WO1999024608A1 - Method for labeling polynucleotides - Google Patents

Method for labeling polynucleotides Download PDF

Info

Publication number
WO1999024608A1
WO1999024608A1 PCT/IL1998/000513 IL9800513W WO9924608A1 WO 1999024608 A1 WO1999024608 A1 WO 1999024608A1 IL 9800513 W IL9800513 W IL 9800513W WO 9924608 A1 WO9924608 A1 WO 9924608A1
Authority
WO
WIPO (PCT)
Prior art keywords
dna
ohgonucleotide
nucleotides
labeled
molecule
Prior art date
Application number
PCT/IL1998/000513
Other languages
French (fr)
Other versions
WO1999024608A8 (en
Inventor
Zeev Lev
Ronit Herzog
Original Assignee
Technion Research And Development Foundation Ltd.
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Technion Research And Development Foundation Ltd. filed Critical Technion Research And Development Foundation Ltd.
Priority to AU95596/98A priority Critical patent/AU9559698A/en
Publication of WO1999024608A1 publication Critical patent/WO1999024608A1/en
Publication of WO1999024608A8 publication Critical patent/WO1999024608A8/en

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6844—Nucleic acid amplification reactions
    • C12Q1/6846—Common amplification features

Definitions

  • the present invention relates to a method for the terminal labeling of poiynucleotides, and to a method for detecting specific restriction sites in a DNA molecule using the above labeling method.
  • Labeling of DNA molecules is a fundamental step in a large number of protocols in academic, medical, and industrial laboratories. The primary parameters in this process are the integrity, the strandedness, and the specific activity of the labeled product.
  • Some methods for labeling DNA such as nick-translation and labeling by random primers, provide double-stranded probes made of truncated pieces with high specific activity (Sambrook et al., 1992; Ausubel at al., 1995). These methods are limited to DNA molecules longer than about 50 bases.
  • End-labeling of DNA molecules is the method of choice when the intactness or the single-strandedness of a given probe are considered, or when a short DNA fragment or a synthetic oligonucleotide is being labeled.
  • end-labeling is achieved by either 5 " -end kinasing with labeled ⁇ -ATP by T4 nucleotide kinase (Chaconas, 1980) or 3 ⁇ -end tailing with labeled -dNTPs by terminal transferase (Chang, 1986).
  • Dutta and Moss, 1988 designed a double-stranded tailing-adaptor made of two oligonucleotides. The upper one contained the desired tail, and the lower one completed the adapter in such a way that it could be joined to the target fragment simply by ligation with T4-DNA Ugase.
  • Sriprakash and Hartas, 1989 used a hairpin extension method for labeling oligonucleotide probes.
  • the probe comprises a sensor region at the 5' end which recognizes the target DNA, a short hinge sequence, and a poly-T tail ending with a hairpin bend comprising three A residues at the 3Xnd.
  • a Klenow polymerase was used to extend the 3' end with radioactively labeled ⁇ - 32 P-dATP, but only as far as the length of the built-in poly-T tail.
  • RFLP restriction fragment length polymorphism
  • ASOH allele-spec fic oligo hybridization
  • DGGE denatured gradient gel electrophoresis
  • SSCP single strand conformation polymorphism
  • RFLP (Botstein et al., 1980; Kahn et al., 1991) is a common technique frequently used in detection of inherited mutations, gene mapping, etc. RFLP relies on the detection of differences in the length of restriction fragments created by polymorphic restriction sites in a given locus. These sites appear or disappear due to minor changes in the DNA sequence, such as point mutations, and small insertions or deletions. Consequently, after restriction of a DNA molecule, fragments with different lengths, or even novel fragments, are present. These changes are displayed by gel electrophoresis of the restricted DNA.
  • RFLP uses gel electrophoresis for the detection of changes in the length of restriction fragments generated by the creation of novel restriction sites or by the removal of existing sites.
  • a method for the labeling of the single stranded 3' end of a target polynucleotide molecule comprising:
  • the tailing sequence (a) preparing an ohgonucleotide, wherein the 3' end of the ohgonucleotide is complementary to the 3' end of the target polynucleotide, and the ohgonucleotide comprises a nucleotide sequence located on the 5' side of the 3' end, the nucleotide sequence being termed hereinafter "the tailing sequence";
  • step (c) adding a polymerase and labeled tri-phosphate nucleotides to the incubation mixture of step (b), wherein the labeled nucleotides are complementary to the tailing sequence of the ohgonucleotide, and allowing the labeled nucleotides to extend the 3' end of the target polynucleotide;
  • a polynucleotide probe labeled according to the method of the invention there is provided a method for detecting the presence of a restriction site in a DNA molecule comprising:
  • step (e) adding DNA polymerase and labeled tri-phosphate nucleotides to the incubation mixture of step (d), wherein the labeled nucleotides are comple- mentary to the tailing sequence of the ohgonucleotide, and allowing the labeled nucleotides to extend the 3' end of the separated strand of the restricted DNA;
  • a method for screening a body fluid or tissue sample for the presence of mutated DNA by determining the presence of a restriction site in said DNA which is normally not included therein, or by deteraiming the absence of a restriction site in said DNA which is normally included therein, comprising:
  • step (f) adding DNA polymerase and labeled tri-phosphate nucleotides to the incubation mixture of step (d), wherein the labeled nucleotides are complementary to the tailing sequence of the ohgonucleotide, and allowing the labeled nucleotides to extend the 3' end of the restricted DNA;
  • the kit comprises 2 PCR primers for DNA amplification, a prelabeled ohgonucleotide as defined above, and a sohd phase support capable of binding one of the PCR primers.
  • the sohd phase support is a microwell plate.
  • kits are possible according to the invention.
  • one PCR primer may be labelled with biotin and the ohgonucleotide with fluorescein, while the sohd support is avidin coated.
  • one PCR primer may be covalently bound to the sohd support, and the ohgonucleotide may be labeled with fluorescein or biotin.
  • the kits would include reagents for detecting fluorescein and/or biotin, unlabeled nucleotides, and, optionally, restriction enzymes and a DNA polymerase.
  • a further configuration may include the ohgonucleotide labeled with biotin for binding to an avidin coated sohd support, and either the PCR primers are labeled with fluorescein or the kit contains fluorescein-labeled nucleotides for the PCR amplification step.
  • kit configurations are also possible as will be readily understood by the skilled artisian.
  • a novel approach, named template-mediated tailing, is disclosed for the
  • Template-mediated tailing is a sequence-specific, strand-specific labeling method, producing an intact, homogenous population of molecules labeled to high specific activity. As illustrated in Figs, la and lb, the method is a template-mediated primer extension approach based on a short ohgonucleotide - termed the "tailer".
  • the tailer comprises an "anchor" sequence on its 3' end and a "tailing" sequence on its 5' end.
  • the anchor is a stretch of 8-20 nucleotides, preferrably 8-12 nucleotides, most preferably 9-12, complementary to the 3 -terminal nucleotides of the target polynucleotide to be labeled.
  • the tailing sequence is a range of 1-50 nucleotides, preferrably 1-20 nucleotides, 5 " to the anchor sequence which serves as a template for the 3 -end extension of the target DNA molecule by incorporation of labeled tri-phosphate nucleotides.
  • the tailing sequence is a (dT)n homopolymer and the labeled nucleotides are ⁇ - P-dATP.
  • the 3'-end of the tailer is preferrably designed to prevent extension on that end by the inclusion of 1-2 noncomplementary nucleotides.
  • the target polynucleotide is incubated with the tailer under polynucleotide extending conditions which allow the formation of a priming complex for DNA polymerase.
  • these conditions are 0-100 mM NaCl, 5 mM MgCl 2 , 10 mM Tris-HCl pH 7.5.
  • tailer-mediated extension of the target polynucleotide is initiated, and a defined number of nucleotides (adenine in the example) are added to its 3 ' -terminus according to the length of the tailing sequence of the tailer.
  • the tailer may then be optionally dissociated from the target polynucleotide by heat or alkaline treatment as is well known to the skilled artisan, and removed from the solution if required.
  • DNA target DNA polymerase in the illustrated embodiment
  • ⁇ - P-dATP labeled tri-phosphate nucleotides
  • DNA tailer DNA-primed DNA-dependent DNA polymerase such as the Klenow fragment of E. coli DNA polymerase I, and dNTPs
  • DNA target DNA target, RNA tailer, DNA-primed RNA-dependent DNA polymerase such as reverse transcriptase, and dNTPs
  • RNA target DNA tailer, RNA-primed DNA-dependent DNA polymerase such as E. coli DNA polymerase I, and dNTPs
  • Various polymerases can be used such as T4 DNA polymerase, Taq DNA polymerase, etc, and with one or several types of nucleotides including the four tri-phosphate deoxyribonucleotides (dNTPs) - dATP, dGTP, dCTP, and TTP, or modified dNTPs such as ddATP, dUTP, etc.
  • dNTPs tri-phosphate deoxyribonucleotides
  • Template-mediated tailing can be used for the labeling of a variety of single stranded DNA molecules (Fig. la) including oligonucleotides and denatured restriction fragments, provided that the sequence of the last few (preferably 8-12) nucleotides is known.
  • Double stranded restriction fragments can also be labeled after being treated with lambda exonuclease (a 5Xo 3 " exonuclease) as illustrated in Fig. lb. Labeling can be carried out with radioactive nucleotides as well as with non-radioactive tagged nucleotides such as biotinylated-dUTP or digoxigenin-dUTP.
  • the labeled DNA can be used for many applications including nucleic acid hybridization assays, gel mobility shift assays, molecular markers, DNA cloning, polynucleotide probes, recognition of a restriction site by a specially designed tailer recognizing only the chosen site (Examples B and C below) and tagging a given strand of a given restriction fragment for isolation of this strand or for the preparation of a fragment-specific, strand-specific probe (Fig. 7 below).
  • template-mediated tailing will label only a DNA terminus containing a sequence which complements the "anchor" sequence of the tailer. Consequently, template-mediated tailing can be used to label only one restriction site out of several similar sites present in a restriction digest. This is due to the nrinimal working length of the "anchor" sequence which is most preferably 9 nucleotides long, while even 3 ' -protruding restriction enzymes, such as PstI, leaves only 4 identical nucleotides at the 3 " -end of the restricted site.
  • nucleotide-long sequences at the 3" -end are common to ah sites, but the 9-long sequences are unique, and a specific tailer can be designed to label it. Furthermore, the apparent sensitivity of template-mediated tailing suggests that this labeling can be done in the presence of a large excess of unrestricted DNA. In addition, since only one strand is labeled, a fragment-specific, strand-specific single-stranded probe can be obtained (see e.g. Fig. 7). Such a probe is much more effective than double-stranded labeled probes, and it is invaluable in RNA mapping experiments where fragment-specific, polar probes are required.
  • the method of the invention differs from the other methods previously described for modifying 3'-ends without the use of terminal transferase.
  • Dutta and Moss use DNA ligase, not DNA polymerase as in the present invention. Their modification is terminal-sequence specific only with respect to the 3'-end formed by a 3'-protruding restriction enzyme digest. Thus all fragments in a restriction mixture are modified identically. Furthermore, no dNTPs are utilized so no labeling or other modifications are possible.
  • the target entity and labeling agent are joined in the same molecule, and their method is apphcable for synthetic oligonucleotides only, since the built-in labeling sequence must be added to the target polynucleotide during ohgonucleotide synthesis. Thus, no native DNA fragments can be modified.
  • the approach disclosed in the present invention is conceptually different since the target sequence is separated from the labeling sequence (the "tailer"). This separation gives the method of the invention its extreme flexibility so that not only synthetic oligonucleotides can be labeled but many other applications are also possible, as described below.
  • restriction site polymorphism RSP
  • RSP is a fast, efficient, and cost-effective assay, which may replace RFLP as a major assay in medical genetics. Since many tumors are associated with DNA mutations, this sensitive assay may be useful in the early detection and follow-up of cancer. In the long run, it may help in reducing costs of routine diagnostic mutation detection services, and in controUed large-scale molecular screening of the general population. Furthermore, detection of mutations by RSP is very sensitive and specific, so that incomplete PCR amplifications wiU stiU work with RSP, but not with RFLP. RSP may be used, inter alia for: (1) Detection of any DNA mutation which creates a restriction site. It should be noted that even if a new site is not naturaUy formed by the mutation, in many cases a designed primer can create a new site artificiaUy.
  • RSP can be used for detection of many inherited and somatic DNA mutations which creates a novel restriction site. It should be noted that even if a new site is not naturaUy formed by the mutation, in most cases a designed primer can create a new site artificially (Kahn et al., 1991). FinaUy, RSP can be modified such that it wiU distinguish not only between normal and mutated DNA but also between mutated heterozygous and homozygous individuals. The method can be employed by the basic protocols outlined below (Examples D-F), but also by modified protocols and in other devices including DNA micro-array/micro-chip technologies (HeUer et al., 1997). BRIEF DESCRIPTION OF THE DRAWINGS
  • Fig. la is a schematic diagram iUustrating an embodiment of a method of the invention using single stranded DNA
  • Fig. lb is a schematic diagram iUustrating an embodiment of a method of the invention using double stranded DNA
  • Fig. 2 shows pairs of target oligonucleotides and their corresponding tailers
  • Fig. 3 shows an aciylamide gel on which were loaded the pairs of Fig. 2 without (A) or with (B) dATP added prior to the addition of radioactive dATP;
  • Fig. 4 iUustrates the use of probes labeled according to the method of the invention in the detection of a mutated Ki-ras gene in colorectal carcinoma;
  • Fig. 5 shows a comparison between specific end-labeling of DNA fragments according to the method of the invention as compared to the conventional labeling method using transferase;
  • Fig. 6A is a schematic iUustration and Fig. 6B is an aciylamide gel showing the use of the method of the invention to detect restriction sites;
  • Fig. 7 schematicaUy Ulustrates the preparation of a fragment-specific, strand-specific probe by the method of the invention.
  • Fig. 8 iUustrates the RSP method of the invention by identification of a novel Hinfl site in the MTHFR locus
  • Fig. 9 iUustrates utilization of avidin-coated magnetic beads in a solid-phase RSP
  • Fig. 10 is a schematic illustration showing the utilization of avidin-coated microweU plates in a sohd-phase RSP;
  • Fig. 11 shows large-scale screening for MTHFR mutations in avidin-coated microweU plates: (A) incubated with intact PCR products; (B) incubated with the Hinfl-restricted products; and
  • Fig. 12 is a schematic iUustration showing how RSP can be utilized to distinguish among normal, heterozygous and homozygous individuals.
  • DNA samples of normal, heterozygous, and homozygous methylene- tetrahydrofolate reductase (MTHFR) individuals were obtained from Dr. Gershoni, Rambam Medical Center, Haifa. Primers were modified simUarly to Goyette et al. (1994). The reverse (3 ⁇ ) primer contained a S ' -biotin tag. TaUers were designed corresponding to the DNA sequence of the amplified MTHFR locus.
  • taUers were purified on a G-50 spin column and labeUed at their 5 ' -ends in 20 ⁇ l of kinase buffer (50 mM NaCl, 10 mM MgCl 2 , 10 mM Tris-HCl pH 7.2), containing 20 pmole of taUer, 5 ⁇ Ci 32 P-y-ATP (6000 Ci/mmole, Amersham) and 15 units of T4 nucleotide kinase (New-England Biolabs), at 37°C for 90 min. About 20% incorporation was obtained. Restriction site tagging Methylenetetrahydrofolate reductase (MTHFR) DNA was amplified in
  • PCR buffer 50 mM KC1, 1.5 mM MgCl 2 , 10 mM Tris-HCl pH 8.3 containing 200 ⁇ M of each dNTP, and 0.5 units of Taq DNA polymerase (Takahara), using l ⁇ M primers #890 and #892, the latter containing 5" -biotin.
  • the amplification was carried out as foUows: 94°C, 4 min; [59°C, 30 sec; 72°C, 20 sec; 92°C, 30 sec] x 30; 55°C, 4 min; 72°C, 4 min.
  • Half of the amplified DNA (about 200 ng) was restricted with 10 units of HinfT in 40 ⁇ l buffer #2 containing 50 mM NaCl, 10 mM MgCl 2 , 10 mM Tris-HCl pH 7.2, 1 mM DTT, at 37°C for 1 hr.
  • the restricted and unrestricted DNA samples were brought to 1 M NaCl, ImM EDTA (B buffer), and incubated with 5 ⁇ l avidin-coated magnetic beads (M-280, Dynal, pre-washed with B buffer), at room temperature for 15 min.
  • Genomic DNA was extracted from left-over blood samples in EDTA, which were kept frozen at -20°C for several weeks after coUection. About 200 ⁇ l of each sample were used for DNA isolation with a commercial kit (Boehringer).
  • taUers In a typical experiment, four different oligonucleotides were combined with their corresponding taUers (Fig. 2).
  • the taUers generaUy contained 8-10 nucleotides in their anchor sequence and 6-8 nucleotides in their tailing sequence.
  • the anchor sequence should be long enough to enable efficient initiation of the template-mediated tailing process, and the tailing sequence should be long enough to ensure incorporation of sufficient labeled nucleotides.
  • Labeling by template-mediated tailing was carried out as described in the Methods section. AU four pairs gave strong and sharp bands on the gel (Fig. 3A). The size of the oligonucleotides is indicated on the left side of the gel.
  • oligonucleotides of various lengths can be homogeneously labeUed by template-mediated-tailing to high specific activity, suggesting that template-mediated-taUing can successfuUy replace conventional methods such as 5"-end labeling with nucleotide kinase or 3"-end labeling with terminal transferase.
  • labeUed oligonucleotides A common application of labeUed oligonucleotides is the detection of a point mutation in a certain gene by aUele-specific filter hybridization.
  • the genomic DNA region containing the gene in question is amplified and DNA samples are spotted on nylon membrane and hybridized with labeUed oligonucleotides specific to the normal or the mutated gene sequence. After incubation and wash under appropriate conditions, only the specific ohgonucleotide remains bound to the filter, revealing if it is a normal or a mutated gene.
  • mutations in amino acids 12 and 13 of the genomic DNA region containing the gene in question is amplified and DNA samples are spotted on nylon membrane and hybridized with labeUed oligonucleotides specific to the normal or the mutated gene sequence. After incubation and wash under appropriate conditions, only the specific ohgonucleotide remains bound to the filter, revealing if it is a normal or
  • Ki-ras protein are highly prevalent, having a frequency of up to 50%.
  • two aUele-specific ohgos labeUed by template-mediated-taUing were used to calibrate an aUele-specific hybridization assay for a Ki-ras mutation in colorectal carcinoma.
  • the same taUer (#824) was used for the labeling of the two ohgos.
  • One ohgo (#823) was specific to the normal human Ki-ras first exon, while the second one (#856) was specific to a mutation in amino acid 13 (GGC to GAC).
  • Different amounts of normal and mutated DNA were spotted onto several identical nylon membranes and hybridized with the two probes. After hybridization the membranes were washed sequentiaUy at increasing temperatures and exposed to Phosphoimager (Fuji).
  • plasmid DNA (Bluescript KS ⁇ , Stratagene) was restricted with PvuII into two fragments, creating 4 distinct 3 " -termini. Decreasing amounts of the restricted DNA were mixed with a constant amount of unrestricted DNA, and a specific taUer was used to label one of the 3" -termini present in the short Pvufl fragment The labeUed products were separated in a 1.2% agarose gel. The short PvuH fragment was detected in dUutions down to 1:10 4 with Xhol-linearized plasmid DNA (Fig. 6B).
  • template-mecftated-taihng can be used to recognize restriction sites with very high specificity and sensitivity.
  • template-mediated tailing can detect it.
  • FIG. 7 Another application of the ability of template-mediated tailing to recognize a specific terminal is illustrated in Fig. 7, where a fragment-specific, strand-specific probe is prepared out of a mixture of several restriction fragments.
  • TTT — • represents a specific Biotinylated taUer.
  • RSP Restriction Site Polymorphism
  • a common mutation in the MTHFR locus is a C to T change which creates a new Hinfl site. After gel electrophoresis, normal unrestricted DNA gives a 198 base-long band, while mutant DNA gives two bands of 175 and 23 bases.
  • Homozygous mutated MTHFR DNA was amplified with a reverse primer containing 5 '-biotin (#892).
  • the amplified DNA was divided into two parts: one part was left untreated ("unrestricted"), and the second one was restricted with Hinfl ("restricted"). Both samples were bound to magnetic beads coated with avidin which were washed. The non-biotinylated strands were removed by melting and washing.
  • taUer For the template-dependent tailing two different taUers were prepared: a "general" taUer (#885) which binds to the 3 " -end sequence of the biotinylated, bound strand amplified normal DNA, and a "site-specific” taUer (#884) which binds to the Hinfl site in the amplified mutated DNA.
  • the taUers were labeled at their 5" -ends with ⁇ - 2 P-ATP, and each of the general and site-specific taUers were added to half of the "unrestricted" and "restricted” DNAs.
  • the Klenow DNA polymerase I fragment was used to stably attach them to their targets by complementing the taUs with dATP. It is also possible to add 5'-biotin during taUer synthesis, as exemplified in Section E below.
  • the general taUer #885 recognized the unrestricted DNA (lane b).
  • the site-specific taUer recognized the Hinfl-restricted DNA but not unrestricted DNA.
  • the general taUer detected the unrestricted DNA, proving that it was amplified correctly and therefore the negative signal of this DNA with the site-specific taUer is due to the lack of the restricted Hinfl site.
  • the restricted DNA (lane d) was also recognized by the general tailer.
  • This signal may be interpreted as reflecting either residual non-restricted DNA due to sub-optimal efficiency of the Hinfl restriction enzyme, or more reasonably, indicating the presence of non-specific amplicons such as primer-dimers, etc., which contain the 5 " -primer region used as an anchor site for the general taUer (Fig. 9).
  • This technical problem may be overcome by the introduction of a new general restriction site at the end of the amplified molecule opposite the biotin-bound end.
  • the non-biotinylated, reverse primer is designed so that during amplification a novel restriction site is formed by a combination of the 3'-terminal nucleotides of the primer and the adjacent nucleotides of the target DNA (Kahn, et al, 1991; preferably, the novel restriction site is identical to the restriction site formed by the mutation under study, but a different restriction site type is also feasible).
  • This site is formed in aU molecules amplified from the target DNA, and the general tailer is designed to label the 3'-end of this site after its restriction.
  • Non-specific amplification products, such as primer dimers, wiU not include this site, and therefore wiU not be cleaved nor tagged by this taUer.
  • RSP does not require gel electrophoresis which is labor-intensive and lime-consuming, and therefore can be performed in the format of a microweU plate.
  • this format is the standard for large-scale diagnostic assays, and many devices which fit it have been developed, including solution delivery instruments, PCR thermal cyclers, and robotic workstations.
  • the former experiment may be repeated using avidin-coated microweU plates instead of avidin-coated magnetic beads.
  • Excess and non-specificaUy bound taUers are removed by washings at 30-40°C and the specificaUy bound taUers are eluted at 50-90°C, bound to a DE-81 filter, and detected with X-ray film or by a radioactivity imager.
  • a preliminary screening-like experiment was carried out using the microweU plate RSP assay to test for the presence of a MTHFR mutation in a large number of individuals.
  • the protocol described in the previous experiment was repeated with 79 samples of amplified DNA obtained from individuals with unknown MTHFR phenotype, and 6 samples with known phenotype. These 85 samples were divided into two halves: one half was untreated, whUe the second half was restricted with Hinfl. The two halves were arranged for avidin absorption in identical arrays in two avidin-coated microweU plates, one with the unrestricted (intact) PCR products, and one with the Hinfl-restricted products.
  • simUar protocol can be used to distinguish among normal, heterozygous and homozygous individuals.

Abstract

A method for the labeling of the single stranded 3' end of a target polynucleotide molecule comprises the following steps: (a) preparing an oligonucleotide in which the 3' end of the oligonucleotide is complementary to the 3' end of the target polynucleotide, and the oligonucleotide comprises a nucleotide sequence located on the 5' side of the 3' end, the nucleotide sequence being termed 'the tailing sequence'; (b) incubating the oligonucleotide and the target polynucleotide under polynucleotide extending conditions; (c) adding a polymerase and labeled tri-phosphate nucleotides to the incubation mixture of step (b), wherein the labeled nucleotides are complementary to the tailing sequence of the oligonucleotide, and allowing the labeled nucleotides to extend the 3' end of the target polynucleotide; (d) optionally removing unincorporated labeled nucleotides from the mixture; and (e) optionally dissociating the oligonucleotide from the target polynucleotide. Also disclosed are a method for detecting the presence of a restriction site in a DNA molecule, and a method and kit for screening a body fluid or tissue sample for the presence of mutated DNA.

Description

METHOD FOR LABELING POLYNUCLEOTIDES
FIELD OF THE INVENTION
The present invention relates to a method for the terminal labeling of poiynucleotides, and to a method for detecting specific restriction sites in a DNA molecule using the above labeling method.
BACKGROUND OF THE INVENTION
The following references are referred to in the body of the specification:
1. Ausubel, F.M., Brent, R., Kingston, R.E., Moore, D.D., Seidman, J.G., Smith, J.A., and Struhl, K. (1995). Short Protocols in Molecular Biology (New York: John Wiley & Sons).
2. Botstein, D., White, R.L., Skolnick, M, and Davis, R.W. (1980). Construction of a genetic linkage map in man using restriction fragment length polymorphisms. Am J Hum Genet 32, 314-331.
3. Chaconas, G. and van de Sande, J.H. (1980). 5'-P32 labeling of RNA and DNA restriction fragments. Methods Enzymol. 65, 75-85.
4. Chang, L.M. and Bollum, F.J. (1986). Molecular biology of terminal transferase. CRC Crit Rev. Biochem. 21, 27-52. 5. Dutta, C. and Moss, T. (1988). DNA tailing without terminal transferase. Nucleic. Acids. Res. 16, 7744
6. Goyette, P., Sumner, J.S., Milos, R., Duncan, A.M., Rosenblatt, D.S., Matthews, R.G., and Rozen, R. (1994). Human methylenetetrahydrofolate reductase: isolation of cDNA mapping and mutation identification. Nat. Genet. 7, 551.
7. Heller,R.A., Schena,M., Chai,A., Shalon,D., Bedilion,T., Gilmore,J., Woolley,D.E., Davis,R.W. (1997) Discovery and analysis of inflammatory disease-related genes using cDNA microarrays. Proc.Natl.Acad.Sci.USA 94, 2150-2155.
8. Kahn, S.M., Jiang, W, Culbertson, T.A., Weinstein, I.B., Williams, G.M., Tomita, N., and Ronai, Z. (1991). Rapid and sensitive nonradioactive detection of mutant K-ras genes via 'enriched' PCR amplification. Oncogene 6, 1079-1083. 9. Sambrook, J., Fritsch, E.F., and Maniatis, T. (1989). Molecular cloning: A laboratory manual (Cold Spring Harbor, NY: Cold Spring Harbor Laboratory).
10. Sriprakash, K.S. and Hartas, J. (1989). Hairpin extension. A general method for the improvement of sensitivity of oligonucleotide probes. Gene Anal. Tech. 6, 29-32.
Labeling of DNA molecules is a fundamental step in a large number of protocols in academic, medical, and industrial laboratories. The primary parameters in this process are the integrity, the strandedness, and the specific activity of the labeled product. Some methods for labeling DNA, such as nick-translation and labeling by random primers, provide double-stranded probes made of truncated pieces with high specific activity (Sambrook et al., 1992; Ausubel at al., 1995). These methods are limited to DNA molecules longer than about 50 bases. End-labeling of DNA molecules is the method of choice when the intactness or the single-strandedness of a given probe are considered, or when a short DNA fragment or a synthetic oligonucleotide is being labeled. Generally, end-labeling is achieved by either 5" -end kinasing with labeled γ-ATP by T4 nucleotide kinase (Chaconas, 1980) or 3λ-end tailing with labeled -dNTPs by terminal transferase (Chang, 1986).
However, both of these approaches have significant drawbacks. 5 -end kinasing results in low specific activity since only one labeled nucleotide is added per 5" -end. In addition, this method is not terminal sequence-specific. Therefore, in a mixture of DNA fragments all the fragments will be labeled at their 5 "-ends. The second approach, 3" -end tailing by terminal transferase, can result in a probe with high specific activity since one to more than 20 nucleotides may be added. However, the polymerization activity of terminal transferase is template-independent and therefore the number of added nucleotides is uncontrolled. Consequently, a heterogeneous population of tailed molecules, with respect to length and specific activity, is obtained. 3 "-end tailing by terminal transferase is also not terminal sequence-specific. Again, in a mixture of DNA fragments all the fragments will be tailed at their 3" -ends. Essentially the same arguments apply when non-radioactive labeling is being used.
Several alternatives for tailing by terminal transferase have been described. Dutta and Moss, 1988, designed a double-stranded tailing-adaptor made of two oligonucleotides. The upper one contained the desired tail, and the lower one completed the adapter in such a way that it could be joined to the target fragment simply by ligation with T4-DNA Ugase. Sriprakash and Hartas, 1989, used a hairpin extension method for labeling oligonucleotide probes. The probe comprises a sensor region at the 5' end which recognizes the target DNA, a short hinge sequence, and a poly-T tail ending with a hairpin bend comprising three A residues at the 3Xnd. A Klenow polymerase was used to extend the 3' end with radioactively labeled α-32P-dATP, but only as far as the length of the built-in poly-T tail.
Currently, the most popular methods for detection of inherited and sporadic mutations are restriction fragment length polymorphism (RFLP), allele-spec fic oligo hybridization (ASOH), denatured gradient gel electrophoresis (DGGE), and single strand conformation polymorphism (SSCP).
RFLP (Botstein et al., 1980; Kahn et al., 1991) is a common technique frequently used in detection of inherited mutations, gene mapping, etc. RFLP relies on the detection of differences in the length of restriction fragments created by polymorphic restriction sites in a given locus. These sites appear or disappear due to minor changes in the DNA sequence, such as point mutations, and small insertions or deletions. Consequently, after restriction of a DNA molecule, fragments with different lengths, or even novel fragments, are present. These changes are displayed by gel electrophoresis of the restricted DNA.
All of these methods, however, are labor-intensive and involve time-consuming procedures such as filter hybridization or gel electrophoresis.
RFLP, for example, uses gel electrophoresis for the detection of changes in the length of restriction fragments generated by the creation of novel restriction sites or by the removal of existing sites.
Improved labelling and detection methods are therefore required.
BRIEF SUMMARY OF THE INVENTION
It is an object of the present invention to provide a method for end-labeling poiynucleotides.
It is a further object of the present invention to provide a labeled polynucleotide probe. Additionally, it is an object of the present invention to provide a method for detecting restriction sites in DNA.
It is a still further object of the invention to provide a method for detecting mutations in the DNA of a subject. According to one aspect of the present invention, there is provided a method for the labeling of the single stranded 3' end of a target polynucleotide molecule comprising:
(a) preparing an ohgonucleotide, wherein the 3' end of the ohgonucleotide is complementary to the 3' end of the target polynucleotide, and the ohgonucleotide comprises a nucleotide sequence located on the 5' side of the 3' end, the nucleotide sequence being termed hereinafter "the tailing sequence";
(b) incubating the ohgonucleotide and the target polynucleotide under polynucleotide extending conditions;
(c) adding a polymerase and labeled tri-phosphate nucleotides to the incubation mixture of step (b), wherein the labeled nucleotides are complementary to the tailing sequence of the ohgonucleotide, and allowing the labeled nucleotides to extend the 3' end of the target polynucleotide;
(d) optionally removing unincorporated labeled nucleotides from the mixture; and (e) optionally dissociating the ohgonucleotide from the target polynucleotide.
Further in accordance with this aspect of the present invention, there is provided a polynucleotide probe labeled according to the method of the invention. According to another aspect of the present invention, there is provided a method for detecting the presence of a restriction site in a DNA molecule comprising:
(a) treating the DNA molecule with a restriction enzyme which recognizes the restriction site, thereby creating a 3' end at the restriction site; (b) preparing an ohgonucleotide, wherein the 3' end of the ohgonucleotide is complementary to the 3' end of the restricted DNA molecule, and the ohgonucleotide comprises additional nucleotides located on the 5' side of the 3' end, the nucleotides being termed hereinafter "the tailing sequence"; (c) separating the two strands of the restricted DNA molecule;
(d) incubating the ohgonucleotide and a separated strand of the restricted DNA under DNA extending conditions;
(e) adding DNA polymerase and labeled tri-phosphate nucleotides to the incubation mixture of step (d), wherein the labeled nucleotides are comple- mentary to the tailing sequence of the ohgonucleotide, and allowing the labeled nucleotides to extend the 3' end of the separated strand of the restricted DNA;
(f) optionally removing unincorporated labeled nucleotides from the mixture;
(g) optionally dissociating the ohgonucleotide from the target polynucleotide; and
(h) detecting the labeled restricted DNA molecule.
According to yet another aspect of the present invention, there is provided a method for screening a body fluid or tissue sample for the presence of mutated DNA by determining the presence of a restriction site in said DNA which is normally not included therein, or by deteraiming the absence of a restriction site in said DNA which is normally included therein, comprising:
(a) isolating DNA from the body fluid or tissue sample and optionally amplifying a region in the DNA;
(b) treating the DNA of (a) with a restriction enzyme which recognizes the restriction site, thereby creating a 3' end at the restriction site;
(c) preparing an ohgonucleotide, wherein the 3' end of the ohgonucleotide is complementary to the 3' end of the restricted DNA molecule, and the ohgonucleotide comprises additional nucleotides located on the 5' side of the 3' end, the nucleotides being termed hereinafter "the tailing sequence" ; (d) separating the two strands of the restricted DNA molecule;
(e) incubating the ohgonucleotide and a separated strand of the restricted DNA under DNA extending conditions;
(f) adding DNA polymerase and labeled tri-phosphate nucleotides to the incubation mixture of step (d), wherein the labeled nucleotides are complementary to the tailing sequence of the ohgonucleotide, and allowing the labeled nucleotides to extend the 3' end of the restricted DNA;
(g) optionally removing unincorporated labeled nucleotides from the mixture; (h) optionally dissociating the ohgonucleotide from the target polynucleotide; and
(i) detecting the presence or absence of the restriction site. According to still another aspect of the invention, there is provided a kit for screening a body fluid or tissue sample for the presence of mutated DNA by detemn ing the presence of a restriction site in the DNA which is normally not included therein, or by determining the absence of a restriction site in the DNA which is normally included therein. The kit comprises 2 PCR primers for DNA amplification, a prelabeled ohgonucleotide as defined above, and a sohd phase support capable of binding one of the PCR primers. In a preferred embodiment, the sohd phase support is a microwell plate.
Various configurations of kits are possible according to the invention. For example, in one configuration, one PCR primer may be labelled with biotin and the ohgonucleotide with fluorescein, while the sohd support is avidin coated. In another configuration, one PCR primer may be covalently bound to the sohd support, and the ohgonucleotide may be labeled with fluorescein or biotin. In both of these configurations, the kits would include reagents for detecting fluorescein and/or biotin, unlabeled nucleotides, and, optionally, restriction enzymes and a DNA polymerase. A further configuration may include the ohgonucleotide labeled with biotin for binding to an avidin coated sohd support, and either the PCR primers are labeled with fluorescein or the kit contains fluorescein-labeled nucleotides for the PCR amplification step. Other kit configurations are also possible as will be readily understood by the skilled artisian. A novel approach, named template-mediated tailing, is disclosed for the
3" -end labeling of polynμcleotides, which may be either DNAs or RNAs. Template-mediated tailing is a sequence-specific, strand-specific labeling method, producing an intact, homogenous population of molecules labeled to high specific activity. As illustrated in Figs, la and lb, the method is a template-mediated primer extension approach based on a short ohgonucleotide - termed the "tailer". The tailer comprises an "anchor" sequence on its 3' end and a "tailing" sequence on its 5' end. The anchor is a stretch of 8-20 nucleotides, preferrably 8-12 nucleotides, most preferably 9-12, complementary to the 3 -terminal nucleotides of the target polynucleotide to be labeled. The tailing sequence is a range of 1-50 nucleotides, preferrably 1-20 nucleotides, 5" to the anchor sequence which serves as a template for the 3 -end extension of the target DNA molecule by incorporation of labeled tri-phosphate nucleotides. In the illustrated embodiments of Figs, la and lb, for example, the tailing sequence is a (dT)n homopolymer and the labeled nucleotides are α- P-dATP. The 3'-end of the tailer is preferrably designed to prevent extension on that end by the inclusion of 1-2 noncomplementary nucleotides.
The target polynucleotide is incubated with the tailer under polynucleotide extending conditions which allow the formation of a priming complex for DNA polymerase. For the Klenow fragment of DNA polymerase L for example, these conditions are 0-100 mM NaCl, 5 mM MgCl2, 10 mM Tris-HCl pH 7.5. Thus, in the presence of a polymerase (DNA polymerase in the illustrated embodiment) and labeled tri-phosphate nucleotides (α- P-dATP), tailer-mediated extension of the target polynucleotide is initiated, and a defined number of nucleotides (adenine in the example) are added to its 3' -terminus according to the length of the tailing sequence of the tailer. The tailer may then be optionally dissociated from the target polynucleotide by heat or alkaline treatment as is well known to the skilled artisan, and removed from the solution if required. In addition to the above illustrated combination (namely DNA target,
DNA tailer, DNA-primed DNA-dependent DNA polymerase such as the Klenow fragment of E. coli DNA polymerase I, and dNTPs), other combinations for template-mediated tailing are possible. These include: (1) DNA target, RNA tailer, DNA-primed RNA-dependent DNA polymerase such as reverse transcriptase, and dNTPs; (2) RNA target, DNA tailer, RNA-primed DNA-dependent DNA polymerase such as E. coli DNA polymerase I, and dNTPs; (3) RNA target, RNA tailer, RNA-primed RNA-dependent RNA polymerase, and tri-phosphate ribonucleotides (rNTPs). Various polymerases can be used such as T4 DNA polymerase, Taq DNA polymerase, etc, and with one or several types of nucleotides including the four tri-phosphate deoxyribonucleotides (dNTPs) - dATP, dGTP, dCTP, and TTP, or modified dNTPs such as ddATP, dUTP, etc.
Template-mediated tailing can be used for the labeling of a variety of single stranded DNA molecules (Fig. la) including oligonucleotides and denatured restriction fragments, provided that the sequence of the last few (preferably 8-12) nucleotides is known. Double stranded restriction fragments can also be labeled after being treated with lambda exonuclease (a 5Xo 3" exonuclease) as illustrated in Fig. lb. Labeling can be carried out with radioactive nucleotides as well as with non-radioactive tagged nucleotides such as biotinylated-dUTP or digoxigenin-dUTP.
The labeled DNA can be used for many applications including nucleic acid hybridization assays, gel mobility shift assays, molecular markers, DNA cloning, polynucleotide probes, recognition of a restriction site by a specially designed tailer recognizing only the chosen site (Examples B and C below) and tagging a given strand of a given restriction fragment for isolation of this strand or for the preparation of a fragment-specific, strand-specific probe (Fig. 7 below).
Unlike 5Λ- and 3"-end labeling with kinase or terminal transferase which label any available 5 - or 3 -end, template-mediated tailing will label only a DNA terminus containing a sequence which complements the "anchor" sequence of the tailer. Consequently, template-mediated tailing can be used to label only one restriction site out of several similar sites present in a restriction digest. This is due to the nrinimal working length of the "anchor" sequence which is most preferably 9 nucleotides long, while even 3 '-protruding restriction enzymes, such as PstI, leaves only 4 identical nucleotides at the 3 "-end of the restricted site. Thus 4 nucleotide-long sequences at the 3" -end are common to ah sites, but the 9-long sequences are unique, and a specific tailer can be designed to label it. Furthermore, the apparent sensitivity of template-mediated tailing suggests that this labeling can be done in the presence of a large excess of unrestricted DNA. In addition, since only one strand is labeled, a fragment-specific, strand-specific single-stranded probe can be obtained (see e.g. Fig. 7). Such a probe is much more effective than double-stranded labeled probes, and it is invaluable in RNA mapping experiments where fragment-specific, polar probes are required.
The method of the invention differs from the other methods previously described for modifying 3'-ends without the use of terminal transferase.
Dutta and Moss use DNA ligase, not DNA polymerase as in the present invention. Their modification is terminal-sequence specific only with respect to the 3'-end formed by a 3'-protruding restriction enzyme digest. Thus all fragments in a restriction mixture are modified identically. Furthermore, no dNTPs are utilized so no labeling or other modifications are possible.
In the method of Sriprakash and Hartas, the target entity and labeling agent are joined in the same molecule, and their method is apphcable for synthetic oligonucleotides only, since the built-in labeling sequence must be added to the target polynucleotide during ohgonucleotide synthesis. Thus, no native DNA fragments can be modified. The approach disclosed in the present invention is conceptually different since the target sequence is separated from the labeling sequence (the "tailer"). This separation gives the method of the invention its extreme flexibility so that not only synthetic oligonucleotides can be labeled but many other applications are also possible, as described below.
The significance of the template-mediated tailing method of the invention goes beyond the preparation of a site-specific, strand-specific probe from a mixture of restricted fragments. The method can also be apphed to the highly sensitive recognition of a specific restriction site in a DNA molecule, a method termed restriction site tagging (REST). The later application has been further developed into a novel diagnostic method, termed restriction site polymorphism (RSP), comprising the direct detection of polymorphic restriction sites without the need to perform gel electrophoresis.
RSP is a fast, efficient, and cost-effective assay, which may replace RFLP as a major assay in medical genetics. Since many tumors are associated with DNA mutations, this sensitive assay may be useful in the early detection and follow-up of cancer. In the long run, it may help in reducing costs of routine diagnostic mutation detection services, and in controUed large-scale molecular screening of the general population. Furthermore, detection of mutations by RSP is very sensitive and specific, so that incomplete PCR amplifications wiU stiU work with RSP, but not with RFLP. RSP may be used, inter alia for: (1) Detection of any DNA mutation which creates a restriction site. It should be noted that even if a new site is not naturaUy formed by the mutation, in many cases a designed primer can create a new site artificiaUy.
(2) Detection of mutated cancer ceUs in the presence of a large excess of normal ceUs. Most tumors are associated with somatic mutations, and their detection is more difficult due to the intermingling of mutated and normal ceUs in the tumor. RSP is very sensitive and specific and thus particularly fits to early detection and foUow-up of cancer.
(3) Large-scale screening of populations at risk for inherited or sporadic mutations for early detection of various diseases.
The apparent sensitivity of template-mediated tailing suggests that this labeling of specific restriction site can be done in the presence of a large excess of unrestricted DNA (see Example C). This feature may aUow RSP to be appUcable whenever two heterogeneous DNA populations exist as an admixture and are analyzed together. For example, in the case of a rare DNA mutation associated with a human disease, which creates a novel restriction site at a frequency of 1:10,000 individuals, current tests such as RFLP or ASOH
' require, on the average, 10,000 tests to be done in order to identify the one mutation. In contrast, the approach based on template-mediated tailing can identify the presence of such a mutation in one test only.
RSP can be used for detection of many inherited and somatic DNA mutations which creates a novel restriction site. It should be noted that even if a new site is not naturaUy formed by the mutation, in most cases a designed primer can create a new site artificially (Kahn et al., 1991). FinaUy, RSP can be modified such that it wiU distinguish not only between normal and mutated DNA but also between mutated heterozygous and homozygous individuals. The method can be employed by the basic protocols outlined below (Examples D-F), but also by modified protocols and in other devices including DNA micro-array/micro-chip technologies (HeUer et al., 1997). BRIEF DESCRIPTION OF THE DRAWINGS
The present invention wiU be better understood from the foUowing detaUed description of preferred embodiments, taken in conjunction with the foUowing drawings in which: Fig. la is a schematic diagram iUustrating an embodiment of a method of the invention using single stranded DNA;
Fig. lb is a schematic diagram iUustrating an embodiment of a method of the invention using double stranded DNA;
Fig. 2 shows pairs of target oligonucleotides and their corresponding tailers;
Fig. 3 shows an aciylamide gel on which were loaded the pairs of Fig. 2 without (A) or with (B) dATP added prior to the addition of radioactive dATP;
Fig. 4 iUustrates the use of probes labeled according to the method of the invention in the detection of a mutated Ki-ras gene in colorectal carcinoma; Fig. 5 shows a comparison between specific end-labeling of DNA fragments according to the method of the invention as compared to the conventional labeling method using transferase;
Fig. 6A is a schematic iUustration and Fig. 6B is an aciylamide gel showing the use of the method of the invention to detect restriction sites; Fig. 7 schematicaUy Ulustrates the preparation of a fragment-specific, strand-specific probe by the method of the invention.
Fig. 8 iUustrates the RSP method of the invention by identification of a novel Hinfl site in the MTHFR locus;
Fig. 9 iUustrates utilization of avidin-coated magnetic beads in a solid-phase RSP;
Fig. 10 is a schematic illustration showing the utilization of avidin-coated microweU plates in a sohd-phase RSP; Fig. 11 shows large-scale screening for MTHFR mutations in avidin-coated microweU plates: (A) incubated with intact PCR products; (B) incubated with the Hinfl-restricted products; and
Fig. 12 is a schematic iUustration showing how RSP can be utilized to distinguish among normal, heterozygous and homozygous individuals.
DETAILED DESCRIPTION OF A PREFERRED EMBODIMENT I.METHODS
A. Template-mediated tailing Four pairs of the foUowing oligonucleotides and taUers were incubated, as iUustrated in Fig. 2:
Oligonucleotides
#804 GGCGCCGTCGGTGTGGGCAA(20 bases)
#805 GGCGCCGGCGGTGTGGGCAA(20 bases) #815 CATTAAGCATTCTGCCGACATGGAAGCCAT (30 bases)
#823 GGAGCTGGTGGCGTAGGCAA(20 bases)
TaUers
#806 TTTTTTTTGCCCACA (15 bases)
#816 biotin-TTTTTTTATGGCTTCCA (17 bases) #824 biotin-TTTTTTTTTTTGCCTACG (18 bases)
20 pmole each of oligo and taUer were placed in 20 μl of Klenow buffer containing 100 mM NaCl, lOmM MgC12, 10 mM Tris-HCl pH 7.2 and 10 mM DTT 2 μCi of α-32P-dATP (3000 Ci/mmole, Amersham) and 1 unit of DNA polymerase I (Klenow fragment) were added. After 10 minutes incubation at room temperature, dATP was added to 20 M and after 5 additional minutes of "chase" the reaction was heated at 95°C for 3 minutes to inactivate the enzyme and to dissociate the oligonucleotide/taUer complex. 5 μl aliquots were loaded on 12% denaturing acrylamide gel containing 6M urea. After electrophoresis the gel was dried and exposed to X-ray film (Fuji). B.AUele-specific ohgonucleotide hybridization Oligonucleotides and taUers
Normal-specific ohgo #823 GGAGCTGGTGGCGTAGGCAA (20 bases) Mutation-specific ohgo #856 GGAGCTGGTGACGTAGGCAA (20 bases) TaUer #824 biotm-TTTTTTTTTTTGCCTACG (18 bases)
Normal and mutated DNA
DNA was isolated from normal blood and from colorectal carcinoma tissue and the first exon of the Ki-ras gene was amplified and cloned into a Bluescript KS II phagemid vector (Stratagene; D. Kislitsin, unpublished results). AUele-specific hybridization
Cloned DNA was heat-denatured and spotted onto Hybond N nylon membrane (Amersham). Ohgos #823 and #856 were both taUed with taUer #824, as described above. After heating to 90°C for 1 min, the probe was added to the membrane in 6xSSC buffer (lxSSC is 0.15M NaCl, 0.015M NaCitrate) and incubated for 4 hr at 52°C. Identical filters were washed sequentiaUy at increasing temperatures and exposed to Phosphoimager (Fuji). C.Restriction site polymorphism DNA. PCR primers. and taUers
DNA samples of normal, heterozygous, and homozygous methylene- tetrahydrofolate reductase (MTHFR) individuals were obtained from Dr. Gershoni, Rambam Medical Center, Haifa. Primers were modified simUarly to Goyette et al. (1994). The reverse (3Λ) primer contained a S'-biotin tag. TaUers were designed corresponding to the DNA sequence of the amplified MTHFR locus.
5'-PCR primer #890 GAAGGAGAAGGTGTCTGCGGGA
3'-PCR primer #892 biotin-GGACGGTGCGGTGAGAGTG Mutant taUer #884 TTTTTTCGATTTCAT Normal taUer #885 TTTTTTGAAGGAGAAG Labeling of taUers
Crude taUers were purified on a G-50 spin column and labeUed at their 5' -ends in 20 μl of kinase buffer (50 mM NaCl, 10 mM MgCl2, 10 mM Tris-HCl pH 7.2), containing 20 pmole of taUer, 5 μCi 32P-y-ATP (6000 Ci/mmole, Amersham) and 15 units of T4 nucleotide kinase (New-England Biolabs), at 37°C for 90 min. About 20% incorporation was obtained. Restriction site tagging Methylenetetrahydrofolate reductase (MTHFR) DNA was amplified in
20 μl PCR buffer (50 mM KC1, 1.5 mM MgCl2, 10 mM Tris-HCl pH 8.3) containing 200 μM of each dNTP, and 0.5 units of Taq DNA polymerase (Takahara), using lμM primers #890 and #892, the latter containing 5" -biotin. The amplification was carried out as foUows: 94°C, 4 min; [59°C, 30 sec; 72°C, 20 sec; 92°C, 30 sec] x 30; 55°C, 4 min; 72°C, 4 min. Half of the amplified DNA (about 200 ng) was restricted with 10 units of HinfT in 40 μl buffer #2 containing 50 mM NaCl, 10 mM MgCl2, 10 mM Tris-HCl pH 7.2, 1 mM DTT, at 37°C for 1 hr. The restricted and unrestricted DNA samples were brought to 1 M NaCl, ImM EDTA (B buffer), and incubated with 5 μl avidin-coated magnetic beads (M-280, Dynal, pre-washed with B buffer), at room temperature for 15 min. After wash with 100 μl W buffer (0.1 NaCl, 10 mM Tris-HCl pH 7.2), the non-biotinylated strand was melted with M buffer (0.15 M NaOH, 0.1 NaCl) at room temperature for 10 min. The beads were washed with 0.1 M Tris-HCl pH 7.2, foUowed by W buffer, and then buffer #3 containing 100 mM NaCl, 10 mM MgCl2, 10 mM Tris-HCl pH 7.2, 1 mM DTT, and divided into two. 10 pmole of the labeled mutant or general taUers were added and incubated for 30 min with 20 μM dATP and 5 units of Klenow at room temperature. The extra taUers were washed with fresh buffer #3 at 25-40°C. and the bound taUers were eluted with the same buffer at a temperature of 50-90°C. The wash and elution fractions were layered on DE-81 filters (Whatman), washed with 0.5 M phosphate buffer, end exposed to phosphoimager (Fuji).
D.RSP in microweU plates
In general the same reagents and methods described above have been used here as well, with the foUowing exceptions:
(a) Flat-bed avidin-coated microweU plates (obtained from Dr. Eh Morag, also avaUable from Boehringer) were used to bind the biotinylated DNA;
(b) Previously, bound taUers were eluted with buffer #3 (containing 100 mM NaCl, 10 mM MgCl ). Since high salt and Mg2+ raise the melting temperature, an attempt was made to increase elution efficiency of bound taUers by using elution buffer (EB): 10 mM Tris-HCl pH 7.2, 5 mM EDTA. Indeed, with EB, bound taUers are eluted at 40°C (not shown).
E.Large-scale screening
Genomic DNA was extracted from left-over blood samples in EDTA, which were kept frozen at -20°C for several weeks after coUection. About 200 μl of each sample were used for DNA isolation with a commercial kit (Boehringer).
H.EXAMPLES A.Template-mediated tailing
In a typical experiment, four different oligonucleotides were combined with their corresponding taUers (Fig. 2). The taUers generaUy contained 8-10 nucleotides in their anchor sequence and 6-8 nucleotides in their tailing sequence. The anchor sequence should be long enough to enable efficient initiation of the template-mediated tailing process, and the tailing sequence should be long enough to ensure incorporation of sufficient labeled nucleotides. Labeling by template-mediated tailing was carried out as described in the Methods section. AU four pairs gave strong and sharp bands on the gel (Fig. 3A). The size of the oligonucleotides is indicated on the left side of the gel. No labeling occurred if the taUers were missing (not shown), and if excess unlabeled dATP was added prior to the addition of the radioactive nucleotides (Fig. 3B). Thus, oligonucleotides of various lengths can be homogeneously labeUed by template-mediated-tailing to high specific activity, suggesting that template-mediated-taUing can successfuUy replace conventional methods such as 5"-end labeling with nucleotide kinase or 3"-end labeling with terminal transferase.
B.Utilization of template-mediated-tailing in aUele-specific detection of a point mutation
A common application of labeUed oligonucleotides is the detection of a point mutation in a certain gene by aUele-specific filter hybridization. The genomic DNA region containing the gene in question is amplified and DNA samples are spotted on nylon membrane and hybridized with labeUed oligonucleotides specific to the normal or the mutated gene sequence. After incubation and wash under appropriate conditions, only the specific ohgonucleotide remains bound to the filter, revealing if it is a normal or a mutated gene. In colorectal carcinoma, mutations in amino acids 12 and 13 of the
Ki-ras protein are highly prevalent, having a frequency of up to 50%. To demonstrate the ability of template-mediated-tailing to provide labeUed probes comparable with probes labeUed by traditional methods, two aUele-specific ohgos labeUed by template-mediated-taUing were used to calibrate an aUele-specific hybridization assay for a Ki-ras mutation in colorectal carcinoma. The same taUer (#824) was used for the labeling of the two ohgos. One ohgo (#823) was specific to the normal human Ki-ras first exon, while the second one (#856) was specific to a mutation in amino acid 13 (GGC to GAC). Different amounts of normal and mutated DNA were spotted onto several identical nylon membranes and hybridized with the two probes. After hybridization the membranes were washed sequentiaUy at increasing temperatures and exposed to Phosphoimager (Fuji).
As shown in Fig. 4, washings at 52°C, 55°C, 58°C, and 61°C, were insufficient to reveal differential hybridization. However, at 64°C the normal probe hybridized only to the normal DNA, while the mutant probe hybridized only to the mutated DNA. Thus, ohgos labeUed by template-mediated tailing are amenable for aUele-specific hybridization assay. Furthermore, since the taUer was left in the probe solution, it apparently does not interfere with the hybridization process.
C.Specific restriction site-tagging fRESD bv template-mediated tailing
Referring to Fig. 6A, plasmid DNA (Bluescript KS π, Stratagene) was restricted with PvuII into two fragments, creating 4 distinct 3" -termini. Decreasing amounts of the restricted DNA were mixed with a constant amount of unrestricted DNA, and a specific taUer was used to label one of the 3" -termini present in the short Pvufl fragment The labeUed products were separated in a 1.2% agarose gel. The short PvuH fragment was detected in dUutions down to 1:104 with Xhol-linearized plasmid DNA (Fig. 6B). Thus, template-mecftated-taihng can be used to recognize restriction sites with very high specificity and sensitivity. As exemplified in this experiment, if only one plasmid DNA molecule out of 104 molecules is restricted with the PvuII restriction enzyme, template-mediated tailing can detect it. Another application of the ability of template-mediated tailing to recognize a specific terminal is illustrated in Fig. 7, where a fragment-specific, strand-specific probe is prepared out of a mixture of several restriction fragments. In this figure, TTT — • represents a specific Biotinylated taUer.
D.Utilization of template-memated-tailing in the detection of restriction site polymorphism (RSP")
Based on the proven ability of template-mediated-tailing to detect a given restriction site directly and specificaUy, a novel approach, named Restriction Site Polymorphism (RSP), was developed which can replace RFLP in the detection of inherited and sporadic DNA mutations.
A common mutation in the MTHFR locus is a C to T change which creates a new Hinfl site. After gel electrophoresis, normal unrestricted DNA gives a 198 base-long band, while mutant DNA gives two bands of 175 and 23 bases.
In the RSP version of this assay, Ulustrated in Fig. 8, the amplified, Hinfl-restricted DNA is reacted with a taUer ( — 1 1 1) specific to the new 3 '-end created in the new polymorphic Hinfl site (□) of the DNA containing a mutation (*). After tailing, this new site is detected directly by incorporation of radioactivity, without gel electrophoresis.
To demonstrate how RSP works, an experiment was carried out in which a point mutation in the MTHFR locus, which creates a new Hinfl site, is detected by RSP. In previous experiments it was found that direct labeling by template-mediated tailing involved some non-specific incorporation of radioactivity which is not directed by the taUer (e.g. Fig. 6B). To overcome this technical difficulty it was decided to label the taUer, rather than the target DNA, and to exploit the template-dependent tailing process for specific attachment of the labeled taUer to the novel 3 "-end created in the mutated MTHFR after cleavage with Hinfl. Homozygous mutated MTHFR DNA was amplified with a reverse primer containing 5 '-biotin (#892). The amplified DNA was divided into two parts: one part was left untreated ("unrestricted"), and the second one was restricted with Hinfl ("restricted"). Both samples were bound to magnetic beads coated with avidin which were washed. The non-biotinylated strands were removed by melting and washing.
For the template-dependent tailing two different taUers were prepared: a "general" taUer (#885) which binds to the 3 "-end sequence of the biotinylated, bound strand amplified normal DNA, and a "site-specific" taUer (#884) which binds to the Hinfl site in the amplified mutated DNA. The taUers were labeled at their 5" -ends with γ- 2P-ATP, and each of the general and site-specific taUers were added to half of the "unrestricted" and "restricted" DNAs. The Klenow DNA polymerase I fragment was used to stably attach them to their targets by complementing the taUs with dATP. It is also possible to add 5'-biotin during taUer synthesis, as exemplified in Section E below.
It was predicted that a difference of 10 to 20 degrees in the melting temperature should be found between taUers bound to the template by fiiU extension of their taUs, and taUers bound by some non-specific extensions. In order to calibrate the system after initial wash of the unbound taUers, the bound taUers were washed at elevated temperatures. The results are shown in Fig. 9. Up to 35°C aU taUers incompletely bound were removed and at 40°C essentiaUy no more radioactivity was eluted. However, at 50°C , and more conspicuously at 90°C, substantial amounts of radioactivity were eluted. Thus, if radioactivity eluted at 50°C or higher is considered as an indication of a positive signal, it is clear that the site-specific taUer #884 recognized the restricted DNA (Fig. 9, lane c), but not the unrestricted one (lane a). When no DNA was added to the system, no signal was obtained (lane e).
As expected, the general taUer #885 recognized the unrestricted DNA (lane b). Thus, it has been shown for the first time that the RSP concept works properly. The site-specific taUer recognized the Hinfl-restricted DNA but not unrestricted DNA. The general taUer detected the unrestricted DNA, proving that it was amplified correctly and therefore the negative signal of this DNA with the site-specific taUer is due to the lack of the restricted Hinfl site. The restricted DNA (lane d), however, was also recognized by the general tailer. This signal may be interpreted as reflecting either residual non-restricted DNA due to sub-optimal efficiency of the Hinfl restriction enzyme, or more reasonably, indicating the presence of non-specific amplicons such as primer-dimers, etc., which contain the 5" -primer region used as an anchor site for the general taUer (Fig. 9). This technical problem may be overcome by the introduction of a new general restriction site at the end of the amplified molecule opposite the biotin-bound end. The non-biotinylated, reverse primer, is designed so that during amplification a novel restriction site is formed by a combination of the 3'-terminal nucleotides of the primer and the adjacent nucleotides of the target DNA (Kahn, et al, 1991; preferably, the novel restriction site is identical to the restriction site formed by the mutation under study, but a different restriction site type is also feasible). This site is formed in aU molecules amplified from the target DNA, and the general tailer is designed to label the 3'-end of this site after its restriction. Non-specific amplification products, such as primer dimers, wiU not include this site, and therefore wiU not be cleaved nor tagged by this taUer.
E.Solid-phase RSP in avidin-coated microweU plates
The cost effectiveness of a given diagnostic assay is a major factor in making it available to the pubhc. Thus, a major advantage of the RSP method would be the ability to carry it out on a large scale. Unlike RFLP, RSP does not require gel electrophoresis which is labor-intensive and lime-consuming, and therefore can be performed in the format of a microweU plate. Currently this format is the standard for large-scale diagnostic assays, and many devices which fit it have been developed, including solution delivery instruments, PCR thermal cyclers, and robotic workstations. To test the adaptation of RSP to the microweU plate format, the former experiment may be repeated using avidin-coated microweU plates instead of avidin-coated magnetic beads. Essentially the same procedures described in the former experiment are repeated, as Ulustrated in Fig. 10, in which • signifies biotin, * is a mutation, is the MTHFR gene, is the novel Hinfl site and | is the mutation specific taUer. Briefly, normal and mutated MTHFR DNA is amplified with one biotinylated primer. The amplification products are restricted with Hinfl, and incubated in separated weUs of an avidin-coated microweU plate. After washing and melting of the non-biotinylated strands, and re-washing, 5 -end labeled taUer #884 is added and incubated in the presence of dATP and the Klenow enzyme. Excess and non-specificaUy bound taUers are removed by washings at 30-40°C and the specificaUy bound taUers are eluted at 50-90°C, bound to a DE-81 filter, and detected with X-ray film or by a radioactivity imager.
F.Sohd-phase RSP in avidin-coated microweU plates - a pUot large-scale screening
A preliminary screening-like experiment was carried out using the microweU plate RSP assay to test for the presence of a MTHFR mutation in a large number of individuals.
The protocol described in the previous experiment was repeated with 79 samples of amplified DNA obtained from individuals with unknown MTHFR phenotype, and 6 samples with known phenotype. These 85 samples were divided into two halves: one half was untreated, whUe the second half was restricted with Hinfl. The two halves were arranged for avidin absorption in identical arrays in two avidin-coated microweU plates, one with the unrestricted (intact) PCR products, and one with the Hinfl-restricted products. After washing and melting of the non- biotinylated strands, and re-washing, 5"-end labeUed general taUer #885 was added to the weUs of the first plate, and 5' -end labeUed site-specific taUer #884 was added to the weUs of the second plate. After incubation in the presence of dATP and the Klenow enzyme, excess and non-specificaUy bound taUers were removed by washings at 42°C and the specifically bound taUers were eluted at 80°C. The general taUer #885 was used as positive control for proper PCR amplification and DNA sample handling.
The results are shown in Fig. 11. 74 samples and the 6 control samples gave positive signals. Five samples gave a low signal or no signal at aU with this taUer (Fig. 11A; samples IF, 9A, 9H, lOA, 11C). The site-specific taUer #884 was used to detect DNA samples restricted with Hinfl, and thus contaniing the MTHFR mutation. Known normal DNA samples (N) did not give any signal with this taUer (Fig. 11B; samples 6A, 6B). Heterozygotes (Ht) gave a weak signal (samples 6D, 6E), whUe homozygotes for the mutation (Hm) gave a strong signal (samples 6G, 6H). Interestingly, out of the 74 unknown amplified samples, about 5 samples (indicated by arrows) gave a weak signal similar to the signal obtained by the two known heterozygotes
(samples 2B, AC, 4E, 4G, 4H, 5H), representing putative MTHFR heterozygous individuals. As illustrated in Fig. 12, a simUar protocol can be used to distinguish among normal, heterozygous and homozygous individuals.
WhUe the present invention has been described in terms of several preferred embodiments, it is expected that various modifications and improvements wUl occur to those skUled in the art upon consideration of this disclosure. The scope of the invention is not to be construed as limited by the Ulustrative embodiments set forth herein, but is to be determined in accordance with the appended claims.

Claims

CLA S:
1. A method for the labeling of the single stranded 3' end of a target polynucleotide molecule comprising:
(a) preparing an ohgonucleotide, wherein the 3' end of said oligonu- cleotide is complementary to said 3' end of said target polynucleotide, and said ohgonucleotide comprises a nucleotide sequence located on the 5' side of said 3' end, said nucleotide sequence being termed hereinafter "the taihng sequence";
(b) incubating said ohgonucleotide and said target polynucleotide under polynucleotide extending conditions; (c) adding a polymerase and labeled tri-phosphate nucleotides to the incubation mixture of step (b), wherein said labeled nucleotides are complementary to the tailing sequence of the ohgonucleotide, and aUowing said labeled nucleotides to extend said 3' end of said target polynucleotide;
(d) optionaUy removing unincorporated labeled nucleotides from the mixture; and
(e) optionaUy dissociating said ohgonucleotide from said target polynucleotide.
2. A method according to Claim 1 wherein said target polynucleotide is DNA.
3. A method according to Claim 2 wherein said polymerase is DNA polymerase.
4. A method according to Claim 3 wherein said DNA polymerase is the Klenow fragment of DNA polymerase I.
5. A method according to Claim 1 wherein the tailing sequence of said ohgonucleotide is a (dT)n homopolymer, and said labeled nucleotides are labeled dATP.
6. A method according to Claim 1 wherein said target polynucleotide is RNA.
7. A method according to Claim 2 wherein said polymerase is RNA polymerase.
8. A method according to Claim 1 wherein said label is selected from the group consisting of a radioactive molecule and a non-radioactive molecule.
9. A method according to Claim 8 wherein said non-radioactive molecule is selected from the group consisting of biotin, fluorescein and digoxigenin.
10. A method according to Claim 1 wherein said target polynucleotide is a single stranded DNA molecule.
11. A method according to Claim 1 wherein said target polynucleotide is a double stranded DNA molecule having at least one single stranded end.
12. A method according to Claim 1 wherein said labeUed target polynucleotide molecule is an ohgonucleotide probe.
13. An ohgonucleotide probe labeled according to the method of Claim 1.
14. A method for detecting the presence of a restriction site in a DNA molecule comprising:
(a) treating said DNA molecule with a restriction enzyme which recognizes said restriction site, thereby creating a 3' end at said restriction site;
(b) preparing an ohgonucleotide, wherein the 3' end of said ohgonucleotide is complementary to said 3' end of said restricted DNA molecule, and said ohgonucleotide comprises additional nucleotides located on the 5' side of said 3' end, said nucleotides being termed hereinafter "the tailing sequence";
(c) separating the two strands of the restricted DNA molecule;
(d) incubating said ohgonucleotide and a separated strand of the restricted DNA under DNA extending conditions; (e) adding DNA polymerase and labeled tri-phosphate nucleotides to the incubation mixture of step (d), wherein said labeled nucleotides are complementary to the tailing sequence of the ohgonucleotide, and aUowing said labeled nucleotides to extend the 3' end of the separated strand of the restricted DNA; (f) optionally removing unincorporated labeled nucleotides from said mixture;
(g) optionaUy dissociating said ohgonucleotide from said target polynucleotide; and (h) detecting said labeled restricted DNA molecule.
15. A method according to Claim 14 wherein the tailing sequence of said ohgonucleotide is a (dT)n homopolymer, and said labeled nucleotides are labeled dATP.
16. A method according to Claim 1 wherein said DNA polymerase is the Klenow fragment of DNA polymerase I.
17. A method according to Claim 1 wherein said label is selected from the group consisting of a radioactive molecule and a non-radioactive molecule.
18. A method according to Claim 17 wherein said non-radioactive molecule is selected from the group consisting of biotin, fluorescein and digoxigenin.
19. A method for detecting the presence of a restriction site in a DNA molecule comprising:
(a) treating said DNA molecule with a restriction enzyme which recognizes said restriction site, thereby creating a 3' end at said restriction site;
(b) providing a pre-labeled ohgonucleotide, wherein the 3' end of said ohgonucleotide is complementary to said 3' end of said restricted DNA molecule, and said ohgonucleotide comprises additional nucleotides located on the 5' side of said 3' end, said nucleotides being termed hereinafter "the tailing sequence";
(c) separating the two strands of the restricted DNA molecule; (d) incubating said ohgonucleotide and a separated strand of the restricted DNA under DNA extending conditions;
(e) adding DNA polymerase and unlabeled tri-phosphate nucleotides to the incubation ntixture of step (d), wherein said unlabeled nucleotides are complementary to the tailing sequence of the ohgonucleotide, and aUowing said unlabeled nucleotides to extend the 3' end of the separated strand of the restricted DNA;
(f) optionaUy removing unincorporated labeled nucleotides from said mixture; (g) optionaUy dissociating said ohgonucleotide from said target polynucleotide; and
(h) detecting said labeled restricted DNA molecule.
20. A method for screening a body fluid or tissue sample for the presence of mutated DNA by determining the presence of a restriction site in said DNA which is normaUy not included therein, or by determining the absence of a restriction site in said DNA which is normaUy included therein, comprising:
(a) isolating DNA from said body fluid or tissue sample and optionaUy amplifying a region in said DNA;
(b) treating the DNA of (a) with a restriction enzyme which recognizes said restriction site, thereby creating a 3' end at said restriction site;
(c) preparing an ohgonucleotide, wherein the 3' end of said ohgonucleotide is complementary to said 3' end of said restricted DNA molecule, and said ohgonucleotide comprises additional nucleotides located on the 5' side of said 3' end, said nucleotides being termed hereinafter "the tailing sequence"; (d) separating the two strands of the restricted DNA molecule;
(e) incubating said ohgonucleotide and a separated strand of said restricted DNA under DNA extending conditions;
(f) adding DNA polymerase and labeled tri-phosphate nucleotides to the incubation mixture of step (d), wherein said labeled nucleotides are comple- mentary to the tailing sequence of the ohgonucleotide, and aUowing said labeled nucleotides to extend the 3' end of the separated strand of said restricted DNA;
(g) optionaUy removing unincorporated labeled nucleotides from said mixture; (h) optionaUy dissociating said ohgonucleotide from said restricted DNA and
(i) detecting the presence or absence of said restriction site, the presence or absence indicating the presence of mutated DNA.
21.' A method according to Claim 20 wherein said DNA molecule is a cDNA molecule transcribed from an RNA molecule.
22. A method according to Claim 20 wherein said DNA molecule is bound to magnetic beads.
23. A method according to Claim 20 wherein said DNA molecule is bound to a weU of a microweU plate.
24. A kit for screening a body fluid or tissue sample for the presence of mutated DNA by determining the presence of a restriction site in said DNA which is normaUy not included therein, or by determining the absence of a restriction site in said DNA which is normaUy included therein, comprising: (a) 2 PCR primers for DNA amplification;
(b) a prelabeled ohgonucleotide defined as in Claim 1(a); and
(c) a sohd phase support capable of binding one of said PCR primers.
25. A kit according to Claim 24 comprising:
(a) 2 PCR primers for DNA amplification, one of which is labeled with biotin;
(b) an ohgonucleotide defined as in Claim 1(a) prelabeled with fluorescein;
(c) unlabeled nucleotides;
(d) an avidin-coated microweU plate; (e) optionaUy a restriction enzyme; and
(f) optionaUy a DNA polymerase.
26. A kit according to Claim 24 comprising:
(a) a microweU plate to which is bound a PCR primer;
(b) a second unbound PCR primer; (c) an ohgonucleotide defined as in Claim 1(a) prelabeled with fluorescein;
(d) unlabeled nucleotides;
(e) optionaUy a restriction enzyme; and (i) optionaUy a DNA polymerase.
27. A kit according to Claim 24 comprising:
(a) 2 PCR primers for DNA amplification;
(b) an ohgonucleotide defined as in Claim 1(a) prelabeled with biotin;
(c) an avidin-coated microweU plate; (d) nucleotides labeled with fluorescein;
(e) optionaUy a restriction enzyme; and
(f) optionaUy a DNA polymerase.
28. A kit according to Claim 24 comprising:
(a) 2 PCR primers for DNA amplification, one of which is labeled with fluorescein;
(b) an ohgonucleotide defined as in Claim 1(a) prelabeled with biotin;
(c) an avidin-coated microweU plate;
(d) unlabeled nucleotides;
(e) optionaUy a restriction enzyme; and (JT) optionaUy a DNA polymerase.
PCT/IL1998/000513 1997-11-10 1998-10-21 Method for labeling polynucleotides WO1999024608A1 (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
AU95596/98A AU9559698A (en) 1997-11-10 1998-10-21 Method for labeling polynucleotides

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
IL122147 1997-11-10
IL12214797A IL122147A0 (en) 1997-11-10 1997-11-10 Method for labeling polynucleotides

Publications (2)

Publication Number Publication Date
WO1999024608A1 true WO1999024608A1 (en) 1999-05-20
WO1999024608A8 WO1999024608A8 (en) 1999-08-26

Family

ID=11070831

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/IL1998/000513 WO1999024608A1 (en) 1997-11-10 1998-10-21 Method for labeling polynucleotides

Country Status (3)

Country Link
AU (1) AU9559698A (en)
IL (1) IL122147A0 (en)
WO (1) WO1999024608A1 (en)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN115058469A (en) * 2022-04-25 2022-09-16 深圳大学 Method for labeling 3' -end biotin of short DNA fragment

Citations (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4521509A (en) * 1982-11-24 1985-06-04 Research Corporation Method for degrading DNA
GB2202328A (en) * 1987-03-11 1988-09-21 Orion Yhtymae Oy An improved method for assaying of nucleic acids, a reagent combination and a kit therefore
EP0300796A2 (en) * 1987-07-23 1989-01-25 Syntex (U.S.A.) Inc. Amplification method for polynucleotide assays
EP0649852A1 (en) * 1993-10-26 1995-04-26 Hitachi, Ltd. Fractionation method for nucleotide fragments
EP0701001A2 (en) * 1994-09-07 1996-03-13 Hitachi, Ltd. DNA separating, fractionating and analyzing method and system therefor
WO1996025521A1 (en) * 1995-02-17 1996-08-22 The Trustees Of Columbia University In The City Of New York Detection of high grade cervical lesions and cancers by a pcr/elisa assay
WO1996040994A1 (en) * 1995-06-07 1996-12-19 Merck & Co., Inc. Dna polymerase extension assay

Patent Citations (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4521509A (en) * 1982-11-24 1985-06-04 Research Corporation Method for degrading DNA
GB2202328A (en) * 1987-03-11 1988-09-21 Orion Yhtymae Oy An improved method for assaying of nucleic acids, a reagent combination and a kit therefore
EP0300796A2 (en) * 1987-07-23 1989-01-25 Syntex (U.S.A.) Inc. Amplification method for polynucleotide assays
EP0649852A1 (en) * 1993-10-26 1995-04-26 Hitachi, Ltd. Fractionation method for nucleotide fragments
EP0701001A2 (en) * 1994-09-07 1996-03-13 Hitachi, Ltd. DNA separating, fractionating and analyzing method and system therefor
WO1996025521A1 (en) * 1995-02-17 1996-08-22 The Trustees Of Columbia University In The City Of New York Detection of high grade cervical lesions and cancers by a pcr/elisa assay
WO1996040994A1 (en) * 1995-06-07 1996-12-19 Merck & Co., Inc. Dna polymerase extension assay

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN115058469A (en) * 2022-04-25 2022-09-16 深圳大学 Method for labeling 3' -end biotin of short DNA fragment

Also Published As

Publication number Publication date
WO1999024608A8 (en) 1999-08-26
IL122147A0 (en) 1998-04-05
AU9559698A (en) 1999-05-31

Similar Documents

Publication Publication Date Title
CA1338526C (en) Mutation detection by competitive oligonucleotide priming
Guo et al. Enhanced discrimination of single nucleotide polymorphisms by artificial mismatch hybridization
US5512441A (en) Quantative method for early detection of mutant alleles and diagnostic kits for carrying out the method
EP0200362B1 (en) Process for amplifying, detecting, and/or cloning nucleic acid sequences
EP0648280B1 (en) Method and reagent for determining specific nucleotide variations
EP0843735B2 (en) Glycosylase mediated detection of known nucleotide sequences
US7807358B1 (en) High-throughput methods for detecting DNA methylation
EP0777747B1 (en) Nucleotide sequencing method
NZ227688A (en) Amplification and detection of nucleic acid sequences by synthesis of specific rna transcripts
WO2013192292A1 (en) Massively-parallel multiplex locus-specific nucleic acid sequence analysis
WO1991007505A1 (en) Cloning method and kit
JPH10508746A (en) Method for detecting ras oncogene, especially K-ras oncogene
JP2002517981A (en) Methods for detecting nucleic acid sequences
EP1151136A1 (en) Method for detecting variant nucleotides using arms multiplex amplification
WO1997045555A1 (en) Method for detection of mutations
JP2002516666A (en) Method for amplifying at least one specific nucleotide sequence and primers used
US6083695A (en) Optimized primer library for gene sequencing and method of using same
US6232065B1 (en) Analysis of gene family expression
US6015675A (en) Mutation detection by competitive oligonucleotide priming
WO2018013724A1 (en) System and method for transposase-mediated amplicon sequencing
EP1300473B1 (en) Method of detecting nucleotide polymorphism
WO1999024608A1 (en) Method for labeling polynucleotides
US5851805A (en) Method for producing DNA from mRNA
US5595870A (en) Identifying nucleic acids by restriction digestion and hybridization with random or pseudorandom oligonucleotides
CN108949964A (en) For detecting the primed probe group and its application of rs12041331

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): AL AM AT AU AZ BA BB BG BR BY CA CH CN CU CZ DE DK EE ES FI GB GD GE GH GM HR HU ID IL IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MD MG MK MN MW MX NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT UA UG US UZ VN YU ZW

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): GH GM KE LS MW SD SZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
DFPE Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101)
AK Designated states

Kind code of ref document: C1

Designated state(s): AL AM AT AU AZ BA BB BG BR BY CA CH CN CU CZ DE DK EE ES FI GB GD GE GH GM HR HU ID IL IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MD MG MK MN MW MX NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT UA UG US UZ VN YU ZW

AL Designated countries for regional patents

Kind code of ref document: C1

Designated state(s): GH GM KE LS MW SD SZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG

CFP Corrected version of a pamphlet front page

Free format text: FIGURE ADDED

NENP Non-entry into the national phase

Ref country code: KR

REG Reference to national code

Ref country code: DE

Ref legal event code: 8642

122 Ep: pct application non-entry in european phase
NENP Non-entry into the national phase

Ref country code: CA