WO1999016898A1 - Molecular diagnostic of glaucomas associated with chromosomes 1, and method of treatment thereof - Google Patents
Molecular diagnostic of glaucomas associated with chromosomes 1, and method of treatment thereof Download PDFInfo
- Publication number
- WO1999016898A1 WO1999016898A1 PCT/CA1998/000923 CA9800923W WO9916898A1 WO 1999016898 A1 WO1999016898 A1 WO 1999016898A1 CA 9800923 W CA9800923 W CA 9800923W WO 9916898 A1 WO9916898 A1 WO 9916898A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- oligonucleotide
- tigr
- mutant allele
- seq
- protein
- Prior art date
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
Definitions
- the present invention relates to the identification of mutations in the TIGR/MYOC gene in the GLCIA locus and the detection of these mutations in individuals.
- the invention also relates to the identification of individuals who are genotypically homozygote mutants of an autosomal dominant inherited disease and yet display a normal phenotype.
- Glaucoma encompasses a complex of ocular-disease entities characterized by an optic neuropathy in which degeneration of retinal ganglion cells leads to a characteristic excavation of the head of the optic nerve (Shields et al., 1996, The Glaucomas, 2:717-725). Such damage causes progressive narrowing of the visual fields and, when uncontrolled, blindness. Affected people often have ocular hypertension defined as intraocular pressures consistently >21 mm Hg in both eyes. Although ocular hypertension is no longer an obligatory diagnostic criterion for glaucoma, it is still recognized as one of the most important risk factors (Wilson et al., 1996, The Glaucomas, 2:753-763).
- the glaucomas traditionally have been grouped into three categories: open angle, closed angle (also termed "angle closure"), and congenital. Each subtype has been further arbitrarily subdivided into primary, when the anterior chamber of the eye appears normal and no cause for glaucoma can be identified, or secondary, when glaucomas are caused by underlying ocular or systemic conditions (Shields et al., 1996, supra). Whereas the division between open and closed angles refers to the configuration of the irido-corneal angle in the anterior chamber of the eye, congenital glaucoma is used to define one of the many types of developmental glaucoma that usually occurs within the 1 st year of life.
- the majority (60%-70%) of primary glaucomas are of the open-angle type.
- Primary open-angle glaucomas have been further subdivided into two groups according to age at onset, severity, and mode of inheritance: the more prevalent is middle- to late-age-onset chronic open-angle glaucoma (COAG), by convention diagnosed after age 35 years and characterized by its slow, insidious course (Shields et al., 1996, supra; Wilson et al., 1996, supra).
- COAG chronic open-angle glaucoma
- JOAG juvenile open-angle glaucoma
- the less common form, juvenile open-angle glaucoma (JOAG) occurs between 3 years of age and early adulthood and generally manifests highly elevated intraocular pressures with no angle abnormalities (Goldwyn et al., 1970, Arch. Ophtalmol., 84:579-582; Francois, 1980, Am. J. Ophtalmol., 3:429-449; Johnson e
- GLC Human Genome Organization/Genome Database nomenclature
- “GLC” is the general symbol for the glaucoma genes
- “1", “2”, and “3” are, respectively, the symbols for the open-angle, angle-closure, and congenital subtypes of glaucoma
- “A”, “B”, and “C” refer, respectively, to the first, second, or third gene mapped in each subgroup.
- JOAG is a rare but aggressive form of glaucoma that usually segregates in an autosomal dominant fashion with high penetrance (Stokes, 1940, Arch. Ophthalmol., 24:885-909; Crombie et al., 1964, Br. J. Ophtalmol., 48:143-147; Lee et al., 1985, Ann. Ophtalmol., 17:739-741 ; Johnson et al., 1993, Ophthalmology, 100:524-529).
- Sheffield et al. (1993, Nat. Genet., 4:47-50) located a gene responsible for this condition, at 1q21-q31.
- This locus being the first open-angle glaucoma locus to be mapped, was named "GLC1A.”
- the TIGR/MYOC glaucoma disease gene consistently was first associated with onset of the glaucoma phenotype before the age of 45 years, highly elevated intraocular pressures, and typical excavation of the head of the optic nerve. Gonioscopy showed open angles with no anterior-chamber abnormalities.
- the GLC1A locus has subsequently been reported by Nguyen et al. in US Patent 5,606,043 to encode the trabecular meshwork induced glucocorticoid response (TIGR) gene.
- the gene sequence was first submitted (13-JAN-1997) by Nguyen et al. to the GeneBank accession # U85257.
- the TIGR sequence was modified on 19 April 1997 in GeneBank following modifications by Nguyen submitted on 02-APR-1997. The accession number stayed the same # U85257.
- markers The nomenclature system for the markers is well known in the field. The nomenclature used is decided by the Human Genome Organization (HUGO) nomenclature committee. It is as follows: for anonymous DNA sequences, the convention is to use D which is equivalent to DNA followed by 1-22, X or Y to denote the chromosomal number and location, then S stands for a unique segment and finally a serial number.
- D2S2161 is a DNA marker located on chromosome 2 representing a unique segment. Its serial number is 2161.
- GLC is the general symbol for the glaucoma genes
- 1", “2”, and “3” are, respectively, the symbols for the open-angle, angle-closure, and congenital subtypes of glaucoma
- A", “B” and “C” refer, respectively, to the first, second, or third gene mapped in each subgroup.
- the GLC1A locus was the first open-angle glaucoma locus to be mapped, in this case to chromosome 1q23-q25 in 1993.
- GDB Genome Data Base
- markers disclosed herein are short (CA)n repeat markers that have been developed in the Genethon laboratory near Paris, France. These markers are also accessible electronically at WWW-URL: http://www.genethon.fr/. Therefore markers are accessible either at GDB or at
- the first mutations identified in the TIGR gene that have been shown to give rise to glaucoma were first reported by Stone et. al (Science, 1997, 275:668-670). Twenty-eight mutations have now been reported. The methodology used to identify these mutations was by amplifying overlapping regions by polymerase chain reaction (PCR), performing single-strand conformational polymorphism (SSCP) on the amplification products and sequencing those DNA products that produced aberrant band pattern on the SSCP. No quick method for mutational analyses for the TIGR has been proposed.
- PCR polymerase chain reaction
- SSCP single-strand conformational polymorphism
- a homozygote mutant for an autosomal dominant disease should display a higher penetrance and severity for a human disorder than a heterozygote mutant.
- Heterozygotes for an autosomal dominant disease often exhibit variable penetrance.
- the invention concerns the mutational analyses in the GLC1A gene locus encoding the TIGR gene (GeneBank accession no. U85257; SEQ ID NO:1).
- the present invention provides means to identify at least two nucleotide changes in the DNA sequence coding for TIGR that result in an amino acid change in the TIGR gene.
- the invention further demonstrates that these amino acid changes result in mutations producing a disease state in individuals, the disease being glaucoma.
- a method for mutation analyses called amplification refractory mutation system (ARMS), that is simple, quick and adapted to glaucoma is disclosed herein.
- the proposed invention relates to the inclusion of primers and probes for the amplification and detection of all mutations in the TIGR gene.
- the invention teaches the use of the method of ARMS for glaucoma, the invention is not so limited.
- Other methods of mutation analyses known in the field such as allele specific oligonucleotide (ASO), denaturing gradient gel electrophoresis (DGGE) and artificially created restriction site (ACRS), can also be used.
- ASO allele specific oligonucleotide
- DGGE denaturing gradient gel electrophoresis
- ACRS artificially created restriction site
- the mutation detection and analyses thereof can be performed on either genomic DNA or cDNA by any method known to a person skilled in the art.
- the applicant has demonstrated for the first time a new type of dominance in mammals in which heterozygotes have a much higher penetrance rate for a disease gene mutation than their homozygotic counterparts.
- the present invention provides for the first time the identification in an autosomal dominant disease, of a homozygote mutant which is phenotypically normal, even though such an individual may give rise to an affected heterozygote offspring. This homoallelic complementation phenomenon has now been observed with 4 different patients.
- the invention provides applications and uses for such a discovery. These include but are not limited to: a) treatment of a heterozygote mutant (affected individuals with overexpressed mutant protein to induce protein complementation such that normal protein function can be restored, this application will apply to any autosomal dominant disease exhibiting the same mode of action as described herein (i.e. homoallelic complementation). b) similarly an individual being a heterozygote for an autosomal dominant disorder exhibiting the same mode of action as described herein can be treated by gene therapy, such that a mutant allele is inserted into a vector and delivered to an individual thereby negating the effect of the heterozygote mutation by either allelic or protein complementation.
- a transgenic animal designed to carry a deleterious autosomal dominant mutation can be used to assess the requirement to produce a phenotypically normal animal, by either allelic complementation or protein complementation.
- the teachings of the present invention can be used for showing dimezisation of TIGR peptides. The present invention therefore also provides the means to identify novel mutations in the TIGR gene, wherein these mutations give rise to glaucoma. These mutations can also be identified by any other means known to a person skilled in the art.
- the diagnostic methods of the present invention can be adapted in a kit format comprising probes, primers, oligonucleotides and reagents commonly known in the art to provide the means for detecting mutations that may cause glaucoma.
- the present invention further provides methods to treat diseases or conditions associated with homoallelic complementation.
- the mutation analysis according to the present invention is useful for screening individuals at risk for glaucoma. Such individuals may have a family history of glaucoma, and for identifying individuals carrying a mutation in the glaucoma gene enabling early treatment which may obviate or minimise the progression of the disease.
- kits comprising all the necessary reagents to carry out the herein described methods of detection.
- the kit comprises container means comprising oligonucleotide sequences or antibodies (or binding proteins) and reagents such as washing reagents, reagents for detection purposes and the like. It will also be readily recognized that the nucleic acid sequences or antibodies of the present invention could be incorporated into established kit formats.
- the present invention thus discloses, for the first time, a mechanism termed "homoallelic complementation" wherein for example the K423E mutation is acting in a dominant negative fashion, thereby resulting in a defective TIGRwt/K423E protein heteromaltemers but functional TIGR K23E/K23E homopolymers.
- This form of interaction may be interpreted as being somewhat similar to the "metabolic interference model” that suggested a deleterious defect due to interference between the protein products of the two different alleles (Johnson, 1980, Am. J. Hum. Genet. 32:374-86).
- the homoallelic complementation model of the present invention further proposes that functional TIGRwt/wt and/or TIGR K23E/K23E homopolymers are generated by an admixture of normal and mutant subunits in TIGRwt/K432E heterozygotes, thereby explaining, at least in part, the phenotypic variability observed in effected carriers as well as the unaffected mutant homozygotes described herein. It should be noted that Crick et al. (1964, J. Molec. Biol.
- an isolated DNA comprising the nucleotide sequence defined in SEQ. ID. NO.: 1 , wherein a mutation is identified therein.
- a method for detecting a mutant allele of the TIGR/MYOC gene which comprises the steps of contacting a DNA sample taken from an individual with an oligonucleotide as defined in claims 3, 5 or 7 and with an oligonucleotide primer of the present invention; obtaining an amplified product in an amplification reaction; and detecting the amplification product as an indication of the presence of said mutant allele.
- a method for detecting a non-mutant allele of the TIGR/MYOC gene which comprises the steps of contacting a DNA sample taken from an individual, with an oligonucleotide primer (or a probe enabling a distinction between wild type and mutant); obtaining an amplified product in an amplification reaction; and detecting the amplification product as an indication of the presence of the non-mutant allele.
- the application further relates to a kit for the detection of mutations in the TIGR gene comprising an oligonucleotide of the present invention; and suitable reagents required for obtaining amplified products in an amplification reaction.
- a method to counteract glaucoma in a heterozygotic carrier of TIGR mutations an overexpression of mutated TIGR protein in a patient, thereby rendering the phenotype of said patient normal by homoallelic complementation.
- a method to counteract and/or treat heterozygotic carriers of an autosomal dominant inherited disorder caused by a protein that forms homomultimers comprising at least one of an overexpression of the mutated protein and an inhibition of the normal protein in a patient, thereby rendering said phenotype normal by homoallelic complementation.
- a method to counteract a disease phenotype in a patient wherein the disease phenotype is associated with the presence of a heterozygotic mutation in a protein in the patient, the method comprising at least one of an elevation of the expression of a mutated protein and an inhibition of expression and/or activity of the normal protein, to counteract the affected phenotype, thereby rendering the phenotype normal by one of homoallelic complementation and haploinsufficiency.
- Nucleotide sequences are presented herein by single strand, in the 5' to 3' direction, from left to right, using the one letter nucleotide symbols as commonly used in the art and in accordance with the recommendations of the IUPAC-IUB Biochemical Nomenclature Commission.
- TIGR refers to the trabecular meshwork inducibie glucocorticoid response gene product, also known as MYOC, present at the GLC1A locus.
- MYOC trabecular meshwork inducibie glucocorticoid response gene product
- TIGR' therefore refers to TIGR/MYOC. It should be noted that the TIGR/MYOC gene is sometimes referred to as the GLC1A gene.
- the terminology "homoallelic complementation” refers to the novel description of mutant homozygotes being phenotypically normal with respect to an autosomal dominant inherited disease. It should be noted that although the present invention focuses on autosomal dominant inherited diseases, the present invention also applies to haploinsufficiency. Broadly stated, the mechanism would be similar to a suggested locus with a wild-type allele A and a mutant allele A', such that homozygosity for either allele, has no phenotypic consequences, but the heterozygous state AA' leads to a deleterious defect due to interference between the protein products of the two different alleles.
- nucleic acid molecule refers to a polymer of nucleotides. Non-limiting examples thereof include DNA (i.e. genomic DNA, cDNA) and RNA molecules (i.e. mRNA). The nucleic acid molecule can be obtained by cloning techniques or synthesized. DNA can be double-stranded or single stranded (coding strand or non-coding strand [antisense]).
- recombinant DNA refers to a DNA molecule resulting from the joining of DNA segments. This is often referred to as genetic engineering.
- DNA segment is used herein, to refer to a DNA molecule comprising a linear stretch or sequence of nucleotides. This sequence when read in accordance with the genetic code, can encode a linear stretch or sequence of amino acids which can be referred to as a polypeptide, protein, protein fragment and the like.
- amplification pair or “primer pair” refers herein to a pair of oligonucleotides (oligos) of the present invention, which are selected to be used together in amplifying a selected nucleic acid sequence by one of a number of types of amplification processes, preferably a polymerase chain reaction.
- amplification processes include ligase chain reaction, strand displacement amplification, or nucleic acid sequence-based amplification, as explained in greater detail below.
- the oligos are designed to bind to a complementary sequence under selected conditions. It will be clear to the person of ordinary skill that the present invention can be adapted to the detection of numerous mutations in
- TIGR/MYOC TIGR/MYOC.
- ARMS with oligos having the sequences of SEQ ID NO:5 and SEQ ID NO:7, mutations His366Gln and LYS424GLn were identified.
- the nucleic acid i.e. DNA or RNA
- the nucleic acid for practising the present invention may be obtained according to well known methods.
- Oligonucleotide probes or primers of the present invention may be of any suitable length, depending on the particular assay format and the particular needs and targeted genomes employed.
- the oligonucleotide probes or primers are at least 10 nucleotides in length, preferably between 15 and 24 nucleotides, and they may be adapted to be especially suited to a chosen nucleic acid amplification system.
- the oligonucleotide probes and primers can be designed by taking into consideration the melting point of hydrizidation thereof with its targeted sequence (in Sambrook et al., 1989, Molecular Cloning - A Laboratory Manual, 2nd Edition, CSH Laboratories; Ausubel et al., 1989, in Current Protocols in Molecular Biology, John Wiley & Sons Inc., N.Y.).
- Nucleic acid hybridization refers generally to the hybridization of two single-stranded nucleic acid molecules having complementary base sequences, which under appropriate conditions will form a thermodynamically favored double-stranded structure. Examples of hybridization conditions can be found in the two laboratory manuals referred above (Sambrook et al., 1989, supra and Ausubel et al., 1989 supra) and are commonly known in the art.
- a nitrocellulose filter can be incubated overnight at 65°C with a labeled probe in a solution containing 50% formamide, high salt ( 5 x SSC or 5 x SSPE), 5 x Denhardt's solution, 1 % SDS, and 100 ⁇ g/ml denatured carried DNA ( i.e. salmon sperm DNA).
- the non-specifically binding probe can then be washed off the filter by several washes in 0.2 x SSC/0.1 % SDS at a temperature which is selected in view of the desired stringency: room temperature (low stringency), 42°C (moderate stringency) or 65°C (high stringency).
- the selected temperature is based on the melting temperature (Tm) of the DNA hybrid.
- Tm melting temperature
- RNA-DNA hybrids can also be formed and detected.
- the conditions of hybridization and washing can be adapted according to well known methods by the person of ordinary skill. High stringency conditions will be preferably used (Sambrook et al.,1989, supra).
- Probes or nucleic acid molecules of the invention can be utilized with naturally occurring sugar-phosphate backbones as well as modified backbones including phosphorothioates, dithionates, alkyl phosphonates and ⁇ -nucleotides and the like. Modified sugar-phosphate backbones are generally taught by Miller, 1988, Ann. Reports Med. Chem. 23:295 and Moran et al., 1987, Nucleic acid molecule. Acids Res., 14:5019. Probes of the invention can be constructed of either ribonucleic acid (RNA) or deoxyribonucleic acid (DNA), and preferably of DNA.
- RNA ribonucleic acid
- DNA deoxyribonucleic acid
- probes can be used include Southern blots (DNA detection), dot or slot blots (DNA, RNA), and Northern blots (RNA detection). Although less preferred, labelled proteins could also be used to detect a particular nucleic acid sequence to which it binds. Other detection methods include kits containing probes on a dipstick setup and the like.
- Probes can be labelled according to numerous well known methods (Sambrook et al., 1989, supra).
- Non-limiting examples of labels include 3 H, 14 C, 32 P, and 35 S.
- Non-limiting examples of detectable markers include ligands, fluorophores, chemiluminescent agents, enzymes, and antibodies.
- Other detectable markers for use with probes, which can enable an increase in sensitivity of the method of the invention include biotin and radionucleotides.
- radioactive nucleotides can be incorporated into probes of the invention by several methods. Non-limiting examples thereof include kinasing the 5' ends of the probes using gamma 32 P ATP and polynucleotide kinase, using the Klenow fragment of Pol I of E. coli in the presence of radioactive dNTP (i.e. uniformly labelled DNA probe using random oligonucleotide primers in low-melt gels), using the SP6/T7 system to transcribe a DNA segment in the presence of one or more radioactive NTP, and the like.
- radioactive dNTP i.e. uniformly labelled DNA probe using random oligonucleotide primers in low-melt gels
- oligonucleotides or “oligos” define a molecule having two or more nucleotides (ribo or deoxyribonucleotides). The size of the oligo will be dictated by the particular situation and ultimately by the particular use thereof, and adapted accordingly by the person of ordinary skill.
- An oligonucleotide can be synthetised chemically or derived by cloning according to well known methods.
- a "primer” defines an oligonucleotide which is capable of annealing to a target sequence, thereby creating a double stranded region which can serve as an initiation point for DNA synthesis under suitable conditions.
- Amplification of a selected, or target, nucleic acid sequence may be carried out by a number of suitable methods. See generally Kwoh et al., 1990, (Am. Biotechnol. Lab. 8:14-25). Numerous amplification techniques have been described and can be readily adapted to suit the particular needs of a person of ordinary skill. Non-limiting examples of amplification techniques include polymerase chain reaction (PCR), ligase chain reaction (LCR), strand displacement amplification (SDA), transcription-based amplification, the Q ⁇ replicase system and NASBA (Kwoh et al., 1989, Proc. Natl. Acad. Sci.
- amplification will be carried out using PCR.
- PCR Polymerase chain reaction
- U.S. Pat. Nos. 4,683,195; 4,683,202; 4,800,159; and 4,965,188 the disclosures of all three U.S. Patent are incorporated herein by reference.
- PCR involves, a treatment of a nucleic acid sample (e.g., in the presence of a heat stable DNA polymerase) under hybridizing conditions, with one oligonucleotide primer for each strand of the specific sequence to be detected.
- An extension product of each primer which is synthesized is complementary to each of the two nucleic acid strands, with the primers sufficiently complementary to each strand of the specific sequence to hybridize therewith.
- the extension product synthesized from each primer can also serve as a template for further synthesis of extension products using the same primers.
- the sample is analysed to assess whether the sequence or sequences to be detected are present. Detection of the amplified sequence may be carried out by visualization following EtBr staining of the DNA following gel electrophoresis, or using a detectable label in accordance with known techniques, and the like.
- EtBr staining of the DNA following gel electrophoresis, or using a detectable label in accordance with known techniques, and the like.
- Ligase chain reaction is carried out in accordance with known techniques (Weiss, 1991 , Science 254:1292). Adaptation of the protocol to meet the desired needs can be carried out by a person of ordinary skill. Strand displacement amplification (SDA) is also carried out in accordance with known techniques or adaptations thereof to meet the particular needs (Walker et al., 1992, Proc. Natl. Acad. Sci. USA 89:392-396; and ibid., 1992, Nucleic Acids Res. 20:1691-1696).
- SDA Strand displacement amplification
- the term "gene” is well known in the art and relates to a nucleic acid sequence defining a single protein or polypeptide.
- a "structural gene” defines a DNA sequence which is transcribed into RNA and translated into a protein having a specific amino acid sequence thereby giving rise the a specific polypeptide or protein. It will be readily recognized by the person of ordinary skill, that the nucleic acid sequences of the present invention can be incorporated into anyone of numerous established kit formats which are well known in the art.
- vector is commonly known in the art and defines a plasmid DNA, phage DNA, viral DNA and the like, which can serve as a DNA vehicle into which DNA of the present invention can be cloned. Numerous types of vectors exist and are well known in the art.
- expression defines the process by which a structural gene is transcribed into mRNA (transcription), the mRNA is then being translated (translation) into one polypeptide (or protein) or more.
- expression vector defines a vector or vehicle, as described above, but designed to enable the expression of an inserted sequence following transformation into a host.
- the cloned gene (inserted sequence) is usually placed under the control of control element sequences such as promoter sequences.
- control element sequences such as promoter sequences.
- the placing of a cloned gene under such control sequences is often referred to as being "operably linked" to control elements or sequences.
- Expression control sequences will vary depending on whether the vector is designed to express the operably linked gene in a prokaryotic or eukaryotic host or both (shuttle vectors) and can additionally contain transcriptional elements such as enhancer elements, termination sequences, tissue-specificity elements, and/or translational initiation and termination sites.
- the designation "functional derivative” denotes, in the context of a functional derivative of a sequence, whether nucleic acid or amino acid sequence, a molecule that retains a biological activity (either functional or structural) that is substantially similar to that of the original sequence.
- This functional derivative or equivalent may be a natural derivative or may be prepared synthetically.
- Such derivatives include amino acid sequences having substitutions, deletions, or additions of one or more amino acids, provided that the biological activity of the protein is conserved.
- derivatives of nucleic acid sequences which can have substitutions, deletions, or additions of one or more nucleotides, provided that the biological activity of the sequence is generally maintained.
- the substituting amino acid When relating to a protein sequence, the substituting amino acid has chemico-physical properties which are similar to that of the substituted amino acid.
- the similar chemico-physical properties include, similarities in charge, bulkiness, hydrophobicity, hydrophylicity and the like.
- the term “functional derivatives” is intended to include “fragments”, “segments”, “variants”, “analogs” or “chemical derivatives” of the subject matter of the present invention.
- variant refers herein to a protein or nucleic acid molecule which is substantially similar in structure and biological activity to the protein or nucleic acid of the present invention.
- the functional derivatives of the present invention can be synthesized chemically or produced through recombinant DNA technology. All these methods are well known in the art.
- chemical derivatives is meant to cover additional chemical moieties not normally part of the subject matter of the invention. Such moieties could affect the physico-chemical characteristic of the derivative (i.e. solubility, absorption, half life and the like, decrease of toxicity). Such moieties are exemplified in Remington's Pharmaceutical Sciences (1980). Methods of coupling these chemical-physical moieties to a polypeptide are well known in the art.
- allele defines an alternative form of a gene which occupies a given locus on a chromosome.
- a “mutation” is a detectable change in the genetic material which can be transmitted to a daughter cell.
- a mutation can be, for example, a detectable change in one or more deoxyribonucleotide.
- nucleotides can be added, deleted, substituted for, inverted, or transposed to a new position.
- Spontaneous mutations and experimentally induced mutations exist.
- the result of a mutations of nucleic acid molecule is a mutant nucleic acid molecule.
- a mutant polypeptide can be encoded from this mutant nucleic acid molecule.
- purified refers to a molecule having been separated from a cellular component.
- a purified protein has been purified to a level not found in nature.
- a “substantially pure” molecule is a molecule that is lacking in all other cellular components.
- autosome defines any chromosome other that the sex chromosomes, X and Y.
- mutant refers to an allele that determines the phenotype displayed in a heterozygote with another normal or mutant allele.
- transgenic animal defines an animal that has had its germ line genetically modified to give rise to a progeny animal that is different from the parental type and carrying the modification in its germ line.
- Non-human transgenic animals of the invention comprise animals having transgenic alteration of an endogenous gene which shows homoallelic complementation, in accordance with the present invention.
- Such non-human animals are commonly known in the art and include vertebrates, and more especially mammalians, and especially rodents such as rats and more particularly mice.
- These transgenic animals have had introduced into their genomes, by non-natural means (i.e. by manipulation), one or more gene which does not occur naturally in the animal.
- These non-naturally occuring genes in the animal may be from the same species as the animal, although in such a case, the gene or genes are in a different configuration and/or chromosomal location.
- a transgenic non-human animal of the invention can be produced in accordance with well-known methods in the art. Non-limiting examples of such methods include viral integration, microinjection of zygotes and the like.
- Single Strand Conformational Polymorphism refers to a method for detecting the presence of a base pair change in an amplified DNA fragment. The method involves denaturing the double stranded amplified DNA and comparing the band pattern in a known non-mutant fragment to that of an unknown fragment. A shift in the band pattern is indicative of a base pair change.
- gene therapy defines an attempt to treat disease by genetic modification of the cells of a patient.
- Allele Specific Oligonucleotide are designed to detect known and identified base pair change by designing oligonucleotides that are specific to the DNA fragment with and without the base change. These oligonucleotides are used as probes in hybridisation protocols under stringent conditions. Differences in the hybridization patterns is indicative of the presence or absence of the base change.
- “Artificially Created Restriction Site (ACRS)” refers to a method for detection a known base change in a DNA sequence. It involves the designing of a primer that may either create or obviate a restriction site in the vicinity of known base change, such that the restriction endonuclease used can have a different digestion pattern for the changed and unchanged base.
- sequences and polypeptides useful to practice the invention include without being limited thereto mutants, homologs, subtypes, alleles and the like. It shall be understood that generally, the sequences of the present invention should encode a functional (albeit defective) interaction domain. It will be clear to the person of ordinary skill that whether an interaction domain of the present invention, variant, derivative, or fragment thereof retains its function in binding to its partner can be readily determined by using the teachings and assays of the present invention and the general teachings of the art.
- fusion proteins comprising one of the interacting domains of the present invention.
- at least one of an interaction domain of the present invention may be provided as a fusion protein.
- fusion proteins include LexA-fusions, B42-fusions, hemaglutinin fusions and Gluthione-S-transferase (GST) fusions and Maltose binding protein (MBP) fusions.
- protease cleavage site between the two polypeptide sequences which have been fused.
- protease cleavage sites between two heterologously fused polypeptides are well known in the art.
- the interaction domains of the present invention it might also be beneficial to fuse the interaction domains of the present invention to signal peptide sequences enabling a secretion of the fusion protein from the host cell.
- Signal peptides from diverse organisms are well known in the art.
- Bacterial OmpA and yeast Suc2 are two non limiting examples of proteins containing signal sequences.
- linker commonly known
- the interaction domains of the present invention can be modified, for example by in vitro mutagenesis, to dissect the structure-function relationship thereof and permit a better design and identification of modulating compounds (i.e. to deactivate or inhibit the normal protein).
- modulating compounds i.e. to deactivate or inhibit the normal protein.
- some derivative or analogs having lost their biological function of interacting with their respective interaction partner may provide further advantages as compared to known mutant protein, as well they may also find utility, for example for raising antibodies.
- Such analogs or derivatives could be used for example to raise antibodies to the interaction domains of the present invention.
- These antibodies could be used for detection or purification purposes.
- these antibodies could also act as competitive or non-competitive inhibitor and be found to be modulators of the protein-protein interactions of the present invention.
- the present invention also provides antisense nucleic acid molecules which can be used for example to decrease or abrogate the expression of the normal allele.
- An antisense nucleic acid molecule according to the present invention refers to a molecule capable of forming a stable duplex or triplex with a portion of its targeted nucleic acid sequence (DNA or RNA).
- the use of antisense nucleic acid molecules and the design and modification of such molecules is well known in the art as described for example in WO 96/32966, WO 96/11266, WO 94/15646, WO 93/08845, and USP 5,593,974.
- Antisense nucleic acid molecules according to the present invention can be derived from the nucleic acid sequences and modified in accordance to well known methods.
- some antisense molecules can be designed to be more resistant to degradation to increase their affinity to their targeted sequence, to affect their transport to chosen cell types or cell compartments, and/or to enhance their lipid solubility by using nucleotide analogs and/or substituting chosen chemical fragments thereof, as commonly known in the art.
- the term therapeutic agent should be taken in a broad sense so as to also include a combination of at least two such therapeutic agents.
- the DNA segments or proteins according to the present invention can be introduced into individuals in a number of ways. For example, erythropoietic cells can be isolated from the afflicted individual, transformed with a DNA construct according to the invention and reintroduced to the afflicted individual in a number of ways, including intravenous injection. Alternatively, the DNA construct can be administered directly to the afflicted individual, for example, by injection in the bone marrow. The DNA construct can also be delivered through a vehicle such as a liposome, which can be designed to be targeted to a specific cell type, and engineered to be administered through different routes.
- a vehicle such as a liposome
- the prescribing medical professional will ultimately determine the appropriate form and dosage for a given patient, and this can be expected to vary according to the chosen therapeutic regimen (i.e DNA construct, protein, cells), the response and condition of the patient as well as the severity of the disease.
- the chosen therapeutic regimen i.e DNA construct, protein, cells
- composition within the scope of the present invention should contain the active agent (i.e. fusion protein, nucleic acid, and molecule) in an amount effective to achieve the desired therapeutic effect while avoiding adverse side effects.
- active agents include the mutant protein according to the present invention a nucleic acid molecule encoding such a mutant protein, an antisense molecule to a normal allele according to the present invention, etc.
- the nucleic acids in accordance with the present invention can be administered to mammals (i.e. humans) in doses ranging from 0.005 to 1 mg per kg of body weight per day of the mammal which is treated.
- compositions and salts of the active agent are within the scope of the present invention and are well known in the art (Remington's Pharmaceutical Science, 16th Ed., Mack Ed.).
- the amount administered should be chosen so as to avoid adverse side effects.
- the dosage will be adapted by the clinician in accordance with conventional factors such as the extent of the disease and different parameters from the patient. Typically, 0.001 to 50 mg/kg/day will be administered to the mammal.
- TIGR/MYOC cDNA sequence (SEQ ID NO:1) localized at the GLC1A locus on chromosome 1q23-q25.
- Figure 2 shows the characterization of a carrier homozygous for the Lys423Glu TIGR mutation, a, Structure of the TIGR encoded protein.
- the leucine zipper domain (amino acids 117-166) is shown within the N-terminal half of the protein.
- the Lys423Glu mutation is depicted by an open circle in the olfactomedin homology domain represented by a striped box within the C-terminal half of the protein.
- Amino acids comparison between human TIGR/MYOC protein amino acids 415-437
- ARMS as a method to type specific alleles at a polymorphic locus.
- this method ARMS, was used for detecting a specific pathogenic mutation.
- the allele-specific oligonucleotide primers were designed to discriminate between two target DNA sequences (wild-type (normal) versus pathogenic) that differed by a single nucleotide in the region of interest (either one of the two mutations). Designed primers that differed at the extreme 3' terminus were synthetised. This was done because the DNA synthesis step in the PCR reaction is crucially dependent on correct base pairing at the 3' end.
- the primers that were designed are differing in their 3' ends and can therefore specifically amplify the DNA fragment of interest, either normal or mutated.
- This figure is a pictorial representation of ARMS for the adenine to guanine transition at nucleotide 1267. The amplification strategy is demonstrated for the wild-type, or non-mutant allele, and the mutant allele.
- Figure 4 shows the phenotypic status and segregation analyses of the GLC1A disease haplotype and Lys423Glu in family GV-510. All living individuals were investigated for glaucoma, genotyped with microsatellite markers spanning the GLC1A locus and tested for the presence of the Lys423Glu TIGR mutation using ARMS. Selected AFM markers with their corresponding GDB number, number of alleles observed for each marker in pedigree GV-001 and sizes of the allele associated with the GLC1A disease haplotype are represented on top. The position of the TIGR gene is indicated relative to genetic markers. Sex-averaged recombination distances, depicted between marker loci in centiMorgans, were not drawn to scale.
- Glaucoma patients are depicted by solid black symbols, unaffected individuals by open symbols, and deceased subjects reported as blind by at least two independent family members by a black quadrant in the upper left corner of their respective symbols.
- OHT persons are represented by open symbols containing a central solid dot. Present ages of normal and OHT patients as well as ages of affected carriers at time of diagnosis are depicted above their respective symbols.
- a solid black box indicates the common GLC1A disease haplotype. The right side of each phased haplotype indicates the haplotype inherited from the father; the left side indicates the haplotype inherited from the mother.
- An asterisk in the genotype of person VII-5 represents a microsatellite mutation at locus D1S2790.
- Person VII-5 also inherited a paternal recombination between loci D1S2815 and D1 S2790. Results of the ARMS tests are depicted below each subject's genotype; W, ARMS test performed using the wild-type primers; M, ARMS test performed using the Lys423Glu mutant primers. The internal control PCR product is shown. Persons VI-2, VI-5, VI-6, VI-10 and VI-12 carried the wild-type allele on both chromosomes 1. Persons VI-1 , VI -7, VI-9 and VI-11 are wild-type negative and mutant positive, therefore, homozygous for the Lys423Glu mutation. All other individuals are both wild-type positive and mutant positive, therefore, heterozygotes for the mutation.
- Figure 5 shows the characterization of carriers for the HIS366Gln and Gln368Stop TIGR mutations, a, Structure of the TIGR encoded protein.
- the leucine zipper domain (amino acids 117-166) is shown within the N-terminal half of the protein.
- the His366Gln mutation is depicted by a black circle in the olfactomedin homoiogy domain represented by a striped box within the C-terminal half of the protein.
- the Gln368Stop mutation is depicted by a stop codon in the olfactomedin homoiogy domain.
- the codon numbers correspond to those of the TIGR protein
- b Identification of carriers for the His366Gln and Gln368Stop TIGR mutations.
- Direct sequencing of genomic DNA revealed that persons CT-003 and LA-002 were, respectively, heterozygotic carriers of the Gln368Stop and His366Gln TIGR mutations.
- the arrows indicate the C to T transition or C to G transversion.
- Figure 6 shows that the TIGR wild-type protein and
- Lys423Glu mutated TIGR protein form high molecular weight complexes in vivo and in vitro, a, Western analyses of TIGR wild-type and TIGR Lys423Glu polypeptides in transfected cells.
- COS-7 cells were transiently transfected with expression vectors containing wild-type TIGR, pRc/CMV or TIGRK423E (pRcTIG432E) cDNA (20 mg per sample), alone or in combination. Twenty-four hours after transfection, protein extracts from total cell lysates were resolved by SDS-PAGE and TIGR polypeptides were detected by immunoblotting.
- TIGR wild-type (TIGRwt) 50- TIGR Lys423Glu (TIGRK423E) 50 indicates that 10 mg of each cDNA were added in this transfection.
- TIGRwt TIGR wild-type 50- TIGR Lys423Glu
- TIGRK423E TIGR Lys423Glu
- Two high molecular weight complexes are generated by TIGR polypeptides in COS-7 cells b, Western analyses of extracts obtained from dissected human trabecular meshwork (HTM) tissues. This analysis shows that TIGR polypeptides also form high molecular weight complexes in vivo.
- COS-7 cell extracts from cultures transfected with TIGRwt or TIGRK423E cDNA (20 mg) are depicted for comparison.
- Three distinct subtypes of TIGR monomers are observed after treating HTM tissue extracts with DTT. A brief exposure time period was performed to clearly visualize these monomers, c, Western analyses of in vitro synthesized TIGR wild-type and TIGR Lys423Glu polypeptides.
- pRcTIG or pRcTIG423E plasmids were added to a reticulocyte lysate transcription/translation coupled system containing pancreatic microsomal membranes. 0.5 microgram of each plasmid were tested per reaction.
- the invention thus concerns novel mutations in the TIGR gene, a quick method for an easy detection of identified mutations and the teachings for the first time of mutant homozygotes being phenotypically normal in an autosomally dominant inherited disease.
- the surprising and unexpected showing that homoallelic complementation restores a normal phenotype opens the way to new and powerful therapeutic approaches for diseases or conditions in which such a type of heterozygous state (AA 1 ) leads to a deleterious defect due to interference between the protein products of the two different alleles A and A', and in particular to an autosomal dominance state.
- the pedigree genealogy was reconstituted using the registers compiled from the clergy systematically list births, marriages, and deaths of 98% of the Quebec population. Validation of the family tree and new data on recent births were obtained through interviews with key family members.
- the Archives Nationales du Quebec, the Quebec Civil register, and the Institut detician sur I'etude des populations (IREP) data base (Bouchard et al., 1991 , inne d'un genome. Population et genetique dans Test du Quebec, Presses de I'Universite Laval, Sillery, Quebec, pp 607) were also consulted.
- Clinical assessments comprised complete ophthalmologic evaluation, including best corrected visual acuity; optic disk examination; slit-lamp biomicroscopy; applanation tonometry; gonioscopy; and visual-field evaluation.
- Three criteria were required for primary open-angle glaucoma (POAG) diagnosis: a) intraocular pressures above 22 mm Hg in both eyes, b) characteristic optic disk damage and/or visual field impairment, and c) grade III or IV (open-angle) gonioscopy.
- POAG primary open-angle glaucoma
- Blood samples were obtained from direct descendants of the founder as well as spouses of affected patients with children; from each, 20 ml of blood was drawn by venipuncture in heparinized tubes. One additional 10 ml blood sample was drawn from each subject to establish lymphoblastoid cell lines using the method of Anderson et al. (1984, In Vitro, 20:856-858).
- DNA was extracted from whole blood using the guanidine hydrochloride-proteinase K method developed by Jeanpierre (1987, Nucl. Acids. Res. 15:9611-9611).
- PCR polymerase chain reactions
- Amplifications were carried out using a "hot-start" procedure.
- Taq polymerase was added after a 5-min denaturation step at 96° C.
- Samples were then processed through 35 cycles of denaturation (94° C for 40 s) and annealing (55° C for 30 s), followed by one last step of elongation (2 min at 72°C).
- Phenotypic normal-homozv ⁇ ote mutant ( Figure 4) Phenotypic status and segregation analyses of the GLC1A disease haplotype and Lys423Glu TIGR mutation in family GV-510. All living individuals were investigated for glaucoma, genotyped with microsatellite markers spanning the GLC1A locus and tested for the presence of the Lys423Glu TIGR mutation using ARMS. Selected AFM markers with their corresponding GDB number, number of alleles observed for each marker in pedigree GV-001 and sizes of the allele associated with the GLC1A disease haplotype are represented on top. The position of the TIGR/MYOC gene is indicated relative to genetic markers.
- Sex-averaged recombination distances depicted between marker loci in centiMorgans, were not drawn to scale.
- Glaucoma patients are depicted by solid black symbols, unaffected individuals by open symbols, and deceased subjects reported as blind by at least two independent family members by a black quadrant in the upper left corner of their respective symbols.
- OHT persons are represented by open symbols containing a central solid dot. Present ages of normal and OHT patients as well as ages of affected carriers at time of diagnosis are depicted above their respective symbols.
- a solid black box indicates the common GLC1A disease haplotype. The right side of each phased haplotype indicates the haplotype inherited from the father; the left side indicates the haplotype inherited from the mother.
- An asterisk in the genotype of person VII-5 represents a microsatellite mutation at locus D1S2790. Person VII-5 also inherited a paternal recombination between loci D1S2815 and D1S2790. Results of the ARMS tests are depicted below each subject's genotype; W, ARMS test performed using the wild-type primers; M, ARMS test performed using the Lys423Glu mutant primers. The internal control PCR product is shown. Persons VI-2, VI-5, VI-6, VI-10 and VI-12 carried the wild-type allele on both chromosomes 1. Persons VI-1 , VI-7, VI-9 and VI-11 are wild-type negative and mutant positive, therefore, homozygous for the Lys423Glu mutation. All other individuals are both wild-type positive and mutant positive, therefore, heterozygotes for the mutation.
- RT-PCR was performed using the Superscript RT protocol (Gibco/BRL), 500 ng of oligo-dT and 10 ⁇ g of total RNA isolated from a pool of trabecular meshwork tissue dissected from 10 pairs of human eyes.
- the same protocol was followed using 10 ⁇ g of total RNA isolated from homozygote VI-9 immortalized lymphoblasts.
- genomic DNA sequencing was also performed on selected individuals by direct asymmetric PCR sequencing using modifications of the protocol described by Gyllensten et al. (1988, Proc. Natl. Acad. Sci., ⁇ 5:7652-7656). The mutation was recognized by the approximately equal peak intensity of the bands on the autoradiogram. All sequencing was performed bidirectionally.
- PCR was performed using standard protocols, annealing temperature was at 60°C. Amplification products were electrophoresed in 1 ,5% agarose gels before ethidium staining and scored by two independent observers. 4.2 ARMS test for the His366Gln mutation
- the first reaction contained a forward primer specific for the wild-type allele, SEQ. NO. 6 (GLC1 A 1098CT): GAGAAGGAAATCCCTGGAGCTGGCTACCTC.
- the second reaction contained a forward primer specific for the His366Gln TIGR allele, SEQ. NO. 5, (GLC1 AW98GT): GAGAAGGAAATCCCTGGAGCTGGCTACCTG.
- SEQ NO:4 was used as a common reverse primer. Both reactions gave a 393 bp amplified fragment.
- a second pair of primers that co-amplified a 438 bp fragment within TIGR exon 1 was added to the ARMS reaction.
- the forward TIGR exon 1 primer was: AGAGCTTTCCAGAGGAAGCC (SEQ ID NO: 11)
- the reverse TIGR exon 1 primer was TTGGGTTTCCAGCTGGTC (SEQ ID NO:15).
- PCR was performed using standard protocols, annealing temperature was at 60°C. Amplification products were electrophoresed in 1.5% agarose gels before ethidium staining and scored by two independent observers.
- EXAMPLE 5 The TIGR wild-type protein and Lys423Glu mutated TIGR protein form high molecular weight complexes in vivo and in vitro Methods Construction of cDNA expression vectors.
- This new construct was named pRcTIG and produced high constitutive levels of mRNA due to the presence of CMV enhancer-promoter sequences.
- An expression vector encoding a TIGR cDNA carrying the Lys423Glu mutation was then generated by site-directed mutagenesis of pRcTIG using the QuikChange mutagenesis kit (Stratagene).
- the primers used to generate the A to G transition in pRcTIG were: 5'-GGGAGACAAACATCCGTGAGCAGTCAGTCGCC-3' (SEQ ID NO: 16) and 5'-GGCGACTGACTGCTCACGGATGTTTGTCTCCC-3' (SEQ ID NO: 17).
- This second expression vector was named pRcTIG423E. All constructions were verified by sequencing the inserts bidirectionnally between the Hindlll and Notl sites.
- COS-7 cells were grown in Dulbecco's modified Eagle's medium (DMEM) (Gibco BRL) supplemented with 10% fetal bovine serum (Gibco BRL) and antibiotics (100 U/ml penicillin, 100 mg/ml streptomycin (Gibco BRL)). Cells were plated at a density of 2x106 cells per 75 cm2 tissue culture flask. Twenty-four h later, transient transfection was performed using the DNA/DEAE-dextran transfection method coupled with a chloroquine treatment and followed by a dimethylsulfoxide shock.
- DMEM Dulbecco's modified Eagle's medium
- Gibco BRL fetal bovine serum
- antibiotics 100 U/ml penicillin, 100 mg/ml streptomycin
- Each DNA/DEAE-dextran transfection sample contained a total of 20 mg/flask of plasmid pRcTIG or pRcTIG423E, alone or in combination.
- COS-7 cells were exposed to the DNA/DEAE-dextran solution (0.5 mg/ml of DEAE in PBS; 5ml/flask) for 30 min before addition of 20 ml of DMEM (w/o serum)/flask containing chloroquine to reach a final concentration of 0.02 mg/ml for a further 2.5 h incubation period.
- the solutions were then aspirated and the cells exposed to DMSO (10% DMSO in 5 ml DMEM with serum/flask) for exactly 90 seconds.
- the solutions were again aspirated and the cells incubated in 25 ml DMEM supplemented with 10% fetal bovine serum and antibiotics for 2 days before protein extraction.
- the culture medium was replaced between the second and third day.
- Reticulocyte lysate transcription-translation coupled system In vitro transcription/translation was performed using the TNT Coupled Reticulocyte Lysate System (Promega) according to the manufacturer's protocol. As both pRcTIG and pRcTIG423E constructs carried the T7 RNA promoter, no additional DNA modifications were done before testing. Reactions contained 0.5 microgram of each plasmid and a complete amino acid mixture instead of 35S-methionine. Canine Pancreatic Microsomal Membranes (Promega) (2.5 ml (2EQ/ml)/ 25 ml reaction) were added to the samples to optimize cotranslational processing. The samples were incubated for 90 min at 30°C before protein analysis.
- Protein concentration was estimated and, dithiothreitol (DDT; 0.1 mM) was added to selected samples for 10 minutes, prior to electrophoresis, to reduce disulfide links that may be involved in multimerization.
- SDS-PAGE was performed on 6% resolving acrylamide gels using 5% stacking gels. Protein were transferred onto nitrocellulose, using a Trans-Blot SD Semi-Dry Transfer Cell apparatus (Bio-Rad) for 1 h at 150 mA.
- Nitrocellulose membranes were saturated for 4 h at 4°C in TBS containing 0.1% Tween-20 (TBS-T) and 5% (w/v) skimmed milk powder (blotto), rinsed once (15 min) in TBS-T and incubated O/N at 4°C with purified TIGR antibodies diluted (1/2000) in blotto (1%).
- TBS-T Tween-20
- blotto skimmed milk powder
- the Lys423Glu mutation acts in a dominant negative fashion resulting in defective TIGR wildtype/Lys423Glu protein heteromultimers but functional TIGR Lys423Glu/Lys423Glu homopolymers.
- This model also demonstrates that a locus with a wild-type allele A and a mutant allele A', such that homozygosity for either allele has no phenotypic consequence, but the heterozygous state AA' leads to a deleterious defect due to interference between the protein products of the two different alleles.
- Homoallelic complementation further refers to affected heterozygotes in which some functional TIGR wild-type/wild-type and/or TIGR Lys423Glu/Lys423Glu homopolymers are also generated by an admixture of normal and mutant subunits, thereby explaining part of the phenotypic variability observed at this locus.
- TIGR mutated protein form high molecular weight complexes in vivo and in vitro ( Figure 6) provides evidence for homoallelic complementation as the mechanism accounting for the unaffected status of TIGR Lys423Glu/Lys423Glu mutant homozygotes.
- Figure 5 the TIGR wild-type protein and Lys423Glu TIGR mutated protein form high molecular weight complexes in vivo and in vitro.
- COS-7 cells were transiently transfected with expression vectors encoding the TIGR wild-type or TIGR Lys423Glu gene products, alone or in combination, and newly synthesized proteins were analyzed by immunoblotting.
- the 57 kD form corresponded to TIGR monomers originating at the first translation initiation site of the TIGR mRNA while the 62 kD form represented partially glycosylated monomers.
- the pattern of immunoreactivity was identical to that detected when transfections were performed with pRcTIG alone indicating that TIGR Lys423Glu gene products did not disrupt the formation of the two major complexes ( Figure 6 a and b).
- HTM human trabecular meshwork
Abstract
Description
Claims
Priority Applications (2)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
AU93340/98A AU9334098A (en) | 1997-09-30 | 1998-09-29 | Molecular diagnostic of glaucomas associated with chromosomes 1, and method of treatment thereof |
CA002345923A CA2345923A1 (en) | 1997-09-30 | 1998-09-29 | Molecular diagnostic of glaucomas associated with chromosomes 1, and method of treatment thereof |
Applications Claiming Priority (4)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CA 2216997 CA2216997A1 (en) | 1997-09-30 | 1997-09-30 | Molecular diagnostic of glaucomas associated with chromosomes 1 |
CA2,216,997 | 1997-09-30 | ||
CA2,231,720 | 1998-05-12 | ||
CA 2231720 CA2231720A1 (en) | 1998-05-12 | 1998-05-12 | Molecular diagnostic of glaucomas associated with chromosome 1 and method of treatment thereof |
Publications (1)
Publication Number | Publication Date |
---|---|
WO1999016898A1 true WO1999016898A1 (en) | 1999-04-08 |
Family
ID=25679667
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
PCT/CA1998/000923 WO1999016898A1 (en) | 1997-09-30 | 1998-09-29 | Molecular diagnostic of glaucomas associated with chromosomes 1, and method of treatment thereof |
Country Status (2)
Country | Link |
---|---|
AU (1) | AU9334098A (en) |
WO (1) | WO1999016898A1 (en) |
Cited By (6)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO2000042220A1 (en) * | 1999-01-11 | 2000-07-20 | The Regents Of The University Of California | Nucleic acids, kits, and methods for the diagnosis, prognosis and treatment of glaucoma and related disorders |
US6150161A (en) * | 1994-11-03 | 2000-11-21 | The Regents Of The University Of California | Methods for the diagnosis of glaucoma |
US6171788B1 (en) | 1997-01-28 | 2001-01-09 | The Regents Of The University Of California | Methods for the diagnosis, prognosis and treatment of glaucoma and related disorders |
EP1491627A1 (en) * | 2002-03-29 | 2004-12-29 | Sysmex Corporation | Gene examination method for judging the onset risk of glaucoma |
US6956103B2 (en) | 1994-04-28 | 2005-10-18 | The University Of Iowa Research Foundation | Glaucoma therapeutics and diagnostics |
US7138511B1 (en) | 1997-01-28 | 2006-11-21 | The Regents Of The University Of California | Nucleic acids, kits and methods for the diagnosis, prognosis and treatment of glaucoma and related disorders |
Citations (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO1996014411A1 (en) * | 1994-11-03 | 1996-05-17 | The Regents Of The University Of California | Methods for the diagnosis of glaucoma |
-
1998
- 1998-09-29 WO PCT/CA1998/000923 patent/WO1999016898A1/en active Application Filing
- 1998-09-29 AU AU93340/98A patent/AU9334098A/en not_active Abandoned
Patent Citations (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO1996014411A1 (en) * | 1994-11-03 | 1996-05-17 | The Regents Of The University Of California | Methods for the diagnosis of glaucoma |
Non-Patent Citations (6)
Title |
---|
ALWARD W ET AL: "The phenotype of primary open angle glaucoma patients with mutations in the GLAIA gene", INVESTIGATIVE OPHTHALMOLOGY AND VISUAL SCIENCE, vol. 38, no. 4 (Part 1-2), 11 May 1997 (1997-05-11) - 16 May 1997 (1997-05-16), pages S930, XP002094313 * |
NEWTON C R ET AL: "ANALYSIS OF ANY POINT MUTATION IN DNA. THE AMPLIFICATION REFRACTORY MUTATION SYSTEM (ARMS)", NUCLEIC ACIDS RESEARCH, vol. 17, no. 7, 11 April 1989 (1989-04-11), pages 2503 - 2516, XP000141596 * |
RAYMOND V ET AL: "Homozygotes for autosomal dominant open-angle glaucoma at the GLCIA locus", AMERICAN JOURNAL OF HUMAN GENETIC, vol. 59, no. 4 (suppl), 29 October 1996 (1996-10-29) - 2 November 1996 (1996-11-02), pages A280, XP002094310 * |
RAYMOND V ET AL: "Normal homozygotes for autosomal dominant open-angle glaucoma at tzhe GLAIA locus", INVESTIGATIVE OPTHALMOLOGY AND VISUAL SCIENCE, vol. 38, no. 4 (part 1-2), 11 May 1997 (1997-05-11) - 16 May 1997 (1997-05-16), pages S576, XP002094311 * |
RAYMOND V ET AL: "Normal homozygotes for primary open-angle glaucoma caused by the TIGR/GLCIA gene: evidence for a new form of dominance in man", AMERICAN JOURNAL OF HUMAN GENETICS, vol. 61, no. 4 (suppl), 28 October 1997 (1997-10-28) - 1 November 1997 (1997-11-01), pages A21, XP002094309 * |
STOILOVA D ET AL: "Identification of a new TIGR mutation in a family with juvinile-onset primary open angle glaucoma", OPHTHALMIC GENETICS, vol. 18, no. 3, September 1997 (1997-09-01), pages 109 - 18, XP002094312 * |
Cited By (7)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US6956103B2 (en) | 1994-04-28 | 2005-10-18 | The University Of Iowa Research Foundation | Glaucoma therapeutics and diagnostics |
US6150161A (en) * | 1994-11-03 | 2000-11-21 | The Regents Of The University Of California | Methods for the diagnosis of glaucoma |
US6171788B1 (en) | 1997-01-28 | 2001-01-09 | The Regents Of The University Of California | Methods for the diagnosis, prognosis and treatment of glaucoma and related disorders |
US7138511B1 (en) | 1997-01-28 | 2006-11-21 | The Regents Of The University Of California | Nucleic acids, kits and methods for the diagnosis, prognosis and treatment of glaucoma and related disorders |
WO2000042220A1 (en) * | 1999-01-11 | 2000-07-20 | The Regents Of The University Of California | Nucleic acids, kits, and methods for the diagnosis, prognosis and treatment of glaucoma and related disorders |
EP1491627A1 (en) * | 2002-03-29 | 2004-12-29 | Sysmex Corporation | Gene examination method for judging the onset risk of glaucoma |
EP1491627A4 (en) * | 2002-03-29 | 2005-05-04 | Sysmex Corp | Gene examination method for judging the onset risk of glaucoma |
Also Published As
Publication number | Publication date |
---|---|
AU9334098A (en) | 1999-04-23 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
JP5268145B2 (en) | Genetic polymorphisms associated with Alzheimer's disease, detection methods and uses thereof | |
US8137915B2 (en) | Genes involved in intestinal inflammatory diseases and use thereof | |
US20140018306A1 (en) | Methods and compositions for treating ocular disorders | |
JP2007185199A (en) | Locus for idiopathic generalized epilepsy, mutation thereof and method using the same to assess, diagnose, prognose or treat epilepsy | |
US5879884A (en) | Diagnosis of depression by linkage of a polymorphic marker to a segment of chromosome 19P13 bordered by D19S247 and D19S394 | |
JP2009523404A (en) | Genetic polymorphism associated with rheumatoid arthritis, detection method and use thereof | |
MXPA02008487A (en) | Diagnostics and therapeutics for glaucoma. | |
JP2003510349A (en) | Genes required for striatal function, their use, and compounds for regulating them | |
KR20080065657A (en) | Genes associated with macular degeneration | |
WO1995014085A2 (en) | A method for detection of alterations in the dna mismatch repair pathway | |
Bowles et al. | Construction of a high-resolution physical map of the chromosome 10q22–q23 dilated cardiomyopathy locus and analysis of candidate genes | |
WO1999016898A1 (en) | Molecular diagnostic of glaucomas associated with chromosomes 1, and method of treatment thereof | |
US6417342B1 (en) | Macular degeneration diagnostics and therapeutics | |
JP2002510508A (en) | Glaucoma treatment and diagnostic agents | |
JP4324472B2 (en) | Atlastin | |
US6562574B2 (en) | Association of protein kinase C zeta polymorphisms with diabetes | |
US20030082720A1 (en) | Compositions methods and kits relating to treating and diagnosing hypertension | |
JP2006506988A (en) | Human type II diabetes gene located on chromosome 5q35-SLIT-3 | |
CA2345923A1 (en) | Molecular diagnostic of glaucomas associated with chromosomes 1, and method of treatment thereof | |
CA2231720A1 (en) | Molecular diagnostic of glaucomas associated with chromosome 1 and method of treatment thereof | |
CA2216997A1 (en) | Molecular diagnostic of glaucomas associated with chromosomes 1 | |
WO1999016899A2 (en) | Molecular diagnostic of glaucomas associated with chromosomes 2 and 6 | |
US7351534B2 (en) | Gene mutation associated with age-related macular degeneration | |
EP1293570A2 (en) | Application of aprataxin gene to diagnosis and treatment for early-onset spinocerebellar ataxia (EAOH) | |
WO2004111272A2 (en) | Polymorphism in the human nbs1 gene useful in diagnostic of inherited predisposition to cancer |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
AK | Designated states |
Kind code of ref document: A1 Designated state(s): AL AM AT AU AZ BA BB BG BR BY CA CH CN CU CZ DE DK EE ES FI GB GE GH GM HR HU ID IL IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MD MG MK MN MW MX NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT UA UG US UZ VN YU ZW |
|
AL | Designated countries for regional patents |
Kind code of ref document: A1 Designated state(s): GH GM KE LS MW SD SZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG |
|
121 | Ep: the epo has been informed by wipo that ep was designated in this application | ||
DFPE | Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101) | ||
NENP | Non-entry into the national phase |
Ref country code: KR |
|
WWE | Wipo information: entry into national phase |
Ref document number: 09509516 Country of ref document: US |
|
REG | Reference to national code |
Ref country code: DE Ref legal event code: 8642 |
|
122 | Ep: pct application non-entry in european phase | ||
ENP | Entry into the national phase |
Ref document number: 2345923 Country of ref document: CA Kind code of ref document: A Country of ref document: CA |