WO1999002678A1 - Wa545 compositions - Google Patents
Wa545 compositions Download PDFInfo
- Publication number
- WO1999002678A1 WO1999002678A1 PCT/US1998/008334 US9808334W WO9902678A1 WO 1999002678 A1 WO1999002678 A1 WO 1999002678A1 US 9808334 W US9808334 W US 9808334W WO 9902678 A1 WO9902678 A1 WO 9902678A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- protein
- sequence
- bmp
- seq
- dna
- Prior art date
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
- C07K14/463—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from amphibians
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P17/00—Drugs for dermatological disorders
- A61P17/02—Drugs for dermatological disorders for treating wounds, ulcers, burns, scars, keloids, or the like
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P43/00—Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/475—Growth factors; Growth regulators
- C07K14/51—Bone morphogenetic factor; Osteogenins; Osteogenic factor; Bone-inducing factor
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K38/00—Medicinal preparations containing peptides
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2319/00—Fusion polypeptide
Definitions
- the present invention relates to a novel family of purified proteins designated
- WA545 and WA545-related proteins DNA encoding them, and processes for obtaining them. These proteins may be used to induce bone and/or cartilage or other connective tissue formation, and in wound healing and tissue repair. These proteins may also be used for augmenting the activity of bone morphogenetic proteins.
- BMPs Bone Morphogenetic Proteins
- WA545-related protein refers to the Xenopus WA545 protein, having the amino acid sequence specified in SEQUENCE ID NO:2, as well as homologues of this protein found in mammalian and other species; and other proteins which are closely related structurally and/or functionally to WA545.
- WA545-related proteins examples include murine, bovine and human WA545 protein, as well as homologues in other species, particularly human.
- WA545 activity refers to one or more of the activities which are exhibited by the WA545 proteins of the present invention.
- WA545 activity includes the ability to induce, enhance and/or inhibit the formation, growth, proliferation, differentiation, maintenance of mesodermal tissue, including but not limited to neurons and/or related neural cells and tissues such as brain cells, Schwann cells, glial cells and astrocytes, as well as muscle cells and tissues.
- “WA545 activity” also includes the ability to induce molecular markers of mesodermal tissue, such as Xbra, gsc, brachyury, Pintallavis, Xnot and muscle-actin as well as the ability to induce the formation of neurons and/or related neural cells and tissues such as brain cells, Schwann cells, glial cells and astrocytes.
- “WA545 activity” may also include the ability to regulate the interaction ligands and their protein receptors.
- “WA545 activity” may further include the ability to regulate the formation, differentiation, proliferation and/or maintenance of other cells and/or tissue, for example connective tissue, organs and wound healing.
- WA545 activity may include the ability to enhance and/or inhibit angiogenesis, and formation and growth of capillaries, arteries and other blood vesssels, as well the formation, growth, proliferation, differentiation and/or maintenance of cardiac, spleen, liver, pancreas, stomach, kidney, lung and brain cells and tissue, osteoblasts and bone, chondrocytes and cartilage, tendon and epidermis.
- WA545 activity also includes the activities of WA545 protein in the described in the examples and specification herein.
- Xenopus WA545 The Xenopus WA545 DNA sequence (SEQ ID NO: 1) and amino acid sequence (SEQ ID NO: 2) are set forth in the Sequence Listings.
- WA545 proteins are capable of inducing the formation of cartilage, muscle, nerve, epidermis or other connective tissue, or combinations thereof. WA545 proteins may be further characterized by the ability to demonstrate cartilage, bone, muscle, nerve, epidermis and/or other connective tissue formation activity in the assays described below.
- Xenopus WA545 protein may be produced by culturing a cell transformed with a DNA sequence comprising nucleotide a DNA sequence encoding the mature WA545 polypeptide, comprising nucleotide #55, #775, or #811 to nucleotide #1113 or #1116 as shown in SEQ ID NO: 1, and recovering and purifying from the culture medium a protein characterized by the amino acid sequence comprising amino acids #-240, #1 or #13 to #113 or #114 as shown in SEQ ID NO:2 substantially free from other proteinaceous materials with which it is co-produced.
- the DNA sequence further comprises a DNA sequence encoding a suitable propeptide 5' to and linked in frame to the nucleotide sequence encoding the mature WA545 polypeptide.
- the propeptide may be the native WA545 propeptide, or may be a propeptide from another protein of the TGF- ⁇ superfamily. Human WA545
- the invention includes methods for obtaining the DNA sequences encoding human WA545, the DNA sequences obtained by those methods, and the human protein encoded by those DNA sequences.
- This method entails utilizing the Xenopus WA545 nucleotide sequence or portions thereof to design probes to screen libraries for the human gene or coding sequences or functional fragments thereof using standard techniques.
- the present invention includes DNA sequences from other species, particularly, human, which are homologous to Xenopus WA545 and can be obtained using the Xenopus WA545 sequence.
- a DNA sequence encoding the complete mature human WA545 protein and the corresponding amino acid sequence can be obtained using the procedures which are set forth herein. As described herein, these sequences are isolated using a portion of the Xenopus WA545 sequence as a probe.
- the human WA545 sequence of may also be used in order to design probes to obtain the complete human WA545 gene or coding sequences through standard techniques.
- the Xenopus WA545 and human WA545 sequences, or portions thereof, may also be used as probes, or to design probes, in order to obtain other related DNA sequences, such as homologues from other species.
- the WA545 proteins of the present invention such as human
- WA545 may be produced by culturing a cell transformed with the correlating DNA sequence, such as the WA545 DNA sequence, and recovering and purifying protein from the culture medium.
- the purified expressed protein is substantially free from other proteinaceous materials with which it is co-produced, as well as from other contaminants.
- the recovered purified protein is contemplated to exhibit cartilage, bone, muscle, nerve, epidermis and/or connective tissue formation activity.
- the proteins of the invention may be further characterized by the ability to demonstrate cartilage, bone, muscle, nerve, epidermis and/or other connective tissue formation activity in the assays described below.
- compositions containing a therapeutically effective amount of a WA545 protein such as Xenopus or human WA545 protein
- a WA545 protein such as Xenopus or human WA545 protein
- compositions of the invention may be used in the formation of bone, cartilage, muscle, nerve, epidermis and/or other connective tissue, including tendon, ligament and meniscus, as well as combinations of the above, for example regeneration of the tendon-to-bone attachment apparatus.
- the compositions of the present invention such as compositions of human WA545, may also be used for wound healing and tissue repair.
- Compositions of the invention may further include at least one other therapeutically useful agent such as the BMP proteins BMP-1, BMP-2, BMP-3, BMP- 4, BMP-5, BMP-6 and BMP-7, disclosed for instance in United States Patents
- BMP-8 disclosed in PCT publication WO91/18098
- BMP-9 disclosed in PCT publication WO93/00432
- BMP-10 disclosed in PCT application WO94/26893
- BMP-11 disclosed in PCT application WO94/26892
- BMP- 12 or BMP- 13 disclosed in PCT application WO95/16035, or BMP-15, disclosed in PCT application WO96/36710 or
- compositions which may also be useful include Vgr-2, and any of the growth and differentiation factors [GDFs], including those described in PCT applications WO94/15965; WO94/15949; WO95/01801; WO95/01802;
- compositions of the invention may comprise, in addition to a WA545 protein, other therapeutically useful agents including growth factors such as epidermal growth factor (EGF), fibroblast growth factor (FGF), transforming growth factor (TGF- ⁇ and TGF- ⁇ ), wnt proteins, hedgehog proteins such as sonic, indian and desert hedgehog, activins, inhibins, and insulin-like growth factor (IGF).
- EGF epidermal growth factor
- FGF fibroblast growth factor
- TGF- ⁇ and TGF- ⁇ transforming growth factor
- hedgehog proteins such as sonic, indian and desert hedgehog, activins, inhibins, and insulin-like growth factor (IGF).
- compositions may also include an appropriate matrix, for instance, for supporting the composition and providing a surface for bone, cartilage, muscle, nerve, epidermis and/or other connective tissue growth.
- the matrix may provide slow release of the osteoinductive protein and/or the appropriate environment for presentation thereof.
- the WA545 compositions may be employed in methods for treating a number of bone, cartilage, muscle, nerve, epidermis and/or other connective tissue defects, as well as periodontal disease and healing of various types of tissues and wounds.
- the tissue and wounds which may be treated include epidermis, nerve, including spinal chord, muscle, including cardiac, striated or smoothe muscle, and other tissues and wounds, and other organs such as liver, pancreas, spleen, brain, lung, cardiac, and kidney tissue.
- These methods entail administering to a patient needing such bone, cartilage, muscle, nerve, epidermis and/or other connective tissue formation, wound healing or tissue repair, an effective amount of a WA545 protein.
- the WA545 compositions may also be used to treat or prevent such conditions as osteoarthritis, osteoporosis, and other abnormalities of bone, cartilage, muscle, nerve, epidermis or other connective tissue, organs such as liver, pancreas, spleen, lung, cardiac, and kidney and other tissues.
- These methods may also entail the administration of a protein of the invention in conjunction with at least one other BMP protein as described above.
- these methods may also include the administration of a WA545 protein with other growth factors including EGF, FGF, TGF- , TGF- ⁇ , wnt, hedgehog, activin, inhibin and IGF.
- Still a further aspect of the invention are DNA sequences coding for expression of a WA545 protein.
- sequences include the sequence of nucleotides in a 5' to 3' direction illustrated in SEQ ID NO: 1, as well as DNA sequences which, but for the degeneracy of the genetic code, are identical to the DNA sequence SEQ ID NO: 1, and encode the protein of SEQ ID NO: 2.
- Preferred DNA sequences include those which hybridize under stringent conditions [see, T.
- DNA sequences encode a polypeptide which is at least about 80% homologous, and more preferably at least about 90% homologous, to the mature human WA545 amino acid sequence shown in SEQ ID NO:2.
- allelic or other variations of the sequences of SEQ ID NO: 1, whether such nucleotide changes result in changes in the peptide sequence or not, but where the peptide sequence still has WA545 activity are also included in the present invention.
- the present invention also includes functional fragments of the DNA sequence of WA545 shown in SEQ ID NO: 1 which encode a polypeptide which retains the activity of WA545 protein. The determination whether a particular variant or fragment of a WA545 protein of the present invention will maintain WA545 activity, is routinely performed using the assays described in the examples and specification herein.
- the DNA sequences of the present invention are useful, for example, as probes for the detection of mRNA encoding WA545 in a given cell population.
- the DNA sequences may also be useful for preparing vectors for gene therapy applications as described below.
- a further aspect of the invention includes vectors comprising a DNA sequence as described above in operative association with an expression control sequence therefor.
- These vectors may be employed in a novel process for producing a WA545 protein of the invention in which a cell line transformed with a DNA sequence encoding a WA545 protein in operative association with an expression control sequence therefor, is cultured in a suitable culture medium and a WA545 protein is recovered and purified therefrom.
- This process may employ a number of known cells both prokaryotic and eukaryotic as host cells for expression of the polypeptide.
- the vectors may be used in gene therapy applications. In such use, the vectors may be transfected into the cells of a patient ex vivo, and the cells may be reintroduced into a patient. Alternatively, the vectors may be introduced into a patient in vivo through targeted transfection.
- WA545 proteins or polypeptides are characterized by having an amino acid sequence including the sequence illustrated in SEQ ID NO: 2, variants of the amino acid sequence of SEQ ID NO: 2, including naturally occurring allelic variants, and other variants in which the protein retains the ability to induce the formation of cartilage, bone, muscle, nerve, epidermis and/or other connective tissue, or other organs such as liver, pancreas, brain, spleen, lung, cardiac, and kidney tissue, characteristic of WA545.
- Preferred polypeptides include a polypeptide which is at least about 80% homologous, and more preferably at least about 90% homologous, to the mature Xenopus WA545 amino acid sequence shown in SEQ ID NO:2.
- allelic or other variations of the sequences of SEQ ID NO: 2 whether such amino acid changes are induced by mutagenesis, chemical alteration, or by alteration of DNA sequence used to produce the polypeptide, where the peptide sequence still has WA545 activity, are also included in the present invention.
- the present invention also includes functional fragments of the amino acid sequence of WA545 shown in SEQ ID NO: 2 which retains the activity of WA545 protein.
- the purified proteins of the present inventions may be used to generate antibodies, either monoclonal or polyclonal, to human WA545 and or other WA545-related proteins, using methods that are known in the art of antibody production.
- the present invention also includes antibodies to human WA545 and/or other WA545 proteins.
- the antibodies may be useful for purification of WA545 and/or other WA545 proteins, or for inhibiting or preventing the effects of WA545 proteins.
- the WA545 protein and related proteins may be useful for identifying and isolating a receptor protein which binds to WA545, and for inducing the growth and/or differentiation of embryonic cells and/or stem cells.
- the present invention also includes WA545 receptors, methods of identifying receptors, and methods of treating cell populations, such as embryonic cells or stem cell populations, to enhance or enrich the growth and/or differentiation of the cells.
- the treated cell populations may be useful for implantation and for gene therapy applications.
- a clone encoding the full-length Xenopus WA545 protein was deposited with the American Type Culture Collection (ATCC) 12301 Parklawn Drive, Rockville, MD 20852, on May 9, 1997, and was accorded the ATCC designation 98428. This deposit fully satisfies the requirements of the Budapest Treaty. Description of the Sequences
- SEQ ED NO:l is a nucleotide sequence encoding the entire mature Xenopus WA545 polypeptide.
- SEQ ID NO:2 is the amino acid sequence containing the mature Xenopus
- SEQ ID NO:3 is an oligonucleotide probe to Xenopus WA545 signal sequence.
- SEQ ID NO:4 is an oligonucleotide probe to Xenopus WA545 signal sequence.
- SEQ ID NO:5 is a consensus amino acid sequence derived from a highly conserved region of BMP/TGF- ⁇ /Vg-1 proteins
- SEQ ID NO: 6 is an oligonucleotide designed on the basis of the above identified consensus amino acid sequence of SEQ ID NO:5
- SEQ ID NO:7 is a consensus amino acid sequence derived from a highly conserved region of BMP/TGF- ⁇ /Vg-1 proteins.
- SEQ ID NO: 8 is an oligonucleotide designed on the basis of the above identified consensus amino acid sequence of SEQ ID NO:7.
- SEQ ID NO:9 is an oligonucleotide probe to Xenopus WA545 mature peptide sequence.
- SEQ ID NO: 10 is an oligonucleotide probe to Xenopus WA545 mature peptide sequence.
- FIG. 1 Expression Pattern of WA545.
- WA545 is expressed in the marginal zone (mesoderm) and vegetal cells, and later becomes posteriorly restricted.
- WA545 is expressed during gastrulation. Timing of WA545 RNA expression, using a reverse transcriptase-PCR (RT-PCR).
- ODC ornithine decarboxylase
- WA545 induces a posterior secondary axis when misexpressed on ventral side of embryos.
- Embryos were injected in one ventral blastomere in the marginal zone at the 4-cell stage with 50 or 100 pg WA545 in vitro transcribed RNA, or with globin RNA as a control. 80 pg lacL RNA was included as a lineage tracer to determine where the
- WA545 RNA became localized. Embryos were incubated until hatching (stage 35) before fixation and X-gal staining. Arrowheads point to a secondary axis that is induced on the injected side, as indicated by the blue staining, of the embryos. A secondary head was never observed. This indicates that WA545 is capable of inducing posterior, but not anterior regions. The secondary axis contains both mesodermal and neural tissue. Figure 4. WA545 causes microcephaly when misexpressed on dorsal side of embryos.
- Embryos were injected in one dorsal blastomere in the marginal zone at the 4- cell stage with 100 pg WA545 or globin RNA along with 80 pg lacZ RNA as lineage tracer. Embryos were incubated until tailbud stage (stage 22) before fixation and X- gal staining. Arrowheads indicate the chin primordium (cement gland), an extreme anterior structure. "Control” panel shows embryo injected with globin RNA. "WA545" panel shows embryos injected with WA545 RNA. In WA545 injected embryos, anterior structures are suppressed, as indicated by the smaller sizes of the cement glands. In later stages no eyes and no forebrain is present. This indicates that WA545 may convert anterior to more posterior tissue.
- WA545 induces posterior mesodermal markers in an animal cap assay.
- WA545 induces posterior mesoderm. Anterior mesoderm and neural gene expression is not activated by this gene. Embryos were injected in one blastomere in the animal pole at 2-cell stage with 400 pg WA545 or globin RNA. Animal caps were isolated as indicated and cultured until sibling embryos reached stage 14 (neurula) or 19 (tailbud) when various marker genes are maximally expressed. Total RNA was prepared from globin injected caps, WA545 injected caps and whole embryos. RT-PCR was used to assay for the expression of marker genes. Lanes 1, 2 and 3 are samples harvested at stage 14 samples.
- Xbra is a general mesodermal marker
- gsc is a marker of anterior mesoderm
- Pintallavis and Xnot are markers of posterior mesoderm. All genes were induced; however, gsc induction was very weak indicating that posterior mesoderm is predominantly induced (compare lanes 1 and 2).
- Xvent-1 and ode are loading controls. Lanes 4, 5 and 6 are samples harvested at stage
- Muscle-specific actin is a lateral mesodermal marker and was strongly induced.
- HoxB9 a psoterior mesodermal marker was also induced.
- Krox20 a neural marker whose expression is in the hindbrain and N-CAM, a general neural marker, were not induced.
- Figure 6. WA545 induces muscle in animal caps.
- the Xenopus WA545 nucleotide sequence (SEQ ID NO: 1) and encoded amino acid sequence (SEQ ID NO: 2) are set forth in the Sequence Listing herein.
- the coding sequence of the mature Xenopus WA545 protein begins at nucleotide #55 and continues through nucleotide #1116.
- Purified Xenopus WA545 proteins of the present invention are produced by culturing a host cell transformed with a DNA sequence comprising the DNA coding sequence of SEQ ID NO: 1 from nucleotide #55 to #1116, or from nucleotide #775 to #1116, and recovering and purifying from the culture medium a protein which contains the amino acid sequence or a substantially homologous sequence as represented by amino acids #-240 to #114 or #1 to #114 of SEQ ID NO: 2.
- DNA sequences encoding human WA545 are isolated by various techniques known to those skilled in the art.
- the invention includes methods for obtaining DNA sequences encoding human WA545.
- the methods utilize the Xenopus WA545 nucleotide sequences or portions in the design of probes to screen libraries for the human gene or coding sequences or fragments thereof using standard techniques.
- Regions containing amino acid sequences which are highly conserved within the WA545 family of proteins are identified and consensus amino acid sequences of these highly conserved regions are be constructed based on the similarity of the corresponding regions of individual WA545 proteins. Oligonucleotide primers designed on the basis of the amino acid sequence of such conserved sequences allow the specific amplification of the human WA545 encoding sequences. Two such consensus amino acid sequences are set forth in the Sequence Listing. Once a recombinant bacteriophage containing DNA encoding a portion of a human WA545 is obtained, the human coding sequence can be used as a probe to identify a human cell line or tissue which synthesizes WA545 mRNA.
- the Xenopus coding sequence can be used as a probe to identify such human cell line or tissue.
- the Xenopus WA545 coding sequence is used to design oligonucleotide primers which will specifically amplify a portion of the WA545 encoding sequence located in the region located between the primers utilized to perform the specific amplification reaction. Utilizing Xenopus and human WA545 sequences one can specifically amplify corresponding human WA545 encoding sequences from mRNA, cDNA or genomic DNA templates.
- mRNA is selected by oligo (dT) cellulose chromatography and cDN A is synthesized and cloned in Xgt 10 or other bacteriophage vectors known to those skilled in the art, for example, ZAP by established techniques.
- WA545 protein is screened directly, utilizing the fragment of amplified WA545 encoding DNA as a probe.
- the human WA545 sequence of the present invention is obtained using the whole or fragments of the Xenopus WA545 DNA sequence, or a partial human WA545 sequence, as a probe.
- the human WA545 DNA sequence is expected to comprise a DNA sequence highly homologous to nucleotides #55 or #775 to #1116 of the Xenopus WA545 DNA sequence shown in SEQ ID NO: 1.
- the amino acid sequence of the human WA545 protein is expected to comprise an amino acids highly homologous to the sequence of amino acids #-240 or #1 to #114 of SEQ ED NO: 2. It is expected that WA545 protein, as expressed by mammalian cells such as
- CHO cells exists as a heterogeneous population of active species of WA545 protein with varying N-termini. It is expected that active species will comprise an amino acid sequence beginning with the cysteine residue at amino acid #13 of SEQ ID NO:2, or will comprise additional amino acid sequence further in the N-terminal direction. Thus, it is expected that DNA sequences encoding active WA545 proteins include those comprising nucleotides #775 or #811 to #1113 or #1116 of SEQ ID NO: 1, as well as those including additional nucleotides at the 5 '-terminal end. Accordingly, active species of WA545 are expected to include those comprising amino acids #1 or #13 to #113 or #114 of SEQ ID NO:2, as well as those including additional amino acids at the N-terminal end.
- a host cell may be transformed with a coding sequence encoding a propeptide suitable for the secretion of proteins by the host cell linked in proper reading frame to the coding sequence for the mature WA545 protein.
- a coding sequence encoding a propeptide suitable for the secretion of proteins by the host cell linked in proper reading frame to the coding sequence for the mature WA545 protein.
- United States Patent 5,168,050 in which a DNA encoding a precursor portion of a mammalian protein other than BMP-2 is fused to the DNA encoding a mature BMP-2 protein.
- PCT application WO95/16035 in which the propeptide of BMP-2 is fused to the DNA encoding a mature BMP- 12 protein.
- the present invention includes chimeric DNA molecules comprising a DNA sequence encoding a propeptide or a regulatory sequence from a protein, such as a TGF- ⁇ protein, other than WA545, linked in correct reading frame to a DNA sequence encoding a WA545 protein.
- a host cell which naturally expresses native WA545 may be transfected with a highly expressed or regulable expression sequence so as to recombine in order to increase or alter WA545 expression.
- the N-terminus of one active species of WA545 is expected to be experimentally determined by expression in E. coli to be as follows: [MjSTHSSPPTP.
- the N-terminus of this species of WA545 is at amino acid #1 of SEQ ID NO: l, and a DNA sequence encoding said species of WA545 would comprise nucleotides #775 to #1116 of SEQ ID NO: 1.
- the apparent molecular weight of WA545 monomer is expected to be experimentally determined by SDS-PAGE to be approximately 10-15 kd, more particularly, about 13 kd, on a
- the WA545 protein is expected to exist as a clear, colorless solution in 0.1% trifluoroacetic acid.
- the dimer is expected to have a molecular weight of approximately 20-30 kd.
- WA545 proteins as expressed by mammalian cells such as CHO cells, also exist as a heterogeneous population of active species of
- WA545 protein with varying N-termini For example, it is expected that active species of WA545 will comprise an amino acid sequence beginning with the cysteine residue at amino acid #13 of SEQ ID NO:2, or will comprise additional amino acid sequence further in the N-terminal direction.
- DNA sequences encoding active WA545 proteins include those which comprise a nucleotide sequence comprising nucleotides #55, #775, #811 to #1113 or #1116 of SEQ ID NO: 1. Accordingly, active WA545 proteins include those comprising amino acids #-240, #1, or #13 to #113 or #114.
- the WA545 proteins of the present invention include polypeptides having a molecular weight of about 10-15 kd in monomeric form, said polypeptide comprising the amino acid sequence of SEQ ID NO:2 and having the ability to induce the formation of cartilage, bone, tendon, ligament, muscle, nerve, epidermis and/or other connective tissue in assays such as the Rosen-Modified Sampath-Reddi ectopic implant assay, or in the other assays described below.
- the WA545 proteins recovered from the culture medium are purified by isolating them from other proteinaceous materials from which they are co-produced and from other contaminants present.
- WA545 proteins may be characterized by the ability to induce the formation of cartilage, bone, tendon, ligament, muscle, nerve, epidermis and/or other connective tissue, for example, in the assays described below.
- the WA545 proteins provided herein also include factors encoded by the sequences similar to those of SEQ ID NO: 1, but into which modifications or deletions are naturally provided (e.g. allelic variations in the nucleotide sequence which may result in amino acid changes in the polypeptide) or deliberately engineered.
- synthetic polypeptides may wholly or partially duplicate continuous sequences of the amino acid residues of SEQ ID NO: 2.
- modifications of glycosylation sites involve modifications of glycosylation sites. These modifications may involve O- linked or N-linked glycosylation sites. For instance, the absence of glycosylation or only partial glycosylation results from amino acid substitution or deletion at asparagine-linked glycosylation recognition sites.
- the asparagine-linked glycosylation recognition sites comprise tripeptide sequences which are specifically recognized by appropriate cellular glycosylation enzymes. These tripeptide sequences are either asparagine-X-threonine or asparagine-X-serine, where X is usually any amino acid.
- a variety of amino acid substitutions or deletions at one or both of the first or third amino acid positions of a glycosylation recognition site (and/or amino acid deletion at the second position) results in non-glycosylation at the modified tripeptide sequence. Additionally, bacterial expression of WA545 protein will also result in production of a non-glycosylated protein, even if the glycosylation sites are left unmodified.
- the present invention also encompasses the novel DNA sequences, free of association with DNA sequences encoding other proteinaceous materials, and coding for expression of WA545 proteins.
- DNA sequences include those depicted in SEQ ID NO: 1 in a 5' to 3' direction and those sequences which hybridize thereto under stringent hybridization conditions [for example, 0.1X SSC, 0.1% SDS at 65 °C; see, T. Maniatis et al, Molecular Cloning (A Laboratorv Manual), Cold Spring Harbor Laboratory (1982), pages 387 to 389] and encode a protein having cartilage, bone, tendon, ligament, muscle, nerve, epidermis and/or other connective tissue inducing activity.
- stringent hybridization conditions also refers to the use of initial low stringency hybridization conditions (such as 6X SSC, 0.5% SDS, at about 60° C, overnight which is followed by higher stringency wash condition (such as 2X SSC, 0.1% SDS, at about 20°C) or even higher wash stringency (such as 0.1X SSC, 0.1% SDS, at about 65 °C, for less than an hour.
- the DNA sequences of the present invention also include those which comprise the DNA sequence of SEQ ID NO: 1 and those which hybridize thereto under stringent hybridization conditions and encode a protein having cartilage, bone, tendon, ligament, nerve, epidermis and/or other connective tissue inducing activity.
- DNA sequences which code for WA545 proteins coded for by the sequences of SEQ ID NO: 1 or which encode the amino acid sequence of SEQ ID NO: 2, but which differ in codon sequence due to the degeneracies of the genetic code or allelic variations (naturally-occurring base changes in the species population which may or may not result in an amino acid change) also encode the novel factors described herein.
- Variations in the DNA sequences of SEQ ID NO: 1 which are caused by point mutations or by induced modifications (including insertion, deletion, and substitution) to enhance the activity, half-life or production of the polypeptides encoded are also encompassed in the invention.
- Another aspect of the present invention provides a novel method for producing WA545 proteins.
- the method of the present invention involves culturing a suitable cell line, which has been transformed with a DNA sequence encoding a WA545 protein of the invention, under the control of known regulatory sequences.
- the transformed host cells are cultured and the WA545 proteins recovered and purified from the culture medium.
- the purified proteins are substantially free from other proteins with which they are co-produced as well as from other contaminants.
- Suitable cells or cell lines may be mammalian cells, such as Chinese hamster ovary cells (CHO).
- CHO Chinese hamster ovary cells
- the selection of suitable mammalian host cells and methods for transformation, culture, amplification, screening, product production and purification are known in the art. See, e.g., Gething and Sambrook, Nature, 293:620-625 (1981), or alternatively, Kaufman et al, Mol. Cell. Biol.. 5(7): 1750-1759 (1985) or Howley et al, U.S. Patent 4,419,446.
- Another suitable mammalian cell line, which is described in the accompanying examples, is the monkey COS-1 cell line.
- CV-1 may also be suitable.
- Bacterial cells may also be suitable hosts.
- E. coli e.g., HBlOl, MC1061
- Various strains of B. subtilis, Pseudomonas, other bacilli and the like may also be employed in this method.
- B. subtilis, Pseudomonas, other bacilli and the like may also be employed in this method.
- DNA encoding the propeptide of WA545 is generally not necessary.
- yeast cells Many strains of yeast cells known to those skilled in the art may also be available as host cells for expression of the polypeptides of the present invention. Additionally, where desired, insect cells may be utilized as host cells in the method of the present invention. See, e.g. Miller et al, Genetic Engineering, 8:277-298
- Another aspect of the present invention provides vectors for use in the method of expression of these novel WA545 polypeptides.
- the vectors contain the full novel DNA sequences described above which encode the novel factors of the invention.
- the vectors contain appropriate expression control sequences permitting expression of the WA545 protein sequences.
- vectors incorporating modified sequences as described above are also embodiments of the present invention.
- sequence of SEQ ID NO: 1 or other sequences encoding WA545 proteins could be manipulated to express a mature WA545 protein by deleting WA545 propeptide sequences and replacing them with sequences encoding the complete propeptides of other BMP proteins or members of the TGF- ⁇ superfamily.
- the present invention includes chimeric DNA molecules encoding a propeptide from a member of the TGF- ⁇ superfamily linked in correct reading frame to a DNA sequence encoding a WA545 polypeptide.
- the vectors may be employed in the method of transforming cell lines and contain selected regulatory sequences in operative association with the DNA coding sequences of the invention which are capable of directing tissue specific or inducible replication and expression thereof in selected host cells. Regulatory sequences for such vectors are known to those skilled in the art and may be selected depending upon the host cells. Thus, such specialized vectors constitute part of the present invention.
- a protein of the present invention which induces cartilage, bone, tendon, ligament, muscle, nerve, epidermis and/or other connective tissue formation in circumstances where such tissue is not normally formed, has application in the healing of bone fractures and cartilage or other connective tissue defects in humans and other animals.
- Such a preparation employing a WA545 protein may have prophylactic use in closed as well as open fracture reduction and also in the improved fixation of artificial joints. De novo bone formation induced by an osteogenic agent contributes to the repair of congenital, trauma induced, or oncologic resection induced craniofacial defects, and also is useful in cosmetic plastic surgery.
- a WA545 protein may be used in the treatment of periodontal disease, and in other tooth repair processes.
- Such agents may provide an environment to attract bone-forming cells, stimulate growth of bone-forming cells or induce differentiation of progenitors of bone-forming cells, and may also support the regeneration of the periodontal ligament and attachment apparatus, which connects bone and teeth.
- WA545 polypeptides of the invention may also be useful in the treatment of osteoporosis.
- a variety of osteogenic, cartilage-inducing and bone inducing factors have been described. See, e.g., European patent applications 148,155 and 169,016 for discussions thereof.
- the proteins of the invention may also be used in wound healing and related tissue repair.
- the types of wounds include, but are not limited to burns, incisions and ulcers. (See, e.g. PCT Publication WO84/01106 for discussion of wound healing and related tissue repair).
- proteins of the invention may increase neuronal and glial cell survival and therefore be useful in transplantation and treatment of conditions exhibiting a decrease in neuronal survival and repair.
- the proteins of the invention may further be useful for the treatment of conditions related to other types of tissue, such as nerve, including spinal chord, epidermis, muscle, including cardiac, striated and smoothe muscle, and other organs such as liver, pancreas, brain, spleen, lung, cardiac, and kidney tissue.
- the proteins of the present invention may also have value as a dietary or nutrient supplement.
- the proteins may be used in intact form, or may be predigested to provide a more readily absorbed supplement.
- the proteins of the invention may also have other useful properties characteristic of the TGF- ⁇ superfamily of proteins. Such properties include angiogenic, chemotactic and/or chemoattractant properties, and effects on cells including induction of collagen synthesis, fibrosis, differentiation responses, cell proliferative responses and responses involving cell adhesion, migration and extracellular matrices. These properties make the proteins of the invention potential agents for wound healing, reduction of fibrosis and reduction of scar tissue formation.
- the WA545 heterodimer When dimerized as a homodimer or as a heterodimer with other BMPs, with other members of the TGF- ⁇ superfamily of proteins, or with inhibin- proteins or inhibin- ⁇ proteins, the WA545 heterodimer is expected to demonstrate effects on the production of follicle stimulating hormone (FSH), as described further herein.
- FSH follicle stimulating hormone
- FSH is also important in testicular function.
- WA545 may be useful as a contraceptive based on the ability of inhibins to decrease fertility in female mammals and decrease spermatogenesis in male mammals. Administration of sufficient amounts of other inhibins can induce infertility in mammals. WA545 may also be useful as a fertility inducing therapeutic, based upon the ability of activin molecules in stimulating FSH release from cells of the anterior pituitary. See, for example, United States Patent 4,798,885. WA545 may also be useful for advancement of the onset of fertility in sexually immature mammals, so as to increase the lifetime reproductive performance of domestic animals such as cows, sheep and pigs.
- WA545 may be useful in modulating hematopoiesis by inducing the differentiation of erythroid cells [see, e.g., Broxmeyer et al, Proc. Natl. Acad. Sci. USA, 85:9052- 9056 (1988) or Eto et al, Biochem. Biophys. Res. Comm., . 142:1095-1103 (1987)], for suppressing the development of gonadal tumors [see, e.g., Matzuk et al., Nature, 360:313-319 (1992)] or for augmenting the activity of bone morphogenetic proteins [see, e.g., Ogawa et al., J. Biol. Chem., 267: 14233-14237 (1992)].
- WA545 proteins may be further characterized by their ability to modulate the release of follicle stimulating hormone (FSH) in established in vitro bioassays using rat anterior pituitary cells as described [see, e.g., Vale et al, Endocrinology, 91:562-
- the WA545 protein of the invention when composed as a heterodimer with inhibin ⁇ chains will exhibit stimulatory effects on the release of follicle stimulating hormone (FSH) from anterior pituitary cells as described [Ling et al., Nature, 321:779-782 (1986) or Vale et al., Nature, 321:776-
- FSH follicle stimulating hormone
- the WA545 protein of the invention when composed as a heterodimer with the inhibin a chain, will inhibit the release of follicle stimulating hormone (FSH) from anterior pituitary cells as described [see, e.g., Vale et al, Endocrinology, £1:562-572 (1972). Therefore, depending on the particular composition, it is expected that the WA545 protein of the invention may have contrasting and opposite effects on the release of follicle stimulating hormone (FSH) from the anterior pituitary.
- FSH follicle stimulating hormone
- Activin A (the homodimeric composition of inhibin ⁇ A ) has been shown to have erythropoietic-stimulating activity [see e.g. Eto et al., Biochem. Biophys. Res. Comm., 142:1095-1103 (1987) and Murata et al., Proc. Natl. Acad. Sci. U.S.A.,
- the WA545 protein of the invention has a similar erythropoietic-stimulating activity.
- This activity of the WA545 protein may be further characterized by the ability of the WA545 protein to demonstrate erythropoietin activity in the biological assay performed using the human K-562 cell line as described by [Lozzio et al., Blood,
- a further aspect of the invention is a therapeutic method and composition for repairing fractures and other conditions related to cartilage, bone, tendon, ligament, muscle, nerve, epidermis and or other connective tissue defects or periodontal dis- eases.
- the invention further comprises therapeutic methods and compositions for wound healing and tissue repair.
- Such compositions comprise a therapeutically effective amount of at least one of the WA545 proteins of the invention in admixture with a pharmaceutically acceptable vehicle, carrier or matrix. It is further contemplated that compositions of the invention may increase neuronal survival and therefore be useful in transplantation and treatment of conditions exhibiting a decrease in neuronal survival.
- compositions of the invention may further include at least one other therapeutically useful agent, such as members of the TGF- ⁇ superfamily of proteins, which includes the BMP proteins BMP-1, BMP-2, BMP-3, BMP-4, BMP-5, BMP-6 and BMP-7, disclosed for instance in United States Patents 5,108,922; 5,013,649; 5,116,738; 5,106,748; 5,187,076; and 5,141,905; BMP-8, disclosed in PCT publication WO91/18098; BMP-9, disclosed in PCT publication WO93/00432; BMP-
- members of the TGF- ⁇ superfamily of proteins which includes the BMP proteins BMP-1, BMP-2, BMP-3, BMP-4, BMP-5, BMP-6 and BMP-7, disclosed for instance in United States Patents 5,108,922; 5,013,649; 5,116,738; 5,106,748; 5,187,076; and 5,141,905; BMP-8, disclosed in PCT publication WO91/18098;
- compositions which may also be useful include Vgr-2, and any of the
- GDFs including those described in PCT applications WO94/15965; WO94/15949; WO95/01801; WO95/01802; WO94/21681; WO94/15966; and others.
- Also useful in the present invention may be BIP, disclosed in WO94/01557; and MP52, disclosed in PCT application WO93/ 16099. The disclosures of the above applications are hereby incorporated by reference herein.
- WA545 proteins may exist in nature as homodimers or heterodimers.
- SEQUENCE ID NO: 1 to provide one or more additional cysteine residues to increase potential dimer formation.
- the resulting DNA sequence would be capable of producing a "cysteine added variant" of
- WA545 protein Alternatively, one can produce "cysteine added variants" of WA545 proteins by altering the sequence of the protein at the amino acid level, for example, by altering the amino acid sequences of one or more amino acid residues to Cys. Production of "cysteine added variants" of proteins is described in United States Patent 5,166,322, the disclosure of which is hereby incorporated by reference.
- the proteins of the invention may act in concert with or perhaps synergistically with other related proteins and growth factors.
- Further therapeutic methods and compositions of the invention therefore comprise a therapeutic amount of at least one WA545 protein of the invention with a therapeutic amount of at least one other member of the TGF- ⁇ superfamily of proteins, such as the BMP proteins disclosed in the applications described above.
- Such combinations may comprise separate molecules of the BMP proteins or heteromolecules comprised of different BMP moieties.
- a method and composition of the invention may comprise a disulfide linked dimer comprising a WA545 protein subunit and a subunit from one of the "BMP" proteins described above.
- the present invention includes a purified WA545 polypeptide which is a heterodimer wherein one subunit comprises an amino acid sequence of SEQ ID NO:2, and one subunit comprises an amino acid sequence for a bone morphogenetic protein selected from the group consisting of BMP-2, BMP-3, BMP-4, BMP-5, BMP-6, BMP-7, BMP-8, BMP-9, BMP-10, BMP-11, BMP-12 or BMP- 13, disclosed in PCT application WO 95/16035, or BMP- 15, disclosed in PCT application WO96/36710 or BMP- 16, disclosed in co- pending patent application serial number 08/715/202, filed September 18, 1996.
- a bone morphogenetic protein selected from the group consisting of BMP-2, BMP-3, BMP-4, BMP-5, BMP-6, BMP-7, BMP-8, BMP-9, BMP-10, BMP-11, BMP-12 or BMP- 13, disclosed in PCT application WO 95/16035, or BMP- 15, disclosed in PCT application
- a further embodiment may comprise a heterodimer of WA545 moieties, for example, of Xenopus WA545 and the human homologue of Xenopus WA545 protein.
- WA545 may be combined with other agents beneficial to the treatment of the bone, cartilage, tendon, ligament, muscle, nerve, epidermis and/or other connective tissue defect, wound, or tissue in question.
- agents include various growth factors such as epidermal growth factor (EGF), fibroblast growth factor (FGF), platelet derived growth factor (PDGF), transforming growth factors (TGF- ⁇ and TGF- ⁇ ), wnt proteins, hedgehog proteins, such as sonic, indian and desert hedgehog, activins, inhibins, and k-fibroblast growth factor (kFGF), parathyroid hormone (PTH), leukemia inhibitory factor (LIF/HILDA/DIA), insulin-like growth factors (IGF-I and IGF-H). Portions of these agents may also be used in compositions of the present invention.
- EGF epidermal growth factor
- FGF fibroblast growth factor
- PDGF platelet derived growth factor
- TGF- ⁇ and TGF- ⁇ transforming growth factors
- hedgehog proteins such as sonic, indian and desert hedgehog
- activins activins
- inhibins and k-fibroblast growth factor (kFGF)
- kFGF parathyroid hormone
- compositions having due regard to pH, isotonicity, stability and the like, is within the skill of the art.
- the therapeutic compositions are also presently valuable for veterinary applications due to the lack of species specificity in BMP proteins. Particularly domestic animals and thoroughbred horses in addition to humans are desired patients for such treatment with the WA545 proteins of the present invention.
- the therapeutic method includes administering the composition topically, systemically, or locally as an implant or device.
- the therapeutic composition for use in this invention is, of course, in a pyrogen-free, physiologically acceptable form.
- the composition may desirably be encapsulated or injected in a viscous form for delivery to the site of bone, cartilage, tendon, ligament, muscle, nerve, epidermis or other connective tissue or other tissue damage.
- Topical administration may be suitable for wound healing and tissue repair.
- Therapeutically useful agents other than the WA545 proteins which may also optionally be included in the composition as described above, may alternatively or additionally, be administered simultaneously or sequentially with the BMP composition in the methods of the invention.
- the composition includes a matrix capable of delivering WA545 or other BMP proteins to the site of bone, cartilage, tendon, ligament, muscle, nerve, epidermis and/or other connective tissue damage, providing a structure for the developing bone, cartilage, tendon, ligament, muscle, nerve, epidermis and/or other connective tissue and optimally capable of being resorbed into the body.
- the matrix may provide slow release of WA545 and/or other inductive protein, as well as proper presentation and appropriate environment for cellular infiltration.
- Such matrices may be formed of materials presently in use for other implanted medical applications.
- matrices for the compositions may be biodegradable and chemically defined calcium sulfate, tricalcium phosphate, hydroxyapatite, polylactic acid and polyanhydrides.
- Other potential materials are biodegradable and biologically well defined, such as bone or dermal collagen.
- Further matrices are comprised of pure proteins or extracellular matrix components.
- Other potential matrices are nonbiodegradable and chemically defined, such as sintered hydroxyapatite, bioglass, aluminates, or other ceramics.
- Matrices may be comprised of combinations of any of the above mentioned types of material, such as polylactic acid and hydroxyapatite or collagen and tricalcium phosphate.
- the bioceramics may be altered in composition, such as in calcium-aluminate-phosphate and processing to alter pore size, particle size, particle shape, and biodegradability.
- the dosage regimen will be determined by the attending physician considering various factors which modify the action of the WA545 protein, e.g., amount of tissue weight desired to be formed, the site of tissue damage, the condition of the damaged tissue, the size of a wound, type of damaged tissue, the patient's age, sex, and diet, the severity of any infection, time of administration and other clinical factors.
- the dosage may vary with the type of matrix used in the reconstitution and the types of BMP proteins in the composition.
- the addition of other known growth factors, such as IGF I (insulin like growth factor I) may also affect the dosage.
- Progress can be monitored by periodic assessment of tissue growth and/or repair. The progress can be monitored, for example, x-rays, histomorphometric determinations and tetracycline labeling.
- the Xenopus WA545 full-length cDNA was isolated from a dT-primed cDNA library constructed in the plasmid vector CS2+.
- cDNA was made from Xenopus embryos (stage 11.5-12).
- the probe sequences used to isolate the clone were derived from an sEST, an EST used to allow secretion of invertase in the signal sequence trap, which is described in United States Patents 5,536,637, the disclosure of which is hereby incorpated herein.
- sequences of the probes for WA545 were as follows: 5' - GAAAGTGATAGCCACAACTCTGCCATG - 3' (SEQ ID NO 3) and 5' - GATTTAGGTACAGGAGCTGGAGCAATG - 3' (SEQ ID NO 4).
- Both probes were antisense sequence to the sEST.
- the DNA probes were radioactively labelled with 32 P and used to screen the Xenopus dT-primed cDNA library, under high stringency hybridization/washing conditions, to identify clones containing sequences of the WA545 gene. Approximately 61,000 library transformants were plated at a density of approximately 4350 transformants per plate on selective plates to screen for WA545.
- Nitrocellulose replicas of the transformed colonies were hybridized to the 32 P-labelled DNA probe in standard hybridization buffer (6X SSC, 0.5% SDS, 5X Denhardt's, lOmM EDTA pH8, lOOmg/ml Bakers Yeast ribonucleic acid) under high stringency conditions (65 °C for 2 hours). After 2 hours hybridization, the filters were removed from the hybridization solution and washed under high stringency conditions (2X SSC, 0.5% SDS 21°C for 5 minutes; followed by 2X SSC, 0.1% SDS 21°C for 15 minutes; followed by a 2nd 2X SSC, 0.1% SDS 21°C for 15 minutes; followed by 2X SSC, 0.1% SDS 65°C for 10 minutes).
- the filters were wrapped in Saran wrap and exposed to X-ray film for overnight to 3 days at room temperature.
- the autoradiographs were developed and positively hybridizing transformants of various signal intensities were identified. These positive clones were picked, grown for 5 hours in selective medium and plated at low density (approximately 100 colonies per plate). Nitrocellulose replicas of the colonies were hybridized to the 32 P-labelled probe in standard hybridization buffer (6X SSC, 0.5% SDS, 5X Denhardt's, lOmM
- DNA sequences encoding WA545 homologues and related proteins may be isolated by various techniques known to those skilled in the art.
- oligonucleotide primers may be designed on the basis of amino acid sequences present in other BMP proteins, Vg-1 related proteins and other proteins of the TGF- ⁇ superfamily. Regions containing amino acid sequences which are highly conserved within the BMP family of proteins and within other members of the TGF- ⁇ superfamily of proteins can be identified and consensus amino acid sequences of these highly conserved regions can be constructed based on the similari ty of the corresponding regions of individual BMP/TGF- ⁇ /Vg-1 proteins.
- the WA545 protein of the invention and other BMP/TGF- ⁇ /Vg-1 related proteins may contain amino acid sequences similar to the consensus amino acid sequences described above and that the location of those sequences within a WA545 protein or other novel related proteins would correspond to the relative locations in the proteins from which they were derived. It is further contemplated that this positional information derived from the structure of other BMP/TGF- ⁇ /Vg-1 proteins and the oligonucleotide sequences which have been derived from consensus amino acid sequences could be utilized to specifically amplify DNA sequences encoding the corresponding amino acids of a WA545 protein or other BMP/TGF- ⁇ /Vg-1 related proteins.
- X Y indicates that either amino acid residue may appear at that position.
- oligonucleotide is designed on the basis of the above identified consensus amino acid sequence (1): #1: GCGGATCCTGGVANGABTGGATHRTNGC (SEQ ID NO:6)
- This oligonucleotide sequence is synthesized on an automated DNA synthesizer.
- the standard nucleotide symbols in the above identified oligonucleotide primer are as follows: A, adenosine; C, cytosine; G, guanine; T, thymine; N, adenosine or cytosine or guanine or thymine; R, adenosine or cytosine; Y, cytosine or thymine; H, adenosine or cytosine or thymine; V, adenosine or cytosine or guanine;
- the first eight nucleotides of oligonucleotide #1 (underlined) contain the recognition sequence for the restriction endonuclease BamHl in order to facilitate the manipulation of a specifically amplified DNA sequence encoding the WA545 or WA545 -related proteins and are thus not derived from the consensus amino acid sequence (1) presented above.
- a second consensus amino acid sequence is derived from another highly conserved region of BMP/TGF- ⁇ /Vg-1 proteins as described below:
- oligonucleotide is designed on the basis of the above identified consensus amino acid sequence (2):
- the first eight nucleotides of oligonucleotide #2 (underlined) contain the recognition sequence for the restriction endonuclease Xbal in order to facilitate the manipulation of a specifically amplified DNA sequence encoding the WA545 or
- WA545-related proteins are thus not derived from the consensus amino acid sequence (2) presented above.
- WA545 or WA545-related proteins of the invention and other BMP/TGF- ⁇ /Vg-1 related proteins may contain amino acid sequences similar to the consensus amino acid sequences described above and that the location of those sequences within a WA545 or WA545-related protein or other novel related proteins would correspond to the relative locations in the proteins from which they were derived.
- this positional information derived from the structure of other BMP/TGF- ⁇ /Vg-1 proteins and the oligonucleotide sequences #1 and #2 which have been derived from consensus amino acid sequences (1) and (2), respectively, can be utilized to specifically amplify DNA sequences encoding the corresponding amino acids of a WA545 or WA545-related protein or other BMP/TGF- ⁇ /Vg-1 related proteins.
- Xenopus, human or murine genomic DNA can be used as a template to perform specific amplification reactions which would result in the identification of WA545 encoding sequences and WA545 proteins.
- Such specific amplification reactions of a human or murine genomic DNA template can be initiated with the use of oligonucleotide primers as described earlier. Oligonucleotides such as those set forth in SEQ ID NO:6 and SEQ ID NO:8 are utilized as primers to allow the specific amplification of a specific nucleotide sequence from Xenopus, human, murine or other genomic DNA.
- the amplification reaction is performed as follows: Genomic DNA is sheared by repeated passage through a 25 gauge needle, denatured at 100°C for 5 minutes and then chilled on ice before adding to a reaction mixture containing 200 ⁇ M each deoxynucleotide triphosphates (dATP, dGTP, dCTP and dTTP), 10 mM Tris-HCl pH 8.3, 50 mM KC1, 1.5 mM MgCl 2 , 0.001% gelatin, 1.25 units Taq DNA polymerase, 50 pM of each oligonucleotide, such as those set forth in SEQ ID NO:6 and SEQ ID NO:8, to the consensus sequence, in a total reaction volume of 50 ⁇ l.
- This reaction mixture is subjected to thermal cycling in the following manner: 1 minute at 94°C, 1 minute at 37°C, 2 minutes at 72°C for thirty cycles; followed by a 7 minute incubation at 72°C.
- the DNA which is specifically amplified by this reaction is ethanol precipitated, digested with the restriction endonucleases BamHl and Xbal and subjected to agarose gel electrophoresis.
- a region of the gel, corresponding to the predicted size of the human or murine WA545 or WA545-related encoding DNA fragment, is excised and the specifically amplified DNA fragments contained therein are electroeluted and subcloned into a suitable vector, for example, the plasmid vector pGEM-3 between the Xbal and BamHl sites of the polylinker.
- DNA sequence analysis of the resulting human or murine WA545 or WA545-related subclones is conducted to determine whether the specifically amplified DNA sequence product contained therein encode a portion of the human or murine WA545 or WA545-related protein of the invention.
- Oligonucleotide probes preferably 30-50 nucleotides in length, can be designed on the basis of the human or murine WA545 or WA545-related specifically amplified DNA sequence described above.
- the oligonucleotide probes are radioactively labeled with 32 P and employed to screen a murine or human genomic library constructed in the vector ⁇ FIX II (Stratagene catalog #946309) or a comparable substitute. 500,000 recombinants of the human genomic library are plated at a density of approximately 10,000 recombinants per plate on 50 plates.
- Duplicate nitrocellulose replicas of the recombinant bacteriophage plaques are made one set of nitrocellulose filters is hybridized to one oligonucleotide probe and a duplicate set of nitrocellulose filters is hybridized to a second oligonucleotide probe, both in a hybridization buffer consisting of 5X SSC, 1% SDS, 10% dextran sulfate, 2X Denhardt's, 100 ⁇ g/ml herring salmon sperm DNA) at 60°C overnight. The following day the radioactively labelled oligonucleotide containing hybridization solution is removed an the filters are washed with 5X SSC, 0.1% SDS at 60°C.
- Recombinants which hybridize to both oligonucleotide probes are identified and plaque purified.
- Bacteriophage plate stocks are made and bacteriophage DNA is isolated from the murine or human genomic clone.
- the complete insert of the murine or human genomic recombinant is excised with restriction endonucleases, subcloned into a plasmid vector (pBluescript) and DNA sequence analysis is performed.
- Xenopus WA545 precursor polypeptide would be cleaved at the multibasic sequence Arg-Ala-Lys-Arg in agreement with a proposed consensus proteolytic processing sequence of Arg-X-X-Arg. Cleavage of the Xenopus WA545 precursor polypeptide is expected to generate a 114 amino acid mature peptide beginning with the amino acid Ser at position #1 of SEQ ID NO:2.
- WA545 proteins will comprise a homodimer of two polypeptide subunits, each subunit comprising an amino acid sequence which correlates to a portion of the sequence of SEQ ID 2, such as amino acids #1 through #114. Further active species are contemplated comprising at least amino acids # 13 to #114 of SEQ ID NO:2, thereby including the first conserved cysteine residue. As with other members of the
- the carboxy-terminal portion of the murine WA545 protein exhibits greater sequence conservation than the more amino-terminal portion.
- the percent amino acid identity of the Xenopus WA545 protein in the cysteine-rich C-terminal domain (amino acids #24-#125) to the corresponding region of human BMP proteins and other proteins within the TGF-a family is as follows: BMP-2, 60%;
- BMP-3 43%; BMP-4, 57%; BMP-5, 57%; BMP-6, 59%; BMP-7, 57%; BMP-8, 55%;
- BMP-9 49%; BMP-10, 51%; BMP-l l, 41%; BMP-12, 51%; Vgl, 82%; GDF-l, 63%;
- TGF- ⁇ l 39%; TGF- ⁇ 2, 40%; TGF- ⁇ 3, 43%; inhibin ⁇ (B), 42%; inhibin ⁇ (A), 43%.
- the Xenopus WA545 DNA sequence (SEQ ID NO:l), or a portion thereof, such as the portion of the Xenopus WA545 sequence corresponding to the mature peptide encoding region, can be used as probe to identify corresponding homologues or related proteins, such as the human or murine WA545 or WA545-related proteins.
- Nucleotides #775 through #1116 of SEQ ID NO: 1 can be specifically amplified with oligonucleotide primers designed on the basis of the Xenopus WA545 sequence (SEQ ID NO: l).
- the following oligonucleotide primer is designed on the basis of nucleotide #775 through #794 of the DNA sequence set forth in SEQ ID NO:l and synthesized on an automated DNA synthesizer:
- AGTACTCATTCATCACCTCC (SEQ ED NO:9)
- the following oligonucleotide primer is designed on the basis of the reverse compliment of nucleotide #1116 through #1097 of the DNA sequence set forth in SEQ ED NO: 1 and synthesized on an automated DNA synthesizer.
- CTTGCAACCACACTCATCCA (SEQ ED NO: 10) The amplification reaction is performed as follows: 10 ng of a bacterial plasmid DNA containing the Xenopus W A545 full-length cDNA is added to a reaction mixture containing 200 ⁇ M each deoxynucleotide triphosphates (dATP, dGTP, dCTP and dTTP) 10 mM Tris-HCl pH 8.3, 50 mM KC1, 1.5 mM MgCl 2 , 0.001% gelatin, 1.25 units Taq DNA polymerase, and 100 pM of each oligonucleotide primer.
- the reaction mixture is then subjected to thermal cycling in the following manner: 1 minute at 94°C, 1 minute at 55°C, 1 minute at 72°C for thirty cycles.
- This amplification reaction would be expected to generate a DNA fragment of approximately 344 base pairs which encodes the entire mature peptide of the Xenopus WA545 protein of the invention.
- the resulting 344 bp DNA product is visualized following electrophoresis of the reaction products through a 2% agarose gel.
- the region of the gel containing the 344 base pair Xenopus WA545 DNA fragment is excised and the specifically amplified DNA fragments contained therein are extracted (by electroelution or by other methods known to those skilled in the art).
- the gel- extracted 344 base pair DNA amplification product was radioactively labelled with 32 P and employed to screen a human genomic library constructed in the vector eDASH II (Stratagene catalog #945203).
- the same probe can be used to screen a murine genomic library constructed in the vector eFEX ⁇ (Stratagene catalog #946309).
- One million recombinants of the human or murine genomic library are plated at a density of approximately 20,000 recombinants per plate on 50 plates.
- SHB 5X SSC, 0.1% SDS, 5X Denhardt's, 100 ⁇ g/ml salmon sperm DNA
- plaque purified recombinant bacteriophage are used to prepare bacteriophage plate stocks from which recombinant bacteriophage DNA can be isolated and purified.
- the resulting recombinant bacteriophage DNA isolated from either murine or human genomic clones which were originally identified by hybridization to the Xenopus WA545 probe are analyzed for the presence of either human or murine WA545 or
- the Xenopus WA545 DNA sequence (SEQ ID NO: 1), or a portion thereof, can be used as a probe to identify a human cell line or tissue which synthesizes WA545 mRNA. Briefly described, RNA is extracted from a selected cell or tissue source and either electrophoresed on a formaldehyde agarose gel and transferred to nitrocellulose, or reacted with formaldehyde and spotted on nitrocellulose directly. The nitrocellulose is then hybridized to a probe derived from the coding sequence of Xenopus WA545 DNA.
- the Xenopus WA545 sequence is used to design oligonucleotide primers which will specifically amplify a portion of the human or murine WA545 or
- WA545-related encoding sequence located in the region between the human or murine primers utilized to perform the specific amplification reaction. It is contemplated that these Xenopus WA545 derived primers would allow one to specifically amplify corresponding human WA545 or other mammalian WA545 encoding sequences from mRNA, cDNA or genomic DNA templates.
- mRNA is selected by oligo (dT) cellulose chromatography and cDNA is synthesized and cloned in ⁇ gtlO or other ⁇ bacteriophage vectors known to those skilled in the art, for example, ⁇ ZAP by established techniques (Toole et al., supra).
- oligonucleotide primer directed amplification reaction it is also possible to perform the oligonucleotide primer directed amplification reaction, described above, directly on a pre-established human cDNA or genomic library which has been cloned into a ⁇ bacteriophage vector.
- a library which yields a specifically amplified DNA product encoding a portion of the human WA545 protein could be screened directly, utilizing the fragment of amplified human WA545 protein encoding DNA as a probe.
- Xenopus WA545 genomic clone are predicted to allow the specific amplification of human WA545 encoding DNA sequences from pre-established human cDNA libraries which are commercially available (i.e., Stratagene, La Jolla, CA or Clonetech Laboratories, Inc., Palo Alto, CA).
- the oligonucleotide primers are designed on the basis of the DNA sequence set forth in SEQ ID NO: l and synthesized on an automated DNA synthesizer.
- ⁇ bacteriophage libraries containing human cDNA inserts corresponding to the primers are denatured at 95°C for five minutes prior to addition to a reaction mixture containing 200 ⁇ M each deoxynucleotide triphosphates (dATP, dGTP, dCTP and dTTP) 10 mM Tris-HCl pH
- reaction mixture is then subjected to thermal cycling in the following manner: 1 minute at 94°C, 1 minute at 50°C, 1 minute at 72°C for thirty-nine cycles followed by 10 minutes at 72°C.
- the resulting DNA product which is specifically amplified by this reaction is visualized following electrophoresis of the reaction products through a 2% agarose gel.
- the corresponding cDNA library from which a WA545 specific sequence was amplified could be screened directly with the other WA545 specific probes in order to identify and isolate cDNA clones encoding the full-length WA545 protein of the invention.
- oligonucleotides are utilized as primers to allow the specific amplification of human or murine WA545 specific nucleotide sequences from Xenopus WA545 encoding plasmids.
- the amplification reaction is performed as follows: Approximately 25 ng of Xenopus WA545 DNA is added to a reaction mixture containing 200 ⁇ M each deoxynucleotide triphosphates (dATP, dGTP, dCTP and dTTP) 10 mM Tris-HCl pH 8.3, 50 mM KC1, 1.5 mM MgCl 2 , 0.001% gelatin, 1.25 units Taq DNA polymerase, 100 pM each of oligonucleotide primers to the
- Xenopus WA545 DNA sense and complementary orientations.
- the reaction mixture is then subjected to thermal cycling in the following manner: 1 minute at 94°C, 1 minute at 53°C, 1 minute at 72°C for thirty cycles.
- the DNA which is specifically amplified by this reaction would be expected to generate a WA545 encoding product.
- the resulting DNA product is visualized following electrophoresis of the reaction products through a 2% agarose gel.
- the region of the gel containing the WA545 DNA fragment is excised and the specifically amplified DNA fragments contained therein are extracted (by electroelution or by other methods known to those skilled in the art).
- the gel-extracted DNA amplification product is radioactively labelled with 32 P and employed to screen a human genomic library constructed in the vector ⁇ DASH II (Stratagene catalog #945203).
- W-20 bone marrow stromal cells are a clonal bone marrow stromal cell line derived from adult mice by researchers in the laboratory of Dr. D. Nathan, Children's Hospital, Boston, MA. Treatment of W-20 cells with certain BMP proteins results in (1) increased alkaline phosphatase production, (2) induction of PTH stimulated cAMP, and (3) induction of osteocalcin synthesis by the cells.
- B. W-20 Alkaline Phosphatase Assay Protocol W-20 cells are plated into 96 well tissue culture plates at a density of 10,000 cells per well in 200 ⁇ l of media (DME with 10% heat inactivated fetal calf serum, 2 mM glutamine and 100 Units/ml penicillin + 100 ⁇ g/ml streptomycin. The cells are allowed to attach overnight in a 95% air, 5% CO 2 incubator at 37 °C.
- test sample delivered in DME with 10% heat inactivated fetal calf serum, 2 mM glutamine and 1% penicillin-streptomycin. Test substances are assayed in triplicate.
- test samples and standards are allowed a 24 hour incubation period with the W-20 indicator cells. After the 24 hours, plates are removed from the 37 °C incubator and the test media are removed from the cells.
- the W-20 cell layers are washed 3 times with 200 ⁇ l per well of calcium/magnesium free phosphate buffered saline and these washes are discarded. 50 ⁇ l of glass distilled water is added to each well and the assay plates are then placed on a dry ice/ethanol bath for quick freezing. Once frozen, the assay plates are removed from the dry ice/ethanol bath and thawed at 37 °C. This step is repeated 2 more times for a total of 3 freeze-thaw procedures. Once complete, the membrane bound alkaline phosphatase is available for measurement.
- the reaction is stopped by adding 100 ⁇ l of 0.2 N NaOH to each well and placing the assay plates on ice.
- the spectrophotometric absorbance for each well is read at a wavelength of 405 nanometers. These values are then compared to known standards to give an estimate of the alkaline phosphatase activity in each sample. For example, using known amounts of p-nitrophenol phosphate, absorbance values are generated. This is shown in Table I.
- Absorbance values for known amounts of BMPs can be determined and converted to ⁇ moles of p-nitrophenol phosphate cleaved per unit time as shown in Table II.
- W-20 cells are plated at 10 6 cells per well in 24 well multiwell tissue culture dishes in 2 mis of DME containing 10% heat inactivated fetal calf serum, 2 mM glutamine. The cells are allowed to attach overnight in an atmosphere of 95% air 5%
- test media The next day the medium is changed to DME containing 10% fetal calf serum, 2 mM glutamine and the test substance in a total volume of 2 ml. Each test substance is administered to triplicate wells. The test substances are incubated with the W-20 cells for a total of 96 hours with replacement at 48 hours by the same test medias.
- test media is removed from each well and assayed for osteocalcin production using a radioimmunoassay for mouse osteocalcin.
- BT-431 mouse osteocalcin standard
- BT-432 Goat anti-mouse Osteocalcin
- BT-431R iodinated mouse osteocalcin
- BT-415 normal goat serum
- BT-414 donkey anti goat IgG
- the RIA for osteocalcin synthesized by W-20 cells in response to BMP treatment is carried out as described in the protocol provided by the manufacturer.
- the values obtained for the test samples are compared to values for known standards of mouse osteocalcin and to the amount of osteocalcin produced by W-20 cells in response to challenge with known amounts of BMP-2.
- the values for BMP-2 induced osteocalcin synthesis by W-20 cells is shown in Table HI.
- a modified version of the rat bone formation assay described in Sampath and Reddi, Proc. Natl. Acad. Sci. USA. 80:6591-6595 (1983) is used to evaluate bone and/or cartilage and/or other connective tissue activity of BMP proteins.
- This modified assay is herein called the Rosen-modified Sampath-Reddi assay.
- the ethanol precipitation step of the Sampath-Reddi procedure is replaced by dialyzing (if the composition is a solution) or diafiltering (if the composition is a suspension) the fraction to be assayed against water. The solution or suspension is then equilibrated to 0.1% TFA. The resulting solution is added to 20 mg of rat matrix.
- a mock rat matrix sample not treated with the protein serves as a control. This material is frozen and lyophilized and the resulting powder enclosed in #5 gelatin capsules. The capsules are implanted subcutaneously in the abdominal thoracic area of 21-49 day old male E >ng Evans rats. The implants are removed after 7-14 days. Half of each implant is used for alkaline phosphatase analysis [see, Reddi et al, Proc. Natl. Acad. ScL, 69: 1601 (1972)].
- each implant is fixed and processed for histological analysis. 1 ⁇ m glycolmethacrylate sections are stained with Von Kossa and acid fuschin to score the amount of induced bone and cartilage and other connective tissue formation present in each implant.
- the terms +1 through +5 represent the area of each histological section of an implant occupied by new bone and/or cartilage cells and matrix. A score of +5 indicates that greater than 50% of the implant is new bone and/or cartilage produced as a direct result of protein in the implant. A score of +4, +3, +2, and +1 would indicate that greater than 40%, 30%, 20% and 10% respectively of the implant contains new cartilage and/or bone.
- the implants are inspected for the appearance of tissue resembling embryonic tendon, which is easily recognized by the presence of dense bundles of fibroblasts oriented in the same plane and packed tightly together.
- tissue resembling embryonic tendon which is easily recognized by the presence of dense bundles of fibroblasts oriented in the same plane and packed tightly together.
- the WA545 proteins of this invention may be assessed for activity on this assay.
- the DNA encoding it is transferred into an appropriate expression vector and introduced into mammalian cells or other preferred eukaryotic or prokaryotic hosts by conventional genetic engineering techniques.
- the preferred expression system for biologically active recombinant human WA545 is contemplated to be stably transformed mammalian cells.
- mammalian expression vectors by employing the sequence of SEQ ID NO: 1 , or other DNA sequences encoding WA545 proteins or other modified sequences and known vectors, such as pCD [Okayama et al., Mol. Cell Biol., 2: 161-170 (1982)], pJL3, pJL4 [Gough et al., EMBO J.. 4:645-
- the mammalian expression vector pMT2 CXM is a derivative of p91023(b) (Wong et al., Science 228:810-815, 1985) differing from the latter in that it contains the ampicillin resistance gene in place of the tetracycline resistance gene and further contains a Xhol site for insertion of cDNA clones.
- the functional elements of pMT2 CXM have been described (Kaufman, R.J., 1985, Proc. Natl. Acad. Sci.
- adenovirus VA genes include the adenovirus VA genes, the SV40 origin of replication including the 72 bp enhancer, the adenovirus major late promoter including a 5' splice site and the majority of the adenovirus tripartite leader sequence present on adenovirus late mRNAs, a 3' splice acceptor site, a DHFR insert, the SV40 early polyadenylation site (SV40), and pBR322 sequences needed for propagation in R coli.
- the SV40 origin of replication including the 72 bp enhancer
- the adenovirus major late promoter including a 5' splice site and the majority of the adenovirus tripartite leader sequence present on adenovirus late mRNAs
- a 3' splice acceptor site a 3' splice acceptor site
- a DHFR insert the SV40 early polyadenylation site (SV40)
- Plasmid pMT2 CXM is obtained by EcoRI digestion of pMT2-VWF, which has been deposited with the American Type Culture Collection (ATCC), Rockville, MD (USA) under accession number ATCC 67122. EcoRI digestion excises the cDNA insert present in pMT2-VWF, yielding pMT2 in linear form which can be ligated and used to transform E. coli HB 101 or DH-5 to ampicillin resistance. Plasmid pMT2 DNA can be prepared by conventional methods. pMT2 CXM is then constructed using loopout in mutagenesis [Morinaga, et al., Biotechnology 84: 636 (1984). This removes bases 1075 to 1145 relative to the Hind EH site near the SV40 origin of replication and enhancer sequences of pMT2. In addition, it inserts the following sequence:
- pMT23 contains recognition sites for the restriction endonucleases PstI, Eco RI, Sail and Xhol.
- Plasmid pMT2 CXM and pMT23 DNA may be prepared by conventional methods.
- pEMC2 ⁇ l derived from pMT21 may also be suitable in practice of the invention.
- pMT21 is derived from pMT2 which is derived from pMT2-VWF. As described above EcoRI digestion excises the cDNA insert present in pMT-VWF, yielding pMT2 in linear form which can be ligated and used to transform R Coli HB 101 or DH-5 to ampicillin resistance.
- Plasmid pMT2 DNA can be prepared by conventional methods.
- pMT21 is derived from pMT2 through the following two modifications.
- a unique Clal site is introduced by digestion with EcoRV and Xbal, treatment with Klenow fragment of DNA polymerase I, and ligation to a Clal linker (CATCGATG). This deletes a 250 bp segment from the adenovirus associated RNA (VAI) region but does not interfere with VAI RNA gene expression or function.
- pMT21 is digested with EcoRI and Xhol, and used to derive the vector pEMC2B 1.
- a portion of the EMCV leader is obtained from pMT2-ECAT 1 [S .K. Jung, et al, J. Virol 63: 1651-1660 (1989)] by digestion with Eco RI and PstI, resulting in a 2752 bp fragment.
- a 68 bp adapter and its complementary strand are synthesized with a 5' TaqI protruding end and a 3' Xhol protruding end which has the following sequence:
- This sequence matches the EMC virus leader sequence from nucleotide 763 to 827.
- This vector contains the SV40 origin of replication and enhancer, the adenovirus major late promoter, a cDNA copy of the majority of the adenovirus tripartite leader sequence, a small hybrid intervening sequence, an SV40 polyadenylation signal and the adenovirus VA I gene, DHFR and ⁇ -lactamase markers and an EMC sequence, in appropriate relationships to direct the high level expression of the desired cDNA in mammalian cells.
- the construction of vectors may involve modification of the WA545 DNA sequences. For instance, WA545 cDNA can be modified by removing the non-coding nucleotides on the 5' and 3' ends of the coding region.
- the deleted non-coding nucleotides may or may not be replaced by other sequences known to be beneficial for expression. These vectors are transformed into appropriate host cells for expression of WA545 proteins. Additionally, the sequence of SEQ ID NO: 1 or other sequences encoding WA545 proteins can be manipulated to express a mature WA545 protein by deleting WA545 encoding propeptide sequences and replacing them with sequences encoding the complete propeptides of other BMP proteins.
- One skilled in the art can manipulate the sequences of SEQ ID NO: 1 by eliminating or replacing the mammalian regulatory sequences flanking the coding sequence with bacterial sequences to create bacterial vectors for intracellular or extracellular expression by bacterial cells.
- the coding sequences could be further manipulated (e.g. ligated to other known linkers or modified by deleting non-coding sequences therefrom or altering nucleotides therein by other known techniques).
- the modified WA545 coding sequence could then be inserted into a known bacterial vector using procedures such as described in T. Taniguchi et al., Proc. Natl Acad. Sci. USA, 77:5230-5233 (1980).
- This exemplary bacterial vector could then be transformed into bacterial host cells and a WA545 protein expressed thereby.
- EPA 177,343 For a strategy for producing extracellular expression of WA545 proteins in bacterial cells, see, e.g. European patent application EPA 177,343.
- yeast vector could also be constructed employing yeast regulatory sequences for intracellular or extracellular expression of the factors of the present invention by yeast cells. [See, e.g., procedures described in published PCT application WO86/00639 and European patent application EPA 123,289].
- a method for producing high levels of a WA545 protein of the invention in mammalian cells may involve the construction of cells containing multiple copies of the heterologous WA545 gene.
- the heterologous gene is linked to an amplifiable marker, e.g. the dihydrofolate reductase (DHFR) gene for which cells containing increased gene copies can be selected for propagation in increasing concentrations of methotrexate (MTX) according to the procedures of Kaufman and Sharp, J. Mol. Biol., 159:601-629 (1982).
- DHFR dihydrofolate reductase
- MTX methotrexate
- a plasmid containing a DNA sequence for a WA545 protein of the invention in operative association with other plasmid sequences enabling expression thereof and the DHFR expression plasmid pAdA26SV(A)3 can be co-introduced into DHFR-deficient CHO cells, DUKX-B ⁇ , by various methods including calcium phosphate coprecipitation and transfection, electroporation or protoplast fusion.
- DHFR expressing transformants are selected for growth in alpha media with dialyzed fetal calf serum, and subsequently selected for amplification by growth in increasing concentrations of MTX (e.g.
- WA545 protein expression should increase with increasing levels of MTX resistance.
- WA545 polypeptides are characterized using standard techniques known in the art such as pulse labeling with [35S] methionine or cysteine and polyacrylamide gel electrophoresis. Similar procedures can be followed to produce other related WA545 proteins.
- Example 6 Biological Activity of Expressed WA545
- the proteins are recovered from the cell culture and purified by isolating the WA545 proteins from other proteinaceous materials with which they are co-produced as well as from other contaminants.
- the purified protein may be assayed in accordance with the rat bone formation assay described in Example 4.
- Protein analysis is conducted using standard techniques such as SDS-PAGE acrylamide [Laemmli, Nature 227:680 (1970)] stained with silver [Oakley, et al. Anal. Biochem. 105:361 (1980)] and by immunoblot [Towbin, et al. Proc. Natl. Acad. Sci. USA 76:4350 (1979)1
- WA545 proteins can be tested for their effects on various cell lines. Suitable cell lines include cell lines derived from El 3 mouse limb buds. After 10 days of treatment with WA545 protein, the cell phenotype is examined histologically for indications of tissue differentiation.
- Northern analysis of mRNA from WA545 protein treated cells can be performed for various markers including one or more of the following markers for bone, cartilage and/or tendon/ligament, as described in Table TV:
- ES-E14TG2 which is available from the American Type Culture Collection in Rockville, Md.
- cells may be propagated in the presence of 100 units of LEF to keep them in an undifferentiated state.
- Assays are setup by first removing the LEF and aggregating the cells in suspension, in what is known as embryoid bodies. After 3 days the embryoid bodies are plated on gelatin coated plates (12 well plates for PCR analysis, 24 well plates for immunocytochemistry) and treated with the proteins to be assayed. Cells are supplied with nutrients and treated with the protein factor every 2-3 days. Cells may be adapted so that assays may be conducted in media supplemented with 15% Fetal Bovine Serum (FBS) or with CDM defined media containing much lower amounts of FBS.
- FBS Fetal Bovine Serum
- RNA is harvested from the cells and analyzed by quantitative multiplex PCR for the following markers:
- Brachyury a mesodermal marker, AP-2, an ectodermal marker, and HNF-3 an endodermal marker.
- AP-2 a mesodermal marker
- HNF-3 an endodermal marker.
- neuronal cells glia and neurons
- muscle cells muscle cells
- cytokeratins epidermis
- Example 9 In Situ Hybridization of WA545 with Embryos of Xenopus laevis Albino embryos were collected at various stages for fixation, permeabilized with proteinase K and pre-hybridized. They were then hybridized overnight with digoxygenin-labeled riboprobes. Embryos were washed, treated with RNase A and Tl to remove background and blocked with Boehringer Mannheim Blocking Reagent. Embryos were incubated with alkaline phosphatase-conjugated anti-digoxygenin antibody for four hours at room temperature, washed extensively before chromogenic reaction with alkaline phosphatase substrate. Embryos were then re-fixed and de- stained to remove background for photography. Results: Expression profile.
- Results from in situ hybridization ( Figure 1) and developmental RT-PCR ( Figure 2) show that WA545 has no maternal transcript and is first expressed at late blastula in the entire marginal zone and in some of the vegetal cells.
- the expression level increases at the onset of gastrulation. This high level expression is maintained during gastrulation and starts to decline during late stages of gastrulation.
- WA545 expression is still present in lateral and ventral mesoderm but is excluded from the dorsal-most region which will form the notochord.
- the early expression of this gene in the entire marginal zone and later posterior restriction correlates well with the conclusion that WA545 is involved in induction of mesoderm with posterior characteristics and modification of neural tissue formation.
- Example 10 Whole embryo assay of WA545 Frog embryos were microinjected with 50pg or lOOpg in vitro synthesized, capped RNA at 2-cell or 4-cell stages. Beta-galactosidase RNA was included as lineage tracer to determine the extent of diffusion of the injected RNA. The product of the b-gal RNA was visualized histochemically, by X-gal staining. The target area of these micro-injections were dorsal marginal zone or ventral marginal zone of one of the 2 or 4 cells. Embryos were left to develop until desired stages before harvested for fixation, X-gal staining and photography. Results: WA545 gain-of-function phenotype in whole embryos.
- FIG. 3 Ventral microinjection of early embryos results in the formation of a secondary axis at later stages ( Figure 3). This secondary axis does not contain a head, implying that WA545 is an inducer of posterior mesoderm. Dorsal micro-injection of early embryos results in a loss of anterior structures ( Figure 4) including cement gland (chin), hatching gland, eyes, and forebrain. This observation indicates that WA545 may convert anterior to more posterior tissue.
- Embryos were micro-injected with 50 to 400pg capped RNA in animal pole of one cell at 2-cell stage. Globin RNA was used as a control. Embryos were left to develop until stage 8. Cells at the animal pole of embryos were microdissected
- RNA samples were pooled for total RNA preparation. 5 intact embryos were used for preparation of whole embryo control RNA. These RNA samples were reverse transcribed using random hexamer as primers for cDNA. These DNA samples were subjected to PCR using gene-specific primer pairs at the presence of 32 P-dCTP to assay for the presence of corresponding mRNAs in the original RNA samples. The primer pairs used and cycle number for each pair were optimized previously. The products of these PCR reactions were subsequently resolved on polyacrylamide gels. Results: Animal cap gain-of-function assay.
- WA545 is expressed from late blastula throughout the mesoderm and endoderm. It is later expressed in posterior mesoderm. It is able to efficiently induce posterior and lateral mesoderm, including muscle. Thus, WA545 may be involved in formation of posterior regions and may be useful for ectopic activation of muscle and spinal cord development.
- NAME LAZAR, STEVEN R.
- MOLECULE TYPE DNA (genomic)
- MOLECULE TYPE protein
- SEQUENCE DESCRIPTION SEQ ID NO : 2 :
- MOLECULE TYPE DNA (genomic)
- MOLECULE TYPE DNA (genomic)
- MOLECULE TYPE DNA (genomic)
- MOLECULE TYPE DNA (genomic)
- MOLECULE TYPE DNA (genomic)
- MOLECULE TYPE DNA (genomic)
- MOLECULE TYPE DNA (genomic)
- MOLECULE TYPE DNA (genomic)
Abstract
Description
Claims
Priority Applications (4)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CA002295086A CA2295086A1 (en) | 1997-07-10 | 1998-04-24 | Wa545 compositions |
AU71597/98A AU749878B2 (en) | 1997-07-10 | 1998-04-24 | WA545 compositions |
EP98918722A EP0998558A1 (en) | 1997-07-10 | 1998-04-24 | Wa545 compositions |
JP50862099A JP2002507896A (en) | 1997-07-10 | 1998-04-24 | WA545 composition |
Applications Claiming Priority (2)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
US89091897A | 1997-07-10 | 1997-07-10 | |
US08/890,918 | 1997-07-10 |
Publications (1)
Publication Number | Publication Date |
---|---|
WO1999002678A1 true WO1999002678A1 (en) | 1999-01-21 |
Family
ID=25397334
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
PCT/US1998/008334 WO1999002678A1 (en) | 1997-07-10 | 1998-04-24 | Wa545 compositions |
Country Status (5)
Country | Link |
---|---|
EP (1) | EP0998558A1 (en) |
JP (1) | JP2002507896A (en) |
AU (1) | AU749878B2 (en) |
CA (1) | CA2295086A1 (en) |
WO (1) | WO1999002678A1 (en) |
Citations (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO1994006449A2 (en) * | 1992-09-16 | 1994-03-31 | Creative Biomolecules, Inc. | Morphogen-induced liver regeneration |
US5536637A (en) * | 1993-04-07 | 1996-07-16 | Genetics Institute, Inc. | Method of screening for cDNA encoding novel secreted mammalian proteins in yeast |
Family Cites Families (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US5232664A (en) * | 1991-09-18 | 1993-08-03 | Ventana Medical Systems, Inc. | Liquid dispenser |
-
1998
- 1998-04-24 CA CA002295086A patent/CA2295086A1/en not_active Abandoned
- 1998-04-24 EP EP98918722A patent/EP0998558A1/en not_active Withdrawn
- 1998-04-24 AU AU71597/98A patent/AU749878B2/en not_active Ceased
- 1998-04-24 JP JP50862099A patent/JP2002507896A/en active Pending
- 1998-04-24 WO PCT/US1998/008334 patent/WO1999002678A1/en not_active Application Discontinuation
Patent Citations (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO1994006449A2 (en) * | 1992-09-16 | 1994-03-31 | Creative Biomolecules, Inc. | Morphogen-induced liver regeneration |
US5536637A (en) * | 1993-04-07 | 1996-07-16 | Genetics Institute, Inc. | Method of screening for cDNA encoding novel secreted mammalian proteins in yeast |
Non-Patent Citations (2)
Title |
---|
DALE L ET AL: "Secretion and mesoderm-inducing activity of the TGF-beta-related domain of Xenopus Vg1", EMBO JOURNAL., vol. 12, no. 12, 1993, pages 4471 - 4480, XP002075745 * |
WEEKS D ET AL: "A maternal mRNA localised to the vegetal hemisphere in Xenopus eggs codes for a growth factor related to TGF-beta", CELL, vol. 51, 1987, pages 861 - 867, XP000653563 * |
Also Published As
Publication number | Publication date |
---|---|
CA2295086A1 (en) | 1999-01-21 |
AU749878B2 (en) | 2002-07-04 |
EP0998558A1 (en) | 2000-05-10 |
AU7159798A (en) | 1999-02-08 |
JP2002507896A (en) | 2002-03-12 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
CA2265508C (en) | Bone morphogenetic protein-16 (bmp-16) compositions | |
US5846770A (en) | DNA molecules encoding human chordin | |
US5635372A (en) | BMP-15 compositions | |
EP0698094B1 (en) | Bmp-11 compositions | |
AU763470B2 (en) | Bone morphogenetic protein (BMP)-17 and BMP-18 compositions | |
EP1591526B1 (en) | Frazzled nucleotide sequences, expression products, compositions and uses | |
AU749878B2 (en) | WA545 compositions | |
AU763300B2 (en) | Bone morphogenetic protein-16 (BMP-16) compositions | |
CA2574929C (en) | Bone morphogenetic protein (bmp)-17 and bmp-18 and compositions | |
MXPA00000820A (en) | Wa545 compositions | |
AU4586402A (en) | Frazzled nucleotide sequences expression products compositions and uses | |
MXPA00005709A (en) | Bone morphogenetic protein (bmp)-17 and bmp-18 compositions |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
AK | Designated states |
Kind code of ref document: A1 Designated state(s): AL AM AT AU AZ BA BB BG BR BY CA CH CN CU CZ DE DK EE ES FI GB GE GH GM GW HU ID IL IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MD MG MK MN MW MX NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT UA UG UZ VN YU ZW |
|
AL | Designated countries for regional patents |
Kind code of ref document: A1 Designated state(s): GH GM KE LS MW SD SZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE BF BJ CF CG CI CM GA GN ML MR NE SN TD TG |
|
DFPE | Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101) | ||
121 | Ep: the epo has been informed by wipo that ep was designated in this application | ||
ENP | Entry into the national phase |
Ref document number: 2295086 Country of ref document: CA Ref country code: CA Ref document number: 2295086 Kind code of ref document: A Format of ref document f/p: F |
|
NENP | Non-entry into the national phase |
Ref country code: KR |
|
WWE | Wipo information: entry into national phase |
Ref document number: 1998918722 Country of ref document: EP |
|
WWE | Wipo information: entry into national phase |
Ref document number: PA/a/2000/000820 Country of ref document: MX |
|
WWE | Wipo information: entry into national phase |
Ref document number: 71597/98 Country of ref document: AU |
|
WWP | Wipo information: published in national office |
Ref document number: 1998918722 Country of ref document: EP |
|
REG | Reference to national code |
Ref country code: DE Ref legal event code: 8642 |
|
WWG | Wipo information: grant in national office |
Ref document number: 71597/98 Country of ref document: AU |
|
WWW | Wipo information: withdrawn in national office |
Ref document number: 1998918722 Country of ref document: EP |