WO1999045017A1 - Methyl red energy transfer reagent for dna analysis - Google Patents

Abstract

An energy transfer reagent for DNA analysis, the reagent comprising a fluorophore and methyl red acceptor.

Description

METHYL RED ENERGY TRANSFER REAGENT FOR DNA ANALYSIS

The present invention relates to improved methods for the labelling of oligonucleotides. In particular it relates to methyl red labelled oligonucleotides and to methyl red - controlled pore glass substrates for use in the labelling of oligonucleotides.

A variety of prior art methods are available for labelling oligonucleotides. These include enzymatic methods wherein for example a terminal transferase is used to add a modified dNTP to the 3' terminus of an oligonucleotide. Such modified dNTP is then used to attach a label. Alternatively a terminal nucleotide of an oligonucleotide is chemically modified to provide a functional moiety such as an amino or sulphydryl group for reaction with a group on the label to be attached.

There are many techniques for detecting specific nucleic acid sequences by the hybridisation of a labelled oligonucleotide probe of complementary sequence to the target sequence and then detecting the probe label. Many assays are in non-homogeneous format meaning that excess or unbound probe must be removed from the assay before the bound probe can be detected and quantified. Such techniques include Southern blotting and the many enzyme- linked immunosorbent assay (ELISA) based methods. The label can be a radionucleid, a hapten (e.g. digoxygenin, dinitrophenyl), a fluorophore (e.g. fluorescein, europium cryptate) or an enzyme (e.g. alkaline phosphatase, horseradish peroxidase). More recently homogenous (no wash) assays have been developed for PCR product detection which are advantageous because they tend to be simpler to perform than non- homogeneous assays, lend themselves to automation, remove the need to run gels and reduce the risk of cross-over contamination. Examples of homogeneous assays include fluorescence polarisation (EP-B1-0382433), intercalative fluorescence, TaqMan (US-A-5487972 & US-A- 5210015) and Molecular Beacons (WO-95/13399). In the last two methods, donor and acceptor - fluorophore/quencher species need to be attached to oligonucleotides. The need still exists for further labelled probes of these types and simpler ways of making these.

A number of fluorophore/quencher pairs are detailed in the literature (Glazer et al, Current Opinion in Biotechnology, 1997, 8, 94-102) and in catalogues such as those from Molecular Probes, Glen, and Applied Biosystems (ABI). For example, fluorescein derivatives such as 5- carboxy fluorescein (FAM), tetrachlorofluorescein (TET) and hexachlorofluorescein (HEX) may be used in combination with tetramethylrhodamine (TAMRA).

We have now unexpectedly discovered that methyl red is a useful quencher in fluorophore/quencher dual-labelled oligonucleotides.

Therefore in a first aspect of the invention we provide an energy transfer reagent for DNA analysis, the reagent comprising a fluorophore and methyl red acceptor.

The fluorophore donor is conveniently a fluorescein derivative, such as FAM, HEX or TET. The energy transfer reagent is preferably an olignucleotide, for example a probe or primer.

Oligonucleotides include synthetic single strands of nucleic acid and are of any convenient length for its intended purpose, for example up to about 200 or about 100 nucleotides in length, or such as up to 10, 20, 30 , 40, 50 or 60 nucleotides in length. For probes, such as TaqMan probes, preferred oligonucleotides comprise about 20-30 nucleotides, such as about 20-25 nucleotides. For primers, these preferably comprise about 25-35 nucleotides, such as about 30 nucleotides. For Molecular Beacons probes (discussed in more detail hereinafter), these preferably comprise about 35-70 nucleotides, such as about 40-60 nucleotides. Convenient methods for oligonucleotide synthesis, such as those using an automated DNA synthesiser are well known in the art (Randolph et al, Nucleic Acids Research, 1997, 25, 14). The fluorophore and methyl red quencher are preferably attached to the 5' and 3' terminii of the oligonucleotide probe respectively. Alternative attachment points may be envisaged, for example when devising a TaqMan probe but, in general and certainly for Molecular Beacons probes the 5' and 3' termini are the preferred points of attachment (Tyagi et al, Nature Biotechnology, 1996, _.14, 303-308). In a further aspect of the invention we provide, as a novel intermediate, an oligonucleotide comprising a methyl red quencher attached at the 3' terminus. The oligonucleotide is as defined earlier above. The oligonucleotide is preferably of the formula XV set out hereinafter and derivatives thereof. -3-

We prepared Molecular Beacons oligonucleotide probes comprising a fluorophore donor and a methyl red quencher. These probes perform well and form a preferred aspect of the present invention.

In addition we have found that methyl red may be conveniently attached to an oligonucleotide via a methyl red controlled pore glass (CPG) resin intermediate. CPG is used in oligonucleotide synthesis, however we have capitalised on its usefulness in a simple and elegant method. In a further aspect of the invention we provide methyl red - controlled pore glass of the formula XII wherein CPG represents controlled pore glass, n is an integer between 3 and 8, and DMTO represents a protecting group such as a dimethoxytrityl group.

(XII)

H-N N CPG / \

The intermediate products

H | XX

_/ <CH₂)

TO y^{^} O N

OH II N

(XIII) V N

/ \ -4-

and

(CH₂)_n

wherein DMTO is as defined above and n is an integer between 3 and 8 are novel and each represents a further aspect of the present invention. In any of the above aspects of the invention, n is conveniently 3, 4, 5 or 6, preferably 3 or

4, more preferably 4.

In a further aspect of the invention we provide a method for preparing a methyl red labelled oligonucleotide of the formula XN (as set out below), which method comprises cleaving a compound of the Formula XII (as set out below) from the controlled pore glass. CPG represents controlled pore glass, n is an integer between 3 and 8, and DMTO represents a protecting group such as a dimethoxytrityl group.

Y Oligonucleotide^ -

o H I O' Ν

OH II Ν

⁰ (XII)

H-Ν Ν

^XCPG ^{/ X}

Cleavage is preferably hydrolytic cleavage, for example using base. The Molecular Beacons probes of this invention are conveniently DNA probes. Alternatively they may comprise one or more 2-methyl RNA bases, indeed the whole probe may comprise 2-methyl RNA, all as claimed in our UK patent application no. 9715522.0 entitled "Assays", filed 24^th July 1997, the contents of which are incorporated herein by reference. The invention will now be illustrated but not limited by reference to the following Figures and Examples wherein:

Figure 1 shows Molecular Beacons probes comprising probe sequence, stem loop and linker sequences with fluorophore (F) and quencher (Q) attached, and indicates the fluorophore/quencher interaction. In A, the Beacon is not bound to a target sequence. The fluorophore and Beacon are in close proximity, the fluorphore is quenched by the Beacon. In B, the Beacon is bound to a target sequence. The fluorophore and Beacon are separated, the fluorophore is less efficiently quenched.

Figure 2 shows in outline how an oligonucleotide, methyl red and controlled pore glass are linked and how the methyl red labelled oligonucleotide is cleaved from the controlled pore glass.

Figure 3 shows meltcurves of a Molecular Beacon in the absence and the presence of a matched and partially mismatched template. The Beacon and a 20-fold excess of a target oligonucleotide sequence were mixed in an appropriate buffer and placed in a well of a 96 well plate, then heated to 94°C in an Applied Biosystems 7700 cycling fluorimeter. The target may be entirely complementary to the Beacon, complementary to the loop portion of the Beacon, partially complementary to the loop portion (ie. contain mismatches) or be non-complementary.

At 94 °C the Beacon is dissociated from its target and is believed to have adopted a random coil conformation with the Beacon stretched out and yielding a relatively high fluorescence (see value at 90 °C on graph). As the solution cools, the Beacon tends to close into its hairpin conformation and the fluorescence drops (see no-template curve on the chart). If however complementary target is present, at a certain temperature the Beacon begins to hybridise to the target, stretching it out again and the fluorescence rises again. The greater the complementarity between the Beacon and the target, the higher the temperature at which the Beacon binds. Eventually, as the solution -6-

continues cooling, the Beacon is thermodynamically more stable in its closed hairpin conformation than bound to the target and the fluorescence begins to drop again.

Matched template:

TCTCAAAGGGCTTCTGATGTCCTACATTTGAATCTAATGG Mismatched template:

TCTCAAAGGGCTTCTGATTTACTACATTTGAATCTAATGG

Beacon:

GCGAG*CGATTCAAATGTAGGACATCAGAAGCCCTGCTCGCT

*= Thio linkage, underlined represents complementarity between templates and beacon. Figure 4 shows the use of a methyl red labelled Beacon to detect the build up of a PCR product in real time during a PCR amplification. Full details are given in Example 2. The X-plot is PCR cycle number, the Y-plot is ΔRn being the ratio of fluorescence versus wavelength for the no template control and genomic (POS) template samples.

In the Examples the following abbreviations are used:

DCM Dichloromethane

HOBT Hydroxybenzotriazole

DCC dicyclohexylcarbodiimide

DMAP Dimethylaminopyridine

DIPEA diisopropylethylamine

EDC ethylene dichloride OR ethylcarbodiimide [or l-(3-dimethylaminopropyl)-

3-ethylcarbodiimide hydrochloride] need to see context

DMT dimethoxytrityl

TMSCI trimethyl silyl chloride

DMF dimethylformamide

DMTO dimethoxytrityloxy -7-

Example 1

Synthesis of Methyl Red CPG Resin

OH

(X) (IX)

1 ,2-Isopropy lidenylhexane-1 ,2,6-triol (IX)

1 ,2,6-Trihydroxyhexane (lOOg, 746.3mmol) (compound X) was dissolved in dry acetone (800ml), cone. HC1 (17ml) was then added followed by anhydrous sodium sulphate (430g,

3613mmol) and the reaction was stirred overnight. Basic lead carbonate (280g, 360mmol) and sodium carbonate (4.16g, 50mmol) were added to the mixture which was again stirred overnight. This was filtered, evaporated to dryness and sodium carbonate (4g, 48.2mmol) was added to the residue before being distilled under reduced pressure (bp=102°C at 0.5mmHg) to give the desired compound (IX) (93.06, 72%) as a colourless oil. Rf=0.15 (25% EtO Ac/toluene, anisaldehyde). v_max/cm'(nujol), 3420 (broad OHstr), 2995-2886 (aliphatic CHstr); δl_H (300MHz, CDC1₃) 1.33 (s, 3H, CH₃ of isopropylidene), 1.39 (s, 3Η, CH₃ of isopropylidene), 1.40-1.90 (m, 6Η, CH₂CH, CH₂, CH₂CΗ₂OΗ), 2.03 (s, 1H, OH), 3.50 (t, 1Η, CH, J=6.9Ηz), 3.62 (t, 2H, CH₂OH, J=6.3Hz), 3.98- 4.10 (m, 2H, CH₂O); δl3_c (75.5MΗz, CDC1₃) 22.18 (CH₂CH₂OH), 25.86, 27.07 (CH₃ of isopropylidene), 32.73 (CH₂), 33.39 (CH₂CH), 62.70 (CH₂OH), 69.57 (CΗ₂O), 76.16 (CH),

108.85 (CMe₂); MS (ES⁺) m/z/amu, 197 (MTSfa), 175 (MΗ), 157 (M⁺-OH), 128 (M⁺H-OH^Me); Accurate FAB found 175.1334197 C₉H₁₉O₃ requires 175.133420.

6-p-Toluenesulphonyl-l,2-isopropyIidenylhexane-l,2,6-triol (VIII) The alcohol, compound IX (50.18g, 288mmol) was dissolved in freshly distilled pyridine (100ml) and cooled in a cold water bath and a solution of tosyl chloride (55.65g, 292mmol) in pyridine (150ml) was added dropwise. The reaction was allowed to warm to room temperature and stirring was continued for 1.5 hours after which time TLC showed the reaction to be near completion but some starting material still remained. Stirring was continued for a further 1 hour after which time TLC showed that no change had taken place. The mixture was filtered, evaporated to dryness and the residue dissolved in DCM. This was then washed (NaHCO₃), dried (Na₂SO₄) and evaporated to dryness to give compound VIII (99.8 lg) as a pale yellow oil which was used immediately in the next reaction without purification. Rf=0.56 (25% EtO Ac/toluene, molybdate). v_max/cm^"1 (nujol) 1214, 1057 (SOstr) δl_H (200MHz, CDC1₃) 1.30 (s, 3H, CH₃ of isopropylidene), 1.32 (s, 3Η, CH₃ of isopropylidene), 1.35-1.75 (m, 6Η, CH₂CH, CH₂, CH₂CΗ₂OTs), 2.45 (s, 3H, CH₃ of OTs), 3.45-3.60 (m, 1Η, CH), 3.96-4.15 (m, 4Η, CH₂O, CH₂OTs), 7.32 (d, 2H, CHof OTs, J=8Ηz), 7.75 (d, 2H, CHof OTs, J=8Ηz); 513_c (75.5MHz, CDC1₃) 21.93 (CH₃ of OTs), 23.33 (CΗ₂CH₂OTs), 25.86, 27.10 (CH₃ of isopropylidene), 32.65 (CH₂), 44.92 (CH₂CH), 69.47 (CH₂OTs), 69.54 (CH₂O), 75.96 (CH), 108.91 (CMe₂), 128.04, 128.38 (C₃ of Ts), 129.18, 130.0 (C₂ of Ts), 138.00 (C₄ of Ts), 144.87 (C, of Ts); MS (ES⁺) m/z/amu, 351 (M⁺Na), 329 (MΗ), 271 (M⁺-Me-CMe₂); Accurate FAB found 328.1344460 C₁₆H₂₄SO₅ requires 328.134449.

(VIII) (VII)

l,2-Isopropylidenyl-6-phthalimido-l,2-dihydroxyhexane (VII)

Potassium phthalimide (59.23g, 320mmol) was added to a solution of the tosylate, coompound VIII (95.5g, 291mmol) in DMF (400ml). The reaction mixture was then heated at 75°C with stirring for 4 hours after which time TLC showed the reaction to be complete. The mixture was then cooled overnight, evaporated to dryness, and co-evaporated with toluene. The residue was then separated between DCM and saturated KCl_(aq) solution, dried (Na₂SO₄) and evaporated to dryness. The residual oil was purified by column chromatography on silica gel eluting with hexane/ethyl acetate (1:1) to give compound VII (67.51g, 77% overall) as a waxy white solid. R_f=0.55, (EtOAc/hexane 9:1, molybdate); v_max/cm-'(nujol),1717, 1679 (sym & asym C-Ostr); δl_H (300MHz, CDC1₃) 1.32 (s, 3H, CH₃ of isopropylidene), 1.39 (s, 3Η, CH₃ of isopropylidene), 1.40- 1.82 (m, 6Η, CH₂CH, CH₂, CH₂CΗ₂Pht), 3.50 (m, 1H, CH), 3.70 (t, 2Η, CH₂Pht), 4.05 (m, 2Η, CH₂O), 7.70 (m, 2Η, CHof Pht), 7.85 (m, 2Η, CHof Pht); δl3_c (75.5MΗz, CDC1₃) 23.31 (CH₂CH₂Pht), 25.84, 27.08 (CH₃ of isopropylidene), 32.63 (CH₂), 37.91 (CH₂Pht), 44.90 (CH₂CH), 69.52 (CH₂O), 75.94 (CH), 108.89 (CMe₂), 123.32 (C₃, C₄ of Pht), 132.27 (C„ of Pht), 134.04 (C₂, C₅ of Pht), 168.54 (C=O of Pht); M.S. (ES⁺) m z/amu, 326 (M⁺Na), 304 (MΗ); M.S. (FAB) m/z amu 288(MXCH₃), 272 (MΗ-2xCH₃), 246 (M⁺H-Oisopropylidene), 228 (M⁺H- 2xO-isopropylidene), 160 (Pht CH₂ ⁺), 148 (PhthalimideH⁺). -10-

HO

(VII) (VI)

6-Phthalimidohexane-l,2-diol (VI)

Compound VII (65.85g, 217mmol) was dissolved in distilled THF (300ml) and concentrated HCl (20ml) was added. The mixture was stirred at room temperature for 4 hours after which time a white solid had precipitated out of solution and TLC indicated that the reaction was near completion. More HCl (10ml) was added and stirring was continued for a further 2 hours after which time TLC showed the reaction to be complete. The mixture was evaporated to dryness and co-evaporated with DCM and then dried in a vacuum desiccator over P₂O₅ for 8 hours to gave compound VI (60.62g) as a white solid which was used in the next reaction without purification. Rf=0.27, (EtOAc/hex 9:1, molybdate); v_raax/cm^"1(nujol),1715, 1666 (sym & asym COstr); δl_H (300MHz, d₆-DMSO) 1.10-1.85 (m, 7H, OH, CH₂CH, CH₂, CH₂CΗ₂Pht), 2.10 (s, 1H, OH), 3.25 (m, 2H, CH₂Pht) 3.36 (m, 1Η, CH), 3.55 (m, 2Η, CH₂O), 7.75 (m, 4H, CHof Pht); δl3_c (75.5MHz, d₆-DMSO) 23.11 (CH₂CH₂Pht), 28.26 (CH₂CH), 33.01 (CH₂) 37.57 (CH₂Pht), 66.00 (CH₂O), 70.96 (CH), 123.03 (C₃, C₄ of Pht), 131.63 (C„ C₆ of Pht), 134. 41 (C₂, C₅ of Pht), 167.98 (C=O of Pht); M.S. (ES⁺) m/z/amu, 286 (M⁺+Na), 263 (M⁺); Accurate FAB found 264.1235833 C_!4H₁₇NO₄ requires 264.123584.

O. /=_Λ

O

OH ^Ψ DMT

O

(VI) (V) -11-

l-(4,4'-Dimethoxytrityl)-6-phthalimidohexane-l,2-diol (V)

Compound VI (59.37g, 226mmol) and DMAP (1.28g, 10.5mmol) were co-evaporated three times with freshly distilled dry pyridine and then dissolved in pyridine (150ml). Dimethoxytrityl chloride (76.7g, 226.6mmol) was then added (a small portion was added first, (~5g) and stirred for ~ 20 minutes and then the rest was added) followed by a further volume of pyridine (50ml). The reaction was then stirred under argon at room temperature for 4 hours. After this time TLC showed the reaction to be complete. The mixture was filtered, reduced in volume and the residue was dissolved in DCM. The solution was washed (saturated sodium bicarbonate solution, then water), dried (Na₂SO₄) and evaporated to dryness. The residue was co-evaporated several times with toluene and the residue was purified by column chromatography on pre-equilibrated silica gel (EtOAc/hexane/Et₃N 1:4:0.05) eluting with EtOAc/hexane (1:4). This gave the product, compound V (86g, 68%) as a white foam after drying in a vacuum desiccator over P₂O₅; Rf=0.46 (hexane/ethyl acetate 1:1, H₂SO₄/EtOH), v_^/crn ' iujol) 3461 (br OHstr), 1710, 1607 (sym & asym C=Ostr); δl_H (300MHz, CDC1₃) 1.30-1.80 (m, 6H, CH₂CH, CH₂, CH₂CΗ₂Pht), 2.25-2.55 (bs, IH, OH), 3.00-3.25 (m, 1Η, CH), 3.60-4.00 (s+m, 10Η, CH₃ of DMT, CH₂ODMT, CH₂Pht), 6.85 (d, 4Η, CHof ArOMe), 7.15-7.50 (m, 9Η, CHof ArOMe, CHof Ph), 7.55-7.85 (m, 2Η, CH of Pht), 7.80-7.95 (m, 2Η, CHof Pht); δl3_c (75.5MΗz, CDC1₃) 23.00 (CH₂CH₂Pht), 28.71 (CH₂), 33.01 (CH₂CH), 37.99 (CH₂Pht), 55.37 (CH₃OAr), 67.70 (CH₂ODMT), 70.89 (CH), 86.22 (C(ArOMe)₂Ph), 113.29 (C₂ of ArOMe), 123.33 (C₃, C₄ of Pht), 126.96 ( of Ph), 127.99 (C₂ of Ph), 128.29 (C₃ of ArOMe), 130.19 (C₃ of Ph), 132.29 (C„ of Pht), 134.10 (C₂, C₅ of Pht), 136.20 (C, of Ph), 145.00 (C, of ArOMe), 158.62 (C₄of ArOMe), 168.58 (C=O of Pht); M.S. (EL) m z/amu 565 (M⁺), 303 (DMT⁺), 160 (PhtCH₂ ⁺).

(V) (IV) -12-

l-(4,4'-Dimethoxytrityl)-6-aminohexan-l,2-dioI (IV)

Compound V (2.09g, 3.7mmol) was co-evaporated several times with THF and dissolved in THF (20ml). Hydrazine monohydrate (0.41g, 0.4ml, 8.3mmol) was added dropwise to the stirring solution and the reaction was stirred at room temperature under argon overnight. The mixture was then filtered and evaporated to dryness and the residue was dissolved in DCM, washed (saturated sodium bicarbonate solution), dried (Na₂SO₄) and evaporated to dryness to give a white foam which was dried in a vacuum desiccator over P₂O₅ to give the product, compound IV(1.6g, 99%). This was then used directly in the next reaction without further purification. Rf=0.13, iPrOH7EtOAc/NH_3(aq) 1:9:1, anisaldehyde or ninhydrin.

DMTO DMTO

(IV)

l-(4-4'-Dimethoxytrityl)-6-(2"-(4"'-NJV-dimethylaminophenyl-azo)benzamido)hexane-l,2- diol (III)

Compound IV (1.59g, 3.66mmol) was co-evaporated three times with freshly distilled DCM and then dissolved in DCM (9ml). Anhydrous triethylamine (1ml) was then added followed by methyl red (1.03g, 4.13mmol) 1-Hydroxybenzotriazole (0.77g, 5.7mmol) was then added followed by dicyclohexylcarbodiimide (1.1 lg, 5.4mmol) in DCM (1ml). The reaction was stirred under argon for three hours after which time TLC showed the reaction to be complete. The mixture was filtered, diluted with DCM, washed (sat.NaHCO_3(aq), 2M NaOH_(aq)), dried (Na₂SO₄) and evaporated to dryness. The residual foam was purified by column chromatography on pre- equilibrated silica gel (DCM/Et₃N) eluting with DCM/EtOAc 9:1 to give compound III (1.12g, 45%) as a red foam. Rf_{cpd I}„=0.75, Rf_Met„_Red=0.64, Rf_{cpd IV}=baseline, EtO Ac, Rf_{cpd m}=0-64, -13-

Rf_MethRed=0-55, Rf_{cpd IV}=baseline, DCM/EtOAc, 1 :1, Rf_{cpd πι}=0.86, Rf_Me(hRed=baseline, Rf_{cpd IV}=0.14, iPrOH/EtOAc/NH_3(aq) 1:9:1, compox d III ran as an orange spot, methyl red ran as a red spot. Anisaldehyde or ninhydrin was used to detect compound IV. δl_H (300MHz, CDC1₃) 0.95- 104 (m, 8H, CH₂CH, CH₂CH₂CH, CH₂CH₂NHCO, CH₂NHCO), 2.35 (bd, IH, OH), 3.0 (s+m, 7Η, CH₃ of NMe₂, CH), 3.4 (m, 2Η, CH₂ODMT), 3.7 (s, 6Η, CH₃ of DMT), 6.5-6.8 (2d, 6Η, CH of ArOMe, H₃„.), 7.05-7.4 (m, 11Η, CHof ArOMe, CHof Ph, H , H₄„), 7.65-7.75 (d+m, 3Η, H₂,„, H₅χ 8.3 (m, 1Η, H₂„), 9.1 (bt, 1Η, NH); δl3_c (75.5MΗz, CDC1₃) 23.41 (CH₂CH₂NHCO), 29.89 (CH₂CH₂CH), 33.23 (CH₂CH), 34.13 (CH₂NHCO), 40.42 (N(CH₃)₂), 55.37 (CΗ₃ of DMT), 67.71 (CH₂ODMT), 70.92 (CH), 86.22 (C(ArOMe)₂Ph), 111.75 (C₃,„), 113.27 (C₂ of ArOMe), 116.07 (C₅X 125.86 (C,..), 126.97 (C₂..), 127.99 (C₂ of Ph), 128.26 (C₃ of ArOMe), 129.67 (C₂L), 130.17 (C₃ of Ph), 131.53 (C₃,.), 131.70 (C₄..), 136.15 (C, of Ph), 143.54 (C,-.), 144.99 (C, of ArOMe), 153.24 (Cy, 158.62 (C₄ of ArOMe), 166.30 (CO); M.S. (ES⁺) m/z amu 709 (M⁺Na), 687 (MΗ), 303 (DMT⁺); Accurate FAB found 709.3365908 C₄₂H₄₆N₄NaO₅ requires 709.336590.

DMTO

l-(4,4'-Dimethoxytrityl)-2-succinyI-6-(2"-(4'"-N^V-dimethyI- aminophenylazo)benzamido)hexane-l,2-diol (II)

Compound III (1.09g, 1.56mmol) was co-evaporated three times with anhydrous pyridine and then dissolved in pyridine (5ml). DMAP (50mg, 0.41mmol) was then added followed by succinic anhydride (0.46g, 4.6mmol). The reaction was then stirred under argon overnight at room temperature. The mixture was separated between DCM and sat. KCl_(aq), dried (Na₂SO₄) and evaporated to dryness. The residue was purified by column chromatography on pre-equilibrated silica gel (DCM/NEt₃) eluting with DCM/MeOH 9:1. This gave compound II (0.68g, 57%) as an -14-

orange/red foam. δl_H (300MHz, CDC1₃) 1.10-1.35 (t+m, 13H, CH₂CH₂CH, CH₂CH₂NH, CH₃ of NEt₃, J=7.9Ηz), 1.40-1.7 (m, 4H, CH₂CH, CH₂CH₂NHCO), 2.5-2.7 (m, 4H, CH₂CO₂H, CH₂CO₂CH), 2.9 (q, 6H, CH₂ of NEt₃, J=7.9Ηz), 3.0 (s+m, 7H, CH₃ of NMe₂, CH), 3.35 (m, 2Η, CH₂ODMT), 3.7 (s, 6Η, CH₃ of DMT), 5.0 (bt, 1Η, NHof _ NE.₃), 6.65-6.75 (m, 6Η, CHof ArOMe, H₃.,.), 7.05-7.45 (m, 11Η, CHof ArOMe, CHof Ph, H₄„, H ), 7.7 (m, 3Η, H₂,„, H₅,.), 8.25 (m, 1Η, H ), 9.05 (bt, 1Η, NH); dl3_c (75.5MΗz, CDC1₃) 8.76 (CH₃ of NEt₃), 22.93 (CH₂CH₂NHCO), 29.74 (CH₂CH₂CH), 30.81 (CH₂CH) 31.25 (CH₂NHCO), 40.16 (CH₂CO₂H, CH₂CO₂CH), 40.41 (N(CH₃)₂), 45.26 (CH₂ of NEt₃), 55.34 (CH₃ of DMT), 64.78 (CH₂ODMT), 72.80 (CH), 85.84 (C(ArOMe)₂Ph), 111.82 (C .), 113.20 (C₂ of ArOMe) 116.07 (C₅.,), 125.86 (C_r), 126.82 (C₂A, 127.91 (C₂ of Ph), 128.26 (C₃ of ArOMe), 129.59 (C₂„), 130.14 (C₃ of Ph), 131.48 (C₃„), 131.72 (C₄„), 136.21 (C, of Ph), 143.45 (C,-.), 145.02 (C, of ArOMe), 153.32 (C₄»), 158.57 (C₄ of ArOMe), 166.39 (NHC=O), 173.09 (CO₂CH), 177.06 (CO₂H); M.S. (ES⁺) m/z/amu 809 (M⁺Na), 787 (MΗ), 507 (M⁺HNa-DMT), 463 (M⁺HNa-DMT-NMe₂), 303 (DMT).

l-0-(4,4'-Dimethoxytrityl)-6-(2"-(4'"-N,N-dimethlaminophenyIazo) hexyI-2-O-succinyl CPG resin (I).

All glassware was intially soaked in 5% TMSCI/DCM solution for ~H hour and then rinsed with acetone, water and finally acetone. The resin (2.0 lg) was washed with a solution of 1% diisopropylethylamine in DCM and then dried (in a sintered funnel at the water pump) to liberate the free amine. -15-

Compound III (0.404g, 0.51 mmol) was dissolved in the minimum of 1% diisopropylethylamine in DMF solution and dimethylaminopropyl-3-ethylcarbodiimide hydrochloride (0.054g, 0.26mmol) was added. The resin (2g) was added to the solution and enough 1% diisopropylethylamine in DMF solution was added to cover the solid so that it could be shaken gently intermittently for 2 hours. After this time the resin filtered, washed with 1% diisopropylethylamine in DCM solution and dried in the sinter funnel. More Compound III (0.47g, 0.598mmol) was dissolved in the minimum of 1% DIPEA in DMF and EDC (0.053g, 0.28mmol) was added. The partially functionalised resin was then added and reaction shaken as before for a further 2 hours. A sample of the resin was removed, filtered and washed (1% DIPEA/DCM) and a sample (9.9mg) of this was dissolved in HC 1 /EtOH (3 :2 v:v) solution to a volume of 25ml and shaken for ~5 minutes. The absorbance of 1ml of the orange solution was measured at 495nm and the loading was calculated as shown:- absorbance for 1ml = 0.7549 absorbance for 25ml = 0.7549 x 25ml = 18.8725 lμmol of DMT⁺= 71.7 abs for 25ml at 495nm

18.8725 / 71.7 = 0.263μmol for 0.0099g of resin loading = 0.263 / 0.0099 = 27μmolg-' of DMT⁺ The resin was filtered and washed with 1% diisopropylethylamine in DCM solution three times. This was then soaked in cap A/cap B (1:1) for 1 hour, then washed with 1% diisopropylethylamine in DCM solution and finally ether. The resin was dried to give Compound I (1.85g). The resin was then tested for DMT⁺ loading as before.

Weight of sample = 6. lmg absorbance for 1ml = 0.4787 loading = 27μmolg-¹ of DMT⁺ This was then used in 0.2μmol scale probe synthesis with each column containing ~ 15mg of resin. -16-

Oligonucleotide^

Example 2 Use of methyl red - controlled pore glass to label Molecular Beacons oligonucleotide probes

The Molecular Beacons technique uses oligonucleotide probes with two labels and three sequence domains (see Figure I ). Reading from the 5' end, the first domain is a series of nucleotides non-complementary to the DNA sequence to be detected but capable of base pairing with a complementary nucleotide sequence at the probe's 3' end in order to form a stem loop. The 5' end of the probe is labelled with one of the components of a quencher-fluorophore pair. The second domain is an oligonucleotide sequence complementary to the DNA sequence to be detected and capable of hybridising to this target to form a double helix. The third domain is a series of nucleotides non-complementary to the DNA sequence to be detected but capable of base pairing with the complementary nucleotides at the probe's 5' end in order to form the stem loop. The 3' end of the probe is labelled with the second of the components of the quencher- fluorophore pair.

In the absence of the nucleic acid target for the beacon it forms a stem loop structure which enforces the close spatial proximity of the two components of the quencher-fluorophore pair so that the fluorescence of the fluorophore is substantially quenched. In the presence of the nucleic acid target the complementary region of the beacon binds and enforces the separation of the two components of the quencher-fluorophore pair so that the fluorescence of the fluorophore is increased (see Figure 1). Detection of the increase in fluorescence permits the inference that the target nucleic acid sequence is present in solution which has led to probe hybridisation. This -17-

hybridisation can be monitored during amplification of the appropriate target sequence by the PCR by detecting the increase in fluorescence. It therefore forms a basis for real-time, sequence specific detection of PCR amplification.

The preparation of a Molecular Beacon requires that an oligonucleotide sequence be labelled at both the 5' and 3' terminal residues with dye molecules, one of which is a fluorophore and second of which is an efficient quencher of the fluorophore.

Probe purity is an important issue. If the quencher is not added to 100% of the fluorescently labelled oligos then unquenchable beacons will be prepared. These must be removed from the fully labelled beacons or they will give rise to high fluorescent backgrounds. Post-labelling a Molecular Beacon is also difficult because the 3' terminus, where labelling is to occur, is sterically hindered by being part of a double helix due to the introduction of a stem loop into the probe. This is observed to greatly inhibit the labelling reaction reducing yields of beacon and making the purification of complete beacon very important if backgrounds are to be minimised. We have used derivatised controlled pore glass (CPG) to introduce labels to the 3' terminus of DNA without needing to post-label. An amino alkyl group is bound to the glass and then reacted with succinic anhydride to give a primary carboxylic acid. A trifunctional alkyl compound is condensed with the carboxylic acid to form an aliphatic ester. The alkyl compound has a protected hydroxyl group from which the DNA is synthesised and the third functional group is attached to the label (see Figure 2). When the DNA has been synthesised the CPG is treated with base to hydro lyse the aliphatic ester and the oligo linked to the 3' label is released.

We amplified human genomic DNA (50ng) using the following: PCR primers (5X3') CGC TGA TGA ATG TGA AAA ATC TAA and AGA AGT TCC AGA TAT TGC CTG CTT; dATP, dCTP, dGTP & c TTP (lOOμM each), lOmM TRIS buffer/pH 8.3, 1.2mM magnesium chloride, 50mM potassium chloride, Amplitaq Gold (2 units enzyme in 50μl mix). A parallel mixture minus the human genomic DNA was used as a no-template control (NTC). As Molecular Beacon we used GCGAG*CGATTCAAATGTAGGACATCAGAAGCCCTGCTCGCT (wherein * represents a -18-

thio linkage with a fluorophore and methyl red quencher, at 200 nanomolar concentration. As an invariant internal standard we used X-Rhodamine (ROX) at 60 nanomolar concentration.

25 μl of each solution (ie. +/- genomic DNA) was placed in a PCR tube, covered with a clear plastic cap and placed in a cycling fluorimeter (Applied Biosystems 7700). With reference to Figure 4, as PCR product accumulated in the +genomic DNA sample, the Beacon was able to hybridise to its complementary sequence in the PCR product. With increased PCR cycle number, quenching decreased and fluorescence increased.

Example 3 Synthesis of Methyl Red CPG Resin

DMTO-

NMe₀

XVI (4.27g) 8.0mmol) was co-evaporated three times with DCM and then dissolved in DCM (21μl). The solution was stirred and anhydrous triethylamine (2.1μl, 15mmol) was added. This was followed by methyl red (2.43g, 9mmol), HOBT (1.59g, 11.8mmol) and DCC (2.5 lg, 12.2mmol) and a fiirther volume of DCM (8.4ml). The reaction was stirred under argon overnight.

Thin Layer Chromatography (TLC) showed the reaction to be complete. The mixture was filtered and the filtrate washed with aq. NaHCO₃ (twice), dried (Na₂SO₄) and evaporated to dryness. -19-

It was purified by column chromatography on silica gel (Hex/EtOAC/NEt₃, 1:1:0.2). Impurities at Rf 0.49 and XVII came off together. Lower impurities separated off with small amount of XVII.

It was further purified on pre-equilibrated silica gel (Hex/EtOAc/Et₃N, 1 : 1 :0.2) eluting with Hex/EtOAc, 1:1. This gave XVII (1.56g, 25%) as a red/orange foam.

Upper RF RF lower Rf imp RF XVII Methyl Red impurities Solvent

0.89 0.79 0.85 - DCM/MeOH, 9:l

0.96 0.71 0.86 DCM/MeOH/Et₃N, :1:1

0.83 0.76 baseline 0.08 EtOAc/NEt₃, 9:1

0.90 0.81 0.04 - EtOAc/DCM/Et₃N, :9:1

0.93 0.83 0.13 streak to 0.17 EtOAc/DCM/Et₃N, :9: 1

baseline 0.03 - DCM streaked

0.83 0.83 0.19 DCM/NEt₃, 9:l

0.49 0.28 baseline streak to 0.18 Hex/EtOAc/NEt₃, 1:1:0

0.49 0.21 0.24 streak to 0.16 Hex/EtO Ac, 1 : 1

-20-

DMTO-

H r

Y II \ o N 1 II

N

NMe- i NMe-

XVII (1.53g, 1.95mmol) was co-evaporated three times (15μl) with anhydrous pyridine and then dissolved in pyridine (10ml). DMAP (50mg, 0.1 lmmol) was added followed by succinic anhydride (0.32g, 3.2μmol). The reaction was stirred under argon at room temperature.

TLC showed the reaction to be complete. The mixture was diluted with DCM and washed with potassium chloride KCl(aq) (twice), dried (Na₂SO ) and evaporated to dryness. The residue was dissolved in the minimum of DCM and purified by column chromatography on pre- equilibrated silica gel (EtOAc/Et₃N). The upper impurities eluting with EtOAc and the desired product XVII eluting with EtOAc/MeOH 8:2 to give XVIII (1.18g, 68.4%) as a red/orange foam. Dried in a vacuum desicator over P₂O₅.

RF Impurity RF XVIII Solvent

0.91 0.61 DCM/MeOH 9:l

0.81 0.45 EtOAc

0.86 0.70 EtOAc/MeOH

9:1 -21-

H X

O IIs N 1 II N 1

A

N e. X.

(XIV)

MMe-

All glassware was soaked in 5% TMSCL/DCM solution for ~^lA hour then washed (acetone, water, acetone). The resin (1.07g) was washed with 1% DIPEA/DCM solution, then dried in a sintered funnel. Compound (XVII) (0.2 lg, 0.24mmol) was dissolved in the minimum of 1% DIPEA DCM solution and EDC (23mg, 0.12mmol) was added. This was followed by the resin and enough 1% DIPEA/DCM solution was added to just cover the resin. The mixture was shaken intermittently for 2 hours after which time a sample was removed and washed (1% DIPEA/DCM) several times. A portion of the sample (lO.lmg) was suspended in EtOH/HCI (2:3 v:v) (25ml) and the absorbance of lul of the red solution at 495mm was measured to determine the resin loading :-

Weight of sample = lO.lmg. Absorbance for 1ml = 0.9317 at 495nm. T Thheerreeffoorree Absorbance for 25ml = 23.2925. lμmol of DMT+ = 71.7 abs for 25ml at 495nm.

Therefore 23.2925/71.7 = 0.325μmol for lO.lmg of resin, Therefore loading = 0.325/0.0101 = 32μmol/g. -22-

The resin was filtered and washed (1% DIPEA/DCM) several times. This was then soaked in cap A, cap B (1:1, 50ml) for 20 minutes, and then washed (1% DIPEA/DCM (x5)) and then diethyl ether (x3). The resin was then dried in the sintered funnel for ~1 hour and tested for loading as before: A portion of the resin (3.1mg) was suspended in EtOH/HCI (2:3 v:v) (25ml) and the absorbance of 1ml of the red solution at 495mm was measured.

Weight of resin = 0.003 lg. Absorbance for 1ml =- 0.2449 at 495nm. Therefore Absorbance for 25ml = 6.1225. lμmol of DMT+ = 71.7 abs for 25ml at 495nm 6.1225/71.7 = 0.0854 μmol for 0.0031g. Therefore Loading of resin = 0.0854/0.0031 = 27.5μmol/g. Obtained (l.Olg).

Claims

-23-

CLAIMS:

1. An energy transfer reagent for DNA analysis, the reagent comprising a fluorophore and methyl red acceptor.

2. A reagent as claimed in claim 1 comprising an oligonucleotide of up to 200 nucleotides.

3. A reagent as claimed in claim 2 wherein the fluorophore and methyl red acceptor are attached to the 5' and 3' terminii of the oligonucleotide.

4. An oligonucleotide comprising a methyl red acceptor attached to its 3' terminus.

5. A method for producing a methyl red labelled oligonucleotide of the formula XV which method comprises cleaving a compound of the formula XII from the controlled pore glass: (CPG)

Oligonucleotide^ O

-24-

6. Methyl red -controlled pore glass of the formula XII

(CH₂)_n-

DMTO

o N

O II o N

(XII)

O

H-N N

CPG / \

7. A compound of the formula XIII.

(CH₂)_n

DMTO

O N

OH II N

(XIII)

N / \

-25-

A compound of the formula XIV.

_{0 N}

II N

HO (XIV) N / \

9. A Molecular Beacons probe comprising a reagent as claimed in any one of claims 2-4.

10. A probe as claimed in claim 9 and comprising one or more 2-methyl RNA bases.