WO1999015622A1

WO1999015622A1 - Improved thermal cycling apparatus and method

Info

Publication number: WO1999015622A1
Application number: PCT/AU1998/000796
Authority: WO
Inventors: Ross Barnard; Irina Elarova
Original assignee: Diatech Pty. Ltd.
Priority date: 1997-09-22
Filing date: 1998-09-22
Publication date: 1999-04-01
Also published as: WO1999015622A9; AUPO931797A0

Abstract

An apparatus for repeated execution of a thermal cycle is disclosed for promotion of a chemical reaction in a reaction fluid and/or on a solid support. The apparatus (10) comprises a reaction zone (11A) in fluid communication with an auxiliary zone (12A). There is also provided at least one thermal transfer means (24, 25) associated with the reaction zone (11A) and/or the auxiliary zone (12A). A motive means (408) is used to effect fluid transfer between the reaction zone (11A) and the auxiliary zone (12A). A temperature control means (404) regulates operation of the thermal transfer means (24, 25) to thereby regulate a temperature at said reaction zone (11A) and/or said auxiliary zone (12A). There is also provided a motive control means (401) for regulating operation of said motive means (408). In use, the temperature control means (404) and the motive control means (401) operate cooperatively to synchronize fluid transfer at a temperature to promote continuance of the chemical reaction.

Description

TITLE "IMPROVED THERMAL CYCLING APPARATUS AND METHOD"

FIELD OF THE INVENTION THIS INVENTION relates generally to a thermal cycling apparatus and method for promotion of a chemical reaction. In particular, the present invention relates to an improved thermal cycling apparatus and method in which thermoregulation and relative movement of a reaction fluid between two zones is synchronized such that temperature ramping from one temperature to another is substantially minimized.

BACKGROUND OF THE INVENTION Many processes have been developed which rely on a plurality of different temperature steps for promotion of a chemical reaction. For example, various amplification techniques have been developed for detecting the presence of nucleic acids and/or preparing nucleic acids in amounts sufficient for cloning or sequencing. Many of these techniques are predicated on thermal cycling of nucleic acids. For example, reference may be made to Saiki et al (1985, Science 230:1350-1354), US 4,683,194, US 4,683,195, US 4,683,202 and 4,800,159 which describe the polymerase chain reaction (PCR) . This methodology employs sequential hybridization reactions of a pair of anti-parallel oligonucleotide primers followed by enzymatic primer extension with a heat stable DNA polymerase to generate typically microgram quantities of DNA from diminutive amounts of starting material. The method involves subjecting target DNA and the primers to a denaturation step (usually at between 95°C and 100°C) before annealing the primers to single strands of the denatured DNA (generally at between 40°C and 85°C) . The primers are then extended with the heat stable DNA polymerase and deoxynucleoside triphosphates (typically at between 60°C and 85°C) in order to double the number of nucleic acid sequences between the primers. Repeated cycles of denaturation, primer annealing and extension of primers result in exponential amplification of the target DNA sequence.

Another thermal-cycling based technique is the Ligase Chain Reaction (LCR) which is disclosed in International Application Publication No O89/09835 (Orgel, L.E.). This method involves a cyclic 2-step reaction consisting of a high temperature melting step in which double-stranded target DNA unwinds to become single-stranded and a cooling step in which two abutting complementary oligonucleotides are annealed to the single-stranded target molecule and are ligated together by a heat stable DNA ligase. The products of the ligation from one cycle serve as templates for the ligation products of the next cycle and repetition of such cycling results in an exponential amplification of template DNA in an analogous fashion to that of PCR.

Reference also may be made to International application Publication No WO 98/28438 (Barnard et al ) which describes a solid phase-based primer extension methodology involving the use of an allele-specific oligonucleotide primer immobilized at a reaction zone of a solid support. This methodology is referred to as recirculating allele-specific primer extension (RASPE) . Briefly, a target nucleic acid is denatured and hybridized subsequently to the allele-specific primer. A polymerizing agent such as a heat stable DNA polymerase is then used to extend the primer using the target nucleic acid as a template for extension to form a primer extension product wherein at least one nucleotide incorporated therein is a detectably-modified nucleotide. The allele-specific primer is designed such that extension will only occur if the 3' end nucleotide of the primer is complementary to the 5' end nucleotide of the target nucleotide sequence to which it binds. Repeated cycles of denaturation, hybridization and extension reactions result in the presence or absence of a signal associated with the detectably-modified nucleotide in the reaction zone.

A multitude of thermal cycling devices has been developed to facilitate amplification and/or detection of nucleic acids. For example, reference may be made to EP 236069, US 4,474,015, EP 0693560, US 5,229,297, US 5,089,233, US 5,415,839, EP 0733714, EP 0770871 and EP 0733905 which disclose an assortment of thermal cycling devices. These devices are typically complex in construction and are dedicated to cyclical heating and cooling of a reaction mixture in a single vessel. In addition, heat transfer rates are limited to thermal changes of less than about 1°C per second and in consequence, the speed at which such devices cycle between temperature extremes is limiting. This may be attributed to at least two factors. First, the heat capacity of the apparatus surrounding a reaction vessel (typically a metal block) is generally considerable compared to the heat capacity of the relatively small volume of reaction mixture in the vessel. Accordingly, heating or cooling of the surrounding apparatus is rate limiting with regard to regulating the temperature of the reaction mixture in the vessel. Second, thermal contact between the reaction mixture and the surrounding apparatus is limiting since heat transfer must take place through the vessel in which the mixture resides (typically a plastic tube) .

In the context of a PCR amplification, the inefficiencies referred to above result in a reaction mixture being at a temperature which is disadvantageous for amplification for a significant portion of each cycle. If the temperature is too low, denaturation will not proceed within the manner desirable for amplification. On the other hand, if the polymerase has to be at or near the denaturation temperature for too long, even thermally stable polymerases will be destroyed. The foregoing disadvantages reduce the sensitivity and specificity of the amplification as well as increasing the time for performing the assay. Thermal cyclers are also known in which racks of tubes containing individual reaction mixtures are moved cyclically by a robotic arm through a plurality of baths set at different temperatures. This type of arrangement is cumbersome and requires substantially more user attention.

Attempts have been made to provide thermal cycling devices with improved heat transfer performance.

For example, reference may be made to US 5,133,940 which discloses an apparatus having a pair of reaction vessels made up of a polymerization vessel in fluid communication with a denaturation vessel. Each of the vessels is provided with a thermoregulator means to maintain a respective vessel at a constant temperature appropriate for polymerization or denaturation. In order to effect amplification of DNA, a reaction mixture is transferred cyclically from one vessel to another by means of liquid transfer tubing operably connected to a fluid transfer means such as a pair of gap supply tubes, or a fluid pump. The reaction mixture may be optionally transferred from the denaturation vessel to the polymerization vessel by first passing through a heat exchanger which rapidly lowers the temperature of the reaction mixture to one at which hybridization of nucleic acids is favoured. A disadvantage of this apparatus is that the number of thermoregulator/heat exchanger means necessary to perform an amplification will be directly proportional to the number of different temperature steps required to perform a particular thermal cycle. Thus, if a large number of different temperature steps are required per thermal cycle, the resulting apparatus may become relatively unwieldy thereby limiting portability of the apparatus. Also, transfer of a reaction mixture from one vessel to another requires the operation of a fluid pump and tubing which, in practice, suffer generally from poor/incomplete delivery of reagents. Another disadvantage is that this thermal cycler is incapable of accommodating solid-phase nucleic acid amplification reactions thereby limiting its flexibility.

Reference also may be made to US 5,176,203 which describes a thermal cycling apparatus comprising a capillary tube which may be of spiral, closed loop or linear form. The capillary tube defines a pathway along which a plurality of thermal means are positioned adjacent thereto for heating or cooling a reaction mixture introduced into the capillary tube in use. The apparatus also comprises means for moving the reaction mixture along the pathway at positions adjacent which respective thermal means are located thereby facilitating thermal cycling of the reaction mixture. A similar apparatus based on a microchip format is described by

Kopp et al (1998, Science 280:1046-1048). Although these devices appear to have improved ramping times with regard to temperature regulation of a reaction mixture, they have many of the inefficiencies discussed in respect of US 5,133,940.

Very few thermal cyclers have been developed for carrying out solid phase amplification of nucleic acids . Generally, thermal cyclers of this type have been developed for in si tu PCR. The HYBAID OmniSlide™ is a commercially available example in which a closable reaction chamber is provided within which a slide having a tissue sample immobilized thereon is positionable on a thermoregulator block and immersible in a suitable reaction mixture. This machine, however, suffers from many of the disadvantages of other prior art cyclers in that the thermoregulator block has a very high heat capacity which limits substantially its rate of thermal change. Accordingly, the speed and precision at which a reaction mixture is heated or cooled is less than optimal.

Reference also may be made to Barnard et al { supra ) which teach an apparatus for amplifying or detecting a target nucleic acid. The apparatus comprises a reaction zone for receiving a solid support having immobilized thereto first nucleic acids which are immersible in a reaction fluid. The reaction fluid comprises second nucleic acids being free in solution. The target nucleic acid may be included in the first nucleic acids on the solid support or the second nucleic acids in the reaction fluid depending on the particular amplification or detection method employed. A thermoregulation means is also provided for regulating the temperature of the reaction fluid at the reaction zone to facilitate at least in part the amplification and/or detection. Spaced from, and in fluid communication with, the reaction zone, there is provided a denaturation zone for denaturing the second nucleic acids in the reaction fluid. A fluid transfer means is also provided to move continuously the reaction fluid between the reaction zone and the denaturation zone during the course of the amplification and/or detection. This apparatus has significant advantage in that it provides a continuous source of denatured second nucleic acids for reaction with the first nucleic acids at the reaction zone. However, prior art inefficiencies relating to temperature ramping still apply.

OBJECT OF THE INVENTION It is an object of the present invention to provide an improved thermal cycling apparatus and method for promoting chemical reactions requiring a plurality of temperature steps which apparatus and method may ameliorate at least some of the aforementioned disadvantages .

DISCLOSURE OF THE INVENTION According to one aspect of the invention, there is provided an apparatus for repeated execution of a thermal cycle for promotion of a chemical reaction in a reaction fluid, said apparatus comprising: a reaction zone in fluid communication with an auxiliary zone at least one thermal transfer means associated with said reaction zone and/or said auxiliary zone; a motive means for effecting fluid transfer between the reaction zone and the auxiliary zone; a temperature control means for regulating operation of said at least one thermal transfer means to thereby regulate a temperature at said reaction zone and/or said auxiliary zone; a motive control means for regulating operation of said motive means; wherein the temperature control means and the motive control means operate cooperatively to synchronize fluid transfer at a temperature to promote continuance of the chemical reaction.

Preferably, each of said zones has a thermal mass greater than the thermal mass of the reaction liquid. Suitably, the apparatus further comprises a solid support associated with at least one of said reaction zone or said auxiliary zone, said chemical reaction occurring on the solid support. Preferably, the solid support has one or more reactants attached thereto.

The apparatus may have a single thermal transfer means associated with both said zones such that both zones are maintained at the same temperature. Alternatively, the apparatus may have a single thermal transfer means associated with the reaction zone such that the reaction zone is maintained at a temperature determined by the temperature control means and the auxiliary zone is at ambient temperature. Preferably, the apparatus comprises a first thermal transfer means associated with the reaction zone and a second thermal transfer means associated with the auxiliary zone such that both zones are maintained at temperatures determined by the temperature control means. The thermal transfer means may comprise any suitable heat exchanger for regulating the temperature of the reaction fluid at the reaction zone and/or the auxiliary zone such that the reaction fluid may be regulated rapidly to a temperature advantageous for effecting a step of the chemical reaction. The regulation of the reaction fluid temperature by the thermal transfer means may be effected by convection, conduction, radiation or a combination of any two or more of these. Suitably, the thermal transfer means comprises a Peltier cell which may effect heating and cooling of the reaction fluid as desired. Alternatively, the thermal transfer means may comprise heating means such as heating tape if cooling of a reaction fluid below ambient temperature is not required. Preferably, the respective cross sections of the reaction zone and the auxiliary zone ensure a large heat exchange surface to volume ratio, and each therefore enables rapid temperature variations of the reaction fluid. The temperature control means may be a circuit of fixed components arranged to regulate the temperature of the thermal transfer means according to a predetermined sequence of values. Alternatively, the temperature control means may be a circuit of fixed components and variable components arranged to regulate the temperature of the thermal transfer means at values determined by the variable components. Preferably, the temperature control means is a microprocessor programmed to regulate the thermal transfer means to a predetermined sequence of temperatures according to the thermal cycle of the chemical reaction.

Any suitable motive means may be employed to effect movement of the reaction fluid between the respective zones. For example, the motive means may comprise at least one fluid pump such as a vacuum pump or a peristaltic pump. Alternatively, the motive means may rely on a pressure differential between the respective zones and may therefore include a pair of gas supply tubes. In another form, the motive means may comprise a centrifuge whereby reaction fluid in the reaction zone is caused to migrate to the auxiliary zone and vice versa under centrifugal force. In a preferred form, the motive means is a stepping motor.

In a preferred form, the reaction zone and the auxiliary zone may be disposed within a reaction chamber. In this instance, the reaction chamber is disposed upon a substantially horizontal shaft of the motive means and oscillatory motion of the motive means causes one or other of said reaction zone or said auxiliary zone to be a lower zone causing gravity-induced transfer of the reaction fluid to the lower zone.

The motive control means may be a circuit of fixed components arranged to effect oscillation of the reaction zone and the auxiliary zone about a generally horizontal axis according to a predetermined time schedule. Preferably, the motive control means is a circuit of fixed components and variable components arranged to effect oscillation of the reaction zone and the auxiliary zone about a generally horizontal axis according to a time schedule determined by the variable components. More preferably, the motive control means is microprocessor programmed to synchronize oscillation of the reaction zone and the auxiliary zone about a generally horizontal axis, to the temperature of the thermal transfer means according to the thermal cycle of the chemical reaction.

Suitably, the temperature control means and the motive control means are combined in a single control means. In such a case, the single control means may effect temperature control and motive control according to a predetermined synchronized sequence to promote continuance of the chemical reaction.

In yet another form, the apparatus may comprise two reaction chambers, wherein one of the two reaction chambers comprises the reaction zone and the other comprises the auxiliary zone. Alternatively, two reaction chambers may be included in which each has a reaction zone capable of receiving a solid support, wherein the respective reaction zones function as auxiliary zones relative to each other.

In yet another form, the apparatus may comprise a single reaction chamber having a discrete reaction zone and a discrete auxiliary zone.

Alternatively, a single reaction chamber may be included having two discrete reaction zones, wherein the respective reaction zones function as auxiliary zones relative to each other.

In a still yet another form, the apparatus may comprise a plurality of pairs of reaction chambers wherein each said pair of reaction chambers is in fluid communication therebetween, and wherein one reaction chamber of a respective pair comprises a reaction zone and the other reaction chamber of the respective pair comprises an auxiliary zone. Alternatively, each reaction chamber of a respective pair may comprise two discrete reaction zones, wherein each said reaction zone functions as an auxiliary zone relative to the other reaction zone.

A reaction chamber according to the invention may have any suitable dimensions. For example, in the case of a reaction zone receiving, in use, a solid support, the dimensions of the reaction chamber are suitably selected to accommodate at least a volume of the reaction fluid sufficient for immersing the reactant(s) immobilized on the solid support.

Preferably, internal surfaces of a reaction chamber are comprised of a hydrophobic material so that the reaction fluid does not adhere to the internal surfaces in use. The internal surfaces, in this regard, may be formed of any suitable hydrophobic material including, but not limited to, silicon, polycarbonate, Teflon, polyvinylchloride and silanized glass.

Suitably, the apparatus accommodates one or more closable vessels extending, in use, between the reaction zone and the auxiliary zone. Advantageously, the vessel (s) may define a disposable test unit which is preferably hermetically sealable and has means for introducing therein, and removal therefrom, reactants and/or products of the chemical reaction. The vessel (s) may be constructed of any suitable material. Suitably, the vessel is comprised of a hydrophobic material so that the reaction fluid does not adhere to the internal surface of the vessel, in use. Preferably, at least the portions of the vessel (s) adjacent the respectively the reaction zone and the auxiliary zone, in use, are constructed of a thermally conductive material. For example, the material may be a thermoplastics material such polyester/polyethylene or other heat sealable laminate. Alternatively, the apparatus is provided with one or more spaced recesses, grooves or tracks defining respective liquid flow paths extending between the reaction zone and the auxiliary zone. Preferably, in such a case, the liquid flow paths are hermetically sealable . Suitably, the reaction zone receives, in use, a solid support having immobilized thereto one or more reactants of the chemical reaction. In this instance, if only some of the reactants of the chemical reaction are immobilized on the solid support, the reaction fluid may comprise the remainder of the reactants. For example, in the context of a nucleic acid amplification/detection, the one or more reactants immobilized on the solid support may comprise first nucleic acids and the remainder of the reactants in the reaction fluid may comprise second nucleic acids as described hereinafter.

Suitably, in one form, the apparatus comprises means for retaining the solid support therewithin, and more preferably means for retaining the solid support at the reaction zone. In the case of the apparatus comprising at least one reaction chamber, suitably, the at least one reaction chamber has means for introducing the solid support and the reaction fluid therein prior to the commencement of the chemical reaction, and for removing the solid support and the reaction fluid therefrom subsequent to the completion of the chemical reaction. In an alternate form, in which the apparatus accommodates hermetically sealable vessels or liquid flow paths, in use, it is preferable that such vessels or liquid flow paths have means for introduction and removal of the solid support.

Suitably, the apparatus further comprises a display means for displaying that the temperature of a zone according to the invention is being regulated and/or is at a particular temperature.

The apparatus may further comprise a detection means for detecting a reaction product of the chemical reaction in solution and/or on a solid support. Detection of any suitable reaction product is contemplated wherein the reaction product is associated with a detectable label. For example, in the case of a nucleic acid amplification/detection, the reaction product may include, but is not limited to, a probe nucleic acid or an extension product thereof attached to the solid support. Depending on the nature of the label, a signal may be instrumentally detected by irradiating a fluorescent label with light and detecting fluorescence in a fluorimeter; by providing for an enzyme system to produce a dye which could be detected using a spectrophotometer; or detection of a dye particle or a coloured colloidal metallic or non metallic particle using a reflectometer; in the case of using a radioactive label or chemiluminescent molecule employing a radiation counter or autoradiography. Accordingly, the detection means may be adapted to detect or scan light associated with the label which light may include fluorescent, luminescent, focussed beam or laser light. In such a case, the reaction product is preferably mounted on a charge couple device (CCD) or on a photocell and subsequently scanned for emission of light therefrom. In some cases, for example, enzymatically generated colour spots associated with an oligonucleotide array format as described in Barnard et al { supra ) , visual examination of the array will allow interpretation of the pattern on the array. However, even for a simple array, the number of possible patterns is large (e.g., for a 4 X 4 array there exists 2¹⁶ patterns) . Thus, for such an example, the detection means may be interfaced with pattern recognition software to convert the pattern of signals from the oligonucleotide array into a plain language genetic profile.

Suitably, the apparatus further comprises one or more auxiliary vessels in fluid communication with the reaction zone and/or auxiliary zone such that reagents for the chemical reaction may be introduced into, or removed from, said zones. Such reagents may include, for example, one or more reactants of the chemical reaction. In the case of a nucleic acid amplification/detection, reactants may include a probe nucleic acid, a target nucleic acid, dNTPs, ddNTP's, extender enzymes, buffers and washing solutions which may suitably comprise a reaction fluid according to the present invention.

In the case where the apparatus is adapted to receive a solid support, the support may be comprised of natural, synthetic or naturally occurring materials which are synthetically modified including, but not limited to, cellulose materials such as paper, cellulose and cellulose derivatives such as cellulose acetate and nitrocellulose; glass or glass fibres; natural or synthetic cloth; plastics; nylon; porous gels such as agarose, silica gel, dextran and gelatin; porous fibrous matrixes; starch based materials such as Sephadex® cross- linked dextran chains; ceramic materials; latex; films of polyvinyl chloride and polyamide; polystyrene; polycarbonate; and combinations of polyvinyl chloride- silica and the like. In a preferred embodiment, the solid support is characterized in that it is substantially planar. For example, a two dimensional substrate as described in US 5,424,186 (Fodor et al . ) may be employed. Such substrate may be used to synthesize two dimensional spatially addressed oligonucleotide (matrix) arrays. Alternatively, the solid support may be characterized in that it forms a tubular array in which a two dimensional planar sheet is rolled into a three dimensional tubular configuration.

In another aspect, the invention resides in a method for promoting a thermocyclic chemical reaction, said method including the sequential steps of:

(A) regulating the temperature of a reaction zone to a level that promotes the chemical reaction;

(B) collocating the reaction fluid with the reaction zone;

(C) regulating the temperature of an auxiliary zone to a level that promotes continuance of the chemical reaction;

(D) collocating the reaction fluid with the auxiliary zone;

(E) regulating the temperature of the reaction zone to a different level appropriate for facilitating further continuance of the chemical reaction;

(F) collocating the reaction fluid with the reaction zone; (G) carrying out steps (C) through (F) one or more times to effect said chemical reaction wherein at least one of step (C) or step (E) effects a thermal step of the chemical reaction.

The method is preferably further characterized in that step (C) effects a thermal step of the chemical reaction. Alternatively, the method may be further characterized in that step (E) effects a thermal step of the chemical reaction.

In yet another aspect of the present invention, there is provided a method for promoting a thermocyclic chemical reaction using the aforementioned apparatus, said method including the steps of:

(A) regulating the temperature of the reaction zone to a level that promotes the chemical reaction;

(B) collocating the reaction fluid with the reaction zone;

(C) controlling the thermal transfer means to regulate the temperature of the auxiliary zone to a level that promotes continuance of the chemical reaction;

(D) activating the motive means to transfer the reaction fluid from the reaction zone to the auxiliary zone;

(E) controlling the thermal transfer means to regulate the temperature of the reaction zone to a different level appropriate for facilitating further continuance of the chemical reaction;

(F) activating the motive means to transfer the reaction fluid from the auxiliary zone to the reaction zone;

(G) carrying out steps (C) through (F) one or more times to effect said chemical reaction wherein at least one of step (C) or step (E) effects a thermal step of the chemical reaction. Preferably, the method further includes the step of synchronizing the motive means with the thermal transfer means such that after completion of a thermal step of the chemical reaction at a first temperature at the reaction zone, the reaction fluid is transferred to the auxiliary zone which regulates the temperature of the reaction fluid so that the reaction fluid is suitable for carrying out a subsequent thermal step at the reaction zone or at the auxiliary zone.

In one form, the synchronization step may be characterized in that if the subsequent thermal step is carried out at the reaction zone, the reaction zone is regulated to a second temperature appropriate for facilitating said subsequent thermal step prior to transfer of the reaction fluid to the reaction zone. In such a case, the synchronization step is suitably further characterized in that different thermal steps of the chemical reaction are conducted only at the reaction zone .

In another form, the synchronization step may be characterized in that if the subsequent thermal step is carried out at the auxiliary zone, the auxiliary zone is regulated to a second temperature appropriate for facilitating said subsequent thermal step prior to transfer of the reaction fluid with the auxiliary zone. In this case, the synchronization step is preferably further characterized in that different thermal steps of the chemical reaction are conducted alternatingly between the reaction zone and the auxiliary zone.

Suitably, the method includes the step of placing a solid support at the reaction zone before initiation of the chemical reaction, wherein the solid support has one or more reactants attached thereto. In this instance, the method may further include the step of introducing into the reaction fluid one or more reactants for reacting with said reactant(s) on said solid support.

BRIEF DESCRIPTION OF THE DRAWINGS In order that the invention may be readily understood and put into practical effect, particular preferred embodiments will now be described by way of example with reference to the accompanying drawings in which:

FIG. 1 is a top plan view of one embodiment of the apparatus according to the invention;

FIG. 2 is a side plan view of the apparatus of FIG. 1;

FIG. 3 is an alternate side plan view of the apparatus of FIG. 1; FIG. 4 shows a block diagram of a control circuit for the apparatus of FIG. 1;

FIG. 5 is a circuit diagram of the apparatus of FIG. 1;

FIG. 6 is an alternative circuit diagram of the apparatus of FIG. 1;

FIG. 7 is a top plan view of an alternate embodiment of the apparatus suitable for effecting multiple chemical reactions;

FIG. 8 is a schematic illustration of another embodiment of the apparatus;

FIG. 9 is a schematic illustration of yet another embodiment of the apparatus;

FIG. 10 shows results of a RASPE assay conducted with the apparatus of FIG. 10; FIG. 11 is a graph of a timing diagram showing a typical heat cycle pattern of the apparatus of FIG. 1 used for facilitating an embodiment of the RASPE process;

FIG. 12 is a graph of a timing diagram showing a typical heat cycle pattern of the apparatus of FIG. 1 used for facilitating PCR.

FIG. 13 is histogram comparing the efficiency of a PCR reaction between the apparatus of FIG. 1 and a conventional thermal cycler; FIG. 14 is histogram comparing the efficiency of a Southern hybridization between the apparatus of FIG. 1 and a conventional Southern blot conducted in a dry oven.

EXAMPLE 1

Now referring to the figures and more particularly to FIGS. 1-3, there is illustrated an embodiment of the apparatus of the invention. The apparatus shown generally at 10 comprises a pair of reaction chambers 11, 12 in fluid communication therebetween, a thermoregulating plate 13, a plastics base plate 14 and a control unit 15.

The reaction chambers 11, 12 each have a substantially planar bottom surface 16, an end wall 17 and two side surfaces 18, 19 converging towards a junction 20 between the reaction chambers 11, 12. Side surfaces 18, 19 in use retain a solid support in the reaction chambers 11, 12. Reaction chambers 11, 12 each comprise a reaction zone 11A, 12A for sequentially regulating thermal steps of a chemical reaction.

A lid 21 is also provided in releasable sealing engagement with both reaction chambers 11, 12. Such engagement is provided by magnets 22, 23 and parts 22A and 23A responding to the effect of the magnets (either a metal part or a second complementary magnet) . Lid 21 is utilized for introducing a solid support to each of said reaction chambers 11, 12 or for removing a solid support therefrom.

Connected below the reaction chambers 11, 12 is thermoregulating plate 13 comprising Peltier cells 24, 25 located beneath and in bearing engagement with reaction zones 11A, 12A. In use, Peltier cells 24, 25 regulate the temperature of the reaction zones. In an alternate embodiment in which cooling below ambient temperature is not required, the Peltier cells may be replaced with heaters such as heating tape.

Base plate 14 is connected below thermoregulating plate 13 and comprises an axle 26 fixedly attached thereto. Axle 26 is disposed parallel to end walls 17 and below junction 20 of reaction chamber 11, 12. An oscillating means situated in the control unit 15 engages axle 26 to facilitate relative movement of reaction chamber 11, 12 about axle 26. With particular reference to FIG. 3, relative movement of reaction chamber 11, 12 is shown between upper and lower positions. In operation, such movement will effect gravity migration of a reaction fluid from one reaction zone to another reaction zone.

Control unit 15 comprises a microprocessor which effects control of the temperature of each Peltier cell 24, 25 through leads 27, 28 and control of the rate of oscillation of axle 26. Control unit 15 further comprises an actuating means 29 for initiating and terminating operation of the apparatus 10. Any suitable circuit configuration may be employed for controlling temperature regulation of Peltier cells 24, 25 and for controlling the rate and frequency of oscillation of axle 26.

Figure 4 shows a block diagram of a control circuit for the apparatus. A processor 401 generates control signals for determining the temperature of the left cell 402 and the right cell 403. Temperature controllers 404 control the temperature of the cells according to a set temperature signal provided from the processor 401 on lines 405.

The temperature controllers 404 drive heaters

(not shown) in the cells on lines 406 and receive feedback from thermal monitors (not shown) on lines 407.

Suitable temperature controllers are TMP-01 integrated circuits, as shown in FIGS. 5 and 6. The oscillation of the cells is provided by stepping motor 408 according to signals provided from the processor 401 and on line 409. An external clock (such as 555 timer) 410 can be used to provide the necessary timing signals for determining delays between operation of the stepping motor.

The processor 401 can be programmed by input means 411 to adjust the temperature of the cells and the oscillation of the stepping motor. Complex reaction conditions can be achieved by suitable programming of the processor. For instance, the reaction process displayed by the trace in FIG. 11 can be achieved automatically with suitable programming. A display 412 may optionally be provided for tracking the programmed reaction conditions during execution.

The circuit can be embodied in the fixed parameter version shown in FIG. 5. The circuit of FIG. 5 controls the right cell to a fixed temperature of 50 °C and the left cell to a fixed temperature of 95 °C. The stepping motor is operated according to the fixed time oscillation shown in FIG. 11. It will be appreciated that the circuit of FIG. 5 can be extended to provide a sequence of fixed temperatures for each cell. Such extension is well within the realm of those of ordinary skill in the art.

The circuit can also be embodied in the manually adjustable parameter version displayed in FIG. 6. In this version, the set temperature of each cell is adjustable by variable resistors 413. The time between operations of the stepping motor is set by decade counter 414.

The apparatus 10 may have any suitable dimension which preferably affords portability. The dimensions of the reaction chambers 11, 12 are suitably selected such that a relatively small volume of reaction fluid is necessary to effect the chemical reaction. Operation of the above apparatus 10 will be described in more detail hereinafter.

EXAMPLE ?

Now turning to FIG. 7, there is shown an alternate embodiment of the apparatus 100 comprising a plurality of pairs of reaction chambers shown generally at 101, each pair being similar to the pair of reaction chambers 11, 12 of apparatus 10 described above. In this embodiment, each pair of reaction chambers 11, 12 are connected side by side such that rotation of axle 103 effects simultaneous displacement of reaction chambers 11 relative to reaction chambers 12. Apparatus 100 in use suitably facilitates multiple chemical reactions.

EXAMPLE 3 With reference to FIG. 8, there is shown yet another embodiment of an apparatus according to the invention. The apparatus shown generally at 200 comprises concentrically disposed annular ring 201 and hub 202 as well as a backing plate 208 defining a reaction chamber 207. There is also provided two opposed reaction zones 203, 204 located on an inner wall 201A of the outer ring 201 and two solid supports 203A and 204A connected thereto. For convenience, reaction zone 203 is at 12 o'clock and reaction zone 204 is at 6 o'clock. The reaction chamber 207 is rotatable about axle 205 for facilitating upright movement of the reaction zones 203, 204 relative to each other.

Reaction zones 203, 204 are each operatively associated with a Peltier cell such that the temperature of a reaction fluid 206 is regulatable at these zones 203, 204. The Peltier cells in this regard are preferably microprocessor controlled for regulating a series of temperature changes at the reaction zones 203,

204 as well as the frequency of such temperature changes.

The apparatus 200 further comprises a cover plate 208 in releasable sealing engagement with the opening of the reaction chamber 207 to facilitate introduction and removal of solid supports 203A, 204A and reaction fluid 206.

In operation, the reaction fluid 206 when introduced into the reaction chamber 207 collocates with reaction zone 204 at 6 o'clock such that reactants such as nucleic acids attached to solid support 204A are immersed in said reaction fluid 206. Collocation of the reaction fluid 206 with reaction zone 203 and solid support 203A is effected by rotation of the reaction chamber about axle 205 which facilitates displacement of reaction zone 204 to the 12 o'clock position and displacement of reaction zone 203 to the 6 o'clock position. Reaction fluid 206 remains at the 6 o'clock position under the influence of gravity.

EXAMPLE 4 Turning now to FIG. 9, there is illustrated another embodiment of the apparatus 300 comprising two spaced reaction chambers 301, 302 in fluid communication therebetween. Reaction chambers 301, 302 comprise reaction zones 301A, 302A which may receive and retain solid supports 307, 308. Reaction zones 301A, 302A are each operatively associated with a Peltier cell such that the temperature of a reaction fluid is regulatable at these zones 301A, 302A. Preferably, the Peltier cells are microprocessor controlled for regulating a series of temperature changes at the reaction zones 301A, 302A and the frequency thereof.

Each reaction chamber further comprises a fluid inlet 310, 311 and a fluid outlet 312, 313. There is also provided fluid transfer tube 305 which communicates between outlet 312 of reaction chamber 301 and inlet 311 of reaction chamber 302, as well as fluid transfer tube 306 which communicates between outlet 313 of reaction chamber 302 and inlet 310 of reaction chamber 301. Peristaltic pumps 303, 304 are also provided for effecting transfer of a reaction fluid between reaction zone 301A and reaction zone 302A.

EXAMPLE 5

In one embodiment, synchronization of the relative movement of the reaction fluid with the thermoregulation means may be characterized in that after completion of a step of a cycle of a chemical reaction at the reaction zone, the reaction fluid is collocated with the auxiliary zone. Subsequent to, or simultaneously with, relative movement of the reaction fluid from the reaction zone to the auxiliary zone, the thermoregulation means effects a change in temperature of the reaction zone so that the temperature of the reaction fluid may be regulated to a level suitable for a subsequent step of the chemical reaction at the reaction zone. This level does not have to be the same level required at the reaction zone for effecting the subsequent step. All that is required is that the temperature of the fluid at the auxiliary zone is appropriate such that the reactants/products of the chemical reaction are suitable for participating in the subsequent step at the reaction zone. In consequence of the absence of fluid in the reaction zone, it will have a lower thermal mass compared to when it comprises the reaction fluid and will therefore be able to be cooled or heated more rapidly to an appropriate temperature suitable for said subsequent step. With conventional thermal cyclers, a reaction fluid remains stationary in a reaction vessel and the rate of change in temperature of the reaction fluid is limited by the rate of change in temperature of the reaction vessel. In the present embodiment, when the reaction zone reaches the appropriate temperature, the reaction zone may receive subsequently the reaction fluid from the auxiliary zone and the temperature of the reaction fluid may then be regulated by the reaction zone so that the fluid effects the subsequent step of the chemical reaction. Transfer of reaction fluid between said reaction zone and said auxiliary zone is repeated through a plurality of cycles in concert with sequential regulation of temperature at the reaction zone and/or the auxiliary zone to effect completion of the chemical reaction. Synchronization of the relative movement of the reaction fluid with the thermoregulation means in this way advantageously minimizes the time for changing temperature of the reaction fluid and for completing the chemical reaction. In an embodiment which is advantageous for solution phase chemical reactions, synchronization of the relative movement of the reaction fluid with thermoregulation means may be effected such that at the completion of a step of a cycle of the chemical reaction at the reaction zone, the temperature of the auxiliary zone is such that when the auxiliary zone receives the reaction fluid from the reaction zone, the temperature of the reaction fluid is changed rapidly to an appropriate temperature which is advantageous for facilitating a subsequent step of the chemical reaction at the auxiliary zone. This relative movement of the reaction fluid from the reaction zone to the auxiliary zone effects rapid heating or cooling of the reaction fluid to said appropriate temperature since the auxiliary zone is at or near said appropriate temperature before receiving the reaction fluid.

Subsequent to, or simultaneously with, relative movement of the reaction fluid from the reaction zone to the auxiliary zone, the temperature of the reaction zone is regulated to a level appropriate for the next step of the chemical reaction at the reaction zone. The reaction zone in this regard will have a lower thermal mass compared to when it comprises the reaction fluid and will therefore be able to be cooled or heated more rapidly to the appropriate temperature. After a suitable time of incubating the reaction fluid at the appropriate temperature at the auxiliary zone, the reaction fluid is then collocated with the reaction zone to facilitate the next step of the chemical reaction. Transfer of reaction fluid between the reaction zone and the auxiliary zone is repeated through a plurality of cycles in concert with sequential regulation of temperature at the reaction zone and the auxiliary zone to effect completion of the chemical reaction. The above synchronization of the relative movement of the reaction fluid with thermoregulation means associated with the reaction zone and the auxiliary zone minimizes the time for changing temperature of the reaction fluid and for effecting the chemical reaction.

EXAMPLE 6 In the case where the chemical reaction defines a nucleic acid amplification and/or detection assay, a target nucleic acids may be free in solution for solution phase assays, or may be attached to a solid support for solid phase assays. With regard to the latter, the type of nucleic acid attached to the solid support will vary depending on the particular analysis being performed. In the case of a probe nucleic acid, such sequence may comprise an oligonucleotide primer specific for detecting a particular target nucleic acid present in a nucleic acid extract. Examples of methods for attaching oligonucleotide primers to a solid support are well known to those of ordinary skill in the art. Alternatively, in the case of a target nucleic acid being attached to a solid support, such sequence may be prepared by first extracting nucleic acids from a sample and subsequently attaching the nucleic acids to the solid support as routinely performed for colony hybridizations, Southern hybridizations, or Northern hybridizations and the like. Methods for attaching such nucleic acid extracts to suitable solid supports are well known to persons of ordinary skill in the art.

In view of the above, it will be appreciated that the apparatus of the invention may be utilized for any chemical reaction in which different temperatures are required for facilitating different thermal steps of the reaction. For example, the chemical reaction may define a process of amplifying or detecting a target nucleic acid. Such process includes, but is not limited to, a nucleic acid amplification technique such as PCR, LCR, and primer extension reactions such as RASPE mentioned above. In this context, the thermoregulation means preferably regulates the temperature of a reaction zone such that the zone is capable of regulating the temperature of the reaction fluid to a level appropriate for effecting a step selected from the group consisting of:

(i) hybridizing a probe nucleic acid to a target nucleic acid to form a hybrid, wherein said probe nucleic acid is substantially complementary to at least a portion of said target nucleic acid;

(ii) extending the probe nucleic acid of the hybrid, in the presence a polymerization agent to form a duplex including an extended probe molecule; (ϋi ligating two or more probe nucleic acids hybridized to two abutting sequences of a target nucleic acid to form a duplex having a ligated strand; and (iv) denaturing the hybrid of (i) and/or the duplex of (ii) and/or the duplex of (iii) to separate the strands thereof.

In the case of a nucleic acid amplification and/or detection reaction in which a solid support has immobilized thereto first nucleic acids and the reaction fluid contains second nucleic acids, the first nucleic acids attached to the solid support may comprise (1) a probe nucleic acid or (2) a target nucleic acid. In the case of (1) , suitable nucleic acid amplifications and/or detections which may be facilitated therewith include, for example, solid-state embodiments of PCR and LCR methods which are well known to those of ordinary skill in the art, as well as primer extension reactions such as the RASPE process mentioned above. With reference to (2), it will be appreciated that nucleic acid detections which may be facilitated therewith include, but are not limited to, colony hybridizations, Southern hybridizations, and Northern hybridizations. Thus, for example, the apparatus of the invention may be utilized for carrying out any suitable nucleic acid detection method which requires thermoregulation of a reaction and, for instance, recirculation of denatured probe nucleic acid or denatured target nucleic acid.

EXAMPLE 7 Applica tion of the appara tus of FIG. 1 to a Two-Tempera ture RASPE process

Two chemically activated Immobilon® strips each with a linear array of spots of oligonucleotides (approximately 23-29 nucleotides long with a spacer molecule between the 5' end of the oligonucleotide and the PVDF strip) were placed at opposite ends of the apparatus shown in FIG. 1. The strips were constructed by covalently linking 800 pmole of the following oligonucleotides to Immobilon® strips: p-53 5'-NH₂-7 carbon linker-

GTGGTAATCTACTGGGACGGAAC-3 * 'CF' or 5'-NH₂-7 carbon linker- 'CFWT' AAAAAAAATTCATCATAGGAAACACCAAA-3' CFDEL 5'-NH₂-7 carbon linker-

AAAAAAAATTAAAGAAAATATCATTGG-3 ' CF542T 5'-NH₂-7 carbon linker-

TTTTTTTTTAAGACAATATAGTTCTTT -3*

Oligonucleotide CF or CFWT is complementary along its entire sequence to a target sequence within wild type exon 10 of the CFTR gene. Oligonucleotide CFDEL is specific for a mutant CFTR exon 10 (which has a deletion of three bases) . Oligonucleotide CF542T is specific for a mutant CFTR exon 11 (relating to codon 542 of the deduced CFTR polypeptide sequence) . Oligonucleotide p-53 is specific for p53 exon 8.

Five hundred microlitres of a buffer solution containing 0.2 picomole of p53 double stranded DNA, a solution of dNTPs (deoxynucleoside triphosphates) and Taq DNA polymerase (15 units) were placed in of the reaction chamber 11. The chamber 11 containing the sample is initially in the lower position. The reaction zone 11A heats to 95°C for 3 minutes to denature the DNA sample. Subsequently, relative displacement or tilting of reaction chamber 11 to an upper position results also in displacement of reaction chamber 12 to a lower position and the sample migrates under gravity into reaction zone 12A which then heats to 50°C and remains at 50°C for 3 minutes. During this phase (refer to timing diagram of FIG. 11) , the sample cools to 50°C and a proportion of the single stranded DNA hybridizes to the complementary oligonucleotides immobilized on the PVDF strip. Also during this phase the polymerase enzyme incorporates dNTPs beginning from the 3' end of the immobilized oligonucleotides that are hybridized to a proportion of the single stranded DNA in the sample, forming a new strand complementary to the sample DNA strand which has annealed to the immobilized oligonucleotide. Initiated by the first displacement or tilt, reaction zone 11A is actively cooled to 50°C by means of a Peltier cell beneath, and in bearing contact with, the reaction zone 11A. After 3 minutes extension time in reaction zone 12A at 50°C, reaction zone 12A heats to 95°C. After 3 minutes at 95°C to denature and release the sample DNA, reaction chamber 12 is tilted to the upper position. The DNA sample then migrates from reaction zone 12A back into reaction zone 11A which has been pre-heated to the annealing/extension temperature of 50°C. A proportion of the denatured single strands in the DNA sample anneals to the immobilized complementary oligonucleotides and the polymerase enzyme incorporates dNTPs beginning from the 3 ' end of the immobilized oligonucleotides that are hybridized to a proportion of the single stranded DNA in the sample, forming a new strand complementary to the sample DNA strand which has annealed to the immobilized oligonucleotide. After 3 minutes at 50°C reaction zone 11A is heated to 95°C for 3 minutes to denature and release the DNA sample. Reaction zone 12A has been actively pre-cooled to 50°C (see timing diagram of FIG. 11). Reaction chamber 11 tilts to the upper position, the sample containing denatured DNA runs into reaction zone 12A and the next cycle of annealing and extension begins. The cyclical process is repeated for a predetermined number of cycles typically from about 30 cycles to 50 or more cycles if desired, then the strips are removed from reaction chamber 11, 12 for the detection step.

A proportion of the dNTPs contain a Fluorescein label, so the extended oligonucleotides on the solid phase strips are detected using an antibody to Fluorescein. The anti-Fluorescein detection antibody is linked to alkaline phosphatase which catalyses the conversion of a chromogenic substrate (NBT/BCIP from Boehringer Mannheim) to a water insoluble purple deposit on the surface of the strip. Typical results, presented in FIG. 10, indicate that the p53 target DNA reacted specifically with the immobilized p-53 oligonucleotide defined above. No cross reactivity was detected with the other oligonucleotides.

Note that the number of different oligonucleotide spots on a strip is limited only by the spotting technology used. Machines (for example the BioDot dispense system, Bio Dot incorporated , Irvine, California) are available to spot oligonucleotides at less than 100 micron spacing with as little as 8 nanolitre drops. Alternatively arrays of 200 micron spots can be microjet printed onto a UV silica glass wafer at 800 micron spacing (Eggers et al. (1994), BioTechniques 17, page 516).

Reaction Mix for RASPE Process in Apparatus of FIG. 1 10 x PCR buffer + MgCl₂ 60 μL

Cold T, C, G (2.5 mM) 36 μL each

Flu dATP (240 pmole) 24 μL

AmpliTaq 3 μL

Target DNA (Exon 8) 24 μL ddH₂0 381 μL Total volume 600 μL

(final target DNA concentration = 0.2 pmole in 600 μL)

EXAMPLE 8

Applica tion of the appara tus of FIG. 1 to a Three-Tempera ture RASPE process

A repeated cyclical process can be carried out with the apparatus of FIG. 1 which is adapted to facilitate one or more additional temperature steps at reaction zones 11A, 12A (see timing diagram of FIG. 12). This is desirable when the optimum temperature for activity of the polymerase enzyme is different to the temperature for annealing of the target DNA to the oligonucleotide primers.

Two chemically activated PVDF strips each with a linear array of spots of oligonucleotides (approximately 24 nucleotides long with a spacer molecule between the 5' end of the oligonucleotide and the PVDF strip) may be placed at in reaction zones 11A and 12A of reaction chambers 11 and 12. The oligonucleotides on solid supports introduced into the reaction chambers 11, 12 are complementary to a target DNA sequence. Five hundred microlitres to 1 mL of a buffer solution containing 0.2 picomole of double stranded target DNA sample, a solution of dNTPs (deoxynucleoside triphosphates) and Taq DNA polymerase (units) are then introduced into reaction chamber 11 which is initially in the lower position. Reaction zone 11A then heats to 95°C for 3 minutes to denature the DNA sample. Chamber 11 then tilts and the sample migrates into the reaction zone 12A of chamber 12. Reaction zone 12A then heats to 50°C and remains at 50°C for 1.5 minutes. During this phase the sample cools to 50°C and a proportion of the single stranded DNA hybridizes to the complementary oligonucleotides immobilized on the PVDF strip. Reaction zone 12A then heats to the optimum temperature for polymerase action (typically approximately 72°C, see FIG. 12) . During this phase the polymerase enzyme incorporates dNTPs beginning from the 3' end of the immobilized oligonucleotides that are hybridized to a proportion of the single stranded DNA in the sample, forming a new strand complementary to the sample DNA strand which has annealed to the immobilized oligonucleotide. Initiated by the first tilt, reaction zone 11A is actively cooled to 50°C by means of a Peltier cell 24 beneath and in bearing contact with reaction zone 11A. After 1.5 minutes extension time in reaction zone 12A at 72°C, reaction zone 12A heats to 95°C. After 3 minutes at 95°C to denature and release the sample DNA, chamber 12 is displaced to the upper position. The DNA sample then migrates under gravity from reaction zone 12A back into reaction zone 11A which has been pre-heated to the annealing/extension temperature of 50°C. A proportion of the denatured single strands in the DNA sample anneals to the immobilized complementary oligonucleotides. After 1.5 minutes at 50°C reaction zone 11A heats to 72°C and the polymerase enzyme efficiently incorporates dNTPs beginning from the 3' end of the immobilized oligonucleotides that are hybridized to a proportion of the single stranded DNA in the sample, forming a new strand complementary to the sample DNA strand which has annealed to the immobilized oligonucleotide. After 1.5 minutes at 72°C reaction zone 11A is heated to 95°C for 3 minutes to denature and release the DNA sample. By this time, reaction zone 12A has been actively pre-cooled to 50°C (see timing diagram, FIG. 12) . Reaction chamber 11 is then displaced to the upper position and the sample containing denatured DNA migrates under gravity into reaction zone 12A and the next cycle of annealing and extension begins. The cyclical process is typically repeated thirty times and then the strips are removed from the apparatus of FIG. 1 for the detection step. A proportion of the dNTPs contain a fluorescein label, so the extended oligonucleotides on the solid phase strips are detected using an antibody to fluorescein. The anti-fluorescein detection antibody is linked to alkaline phosphatase which catalyses the conversion of a chromogenic substrate

(NBT/BCIP from Boehringer Mannheim) to a water insoluble purple deposit on the surface of the strip.

EXAMPLE 9 Applica tion of Appara tus of FIG. 1 to conventional PCR wi th all or some reagen ts in the solution phase

The PCR reaction is commonly carried out in a solution phase contained in a plastic microfuge tube. The plastic tube is then inserted into wells of a metal block which undergoes heating and cooling cycles. The apparatus 10 in this regard may be used to carry out this process using a temperature cycle similar to that shown in the timing diagram of FIG. 12.

A typical reaction mixture would contain dNTPs, target nucleic acid (genomic DNA for example, or a cloned piece of DNA with a known sequence) , 2 oligonucleotide primers (one primer complementary to one strand of DNA and the other complementary to the opposite strand of DNA,) and a PCR buffer (e.g. 50 mM KC1, 10 mM Trishydroxymethylamino-methane) to maintain pH in the optimum range for polymerase enzyme action (approximately pH 8.4 for TAQ polymerase (Saiki, R. K. (1989, supra ) and 100 μg/mL gelatin) . A typical reaction mix may contain:

10 x "PCR buffer" with MgCl₂ 5 μL Cold dCTP, dTTP, dGTP, dATP (2.5 mM stock) 3 μL each AmpliTaq (Perkin Elmer) 0.25 μL

Target DNA 0.2 μL oligonucleotide primers in the range 0.1-1 μM ddH₂0 35.35 μL

For optimum yield in a particular PCR reaction, the concentration of Magnesium will need to be pre-determined (typically within the range of 0.5 to 5 mM to yield a free Mg ion concentration of 0.5 to 1.5 mM) as will the temperature cycling parameters and the primer concentration (Saiki, R.K. 1989, supra ) .

A heat stable polymerase (eg. Taq polymerase from Thermus aqua ticus or Pfu polymerase from Pyrococcus furiosus) is then added to the reaction mix. The reaction mix is then added to reaction zone 11A which has been pre-heated to 95°C. The heating at 95°C would be continued typically for 1 minute, to allow denaturation of the DNA sample into single strands. Reaction chamber 11 is then displaced to the upper position and the denatured sample flows under gravity into reaction zone 12A which has been pre-heated to a suitable primer annealing temperature (between 50°C and 60°C is common) . The 50-60°C heating continues for one minute, then reaction zone 12A is heated to the optimum temperature (for Taq or Pfu approximately 72°C) for the polymerase to incorporate dNTPs from the 3 ' end of each primer that has annealed to the target DNA. After (for example) 2 minutes for polymerase catalysed extension, reaction chamber 12 is displaced to the upper position and the reaction mixture migrates under gravity back into reaction zone 11A which has been pre-heated to 95°C in readiness for another round of denaturation. The preheating of the opposite reaction zone in anticipation of the next step minimizes the temperature ramping time for the reaction mix. Simpler PCR protocols are possible using the apparatus 10 with a temperature timing diagram as in FIG. 11. In such a case , sample denaturation will take place at 95°C and reaction chamber 11 will be displaced subsequently to the upper position. The sample will then migrate under gravity into reaction zone 12A where annealing of primers and extension of strands by incorporation of dNTPs would occur at a single temperature (say 50°C) for approximately 3 minutes. After 3 minutes at the primer extension temperature, reaction chamber 12 would then be displaced to the upper position and the reaction mix would migrate back into reaction zone 11A which has been pre-heated to 95°C in readiness for another round of denaturation. To demonstrate the sensitivity of the apparatus 10, this apparatus was compared with a conventional HYBAID OmniGene™ thermal cycler in a side-by side analysis of a solution phase PCR. Cycling parameters were: (A) 95°C for 1 min; 65°C for 5 min for 35 cycles, or alternatively: (B) 95°C for 1 min; 50°C for 1 min for 35 cycles.

Reaction mix for OmniGene™ 10X PCR buffer 10 μL 10 mM dNTPs 2.0 μL

Primer 1 (Ipm/μL) 2.5 μL 5' - TGCCCACTGCTTAAC

AAG ACCA - 3' Primer 2 (lpm/μL) 2.0 μL 5' - TGTTATCACACTGGT

GCT AA - 3' Taq Polymerase 1.0 μL

DNA (Factor V) 2.0 μL (10 ng) 267 base pair double stranded DNA dH20 80.5 μL

Total 100 μL Reaction mix for the apparatus of FIG. 1

10X PCR buffer 60 μL

10 mM dNTPs 10 μL

Primer 1 15 μL

Primer 2 12 μL

Taq polymerase 6 μL

DNA (Factor V) 2 μL (10 ng) # dH20 495 μL

Total 600 μL#

Note that the starting concentration of target DNA for the apparatus of FIG. 1 is one sixth the amount for the OmniGene™ cycler. A 20 μL sample was taken after 35 cycles from each reaction and electrophoresed through a 2% agarose Tris-Acetate-EDTA (TAE) gel. DNA products were visualized by ethidium staining and ultraviolet irradiation. Relative amounts of DNA product was calculated by ImageQuant™ software (Molecular Dynamics) . The results presented in FIG. 13 depict the amount of 267 bp Factor V exon 10 product formed after 35 cycles (Lane 1, OmniGene™ , parameters (A); Lane 2, apparatus 10, parameters (A); Lane 3, OmniGene™ , parameters (B) ; Lane 4, apparatus 10, parameters (B) ) . Comparison of these results indicate that apparatus 10 has at least an order of magnitude better yield compared to the OmniGene™ machine using either set of parameters. Thus, apparatus 10 has substantially improved sensitivity compared to the conventional OmniGene™ machine which provides for shorter assay times.

EXAMPLE 10 Southern blot wi th recycling and re-use of double stranded DNA probe The apparatus 10 is capable of facilitating probing of Southern blots with cyclical re-use, if desired, of a double stranded DNA probe on the same target immobilized DNA. The process involves the following steps:

1) Genomic or other DNA is fragmented or digested in the presence of restriction enzymes, denatured and transferred onto a suitable membrane strip

(these methods are well known to those of ordinary skill in the art, see for example the relevant sections of CURRENT PROTOCOLS IN MOLECULAR BIOLOGY, Ausubel, et al . , eds., John Wiley & Sons, Inc. 1995, and of MOLECULAR CLONING. A LABORATORY MANUAL, Sambrook, et al . , Cold Spring Harbor Press, 1989 which are hereby incorporated by reference) . The membrane strips are air dried and then baked at 70-80°C for up to 90 minutes.

2) The strip is then inserted into reaction zone 11A of chamber 11 of apparatus 10. Approximately 1 mL of a pre-hybridization mix (e.g., 0.01 M NaP0₄, 1 mM EDTA, 6 x SSC , 0.5% SDS, 2 x Denhardts solution, 100 μg/mL denatured salmon sperm DNA) is added to chamber 11 to immerse the strip and chambers 11, 12 are set to operate at a constant temperature (say 65°C) for 4 hours or overnight. The chamber 11, 12 are displaced relative to each other between upper and lower positions at regular short intervals (say 30 seconds to one minute) .

3) The prehybridization solution is removed and fresh prehybridization solution is added to chamber 11 which holds the strip. Chamber 11 remains heated at 65°C. A double stranded DNA probe is labeled by a method such as random priming, which method is well known to those skilled in the art, with detectably- modified nucleotides including, but not limited to, biotin-labeled, fluorescent-labeled, radioactively- labeled and digoxigenin labeled nucleotides. The double stranded probe is denatured by heating at 95°C, and then the denatured probe is added to reaction zone 11A.

Reaction zone 11A containing the reaction mix and the strip is incubated for a predetermined hybridization time

(say) 10 to 30 min at 65°C. During this incubation time reaction zone 12A is pre-heated to 95°C. After the first incubation of 10 to 30 min is complete, chamber 11 is displaced to the upper position and the reaction mix migrates under gravity into reaction zone 12A which has been pre-heated to 95°C. The reaction mix is incubated in reaction zone 12A for 3 minutes to re-denature the DNA probe, then chamber 12 is tilted to the upper position and the denatured probe and reaction mix migrate back into reaction zone 11A for another round of hybridization. The apparatus 10 can be allowed to run through repeated rounds of hybridization at 65°C in reaction zone 11A and denaturation at 95°C in reaction zone 12A for as long as desired. Conveniently, the hybridization time may be shortened substantially from the standard minimum 12 hours.

After hybridization, the washing away of excess unbound probe can be carried out in the apparatus 10. The hybridization reaction mix is removed followed by addition of wash buffers (usually 0.1 to 2 x SSC plus 0.1% SDS) . Usually a series of wash steps is undertaken, with a change of wash buffer between each wash step. In such a case, the apparatus 10 will continue to tilt at regular intervals throughout the wash steps to increase the efficiency of the washing steps.

In view of the above, strips of Hybond N (Amersham, U.K.) membrane - approximately 43 mm X 6 mm - were spotted with a dilution series of wild-type plasmid DNA (pGemT vector - from Promega, Madison WI USA - containing a 267 bp PCR product from the Factor V gene located on Chromosome 1, Exon 10 ) - 100 picograms (pg) , 10 pg, 1 pg, 0.1 pg, and a no DNA water blank. 10 mL of Rapid-hyb buffer, from Amersham (NIF 939 batch 22) was pre-warmed in a hybridization oven at 65°C. 1 mL of the pre-warmed buffer was transferred to a 1.5 mL EPPENDORF™ tube and was left in the oven. The other 9 mL was used to pre-hybridize the strip at 65°C for 15 minutes.

Probe prepara tion

The digoxigenin (dig) labeled probe was constructed using the digoxigenin PCR labelling kit (Boehringer Mannheim) and the normal PCR conditions which were :

10 X PCR buffer 10 (final [MgCl₂] = 1.5 mM) PCR Dig labelling mix 1

Primer 1 (PR990) 4.8 (50 pmoles)

Primer 2 (PR6967) 6 (50 pmoles)

Taq Polymerase 1

Template - wt plasmid 2 (approx. 100 ng) Water 66.2

The parameters employed were: 95°C for 5 min, 32 cycles of 95°C for 1 min/ 55^CC for 45 sec and 72°C for 1 min and a final extension at 72°C for 10 min in the OmniGene™ PCR machine. The primers were: (PR 990) TGT TAT CAC ACT GGT GCT AA, and (PR 6967) TGC CCA GTG CTT AAC AAG ACC A.

The probe was denatured by diluting it 1:20 to give a final volume of 10 μL (and a final concentration of approx. 5 ng/mL) and was heated to 100°C in the OmniGene™ PCR machine for 2 minutes and was then added to the 1 mL of the 65°C Rapid-hyb buffer. The 1 mL hybridization solution (containing the probe) was put into chamber 11 of apparatus 10 with the strip. The strip was given 48 cycles - (one cycle consisted of 95°C for 1 minute and 65°C for 5 minute) or 4 hour contact time between the solution and the strip to hybridize. After hybridization, the strip was removed and washed twice for 5 minutes in 2XSSC + 0.1%SDS, then twice for 5 minutes in 0.2XSSC + 0.1%SDS and finally twice for 20 minutes in O.IXSSC + 0.1%SDS at 50°C. After washing, the strip was immersed in 5 mL of 2% skim milk (dissolved in 100 mM Tris/ 150 mM NaCl) for 30 minutes, before 2 μL of anti-digoxigenin-Alkaline Phosphatase conjugate (Boehringer Mannheim, cat #1426338) was added and let bind to the strip for a hour. The strip was then washed twice more with double distilled water for 15 minutes before 500 μL of substrate (Western Blue ™ from Promega) was added and the strip was allowed to develop for 2 hours. A normal hybridization was run parallel to apparatus 10 using the same concentrations and volumes except it was performed using a 15 mL polypropylene tube in a HYBAID ™ dry oven at 65°C for 4 hours (same contact time between the membrane and the probe) for the hybridization. The results presented in FIG. 14 show the decreasing amounts of DNA (pg) detected respectively by the apparatus 10 and normal hybridization. These results indicate that Southern hybridizations may be facilitated with apparatus 10 with comparable sensitivity relative to conventional hybridizations.

EXAMPLE 11 Mul tiplex PCR in apparatus 10 It is common practice in the field of DNA- based diagnostics to run several polymerase chain reactions simultaneously in a single vessel, using multiple pairs of oligonucleotide primers. It often eventuates that the optimum melting temperatures (T s) for each primer set are non identical and to ensure the annealing of all primer sets it is therefore necessary to run a complex thermal cycling program that, in successive cycles, passes through the optimum annealing temperature for each primer set ( a "touch down" polymerase chain reaction- see Don et al . (1991) Nucleic Acids Research 19:4008)

The present invention is suited to such procedures. A series of incrementally reducing temperatures can be programmed into apparatus 10. Reaction chamber 11, 12 are functionally interchangeable, so that in successive cycles the cells function as either denaturation chamber, annealing chamber or extension chamber.

One such example is the multiplex PCR for simultaneous detection of four serotypes of the dengue virus RNA , Yellow fever and Japanese encephalitis- where six primer pairs are utilized with a range of Tms from 54°C to 46°C and touch down PCR is carried out using a range of primer annealing temperatures from 58°C to 40°C. To commence the process all PCR reagents (5 X PCR buffer, dNTPs , and the target RNA, AMV reverse

TM transcriptase and DNA polymerase (Titan enzyme mix,

Boehringer Mannheim) ) are added to reaction zone 11A in a volume of 300 μL, which is heated to the denaturation temperature 95°C. Contemporaneously reaction zone 12A is heated to the optimum temperature for the first primer annealing stage (58°C) . After an appropriate time for denaturation, chamber 11 is tilted and the reaction mix migrates into chamber 12 wherein the primer annealing step takes place. After appropriate annealing, the cell tilts and the reaction mix migrates into reaction zone 11A which has been preheated to the optimum temperature for primer extension mediated by reverse transcriptase or polymerase. Thereafter, the sequence of thermal cycles follows as set out in TABLE 1. EXAMPLE 12 Use of solid phase storage media containing blood spots or nucleic acid with apparatus of FIG. 1

Dry solid media are commonly used to store tissue fluid samples in a dry state. These media include such products as Guthrie cards (specimen collection paper no. 903-consisting of pure cotton linter manufactured by Schleicher and Schuell (Dassell, Germany) or FTA™ Gene Guard system (Life Technologies, Inc. Gaithersburg, MD, USA) ) . In typical usage, approximately 50 μL of biological fluid (eg. blood from a finger prick) or a nucleic acid sample is spotted onto the solid phase medium and the sample is stored dry at room temperature. Prior to PCR, a small piece of the solid medium containing the DNA or tissue fluid sample is punched (or cut) out and placed in a suitable volume of PCR reaction mix. During the PCR reaction, sufficient nucleic acid is leached into the solution phase and becomes accessible to the PCR reagents. Such solid media are ideal for use in an apparatus according to the invention, such as apparatus 10, because the DNA extraction step is integrated with the amplification process.

Method for amplification of a 267 base pair fragment of exon 10 of the factor V σene from a solid storage medium:

A Guthrie card or FTA paper is cut into strips of 3 X 45 mm that fit snugly into one reaction chamber of apparatus 10 (i.e., the chamber that will be heated to 95°C during a two-step PCR process) .

A 50 μL blood spot is applied to the strip and stored dry at room temperature until PCR can be carried out or, in the preferred method, is inserted into apparatus 10 for immediate PCR amplification. A PCR reaction mix prepared as for Example 7 is then added to the same chamber of apparatus 10 as the above strip. The PCR reaction is then commenced and the chamber containing the solid strip impregnated with the nucleic acid sample is heated to 95°C in contact with the reaction mix thereby eluting, at least in part, the DNA contained thereon. After 5 minutes at 95°C, the machine tilts and the reaction mix containing eluted DNA is incubated for 1 minute at 50°C at the opposite chamber. After 1 minute at 50°C, the reaction mix is then tilted back into the denaturation chamber for a further round of denaturation and elution of more DNA from the strip.

The cyclical immersion at 95°C of the solid strip containing the blood spot or DNA sample results in efficient elution of nucleic acid from the strip, and the nucleic acid becomes available for reaction with the components of the reaction mix. This cyclical elution or leaching process continues throughout the multiple cycles of the amplification reaction.

**********************

The present invention has been described in terms of particular embodiments found or proposed by the present inventors to comprise preferred modes for the practice of the invention. It will be appreciated by those of skill in the art that, in light of the instant disclosure, various modifications and changes can be made in the particular embodiments exemplified without departing from the scope of the invention. All such modifications and changes are intended to be included within the scope of the appended claims. TABLES TABLE 1. Series of programmable thermal cycling steps required to carry out a multiplex PCR with six primer pairs and using annealing temperatures ranging between 58°C and 40°C.

TABLE LEGENDS

TABLE 1

In each cycle, a reaction zone (i.e., 'empty' reaction zone) is heated to the optimum temperature in anticipation of the arrival of reagents from the opposite reaction zone. Such anticipatory heating/cooling is an important feature of the present invention which affords minimization of thermal ramping times.

Claims

CLAIMS 1. An apparatus for repeated execution of a thermal cycle for promotion of a chemical reaction in a reaction fluid, said apparatus comprising: a reaction zone in fluid communication with an auxiliary zone at least one thermal transfer means associated with said reaction zone and/or said auxiliary zone; a motive means for effecting fluid transfer between the reaction zone and the auxiliary zone; a temperature control means for regulating operation of said at least one thermal transfer means to thereby regulate a temperature at said reaction zone and/or said auxiliary zone; a motive control means for regulating operation of said motive means; wherein the temperature control means and the motive control means operate cooperatively to synchronize fluid transfer at a temperature to promote continuance of the chemical reaction.

2. The apparatus of claim 1, wherein the motive means causes oscillatory motion of said zones to effect gravity-induced transfer of the reaction fluid.

3. The apparatus of claim 1, wherein each of said zones has a thermal mass greater than the thermal mass of the reaction liquid.

4. The apparatus of claim 1 further comprising a solid support associated with at least one of said reaction zone or said auxiliary zone, said chemical reaction occurring on the solid support.

5. The apparatus of claim 4, wherein the solid support has one or more reactants attached thereto.

6. The apparatus of claim 5 having a single thermal transfer means associated with both said zones such that both zones are maintained at the same temperature.

7. The apparatus of claim 1 having a single thermal transfer means associated with the reaction zone such that the reaction zone is maintained at a temperature determined by the temperature control means and the auxiliary zone is at ambient temperature.

8. The apparatus of claim 1 having a first thermal transfer means associated with the reaction zone and a second thermal transfer means associated with the auxiliary zone such that both zones are maintained at temperatures determined by the temperature control means.

9. The apparatus of claim 1, wherein said at least one thermal transfer means is a heating means.

10. The apparatus of claim 1, wherein said at least one thermal transfer means is a Peltier cell.

11. The apparatus of claim 1, wherein the motive means is a stepping motor.

12. The apparatus of claim 1, wherein the motive means is at least one fluid pump.

13. The apparatus of claim 1, wherein said reaction zone and said auxiliary zone are disposed within at least one reaction chamber.

14. The apparatus of claim 1, wherein the at least one reaction chamber is disposed upon a substantially horizontal shaft of the motive means and oscillatory motion of the motive means causes one or other of said reaction zone or said auxiliary zone to be a lower zone causing gravity-induced transfer of the reaction fluid to the lower zone.

15. The apparatus of claim 1 wherein the temperature control means is a circuit of fixed components arranged to regulate the temperature of the thermal transfer means according to a predetermined sequence of values.

16. The apparatus of claim 1 wherein the temperature control means is a circuit of fixed components and variable components arranged to regulate the temperature of the thermal transfer means at values determined by the variable components.

17. The apparatus of claim 1 wherein the temperature control means is a microprocessor programmed to regulate the thermal transfer means to a predetermined sequence of temperatures according to the thermal cycle of the chemical reaction.

18. The apparatus of claim 1 wherein the motive control means is a circuit of fixed components arranged to effect oscillation of the reaction zone and the auxiliary zone about a generally horizontal axis according to a predetermined time schedule.

19. The apparatus of claim 1 wherein the motive control means is a circuit of fixed components and variable components arranged to effect oscillation of the reaction zone and the auxiliary zone about a generally horizontal axis according to a time schedule determined by the variable components.

20. The apparatus of claim 1 wherein the motive control means is microprocessor programmed to synchronize oscillation of the reaction zone and the auxiliary zone about a generally horizontal axis, to the temperature of the thermal transfer means according to the thermal cycle of the chemical reaction.

21. The apparatus of claim 1 wherein the temperature control means and the motive control means are combined in a single control means.

22. The apparatus of claim 21 wherein the single control means effects temperature control and motive control according to a predetermined synchronized sequence to promote continuance of the chemical reaction.

23. The apparatus of claim 1 further comprising two reaction chambers, wherein one of the two reaction chambers comprises the reaction zone and the other comprises the auxiliary zone.

24. The apparatus of claim 1 further comprising two reaction chambers each having a reaction zone capable of receiving a solid support, wherein the respective reaction zones function as auxiliary zones relative to each other.

25. The apparatus of claim 1 further comprising a single reaction chamber having a discrete reaction zone and a discrete auxiliary zone.

26. The apparatus of claim 1, further comprising a single reaction chamber having two discrete reaction zones, wherein the respective reaction zones function as auxiliary zones relative to each other.

27. The apparatus of claim 1 further comprising a plurality of pairs of reaction chambers wherein each said pair of reaction chambers is in fluid communication therebetween, and wherein one reaction chamber of a respective pair comprises a reaction zone and the other reaction chamber of the respective pair comprises an auxiliary zone.

28. The apparatus of claim 1, further comprising a plurality of pairs of reaction chambers wherein each said pair of reaction chambers is in fluid communication therebetween, and wherein each reaction chamber of a respective pair comprises two discrete reaction zones, wherein each of said reaction zones functions as an auxiliary zone relative to the other reaction zone.

29. The apparatus of claim 1 further having means of accommodating one or more closable vessels extending, in use, between the reaction zone and the auxiliary zone.

30. The apparatus of claim 29, wherein the vessel (s) are hermetically sealable.

31. The apparatus of claim 1 further comprising one or more spaced recesses or tracks defining respective liquid flow paths extending between the reaction zone and the auxiliary zone.

32. The apparatus of claim 30, wherein the liquid flow paths are hermetically sealable.

33. The apparatus of claim 1, further comprising means for retaining a solid support at the reaction zone and/or the auxiliary zone.

34. The apparatus of claim 1, wherein surfaces communicating between said reaction zone and said auxiliary zone are comprised of a hydrophobic material so that the reaction fluid does not adhere substantially to the surfaces, in use.

35. The apparatus of claim 1 further comprising one or more auxiliary vessels in fluid communication with the apparatus such that reagents for said chemical reaction are introducible into, and/or removable from, the reaction zone and/or the auxiliary zone.

36. The apparatus of claim 1 further comprising a display means for displaying the temperature of each of said reaction zone and said auxiliary zone.

37. The apparatus of claim 1 further comprising a detection means for detecting a product of said reaction at said reaction zone and/or said auxiliary zone .

38. A method for promoting a thermocyclic chemical reaction, said method including the sequential steps of:

(B) collocating the reaction fluid with the reaction zone;

(C) regulating the temperature of an auxiliary zone to a level that promotes continuance of the chemical reaction; (D) collocating the reaction fluid with the auxiliary zone;

(F) collocating the reaction fluid with the reaction zone;

(G) carrying out steps (C) through (F) one or more times to effect said chemical reaction wherein at least one of step (C) or step (E) effects a thermal step of the chemical reaction.

39. The method of claim 38, wherein step (C) effects a thermal step of the chemical reaction.

40. The method of claim 38, wherein step (E) effects a thermal step of the chemical reaction.

41. A method for promoting a thermocyclic chemical reaction using the apparatus of claim 1, said method including the steps of:

(B) collocating the reaction fluid with the reaction zone;

(F) activating the motive means to transfer the reaction fluid from the auxiliary zone to the reaction zone; (G) carrying out steps (C) through (F) one or more times to effect said chemical reaction wherein at least one of step (C) or step (E) effects a thermal step of the chemical reaction.

42. The method of claim 41, further including the step of synchronizing the motive means with the thermal transfer means such that after completion of a thermal step of the chemical reaction at a first temperature at the reaction zone, the reaction fluid is transferred to the auxiliary zone which regulates the temperature of the reaction fluid so that the reaction fluid is suitable for carrying out a subsequent thermal step at the reaction zone or at the auxiliary zone.

43. The method of claim 42, wherein the synchronization step is characterized in that if the subsequent thermal step is carried out at the reaction zone, the reaction zone is regulated to a second temperature appropriate for facilitating said subsequent thermal step prior to transfer of the reaction fluid to the reaction zone.

44. The method of claim 43, wherein the synchronization step is further characterized in that different thermal steps of the chemical reaction are conducted only at the reaction zone.

45. The method of claim 42, wherein the synchronization step is characterized in that if the subsequent thermal step is carried out at the auxiliary zone, the auxiliary zone is regulated to a second temperature appropriate for facilitating said subsequent thermal step prior to transfer of the reaction fluid with the auxiliary zone.

46. The method of claim 43, wherein the synchronization step is further characterized in that different thermal steps of the chemical reaction are conducted alternatingly between the reaction zone and the auxiliary zone.

47. The method of claim 41 further including the step of placing a solid support at the reaction zone before initiation of the chemical reaction, wherein the solid support has one or more reactants attached thereto.

48. The method of claim 47, further including the step of introducing into the reaction fluid one or more reactants for reacting with said reactant(s) on said solid support.