one or more of nucleic acid probes of the present invention and assaying for binding of the nucleic acid probes or antibodies to components within the test sample.
- Conditions for incubating a nucleic acid probe or antibody with a test sample vary. Incubation conditions depend on the format employed in the assay, the detection methods employed, and the type and nature of the nucleic acid probe or antibody used in the assay.
- One skilled in the art will recognize that any one of the commonly available hybridization, amplification or immunological assay formats can readily be adapted to employ the nucleic acid probes or antibodies of the present invention. Examples of such assays can be found in Chard, T., An Introduction to Radioimmunoassay and Related Techniques, Elsevier Science Publishers, Amsterdam, The Netherlands (1986); Bullock, G.R. et al, Techniques in Immunocytochemistry, Academic Press, Orlando, FL Vol. 1 (1982), Vol.
- test samples of the present invention include cells, protein or membrane extracts of cells, or biological fluids such as sputum, blood, serum, plasma, or urine.
- biological fluids such as sputum, blood, serum, plasma, or urine.
- the test sample used in the above-described method will vary based on the assay format, nature of the detection method and the tissues, cells or extracts used as the sample to be assayed. Methods for preparing protein extracts or membrane extracts of cells are well known in the art and can be readily be adapted in order to obtain a sample which is compatible with the system utilized.
- kits which contain the necessary reagents to carry out the assays of the present invention.
- the invention provides a compartment kit to receive, in close confinement, one or more containers which comprises: (a) a first container comprising one of the probes or antibodies of the present invention; and (b) one or more other containers comprising one or more of the following: wash reagents, reagents capable of detecting presence of a bound probe or antibody.
- a compartment kit includes any kit in which reagents are contained in separate containers.
- Such containers include small glass containers, plastic containers or strips of plastic or paper.
- Such containers allows one to efficiently transfer reagents from one compartment to another compartment such that the samples and reagents are not cross- contaminated, and the agents or solutions of each container can be added in a quantitative fashion from one compartment to another.
- Such containers will include a container which will accept the test sample, a container which contains the antibodies used in the assay, containers which contain wash reagents (such as phosphate buffered saline, Tris-buffers, etc.), and containers which contain the reagents used to detect the bound antibody or probe.
- Types of detection reagents include labeled nucleic acid probes, labeled secondary antibodies, or in the alternative, if the primary antibody is labeled, the enzymatic, or antibody binding reagents which are capable of reacting with the labeled antibody.
- labeled nucleic acid probes labeled secondary antibodies, or in the alternative, if the primary antibody is labeled, the enzymatic, or antibody binding reagents which are capable of reacting with the labeled antibody.
- the disclosed probes and antibodies of the present invention can be readily incorporated into one of the established kit formats which are well known in the art.
- the present invention further provides methods of obtaining and identifying agents which bind to a polypeptide encoded by the ORF from a polynucleotide with a sequence of SEQ ID NOS:l, 2, 4, 6 or 7 or 8to a specific domain of the polypeptide encoded by the nucleic acid, or to a nucleic acid with a sequence of SEQ ID NOS: 1, 2 4, 6 or 7.
- said method comprises the steps of:
- such methods for identifying compounds that bind to a polynucleotide of the invention can comprise contacting a compound with a polynucleotide of the invention for a time sufficient to form a polynucleotide/compound complex, and detecting the complex, so that if a polynucleotide/compound complex is detected, a compound that binds to a polynucleotide of the invention is identified.
- such methods for identifying compounds that bind to a polypeptide of the invention can comprise contacting a compound with a polypeptide of the invention for a time sufficient to form a polypeptide/compound complex, and detecting the complex, so that if a polypeptide/compound complex is detected, a compound that binds to a polynucleotide of the invention is identified.
- Methods for identifying compounds that bind to a polypeptide of the invention can also comprise contacting a compound with a polypeptide of the invention in a cell for a time sufficient to form a polypeptide/compound complex, wherein the complex drives expression of a receptor gene sequence in the cell, and detecting the complex by detecting reporter gene sequence expression, so that if a polypeptide/compound complex is detected, a compound that binds a polypeptide of the invention is identified.
- Compounds identified via such methods can include compounds which modulate the activity of a polypeptide of the invention (that is, increase or decrease its activity, relative to activity observed in the absence of the compound).
- compounds identified via such methods can include compounds which modulate the expression of a polynucleotide of the invention (that is, increase or decrease expression relative to expression levels observed in the absence of the compound).
- Compounds, such as compounds identified via the methods of the invention can be tested using standard assays well known to those of skill in the art for their ability to modulate activity/expression.
- the agents screened in the above assay can be, but are not limited to, peptides, carbohydrates, vitamin derivatives, or other pharmaceutical agents.
- the agents can be selected and screened at random or rationally selected or designed using protein modeling techniques.
- agents such as peptides, carbohydrates, pharmaceutical agents and the like are selected at random and are assayed for their ability to bind to the protein encoded by the ORF of the present invention.
- agents may be rationally selected or designed.
- an agent is said to be "rationally selected or designed" when the agent is chosen based on the configuration of the particular protein.
- one skilled in the art can readily adapt currently available procedures to generate peptides, pharmaceutical agents and the like capable of binding to a specific peptide sequence in order to generate rationally designed antipeptide peptides, for example see Hurby et al, Application of Synthetic Peptides: Antisense Peptides," In Synthetic Peptides, A User 's Guide, W.H. Freeman, NY (1992), pp. 289-307, and Kaspczak et al, Biochemistry 2S:9230-8 (1989), or pharmaceutical agents, or the like.
- one class of agents of the present invention can be used to control gene expression through binding to one of the ORFs or EMFs of the present invention. As described above, such agents can be randomly screened or rationally designed/selected. Targeting the ORF or EMF allows a skilled artisan to design sequence specific or element specific agents, modulating the expression of either a single ORF or multiple ORFs which rely on the same EMF for expression control.
- One class of DNA binding agents are agents which contain base residues which hybridize or form a triple helix formation by binding to DNA or RNA. Such agents can be based on the classic phosphodiester, ribonucleic acid backbone, or can be a variety of sulfhydryl or polymeric derivatives which have base attachment capacity.
- Agents suitable for use in these methods usually contain 20 to 40 bases and are designed to be complementary to a region of the gene involved in transcription (triple helix - see Lee et al, Nucl. Acids Res. 3:173 (1979); Cooney et al, Science 241:456 (1988); and Dervan et al, Science 251: 1360 (1991)) or to the mRNA itself (antisense - Okano, J. Neurochem. 56:560 (1991); Oligodeoxynucleotides as Antisense Inhibitors of Gene Expression, CRC Press, Boca Raton, FL (1988)).
- Triple helix- formation optimally results in a shut-off of RNA transcription from DNA, while antisense RNA hybridization blocks translation of an mRNA molecule into polypeptide. Both techniques have been demonstrated to be effective in model systems. Information contained in the sequences of the present invention is necessary for the design of an antisense or triple helix oligonucleotide and other DNA binding agents. Agents which bind to a protein encoded by one of the ORFs of the present invention can be used as a diagnostic agent, in the control of bacterial infection by modulating the activity of the protein encoded by the ORF. Agents which bind to a protein encoded by one of the ORFs of the present invention can be formulated using known techniques to generate a pharmaceutical composition.
- Another aspect of the subject invention is to provide for polypeptide-specific nucleic acid hybridization probes capable of hybridizing with naturally occurring nucleotide sequences.
- the hybridization probes of the subject invention may be derived from the nucleotide sequence of the SEQ ID NOS: 1, 2, 4, 6, or 7. Because the corresponding gene is only expressed in a limited number of tissues, especially adult tissues, a hybridization probe derived from SEQ ID NOS: 1, 2, 4, 6, or 7 or 8can be used as an indicator of the presence of RNA of cell type of such a tissue in a sample.
- any suitable hybridization technique can be employed, such as, for example, in situ hybridization.
- PCR as described US Patent Nos 4,683,195 and 4,965,188 provides additional uses for oligonucleotides based upon the nucleotide sequences.
- probes used in PCR may be of recombinant origin, may be chemically synthesized, or a mixture of both.
- the probe will comprise a discrete nucleotide sequence for the detection of identical sequences or a degenerate pool of possible sequences for identification of closely related genomic sequences.
- nucleic acids include the cloning of nucleic acid sequences into vectors for the production of mRNA probes.
- vectors are known in the art and are commercially available and may be used to synthesize RNA probes in vitro by means of the addition of the appropriate RNA polymerase as T7 or SP6 RNA polymerase and the appropriate radioactively labeled nucleotides.
- the nucleotide sequences may be used to construct hybridization probes for mapping their respective genomic sequences.
- the nucleotide sequence provided herein may be mapped to a chromosome or specific regions of a chromosome using well known genetic and/or chromosomal mapping techniques.
- Fluorescent in situ hybridization of chromosomal preparations and other physical chromosome mapping techniques may be correlated with additional genetic map data. Examples of genetic map data can be found in the 1994 Genome Issue of Science (265: 198 If). Correlation between the location of a nucleic acid on a physical chromosomal map and a specific disease (or predisposition to a specific disease) may help delimit the region of DNA associated with that genetic disease.
- the nucleotide sequences of the subject invention may be used to detect differences in gene sequences between normal, carrier or affected individuals. The nucleotide sequence may be used to produce purified polypeptides using well known methods of recombinant DNA technology.
- Polypeptides may be expressed in a variety of host cells, either prokaryotic or eukaryotic. Host cells may be from the same species from which a particular polypeptide nucleotide sequence was isolated or from a different species. Advantages of producing polypeptides by recombinant DNA technology include obtaining adequate amounts of the protein for purification and the availability of simplified purification procedures. Each sequence so obtained was compared to sequences in GenBank using a search algorithm developed by Applied Biosystems and incorporated into the INHERIT 670 Sequence Analysis System.
- Pattern Specification Language developed by TRW Inc., Los Angeles, CA was used to determine regions of homology.
- the three parameters that determine how the sequence comparisons run were window size, window offset, and error tolerance.
- the DNA database was searched for sequences containing regions of homology to the query sequence, and the appropriate sequences were scored with an initial value. Subsequently, these homologous regions were examined using dot matrix homology plots to distinguish regions of homology from chance matches. Smith- Waterman alignments were used to display the results of the homology search.
- Peptide and protein sequence homologies were ascertained using the INHERIT 670 Sequence Analysis System in a way similar to that used in DNA sequence homologies. Pattern Specification Language and parameter windows were used to search protein databases for sequences containing regions of homology that were scored with an initial value. Dot-matrix homology plots were examined to distinguish regions of significant homology from chance matches.
- BLAST which stands for Basic Local Alignment Search Tool, is used to search for local sequence alignments (Altschul SF (1993) J Mol Evol 36:290-300; Altschul, SF et al (1990) J Mol Biol 215:403-10). BLAST produces alignments of both nucleotide and amino acid sequences to determine sequence similarity. Because of the local nature of the alignments, BLAST is especially useful in determining exact matches or in identifying homologs. Whereas it is ideal for matches which do not contain gaps, it is inappropriate for performing motif-style searching. The fundamental unit of BLAST algorithm output is the High-scoring Segment Pair (HSP).
- HSP High-scoring Segment Pair
- An HSP consists of two sequence fragments of arbitrary but equal lengths whose alignment is locally maximal and for which the alignment score meets or exceeds a threshold or cutoff score set by the user.
- the BLAST approach is to look for HSPs between a query sequence and a database sequence, to evaluate the statistical significance of any matches found, and to report only those matches which satisfy the user-selected threshold of significance.
- the parameter E establishes the statistically significant threshold for reporting database sequence matches. E is interpreted as the upper bound of the expected frequency of chance occurrence of an HSP (or set of HSPs) within the context of the entire database search. Any database sequence whose match satisfies E is reported in the program output.
- BLAST analysis was used to search for related molecules within the libraries of the LIFESEQ database.
- This process an "electronic northern” analysis is analogous to northern blot analysis in that it uses one cellubrevin sequence at a time to search for identical or homologous molecules at a set stringency.
- the stringency of the electronic northern is based on "product score".
- the product score is defined as (% nucleotide or amino acid [between the query and reference sequences] in Blast multiplied by the % maximum possible BLAST score [based on the lengths of query and reference sequences]) divided by 100.
- product score is defined as (% nucleotide or amino acid [between the query and reference sequences] in Blast multiplied by the % maximum possible BLAST score [based on the lengths of query and reference sequences]) divided by 100.
- the match will be exact within a 1-2% error; and at 70, the match will be exact.
- Homologous or related molecules can be identified by selecting those which show product scores between approximately 15 and 30.
- the present invention is illustrated in the following examples. Upon consideration of the present disclosure, one of skill in the art will appreciate that many other embodiments and variations may be made in the scope of the present invention. Accordingly, it is intended that the broader aspects of the present invention not be limited to the disclosure of the following examples.
- a Novel Interleukin-l Receptor Antagonist Obtained from a cDNA Library of Fetal Liver-Spleen A plurality of novel nucleic acids were obtained from the b HFLS20W cDNA library prepared from human fetal liver-spleen tissue, as described in Bonaldo et al., Genome Res. 6:791-806 (1996), using standard per, SBH sequence signature analysis and Sanger sequencing techniques. The inserts of the library were amplified with per using primers specific for vector sequences which flank the inserts. These samples were spotted onto nylon membranes and interrogated with oligonucleotide probes to give sequence signatures.
- the clones were clustered into groups of similar or identical sequences, and single representative clones were selected from each group for gel sequencing.
- the 5' sequence of the amplified inserts was then deduced using the reverse Ml 3 sequencing primer in a typical Sanger sequencing protocol. PCR products were purified and subjected to flourescent dye terminator cycle sequencing. Single pass gel sequencing was done using a 377 Applied Biosystems (ABI) sequencer. Two (2) of these inserts have been identifed as novel sequences not previously obtained from this library, and not previously reported in public databases. These sequences are shown in Figure 2 as SEQ ID NO. 1 and 2.
- the polypeptide sequences corresponding to these nucleic acid sequences are shown in Figure 3 as SEQ ID NO. 3. These amino acid sequences have striking homology to Interleukin-l receptor antagonist.
- SEQ ID NO.2 To study the role of SEQ ID NO. 2 in the regulation of the inflammatory response, gene expression was analyzed using a semi-quantatative polymerase chain reaction-based technique. cDNA libraries were used as sources of expressed genes from tissues of interest (three leukocyte preparations [two stimulated and one unstimulated], heart, lung, spleen, placenta, testes, fetal liver, adult liver, bone marrow, lymph node, macrophages, endothelial cells, fetal skin, and umbilical cord). Gene specific primers were used to amplify portions of the SEQ ID NO. 2 sequence (corresponding to bases 105-772 and 161-690, as numbered frome the 5' end of SEQ ID NO.
- fetal skin and umbilical cord were the only samples that provided a signal, indicating that expression of SEQ ID NO. 2 is tightly regulated.
- Expression of both IL-1 Ra are tightly restricted to a subset of tissues and cell types; both constitutively expressed in skin but not present in other tissues or cell types without stimulation
- the expression pattern of SEQ ID NO. 2 parallels that of the IL-1 Ra genes, indicating that the novel cytokine encoded by SEQ ID NO. 2 plays a role in the regulation of the inflammatory response.
- Chromosome mapping technologies allow investigators to link genes to specific regions of chromosomes. Chromosomal mapping was performed with the Stanford G3 Radiation Hybrid Panel (Research Genetics). The panel was screened with gene-specific primers (5' primer: CCCCACTGGATGGTGCTACTG; (SEQ ID NO. 15), 3' primer: GGGAAGAGATAGGAAAGGTAG) (SEQ ID NO. 16)that generated a sequence tag site (STS), and the results of the PCR screening were submitted to the Stanford Radiation Hybrid mapping email server at the Stanford Human Genome Center (SHGC). The gene position on the radiation hybrid framework map was provided by linking the STS corresponding to SEQ ID NO. 2 with the SHGC marker with best linkage.
- SHGC Stanford Human Genome Center
- SEQ ID NO. 2 is located on the long arm of chromosome 2.
- the STS was linked to the marker SHGC-7020 with a LOD (log of the odds) score of 12.25 and cR-1000 of 5, indicating that the STS was within 120 kb (kilobases) of this marker.
- SHGC-7020 is in turn located within 120 kb of the IL-1 Ra gene.
- the STS corresponding to SEQ ID NO. 2 is located within about 240 kilobases of the IL-1 Ra gene and could be in close proximity to the IL-1 Ra gene.
- interleukin-l gene family has been mapped to chromosome 2. More specifically, all of the interleukin 1 genes (IL-1 a, IL-lb) and the receptors (IL-1 RI and IL-1 RU), as well as the receptor antagonist IL-1 Ra, have been found to be situated on the long arm of chromosome 2. The identification of SEQ ID NO. 2 sequences in this same region establishes the physical linkage of SEQ ID NO. 2 to the interleukin-l locus which evidences that the cytokine encoded by SEQ ID NO. 2 functions as a modulator of the inflammatory response. 7.4 EXAMPLE 4
- IL-1 a, IL-lb and IL-1 Ra have been highly conserved, demonstrating that they probably arose from a common precursor gene.
- BAC bacterial artificial chromosome
- the intron/exon structure is identical between IL-1 Ra and the BAC fragment containing SEQ ID NO. 2, providing evidence that these two sequences are members of the same family and were generated from a common gene precursor.
- Interleukin-l Receptor Binding Domain and Interleukin-l Receptor Assay The receptor binding region of both IL-1 ⁇ and IL-1 Ra have been mapped an 18 amino acid region in the carboxy terminal half of the proteins (i.e., residues 88-105 of IL-l ⁇ ) by site- directed mutagenesis and protein modification studies.
- An amino acid alignment of SEQ ID NO. 3 with both IL-1 ⁇ and IL-1 Ra demonstrates that SEQ ID NO. 3 contains a receptor binding region.
- SEQ ID NO. 3 is 39% identical to IL-lRa and 22% identical (39% conserved) with IL-1 ⁇ in this region.
- IL-1 Ra which is known to bind to the IL-1 receptor
- SEQ ID NO. 3 also contains an IL-1 receptor binding region.
- the alignment of all three proteins in the receptor bining region is shown in Fig. 4. Because SEQ ID NO. 3 contains a IL-1 receptor binding region, SEQ ID NO. 3 and truncated forms of SEQ ID NO. 3 that include the receptor binding region are useful as reagents to identify cells and tissues expressing IL-1 receptors.
- SEQ ID NO. 3 is prepared by growing E.coli expressing SEQ ID NO. 3 on M9 medium containing [35S] sulphate and purifying the labeled SEQ ID NO. 3 by chromatography on a Mono-S column. The labeled SEQ ID NO. 3 is incubated with the cells or tissue under standard IL-1 binding assay conditions, and [35S] binding. Significant [35S] binding indicates the presence of IL-1 receptors.
- the extended nucleotide sequence was obtained by isolating PCR products generated from pools of clones from a fetal skin cDNA library. In short, a fetal skin cDNA library was plated on ampicillin containing plates in pools of about 40,000 colonies. The colonies were recovered into LB medium and PCR was used to detect pools which contained SEQ ID NO. 2 ( Figure 2). Two pools were identified. PCR using vector- and gene-specific primers amplified the 5' portion of the cDNA. Nested primers were used to generate sequence from the two amplified products.
- SEQ ID NO. 4 encodes a protein of 155 amino acids, lacking a typical hydrophobic leader peptide, suggesting that this protein is retained as a cytoplasmic molecule, similar to the cytoplasmic isoform of the human IL-1 Ra gene product.
- Figure 7 presents an amino acid alignment of SEQ ID NO. 5 with the cytoplasmic form of human IL-1 Ra (labeled "HUMILIRASIC"). The alignment reveals a high degree of homology between the two; 48% of the amino acids were identical and 54% represent conservative amino acid substitutions. Three residues have been proven to be critical for receptor activation by IL-1 ⁇ (marked with asterisks in Figure 7).
- SEQ ID NO. 5 possesses a combination of both residues, RIO (identical to the corresponding residue in IL-1 Ra) and K12 and D148 (similar and identical, respectively, to the corresponding residues in IL-1 ⁇ ).
- RIO identical to the corresponding residue in IL-1 Ra
- K12 and D148 similar and identical, respectively, to the corresponding residues in IL-1 ⁇ .
- the overall homology and agonist/antagonist site-specific sequence homologies clearly define SEQ ID NO. 5 as a protein modulator of the inflammatory response.
- SEQ ID NO. 6 ( Figure 8) is an extension of the 3' end of the nucleic acid sequence of SEQ ID NO. 4.
- SEQ ID: 6 was obtained from a fetal skin cDNA library as described above for SEQ ID NO: 4.
- a human BAC genomic library (Research Genetics) was screened with gene-specific primers (273-D, 5 '-CCCCACTGGATGGTGCTACTG-3 ' (SEQ ID No. : 15) which hybridizes at position 4533 to 4553 in the genomic sequence and 273-E, 5'- GGGAAGAGATAGGAAAGGTAG-3' (SEQ ID No.: 16) which hybridizes at position 4849 to 4869) using a PCR based assay. Briefly, the gene specific primers were used to amplify BAC DNAs as templates using standard PCR conditions. BACs that produce a fragment of DNA corresponding to the predicted size were pursued.
- BAC393-I6 was isolated and its DNA sequenced with gene-specific primers derived from SEQ ID NO 2. The sequence (16403 bases in length) is shown in Fig. 9. The IL-lRa coding sequence was found to be distributed over 5 exons. The splice donor and acceptor sites are shown below, along with intron and exon sizes.
- SEQ ID NO:3 was expressed in E. coli by subcloning the entire coding region of the Seq ID NO:2 into a prokaryotic expression vector.
- the expression vector (pQE16) used was from the QIAexpression prokaryotic protein expression system (Qiagen).
- the features of this vector that make it useful for protein expression include: an efficient promoter (phage T5) to drive transcription; expression control provided by the lac operator system, which can be induced by addition of IPTG ( isopropyl- ⁇ -D-thiogalactopyranoside), and an encoded His 6 tag. The latter is a stretch of 6 histidine amino acid residues which can bind very tightly to a nickel atom.
- the vector can be used to express a recombinant protein with a His 6 tag fused to its carboxyl terminus, allowing rapid and efficient purification using Ni-coupled affinity columns.
- the coding sequence of Seq ID NO:2 (including the start codon but excluding the stop codon) was amplified using the PCR reaction primers API
- the PCR fragment was ligated into the digested pQE16 vector to produce pl6BB-273.
- the ligation was transformed by electroporation into electrocompetant E.coli cells (strain M 15 [pREP4] from Qaigen), and the transformed cells were plated on ampicillin-containing plates. Colonies were screened for the correct insert in the proper orientation using a PCR reaction employing a gene-specific primer and a vector-specific primer. Positives were then sequenced to ensure correct orientation and sequence.
- the lysate obtained was further purified using a nickel containing column (Ni- NTA spin column from Qiagen) under non-denaturing conditions. Briefly, the lysate was brought up to 300mM NaCl and lOmM imidazole and was centrifuged at 700xg through the spin column to allow the His-tagged recombinant protein to bind to the nickel column.
- the column was then washed twice with Wash Buffer (50mM NaH 2 PO 4 , pH8.0; 300mM NaCl; 20mM imidazole) and was eluted with Elution Buffer (50mM NaH 2 PO 4 , pH8.0; 300mM NaCl; 250mM imidazole). All the above procedures were performed at 4°C.
- the purified protein was checked with SDS-PAGE. A strong single band was observed, indicating a molecular weight of 16 kD, which is consistent with the predicted size of SEQ ID NO: 3.
- novel Interleukin-l receptor antagonist polypeptides of the invention are useful in medical imaging, e.g., imaging the site of infection, inflammation, and other sites having Interleukin-l receptor antagonist receptor molecules. See, e.g., Kunkel et al., U.S. Pat. NO. 5,413,778.
- Such methods involve chemical attachment of a labelling agent, administration of the labelled Interleukin-l receptor antagonist polypeptide to a subject in a pharmaceutically acceptable carrier, and imaging the labelled Interleukin-l receptor antagonist polypeptide in vivo at the target site.
- Acute edematous, necrotizing pancreatitis is induced in adult male Swiss mice weighing more than 35 grams using caerulein ⁇ an analog of cholecystokinin. Mice are divided into four groups with three of the groups receiving caerulein 50 mu g/kg by intraperitoneal (IP) injection in four doses over three hours as previously described.
- IP intraperitoneal
- Group 1 is a control group (n-9) which received only IP saline injections.
- pancreata After a suitable time period, all animals are euthanized, the blood collected, and the pancreata surgically excised and weighed. Serum is assayed for amylase, lipase, IL-6, and TNF levels. Each pancreas is fixed, stained, and graded histologically in a blinded fashion for interstitial edema, granulocyte infiltration, acinar vacuolization, and acrnar cell. Additionally, serum levels of Interleukin-l receptor antagonist are determined, therefore allowing comparisons between dosage, serum level, systemic cytokine response, and degree of pancreatic damage.
- Interleukin-6, Interleukin-l, Interleukin-l receptor antagonist, and TNF are measured by commercially available ELISA kits (Genzyme Corp., Boston, Mass.). All specimens are run in triplicate. Serum levels of amylase and lipase are measured on a Kodak Ectachem 700 automated analyzer (Eastman Kodak Company, Rochester, N. Y.). Histologic slides are prepared as is known in the art after rapid excision and subsequent fixation in 10% formalin. The tissues are paraffin embedded as is known in the art and then stained with Hematoxylin and Eosin in a standard fashion. These slides are examined and graded in a blinded fashion by a board certified pathologist.
- Murine D10 T cells are obtained from the American Type Culture Collection (Rockville, Md.). Cells are maintained in Dulbecco's modified Eagle medium and Ham's F-12 medium (1 :1) containing 10 n M HEPES buffer (pH 7.4) and 10% fetal bovine serum. All tissue culture reagents contained less than 0.25 ng/mL endotoxin as measured by the limulus amebocyte assay.
- Murine D10 cells an Interleukin-l dependent T-cell line, are used to measure Interleukin-l mitogenic activity.
- Cell proliferation in the present of Interleukin-l with and without the Interleukin-l receptor antagonist polypeptides of the invention is assessed by incorporation of ( sup 3 H) thymidine as previously described (Bakouche, O., et al. J. Immunol. 138:4249-4255, 1987).
- antagonists and agonist of the Interleukin-l receptor antagonist polypeptides of the invention are identified in this assay by adding the candidate compounds with the Interleukin-l and Interleukin-l receptor antagonist polypeptides of the invention and measuring the change in cell proliferation caused by the candidate compound.
- PLD Cell Harvested Cambridge Technology, Inc., Watertown, Ma.
- Disks are air dried overnight, and radioactivity is determined with a Model 1900TR Scintillation Counter (Packard Instrument Division, Downers Grove, 111.)
- Aortic smooth muscle cells are cultured by explanting segments of the medial layer of aortas from adult male Fischer 344 rats. Aortas are removed aseptically and freed of adventitial and endothelial cells by scraping both the luminal and abluminal surfaces. Medial fragments are allowed to attach to Primaria 25-cm sup 2 tissue culture flasks (Becton-Dickinson, Lincoln Park, N.J.) which are kept moist with growth medium until cells emerged.
- Rat aortic smooth muscle cells are incubated with RPMI-1640 medium containing 10% bovine calf serum, 25 mM HEPES buffer (pH 7.4), 2 mM glutamine, 80 mu g/mL penicillin, 80 mu g/mL steptomycin, 2 mu g/mL fungizone, 30 mu g/mL lipopolysaccharide (Escherichia coli 0111 :B4), and 50 U/mL IFN-y. Cells are harvested after 24 hours, and cytosol is prepared (Gross, S. S., et al. Biochem. Biophys. Res. Commun. 178:823-829, 1991).
- mice are injected in the footpad with irradiated, allogeneic spleen cells. The mice are then injected in the contralateral footpad with irradiated, syngeneic spleen cells.
- mice Specific pathogen free 8-12 week old BALB/c (H-2 sup d) and C57BL/6 (H-2 sup b) mice (Jackson Laboratory, Bar Harbor, Me.) are used in this experiment. 48 BALB/c mice are divided into 16 groups, each having 3 mice (unless otherwise indicated). Each group of mice received a different mode of treatment.
- mice On day 0 the left footpads of all mice are injected intracutaneously with 107 irradiated (2500R), allogeneic spleen cells from C57BL/6 mice in 50 ul of RPMI-1640 (Gibco) as antigen and the right contralateral footpads of the same mice are injected with 10 sup 7 irradiated (2500R), syngeneic spleen cells from BALB/c mice. Seven days after antigen administration, the mice are sacrificed and the popliteal lymph nodes (PLN) are removed from the right and left popliteal fossa by surgical dissection.
- PPN popliteal lymph nodes
- Lymph nodes are weighed and the results expressed as the difference (DELTA) in weight (mg) of the lymph node draining the site of allogeneic cell injection and the weight of the node draining the syngeneic cell injection site. Lymph nodes draining the syngeneic cell injection site weighed approximately 1 mg, regardless of whether they are obtained from mice treated with MSA or Interleukin-l receptor antagonist polypeptides of the invention, and did not differ significantly in weight from nodes obtained from mice given no cell injection.
- DELTA difference in weight (mg) of the lymph node draining the site of allogeneic cell injection and the weight of the node draining the syngeneic cell injection site.
- Lymph nodes draining the syngeneic cell injection site weighed approximately 1 mg, regardless of whether they are obtained from mice treated with MSA or Interleukin-l receptor antagonist polypeptides of the invention, and did not differ significantly in weight from nodes obtained from mice given no cell injection.
Abstract
Description
Claims
Priority Applications (6)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
AU34495/99A AU769262B2 (en) | 1998-04-03 | 1999-04-05 | A interleukin-1 receptor antagonist and uses thereof |
EP99916115A EP1068321A2 (en) | 1998-04-03 | 1999-04-05 | A interleukin-1 receptor antagonist and uses thereof |
JP2000542457A JP2002510492A (en) | 1998-04-03 | 1999-04-05 | Interleukin-1 receptor antagonist and use thereof |
CA002326066A CA2326066A1 (en) | 1998-04-03 | 1999-04-05 | A interleukin-1 receptor antagonist and uses thereof |
IL13857699A IL138576A0 (en) | 1998-04-03 | 1999-04-05 | A novel interleukin-1 receptor antagonist and uses thereof |
US09/348,942 US6337072B1 (en) | 1998-04-03 | 1999-07-07 | Interleukin-1 receptor antagonist and recombinant production thereof |
Applications Claiming Priority (14)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
US5501098A | 1998-04-03 | 1998-04-03 | |
US09/055,010 | 1998-04-03 | ||
US7990998A | 1998-05-15 | 1998-05-15 | |
US09/079,909 | 1998-05-15 | ||
US8236498A | 1998-05-20 | 1998-05-20 | |
US09/082,364 | 1998-05-20 | ||
US9981898A | 1998-06-19 | 1998-06-19 | |
US09/099,818 | 1998-06-19 | ||
US12769898A | 1998-07-31 | 1998-07-31 | |
US09/127,698 | 1998-07-31 | ||
US22959199A | 1999-01-13 | 1999-01-13 | |
US09/229,591 | 1999-01-13 | ||
US25137099A | 1999-02-17 | 1999-02-17 | |
US09/251,370 | 1999-02-17 |
Publications (2)
Publication Number | Publication Date |
---|---|
WO1999051744A2 true WO1999051744A2 (en) | 1999-10-14 |
WO1999051744A3 WO1999051744A3 (en) | 2000-03-30 |
Family
ID=27568093
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
PCT/US1999/004291 WO1999051744A2 (en) | 1998-04-03 | 1999-04-05 | A interleukin-1 receptor antagonist and uses thereof |
Country Status (6)
Country | Link |
---|---|
EP (1) | EP1068321A2 (en) |
JP (1) | JP2002510492A (en) |
AU (1) | AU769262B2 (en) |
CA (1) | CA2326066A1 (en) |
IL (1) | IL138576A0 (en) |
WO (1) | WO1999051744A2 (en) |
Cited By (16)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO2000020595A1 (en) * | 1998-10-08 | 2000-04-13 | Zymogenetics, Inc. | Interleukin-1 homolog |
WO2000071719A1 (en) * | 1999-05-20 | 2000-11-30 | Hyseq, Inc. | Interleukin-1 hy2 materials and methods |
WO2001002571A2 (en) * | 1999-07-07 | 2001-01-11 | Hyseq, Inc. | An interleukin-1 receptor antagonist and uses thereof |
WO2001005974A2 (en) * | 1999-07-16 | 2001-01-25 | Interleukin Genetics, Inc. | The il-1l1 gene and polypeptide products |
WO2001089549A2 (en) * | 2000-05-22 | 2001-11-29 | Hyseq, Inc. | Therapeutic uses of il-1 receptor antagonist |
US6339141B1 (en) | 1999-05-20 | 2002-01-15 | Hycey Inc. | Interleukin-1 Hy2 materials and methods |
WO2003010291A2 (en) * | 2001-07-25 | 2003-02-06 | Hyseq, Inc. | Treatment of immune disorders and b cell disorders |
US6521422B1 (en) | 1999-08-04 | 2003-02-18 | Amgen Inc. | Fhm, a novel member of the TNF ligand supergene family |
US6599716B1 (en) | 1999-08-04 | 2003-07-29 | Amgen Inc. | Nucleic acids encoding NTR3, a member of the TNF-receptor supergene family |
US6627199B1 (en) | 1999-07-09 | 2003-09-30 | Amgen Inc | Isolation, identification and characterization of tmst2, a novel member of the TNF-receptor supergene family |
US7285648B1 (en) | 1998-01-09 | 2007-10-23 | Immunex Corporation | IL-1 delta DNA and polypeptides |
EP2319929A1 (en) * | 1998-12-23 | 2011-05-11 | Genentech, Inc. | IL-1 related polypeptides |
US20110182922A1 (en) * | 2004-02-27 | 2011-07-28 | Vax Consulting | Peptides of il1 beta and tnf alpha and method of treatment using same |
US8323635B2 (en) | 2007-11-14 | 2012-12-04 | General Regeneratives, Ltd. | Methods of using interleukin-1 receptor antagonist as a myeloprotective agent |
WO2015191783A2 (en) | 2014-06-10 | 2015-12-17 | Abbvie Inc. | Biomarkers for inflammatory disease and methods of using same |
US9339528B2 (en) | 2009-10-26 | 2016-05-17 | General Regeneratives, Ltd. | Methods for treating epithelium trauma of the intestinal mucosa using interleukin-1 receptor antagonist |
Citations (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
EP0343684A1 (en) | 1988-05-27 | 1989-11-29 | Synergen, Inc. | Interleukin-1 inhibitors |
WO1991017249A1 (en) | 1990-05-01 | 1991-11-14 | Cetus Corporation | Interleukin-1 antagonist and uses thereof |
Family Cites Families (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CA2287254A1 (en) * | 1997-04-21 | 1998-10-29 | Schering Corporation | Mammalian cytokines; related reagents and methods |
AU759375B2 (en) * | 1998-01-09 | 2003-04-10 | Immunex Corporation | IL-1 delta DNA and polypeptides |
-
1999
- 1999-04-05 CA CA002326066A patent/CA2326066A1/en not_active Abandoned
- 1999-04-05 WO PCT/US1999/004291 patent/WO1999051744A2/en active IP Right Grant
- 1999-04-05 AU AU34495/99A patent/AU769262B2/en not_active Ceased
- 1999-04-05 JP JP2000542457A patent/JP2002510492A/en active Pending
- 1999-04-05 EP EP99916115A patent/EP1068321A2/en not_active Withdrawn
- 1999-04-05 IL IL13857699A patent/IL138576A0/en unknown
Patent Citations (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
EP0343684A1 (en) | 1988-05-27 | 1989-11-29 | Synergen, Inc. | Interleukin-1 inhibitors |
WO1991017249A1 (en) | 1990-05-01 | 1991-11-14 | Cetus Corporation | Interleukin-1 antagonist and uses thereof |
Non-Patent Citations (7)
Title |
---|
BEG ET AL., MOL. CELL BID., vol. 13, 1993, pages 3301 - 3310 |
COLLINS ET AL., TRENDS CARDIOVASC. MED., vol. 3, 1993, pages 92 - 97 |
KRASNOW ET AL., CYTOKINE, vol. 3, 1991, pages 372 - 379 |
LIOU ET AL., CURR. OPIN. CELL BIOL., vol. 5, 1993, pages 477 - 487 |
NATANSON ET AL.: "Endotoxin and Tumor Necrosis Factor Challenges in Dogs Simulate the Cardiovascular Profile of Human Septic Shock", J. EXP. MED., vol. 169, 1989, pages 823 |
PARRILLO, J. E. ET AL.: "Textbook of Critical Care", 1989, SAUNDERS PUBLISHING CO., article "Septic Shock in Humans: Clinical Evaluation, Pathogenesis, and Therapeutic Approach", pages: 1006 |
VOLLRATH ET AL., SCIENCE, vol. 258, 1992, pages 52 - 59 |
Cited By (29)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US7285648B1 (en) | 1998-01-09 | 2007-10-23 | Immunex Corporation | IL-1 delta DNA and polypeptides |
WO2000020595A1 (en) * | 1998-10-08 | 2000-04-13 | Zymogenetics, Inc. | Interleukin-1 homolog |
US8628777B2 (en) | 1998-12-23 | 2014-01-14 | Genentech, Inc. | Antibodies binding IL-1 related polypeptides |
US7951916B2 (en) | 1998-12-23 | 2011-05-31 | Genentech, Inc. | Il-1 related polypeptides |
EP2319929A1 (en) * | 1998-12-23 | 2011-05-11 | Genentech, Inc. | IL-1 related polypeptides |
US6339141B1 (en) | 1999-05-20 | 2002-01-15 | Hycey Inc. | Interleukin-1 Hy2 materials and methods |
US6365726B1 (en) | 1999-05-20 | 2002-04-02 | Hyseq, Inc. | Polynucleotides encoding IL-1 Hy2 polypeptides |
US6372892B1 (en) | 1999-05-20 | 2002-04-16 | Hyseq, Inc. | Interleukin—1 Hy2 materials and methods |
WO2000071719A1 (en) * | 1999-05-20 | 2000-11-30 | Hyseq, Inc. | Interleukin-1 hy2 materials and methods |
WO2001002571A3 (en) * | 1999-07-07 | 2001-05-31 | Hyseq Inc | An interleukin-1 receptor antagonist and uses thereof |
WO2001002571A2 (en) * | 1999-07-07 | 2001-01-11 | Hyseq, Inc. | An interleukin-1 receptor antagonist and uses thereof |
US7320796B2 (en) | 1999-07-09 | 2008-01-22 | Amgen Inc. | Isolation, identification and characterization of tmst2, a novel member of the TNF-receptor supergene family |
US6627199B1 (en) | 1999-07-09 | 2003-09-30 | Amgen Inc | Isolation, identification and characterization of tmst2, a novel member of the TNF-receptor supergene family |
WO2001005974A3 (en) * | 1999-07-16 | 2001-05-10 | Interleukin Genetics Inc | The il-1l1 gene and polypeptide products |
WO2001005974A2 (en) * | 1999-07-16 | 2001-01-25 | Interleukin Genetics, Inc. | The il-1l1 gene and polypeptide products |
US6521422B1 (en) | 1999-08-04 | 2003-02-18 | Amgen Inc. | Fhm, a novel member of the TNF ligand supergene family |
US7544519B2 (en) | 1999-08-04 | 2009-06-09 | Amgen Inc. | Fhm a novel member of the TNF ligand supergene family: materials and methods for interaction modulators |
US7118863B2 (en) | 1999-08-04 | 2006-10-10 | Amgen, Inc. | Methods for detecting NTR3 nucleic acids by hybridization |
US6852839B2 (en) | 1999-08-04 | 2005-02-08 | Amgen, Inc. | Fhm, a novel member of the TNF ligand supergene family |
US6599716B1 (en) | 1999-08-04 | 2003-07-29 | Amgen Inc. | Nucleic acids encoding NTR3, a member of the TNF-receptor supergene family |
WO2001089549A2 (en) * | 2000-05-22 | 2001-11-29 | Hyseq, Inc. | Therapeutic uses of il-1 receptor antagonist |
WO2001089549A3 (en) * | 2000-05-22 | 2003-07-10 | Hyseq Inc | Therapeutic uses of il-1 receptor antagonist |
WO2003010291A3 (en) * | 2001-07-25 | 2004-02-19 | Hyseq Inc | Treatment of immune disorders and b cell disorders |
WO2003010291A2 (en) * | 2001-07-25 | 2003-02-06 | Hyseq, Inc. | Treatment of immune disorders and b cell disorders |
US20110182922A1 (en) * | 2004-02-27 | 2011-07-28 | Vax Consulting | Peptides of il1 beta and tnf alpha and method of treatment using same |
US8632781B2 (en) * | 2004-02-27 | 2014-01-21 | Vaxconsulting | Immunogenic compounds comprising peptides of IL1β |
US8323635B2 (en) | 2007-11-14 | 2012-12-04 | General Regeneratives, Ltd. | Methods of using interleukin-1 receptor antagonist as a myeloprotective agent |
US9339528B2 (en) | 2009-10-26 | 2016-05-17 | General Regeneratives, Ltd. | Methods for treating epithelium trauma of the intestinal mucosa using interleukin-1 receptor antagonist |
WO2015191783A2 (en) | 2014-06-10 | 2015-12-17 | Abbvie Inc. | Biomarkers for inflammatory disease and methods of using same |
Also Published As
Publication number | Publication date |
---|---|
WO1999051744A3 (en) | 2000-03-30 |
JP2002510492A (en) | 2002-04-09 |
CA2326066A1 (en) | 1999-10-14 |
AU3449599A (en) | 1999-10-25 |
IL138576A0 (en) | 2001-10-31 |
AU769262B2 (en) | 2004-01-22 |
EP1068321A2 (en) | 2001-01-17 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
US6337072B1 (en) | Interleukin-1 receptor antagonist and recombinant production thereof | |
AU769262B2 (en) | A interleukin-1 receptor antagonist and uses thereof | |
US6541623B1 (en) | Interleukin—1 receptor antagonist and uses thereof | |
US6339141B1 (en) | Interleukin-1 Hy2 materials and methods | |
EP1179068B1 (en) | Interleukin-1 hy2 materials and methods | |
US6884872B1 (en) | Methods and compositions relating to CD39-like polypeptides and nucleic acids | |
US6294655B1 (en) | Anti-interleukin-1 receptor antagonist antibodies and uses thereof | |
US6392018B1 (en) | EGF MOTIF protein obtained from a cDNA library of fetal liver-spleen | |
US6426191B1 (en) | Assays involving an IL-1 receptor antagonist | |
US6392019B1 (en) | Antibodies specific for EGF motif proteins | |
US20020156009A1 (en) | Novel interleukin - 1 Hy2 materials and methods | |
US20040059098A1 (en) | Egf motif protein, egfl6 materials and methods | |
US6800443B2 (en) | Method of detecting a cancerous cell expressing an EGF motif polynucleotide | |
US6899875B1 (en) | Methods and compositions relating to CD39-like polypeptides and nucleic acids | |
US6780977B1 (en) | Methods and compositions relating to CD39-like polypeptides and nucleic acids | |
WO1999032631A1 (en) | CHEMOKINE OBTAINED FROM A cDNA LIBRARY OF FETAL LIVER-SPLEEN | |
US20020107386A1 (en) | Methods and compositions relating to bone-derived growth factor-like polypeptides | |
US20020081625A1 (en) | Member of the immunoglobulin superfamily and uses thereof | |
EP1114159A1 (en) | Methods and compositions relating to egf-repeat-containing polypeptides | |
WO2000073320A1 (en) | A NOVEL CHEMOKINE OBTAINED FROM A cDNA LIBRARY OF FETAL LIVER-SPLEEN | |
WO1999045117A2 (en) | Interferon, ifn-hy and uses thereof | |
MXPA00009515A (en) | A interleukin-1 receptor antagonist and uses thereof |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
WWE | Wipo information: entry into national phase |
Ref document number: 138576 Country of ref document: IL |
|
WWE | Wipo information: entry into national phase |
Ref document number: 09348942 Country of ref document: US |
|
AK | Designated states |
Kind code of ref document: A2 Designated state(s): AE AL AM AT AU AZ BA BB BG BR BY CA CH CN CU CZ DE DK EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MD MG MK MN MW MX NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT UA UG UZ VN YU ZW |
|
AL | Designated countries for regional patents |
Kind code of ref document: A2 Designated state(s): GH GM KE LS MW SD SL SZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG |
|
121 | Ep: the epo has been informed by wipo that ep was designated in this application | ||
DFPE | Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101) | ||
AK | Designated states |
Kind code of ref document: A3 Designated state(s): AE AL AM AT AU AZ BA BB BG BR BY CA CH CN CU CZ DE DK EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MD MG MK MN MW MX NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT UA UG UZ VN YU ZW |
|
AL | Designated countries for regional patents |
Kind code of ref document: A3 Designated state(s): GH GM KE LS MW SD SL SZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG |
|
WWE | Wipo information: entry into national phase |
Ref document number: 09576008 Country of ref document: US |
|
ENP | Entry into the national phase |
Ref country code: JP Ref document number: 2000 542457 Kind code of ref document: A Format of ref document f/p: F |
|
WWE | Wipo information: entry into national phase |
Ref document number: PA/a/2000/009515 Country of ref document: MX |
|
ENP | Entry into the national phase |
Ref document number: 2326066 Country of ref document: CA Ref country code: CA Ref document number: 2326066 Kind code of ref document: A Format of ref document f/p: F |
|
NENP | Non-entry into the national phase |
Ref country code: KR |
|
WWE | Wipo information: entry into national phase |
Ref document number: 1999916115 Country of ref document: EP |
|
WWE | Wipo information: entry into national phase |
Ref document number: 34495/99 Country of ref document: AU |
|
WWP | Wipo information: published in national office |
Ref document number: 1999916115 Country of ref document: EP |
|
REG | Reference to national code |
Ref country code: DE Ref legal event code: 8642 |
|
WWG | Wipo information: grant in national office |
Ref document number: 34495/99 Country of ref document: AU |