WO1998057545A1 - Hypocholesterolemic compositions from bamboo shoots - Google Patents

Abstract

A composition for reducing cholesterol levels in a mammal is disclosed. This composition includes a phytosterol-containing extract isolated from bamboo shoot. Pharmaceutical and dietary supplements incorporating such compositions are also provided. Methods of making and using these compositions are also disclosed.

Description

HYPOCHOLESTEROLEMIC COMPOSITIONS FROM BAMBOO SHOOTS

CROSS-REFERENCE TO RELATED APPLICATIONS

This application claims priority to U.S. Provisional Application Nos. 60/049,861

filed June 17 1997 and 60/051,818 filed July 7, 1997 which are incorporated by reference

herein.

FIELD OF THE INVENTION

The present invention is a composition for lowering cholesterol levels in a

mammal. More particularly, the present invention is a phytosterol-containing extract

derived from bamboo shoots that lowers cholesterol by reducing or inhibiting cholesterol

absorption and cholesterol synthesis and/or increasing fecal excretion of neutral and acid

sterols. Methods of making and using such compositions are also provided.

BACKGROUND OF THE INVENTION

Cholesterol is associated with the pathogenesis of cardiovascular disease, which

is one of the leading causes of death in the United States and developed countries. (Galton

and Drone et al., 1991). Extensive epidemiological studies on the effect of cholesterol in

the body have been carried out in many populations in diverse countries over the past three

decades. Each study strongly suggests that a high blood cholesterol level, especially with

high levels of low density lipoprotein (LDL) cholesterol, is highly associated with

coronary heart disease (Goldstein and Brown, 1973). The cause of atherosclerosis, however, by high serum total and LDL-chθlesterol

concentrations is not fully understood. It may involve complex detrimental interactions

among lipoproteins, blood platelets, arterial endothelium, arterial smooth muscle cells, and

macrophages (Ross and Golmset, 1976). These detrimental interactions are enhanced by

many contributory genetic and environmental factors, including cigarette smoking, high

blood pressure, and diabetes mellitus, which make certain arterial segments more

susceptible than others (Sudhof et al., 1985).

One theory to explain atherosclerosis is known as the lipid oxidation theory.

According to this theory, LDL particles are particularly atherogenic because either or both

of their phospholipid and protein portions are chemically modified by, for example,

oxidation, acetylation or glycosylation (Cathcart et al., 1986). Such modifications appear

to occur largely in the walls of arteries. When these modified LDL particles are taken up

by activated monocytes via scavenger receptors, these cells become laden with cholesterol

(called foam cells) and develop a diminished motility. When cholesterol particles remain

in the arterial wall, they form atherosclerotic plaque. High density lipoprotein (HDL)

particles, however, appear either to reduce the oxidation of LDL in vivo or to remove the

oxidized portion of the LDL particles (Parthasarathy et al., 1990).

Mammalian cells have a variety of mechanisms for regulating the metabolism of

cholesterol. For example, cholesterol can be obtained from cellular metabolism via

biosynthesis from acetate precursors or by absorption mediated by a LDL receptor

pathway. The latter can be further subdivided into an exogenous (dietary cholesterol absorption) pathway and an endogenous (biliary cholesterol absorption) pathway-^Brown

et al., 1981). Cholesterol biosynthesis and the uptake pathways are closely related and

interdependent. Both pathways supply cholesterol to the body. Dietary cholesterol uptake

from the gastrointestinal tract, however, can influence the rate of body cholesterol

synthesis by a feed back mechanism (Dietschy et al., 1970). Overall, cholesterol from

exogenous and endogenous origins are presumed to be indistinguishable and appear to

have similar potential for affecting cholesterol homeostasis (Wilson and Rudel, 1994).

Three major functional tissues are involved in cholesterol metabolism: small

intestine, which is the major place for exogenous and endogenous cholesterol absorption;

liver, which is the dominate location for synthesizing cholesterol from acetyl-CoA; and

other extrahepatic tissues mainly for cholesterol catabolism. The normal catabolic route

for the disposal of cholesterol involves conversion of cholesterol into excretable bile acids

in the form of neutral and acid sterols (Brown et al., 1981).

Cholesterol homeostasis is regulated and maintained by three interrelated feed back

mechanisms: (1) through regulation of LDL receptor production; (2) through regulation

of 3-hydroxy-3-methylglutaryl-CoA (HMG-CoA) reductase and other enzymes in the

biosynthetic pathway; and (3) through regulation of cholesterol 7 alpha-hydroxylase in bile

acid synthesis (Brown and Goldstein, 1986). The key regulators in these feed back

mechanisms are LDL-cholesterol receptors, HMG-CoA reductase in cholesterol

biosynthesis, and cholesterol 7 alpha-hydroxylase in cholesterol catabolism (Brown and

Goldstein, 1986). To combat the devastating effects of high cholesterol levels in the body_? efforts

have been undertaken to reduce serum cholesterol levels. Traditionally, the focus on

lowering cholesterol levels has been on two approaches: (1) drug therapy and (2) dietary

modification.

Drug therapies are based on the fundamental mechanism of cholesterol metabolism

and homeostasis. For example, cholestyramine and colestipol are two common drugs (bile

acid resins) which have been used to treat hypercholesteremia. These drugs interrupt the

cholesterol enterohepatic circulation by stimulating cholesterol 7 alpha-hydroxylase

activity (Galton and Krone, 1991 ). Blocking endogenous cholesterol synthesis in liver and

peripheral tissues is another mechanism for treating hypercholesteremia. For example,

lovastatin, pravastatin and simvastatin are drugs that inhibit HMG-CoA reductase synthesis

by competing for receptors in the liver for endogenously produced HMG-CoA reductase

(Brown and Goldstein, 1986).

The use of drugs to treat hypercholesteremia, however, suffers from several draw

backs. For example, the body can become resistant to the drugs over time and may require

increasingly higher doses which may cause damage to the liver or other organ systems.

Such drugs may also cause undesirable side effects in patients and must be closely

monitored by a physician. Moreover, the drugs are expensive. Accordingly, the use of

these drugs is always a last resort. Thus, attempts have been made to design low

cholesterol diets to lower cholesterol levels in patients without having to resort to the more

extreme measures of conventional drug therapy as set forth above. For example, studies over the last four decades indicate that the effect of diet on the

risk of coronary heart disease is strong. In these studies, many dietary or food sources

have been extensively studied. These food sources include different types of fat, complex

and simple carbohydrates, animal and plant proteins, vitamins and minerals and different

types of dietary fibers.

Traditionally, studies of the effect of diet on serum cholesterol have focused on

medium-chain fatty acids, soluble fiber and dietary cholesterol. In recent years, great effort

has been expended to identify new cholesterol-lowering substances in fruits and

vegetables. Such fruits and vegetables contain many unique and complex organic

compounds, some of which are biologically active. In particular, certain phytochemicals

have been identified from fruits and vegetables which are biologically significant. An

example of such a phytochemical is a family of plant or vegetable sterols known as

phytosterols which are generally classified into three groups: 4-desmethylsterols, 4-

monomethylsterols and 4,4'-dimethylsterols. It is known that certain of these phytosterols

have a therapeutic effect on lipid metabolism.

Moreover, it is known that certain fruits and vegetables produce

hypocholesterolemic effects when consumed as part of a diet. Little research has been

published, however, on the physiologic effects produced by such fruits and vegetables. In

one study it was suggested that consumption of bamboo shoots in a diet reduced weight

and decreased serum cholesterol in rats (Chang 1993). In this study, the author attributed

these effects to the high fiber content of bamboo shoots. The present inventors, however, have demonstrated surprisingly that the cholesterol

lowering effect observed by Chang in 1993 is not caused by the fiber content of the

bamboo shoots. Rather, the inventors have discovered that the cholesterol lowering effect

is caused by phytosterols present in bamboo shoot.

Thus, it is an object of the present invention to provide a composition for lowering

cholesterol levels in a mammal that includes a phytosterol-containing extract isolated from

bamboo shoot. It is a further object of the present invention to provide pharmaceutical

compositions and dietary supplements that include phytosterol-containing extracts isolated

from bamboo shoots that are effective for lowering cholesterol levels in a mammal. It is

another object of the present invention to provide methods of making and using such

compositions for lowering cholesterol levels in a mammal. The present invention is

directed to meeting these and other needs.

SUMMARY OF THE INVENTION

The present invention is a composition for reducing cholesterol levels in a

mammal. This composition includes a phytosterol-containing extract isolated from

bamboo shoot.

Another embodiment of the present invention is a dietary supplement that includes

as an active agent a cholesterol lowering amount of a phytosterol-containing extract

isolated from bamboo shoot. A further embodiment of the invention is a pharmaceutically useful composition

that includes an extract containing one or more phytosterols isolated from bamboo shoots.

A further embodiment of the invention is a method for lowering cholesterol levels

in a mammal. This method includes administering to a mammal a composition that

includes an effective amount of a phytosterol-containing extract isolated from bamboo

shoots sufficient to lower cholesterol levels in the mammal.

The present invention also includes a method of making a composition for lowering

cholesterol levels in a mammal. This method includes obtaining an extract of phytosterols

from a source of bamboo shoots and combining the extract with a suitable delivery vehicle

for administering cholesterol-lowering amounts of the extract to the mammal.

Another embodiment of the present invention is a method for inhibiting cholesterol

absorption and/or increasing fecal excretion of neutral and acid steroids in a mammal. This

method includes administering to the mammal an effective amount of a composition

having as its primary active agent one or more phytosterols isolated as an extract from

bamboo shoots.

A further embodiment of the present invention is a method of inhibiting cholesterol

synthesis by administering to a mammal a cholesterol inhibiting amount of a composition.

This composition includes an extract containing one or more phytosterols isolated from

bamboo shoot. Another embodiment of the present invention is a method for reducing cholesterol

levels in a mammal. This method includes in combination inhibiting cholesterol

absorption and inhibiting cholesterol synthesis by administering to the mammal an

effective amount of a composition that includes an extract of one or more phytosterols

isolated from bamboo shoot.

Yet another embodiment of the present invention is a method for lowering

cholesterol levels in a mammal by reducing or inhibiting cholesterol synthesis and

cholesterol absorption. This method is achieved by administering to the mammal

cholesterol lowering amounts of bamboo shoots.

BRIEF DESCRIPTION OF THE DRAWINGS

For a fuller understanding of the invention, reference is had to the following

description taken in connection with the accompanying drawings in which:

FIG. 1 is an outline of the cholesterol biosynthesis pathway.

FIG. 2 is an outline of the pathway by which cholesterol is converted into the

primary bile acids.

FIG. 3 is a table showing the formulation of two embodiments of the present

invention and two control formulations. FIG. 4 is a table showing the cholesterol-lowering effects of two embodiments of

the present invention vs. control formulations in a hypercholesterolemic model in rat.

FIG. 5 is a table showing the effects on rat liver weights and liver lipid profile of

the formulations of FIG. 3.

FIG. 6 is graph of total cholesterol levels measured in rats comparing the

formulations of FIG. 3.

FIG. 7 is a table showing TDF, SDF, IDF and certain phytosterols contained in the

formulations of FIG. 3.

FIG. 8 is a table showing the effects of the formulations of FIG. 3 on fecal bile acid

steroids, neutral steroids and total steroids in rat.

FIG. 9 is a table showing the effects of the formulations of FIG. 3 on output of

certain fecal neutral phytosterols in rat.

FIG. 10 is a table showing the effects of the formulations of FIG. 3 on output of

certain neutral phytosterols in rat.

FIG 11 is a table showing the effects of the formulations of FIG. 3 on output of

certain fecal acid steroids in rat. FIG. 12 is a table showing the effects of the formulations of FIG. 3 on certain fecal

bile ratios in rat.

FIG. 13 is a process flow chart for the extraction and fractionation of compositions

of the present invention from bamboo shoot by liquid and lipid extraction.

FIG. 14 is a preparative reverse phase HPLC chromatogram of a crude bamboo

shoot methanol soluble fraction of FIG. 12.

FIG. 15 is a preparative normal phase HPLC chromatogram of a methanol insoluble

bamboo shoot fraction of FIG. 12.

FIG. 16 is a graph showing a dose response curve of the crude bamboo shoot

extract of FIG. 12 on Hep G2 cell cholesterol content.

FIG. 17 is a graph showing a time course study on the effect of the crude bamboo

shoot extract of FIG. 12 on Hep G2 cell cholesterol content.

FIG. 18 is a graph showing the effect of various fractions of FIG. 12 on Hep G2

cell cholesterol content.

FIG. 19 is an HPLC chromatogram of the methanol soluble fraction of FIG. 12. FIG. 20 is a gas chromatogram of the total crude extract of FIG. 12.

FIG. 21 is a gas chromatogram of the total methanol insoluble fraction of the total

crude extract of FIG. 12.

FIG. 22 is a table listing the phytosterols identified in the chromatogram of FIG 21.

FIG. 23 is a table listing major peak mass spectra of the phytosterols identified in

the chromatogram of FIG. 21.

FIG. 24 is an electron ionization mass spectrum of the FI fraction of the total

methanol soluble fraction of the total crude extract of FIG. 12.

FIG. 25 is the electron ionization mass spectrum of the F5 fraction of the total

methanol soluble fraction of the extract of FIG. 12.

FIG. 26 is a graph showing the effect of various fractions of the extract of FIG. 12

on the expression activity of HMG-CoA reductase in Hep G2 cells.

DETAILED DESCRIPTION OF THE INVENTION

The present invention includes a composition for reducing cholesterol levels in a

mammal. This composition includes a phytosterol-containing extract isolated from

bamboo shoot. As used herein, the term "phytosterol" includes the entire group of free phytosterols, phytosterol fatty acid esters and (acylated) phytosterol glucosides. The

present invention is based in part on the Ph.D. thesis of one of the applicants entitled "The

Hypocholesterolemic Effect of Bamboo Shoot In Vivo and In Vitro^'" submitted to The

Graduate School, New Brunswick of Rutgers, The State University of New Jersey the

entire contents of which is incorporated by reference.

As used herein, "reducing cholesterol levels" means that the present compositions

when administered to a mammal are able to reduce serum total cholesterol, LDL

cholesterol and total liver lipids. For purposes of the present invention, "total liver lipids"

includes liver cholesterol, as well as liver triglycerides.

As set forth in more detail in the examples infra, the active agent or agents in the

present compositions are derived from a crude extract of bamboo shoots. The crude extract

has been fractionated and analyzed for the presence of phytosterols. In particular, several

phytosterols have been identified in various fractions of the crude extract using

conventional analytical techniques, such as for example, gas chromatography-mass

spectrometry (GC-MS) and liquid chromatography-mass spectrometry (LC-MS). As set

forth in more detail in the examples, each fraction of the crude extract contains one or more

phytosterols.

Useful extracts of the present compositions contain a mixture of phytosterols

therein including, for example, sitosterol, sitastanol, stigmasterol and derivatives and

isomers thereof. The extracts of the present invention can also include, for example, beta- sitosterol, stigmasta-3,5-dien-7 one, stigmast-4-en-3-one, stigmasta-5,22-dien-3-ol,

campesterol, and derivatives and isomers thereof. For purposes of the present invention,

the term "derivatives" is intended to encompass all chemically modified versions of the

enumerated phytosterols which alone or in combination have a cholesterol lowering effect

when administered to a mammal. For example, chemically modified forms of phytosterols

that are useful in the present invention include esterified, glycosidic, saturated or

unsaturated and oxysterol forms thereof.

The term "bamboo" or "bamboo shoot" is used throughout the specification. For

purposes of the present invention, "bamboo" or "bamboo shoot" means species of bamboo

that belong to the family Gramineae (Yamaguchi, 1983), which is a perennial grass.

Bamboos have great variation in clump height and diameter. Bamboos are divided into

two classes on the basis of their vegetative growth habits: clump-forming types and

spreading types. The clump forming types of bamboo produce underground stems called

"rhizomes", which grow horizontally only a few inches from the base of the existing clump

and turn up to form very compact clumps. The spreading type of bamboo grow

horizontally several feet and form open clumps. The clump-forming bamboos generally

are tropical types, whereas, the spreading bamboos usually grow in temperate regions of

the world (Kennard and Freyne, 1957).

Bamboo shoots are underground sprouts of bamboo. Bamboo shoots are divided

into two categories, one comes from tropical clump bamboos, such as Bambusa oldhami

Nakai and Dendrocalamus latiflorus Munro; the other comes from temperate spreading bamboos, such as Phyllostachys edulis, P. pubescens, and P. makinoi (Hui, 1992).

The present compositions include phytosterols derived from bamboo shoot

obtained from a variety of bamboo species including, for example, Bambusa oldhami

Nakai, Bambusa edulis, Pseudosas usawai, Zizania latiflia, Saccharum officinarum,

Dendrocalamus latiflorus Munro, Phyllostachys edulis, Phyllostachys pubescens, and

Phyllostachys makinoi.

In the present invention, pharmaceutical compositions which lower cholesterol

levels in mammals can be formed from phytosterols extracted from bamboo shoot. These

compositions include a therapeutically effective amount of the crude phytosterol extract

and a pharmaceutically acceptable carrier or excipient. Such a carrier includes but is not

limited to saline, buffered saline, dextrose, water, glycerol, ethanol and combinations

thereof. The exact formulation, of course, will suit the mode of administration.

The pharmaceutical compositions of the present invention, if desired, can also

contain minor amounts of wetting or emulsifying agents or pH buffering agents. These

compositions can take various forms including, for example, solutions, suspensions,

emulsions, tablets, pills, capsules, sustained release formulations or powders. These

compositions can be formulated as a suppository with traditional binders and carriers, such

as triglycerides. Oral formulations are also contemplated and can include standard carriers,

such as pharmaceutical grades of mannitol, lactose, starch, magnesium stearate, sodium

saccharine, cellulose, magnesium carbonate, etc. These compositions can be formulated for intravenous administration to mammals.

Typically, compositions for intravenous administration are solutions in sterile isotonic

aqueous buffers. Where necessary, these pharmaceutical compositions may also include

a solubilizing agent and a local anesthetic, such as lidocaine to ease pain at the site of the

injection. Generally, the ingredients are supplied either separately or mixed together in

unit dosage form, for example, as a dry lyophilized powder or water free concentrate in a

hermetically sealed container, such as an ampule or sachette indicating the quantity of

active agent. Where the composition is to be administered by infusion, it can be dispensed

with an infusion bottle containing sterile pharmaceutical grade water or saline. Where the

composition is administered by injection, an ampule of sterile water or saline for injection

can be provided so that the ingredients may be mixed prior to administration.

The compositions of the present invention can be formulated as neutral or salt

forms. Pharmaceutically acceptable salts include those formed with free amino groups,

such as those derived from hydrochloric, phosphoric, acetic, oxalic, tartaric acids, etc. and

those formed with free carboxyl groups such as those derived from sodium, potassium,

ammonium, calcium, ferric hydroxides, isopropylamine, triethylamine, 2-ethylamino

ethanol, histidine, procaine, etc.

The amount of phytosterol extract which will be effective in the treatment of a

particular disorder or condition, such as for example, hypercholesteremia, will depend on

the nature of the disorder or condition, and can be determined by standard clinical

techniques. As used herein, "disorder" or "condition" can include, for example hypercholesteremia, cancer, in particular colon cancer, benign prostatic hyperplasia,

atherosclerosis caused by platelet aggregation and/or smooth muscle cell proliferation and

inflammation.

The precise dose to be employed in the formulation will also depend on the route

of administration and should be decided according to the judgment of a physician and each

patient's circumstances. Suitable dosage ranges for intravenous administration, however,

are generally about 20-500 micrograms of active compound per kilogram body weight.

Suitable dosage ranges for intranasal administration are generally about 0.01 pg/kg body

weight to 1 mg/kg body weight. Effective doses may be extrapolated from does response

curves derived from in vitro or animal model test systems.

Suppositories generally contain active ingredient in the range of 0.5% to 10% by

weight; oral formulations preferably contain 10% to 95% active ingredient.

The present compositions can also be incorporated into dietary supplements. Such

supplements include as an active ingredient effective amounts of the present composition

to lower cholesterol levels in a mammal. The formulation of dietary supplements is well

known in the art and can include a suitable carrier, as well as minor amounts of a variety

of materials including for example, wetting or emulsifying agents or pH buffering agents.

The specific formulation of the dietary supplements of the present invention will

vary depending upon a number of factors, including the sex and weight of the patient, as well as the severity of the disease. The dietary supplements of the present invention,

however, must include a sufficient amount of crude phytosterol extracts from bamboo

shoot to lower cholesterol levels in a patient. In particular, the extract in the supplement

must lower serum total cholesterol, LDL cholesterol, as well as total liver lipids, including

for example, liver cholesterol and liver triglycerides.

As set forth previously, the dietary supplement includes a crude extract that

contains one or more phytosterols derived from bamboo shoots. These extracts can

include, for example, sitosterol, sitastanol, stigmasterol and derivatives and isomers

thereof. The present extracts can also include, for example, a mixture of phytosterols

including beta-sitosterol, stigmasta-3,5-dien-7 one, stigmast-4-en-3-one, stigmasta-5,22-

dien-3-ol, campesterol, and derivatives and isomers thereof. For purposes of the present

invention, the term "derivatives" is intended to include chemically modified phytosterols

that maintain their ability to lower cholesterol in a mammal. Such derivatives include for

example, esterified, glycosidic, saturated or unsaturated and oxysterol forms of the

phytosterols found in the bamboo shoot extracts.

The present invention also includes a method for lowering cholesterol levels in a

mammal by administering to the mammal an effective amount of a phytosterol-containing

extract isolated from bamboo shoots sufficient to lower cholesterol levels. As used herein,

the term "mammal" includes humans, as well as other species.

Another embodiment of the present invention includes a method of making the compositions for lowering cholesterol levels in mammals as set forth above. This-method

includes obtaining an extract from a source of bamboo shoots that contains a mixture of

phytosterols and combining that extract with a suitable delivery vehicle for administering

cholesterol-lowering amounts of the extract to a mammal. The delivery vehicle can be any

physiologically appropriate carrier for administering the cholesterol lowering extracts of

the present invention to a mammal. These delivery vehicles have been described in detail

above and include both pharmaceutical preparations, as well as dietary supplements.

The mechanism by which the present compositions act in vivo to lower cholesterol

levels is poorly understood. Not wishing to be bound by any particular theory, Applicants

believe that the present compositions lower cholesterol levels in mammals through

inhibition of cholesterol absorption and/or modification of bile acid excretion. Another

possible mechanism involves the lipid metabolic and cholesterol synthetic pathways.

As set forth in more detail in the examples, Applicants have conducted in vivo

studies in a rat model of hypercholesteremia using preparations containing the presently

described phytosterol compositions at two different concentrations (15% and 30%,

respectively). These results indicate that the administration of bamboo shoot or extracts

thereof to hypercholesteremic rats significantly increase fecal cholesterol, coprostanol,

cholic acid and phytosterol output as compared to controls. In this model, a majority of

the bamboo shoot phytosterols appear to be absorbed while the rest were recovered in the

feces. As the results demonstrate, the lower concentration preparation (15% bamboo

shoot) significantly increased fecal chenodeoxycholic acid output indicating that the present compositions inhibit cholesterol absorption. The higher concentration preparation

(30% bamboo shoot) significantly increased cholic acid output indicating that the present

compositions also decrease cholesterol absorption while decreasing hepatic cholesterol

synthesis.

These results further indicate that phytosterols in bamboo shoot play a significant

role in reducing cholesterol levels in mammalian models, whereas dietary fiber plays a

relatively minor role. To the best of Applicants' knowledge, the data set forth herein

represent the first in vivo and in vitro demonstration of the cholesterol lowering effect

obtained with phytosterols derived from bamboo shoot. These data also show that the

present compositions significantly decrease the ratio of secondary bile acids to total bile

acids and the ratio of chenodeoxycholic acid to cholic acid. Accordingly, these data

indicate that the present compositions also play a key role in the health of the colon.

Accordingly, another embodiment of the present invention includes a method of

inhibiting cholesterol absorption and/or increasing fecal excretion of neutral and acid

steroids in a mammal. This method includes administering to a mammal an effective

amount of a composition having as its primary active agent one or more phytosterols

isolated as an extract from bamboo shoot as set forth previously.

In this method, the compositions of the present invention can be in any form

conveniently administered to a mammal. For example, the compositions can be

administered as a pharmaceutical preparation, a dietary supplement or as fresh or desiccated bamboo shoot consumed alone or in combination with food or drink. In

mammals, compositions administered according to this method decrease serum total and

LDL cholesterol, as well as total liver lipids, including for example, liver cholesterol and

liver triglycerides.

Another embodiment of the present invention includes inhibiting cholesterol

synthesis by administering to a mammal a cholesterol inhibiting amount of a composition

according to the present invention. As set forth previously, this composition includes an

extract containing one or more phytosterols isolated from bamboo shoot.

To further elucidate the biochemistry of the present compositions, bamboo shoot

was fractionated by column chromatography. When total crude bamboo shoot extract

isolated using column chromatography was applied to human hepatoma cells (Hep G2),

mRNA expression of HMG-CoA reductase was significantly decreased. HMG-CoA

reductase is the rate limiting enzyme in the cholesterol biosynthetic pathway which

converts acetyl CoA to mevalonate and further to cholesterol or to a number of non-sterol

isoprenoids (FIG. 1). Thus, it appears that the phytosterols present in such extracts are able

to prevent one or more enzymes in the cholesterol biosynthetic pathway from effectively

synthesizing cholesterol in vivo.

Surprisingly, it was found that only total crude bamboo shoot extract significantly

down regulated HMG-CoA reductase mRNA transcription in the Hep G2 cells. Moreover,

using liquid chromatography techniques including high pressure liquid chromatography (HPLC), as well as mass spectrometry, 17 phytosterols were identified, in the

chromatographed bamboo shoot samples. Not wishing to be bound by any particular

theory, it is believed that the presence of multiple phytosterols in the crude extract may

explain why the crude extract alone showed significant HMG-CoA reductase mRNA

synthesis down-regulation. In particular, the presence of multiple phytosterols in the crude

extract may function synergistically or act at multiple sites in the cholesterol biosynthetic

pathway to account for the HMG-CoA reductase mRNA synthesis down-regulation.

Among the 17 phytosterols observed by the inventors, 5 have been identified as

stigmasta-3 ,5-dien-7one, stigmast-4-en-3-one, beta-sitosterol, stigmasta-5,22-dien-3-ol and

campestrol. The phytosterols in the crude extract are structurally diverse. For example,

beta-sitosterol and campesterol are common sterols in plant leaves. Stigmasta-3, 5-dien-7-

one and stigmast-4-en-3-one are sterol derivative products which are post mevalonate

metabolites. Furthermore, two saturated phytosterols were found in the crude extract

which are believed to be isomers of sitostanol. To the best of Applicants' knowledge, the

observation of the presence of 17 phytosterols in bamboo shoot has never been reported.

Thus, a further embodiment of the present invention includes a method for reducing

cholesterol levels in a mammal. This method includes in combination, inhibiting

cholesterol absorption and inhibiting cholesterol synthesis by administering to the mammal

an effective amount of a composition according to the present invention. As set forth

above, this composition includes an extract of one or more phytosterols isolated from

bamboo shoot. In this method, cholesterol synthesis is inhibited by suppressing or decreasing

expression of one or more enzymes in the cholesterol biosynthesis pathway, such as, for

example by inhibiting HMG-CoA reductase mRNA activity. The present compositions

can be administered to a mammal in any convenient form, such as for example, as a

pharmaceutical or a dietary supplement together with any physiologically suitable carrier.

A further embodiment of the present invention is a method for lowering cholesterol

levels in a mammal by reducing or inhibiting cholesterol synthesis and cholesterol

absorption. This method includes administering to a mammal a cholesterol lowering

amount of bamboo shoots. In accordance with this method, the bamboo shoots are ground

into a powder using any conventional technique. The powder is then combined with a food

source, a dietary supplement or a pharmaceutical composition. In the present method, the

bamboo shoots are administered to a mammal in any convenient form, such as for

example, as a fresh food source or as a dried source.

The following examples are provided to further illustrate the compositions and

methods of using and preparing the present phytosterol-containing compositions, as well

as certain physical properties thereof. These examples are illustrative only and are not

intended to limit the scope of the invention in any way. EXAMPLE 1

Hypocholesterolemic Effect of Bamboo Shoot on Serum and Hepatic Lipids in the Rat

The objective of this experiment was to investigate the effects of dietary bamboo

shoot on lipid metabolism in the rat through the determination of plasma cholesterol and

liver lipids under hypercholesterolemic diet conditions.

Animals

Male adult Wistar rats (Charles River Laboratory, Wilmington, MA) weighing

about 200 grams were housed individually in stainless steel wire cages in a controlled

environment with 12-hr light and dark cycles plus low background noise and controlled

temperature (22+l°C). The duration of the study was for four weeks. Rats were fed ad

libitum, and had free access to tap water. A one week adjustment period preceded the

experimental phase. The rats were assigned to four dietary treatment groups (7 rats per

treatment) by selective randomization (blocked by weight, one rat per treatment group

from each block).

All rats were fed a semipurified diet and each treatment was controlled by adding

a different source of "fiber" (FIG. 3). The four treatment groups consisted of (1) a wheat

bran diet (containing 15%) wheat bran); (2) an oat bran diet (containing 15% oat bran); (3)

a bamboo shoot diet I (containing 15% by weight bamboo shoots); and a bamboo shoot

diet II (containing 30% bamboo shoots by weight). For this experiment diets (1) and (2)

above where controls and (3) and (4) represented formulations according to the present

invention. Diets

Wheat bran and oat bran were kindly provided as gifts by the Lauhoff Grain Co.

(Illinois) and the Quaker Oats Company (Illinois), respectively. Canned winter bamboo

shoots {Phyllostachys edulis) used in the study were processed by the Meiling Co. (China)

and purchased from a local supermarket. Water was drained from the canned winter

bamboo shoots. The shoots were then sliced and freeze-dried in the Food Science Pilot

Plant at Rutgers University. The dried shoots were ground through a 1 mm sieve Fitz mill

to a fine powder, sealed in glass jars and stored at -20°C for subsequent use.

The formulations of the four diets in FIG. 3 were based on the AIN 76A semi-

purified rodent diet. The experimental design is also based on a proximate analysis of the

three fiber sources, i.e., wheat brand, oat brand and bamboo shoot. These four diets were

blended and pelleted by Research Diets Inc., New Brunswick, NJ. The basic diet provided

a sufficient balance of nutrients for rats to maintain body weight.

Bile salt and cholesterol are necessary to enhance hypercholesterolemia in the

rodent model (Shinnick et al., 1988; Story et al., 1974). Thus, cholesterol (1%) and sodium

cholate (0.1%) were added to each formulation to make the diet hypercholesterolemic and

to elevate liver cholesterol concentrations. In some instances, cholesterol was fed to the

rats together with bile acids or bile salts.

Animals in each of the four treatment groups were provided with new food every

two days. Body weight and food intake were recorded three times a week. At the end of each experimental week, animals were deprived of feed for 16 hours and then blood was

drawn.

In particular, 1 ml of blood was drawn through the rat tail vein of each animal.

After allowing the blood to stand and clot for 30 min, it was centrifuged at 2,500 x g for

25 min. at 4 °C to obtain serum. Serum was immediately frozen at -70 C for future

analysis. At day 30, animals were weighed, blood was collected and serum was prepared.

All animals were then scarified for tissue collection. Livers were excised, rinsed, blotted,

weighed, and stored in dry ice. The liver samples were then divided into several one gram

samples and stored at - 70 °C for future analyses. Other tissues, such as kidney, heart,

spleen, adipose pad were also excised, rinsed, blotted, weighed and recorded.

Total serum cholesterol, high density lipoprotein (HDL) cholesterol, and

triglycerides were determined by enzymatic colorimetric methods for cholesterol, HDL and

triglycerides (diagnostic kit 0599, 0598, 2000, Stanbio Laboratory, Inc., San Antonio,

Texas). The value of low density lipoprotein (LDL) cholesterol was calculated by the

formula: (total Choi.) - (HDL) - (Triglycerides/5). Liver total lipid was determined by

extraction of total lipids by the gravimetric method (Folch et al., 1957). Liver cholesterol

was determined in aliquots (30 μl) of extract after evaporation under nitrogen and

solubilizing with Triton X- 100 (Carlson and Goldfarb 1977), using the same enzymatic kit

(# 0059) as for serum. Total liver triglycerides were determined as described by Fletcher

(1968). Data were statistically analyzed using Analysis of Variance and Scheffe's test by

using the statistic analysis system (SAS). Differences are considered significant at EO.05. We examined the effects of the four experimental diets on organ weights, -such as

heart, kidney, adipose pad, lung and spleen (FIG. 5). As documented in FIG. 5, only

bamboo shoot diet II (30% bamboo shoot) significantly lowered liver weight. No other

organ weight, however, was affected by the dietary treatment. Accordingly, these data

together with the data set forth in FIGS. 4 and 7 indicate that high dosages of bamboo

shoots are able to prevent liver lipid accumulation because of a reduction in liver

triglyceride and cholesterol.

Serum lipid profiles as a result of the four experimental diets are shown in FIG. 5.

Serum total cholesterol levels in both bamboo shoot treatment groups I and II (82 mg/dl

for bamboo shoot I diet, 64.5 mg/dl for bamboo shoot II diet) were significantly lower than

that of the two control treatments (128.7 mg/dl on the wheat bran diet and 117.9 mg/dl on

the oat bran diet). The two different bamboo shoot diets had significantly different impact

on total serum cholesterol levels. The high dosage bamboo shoot diet (30% bamboo

shoot) induced a higher (about 50%) reduction in total serum cholesterol as compared to

the value for the control fiber diets. Whereas, the lower bamboo shoot diet resulted in a

reduction (about 30%) in comparison to the fiber control diets.

The pattern of change in LDL-cholesterol in the four dietary treatments mimic

those of total cholesterol. LDL-cholesterol levels in bamboo shoot diet I (42.5 mg/dl) and

in bamboo shoot diet II (25.5 mg/dl) were significantly lower than those of the two control

treatments groups (89.2 mg/dl in wheat bran diet and 82.4 mg/dl in oat bran diet.)

( =0.001). The higher dose (30%) bamboo shoot diet II lowered the LDL-cholesterol by about 60%) and the lower dosage (15%) bamboo shoot diet I lowered the LDL-cholesterol

by 50%.

Serum HDL's were shown to be significantly different among the four treatments

(P=0.02). Both bamboo shoot treatment groups exhibited a slight but significantly higher

HDL level as compared with the oat bran control groups.

The HDLC/LDLC ratios in both bamboo shoot treatment groups (0.66 in bamboo

shoot diet I and 1.21 in bamboo shoot diet II) were significantly higher than those of oat

bran (0.29) and wheat bran (0.30). Since the HDL to LDL ratio is a clinical index of heart

protection, the significantly higher ratio of HDL to LDL in both bamboo shoot treatments

indicates that bamboo shoot is protective and the response is dose related. Triglyceride

values in the four treatments were not significantly different from each others (E=0.07).

2) Liver Lipids

Liver weight and lipid content per 100 g of fasting body weights are shown in FIG.

5. Rats fed the high dosage bamboo shoot diet (30%) had significantly lower liver weights

per 100 g of body weight compared to those of the other three treatment groups. Lower

liver weights were not attributable to lower feed intake or feed efficiency. The mean liver

weight in the bamboo shoot I diet was also lower than that of the other two control

treatments, but the value was not statistically significant. Total liver total lipid per lOOg of liver weight (17.8 g) was significantly lower in the

rats fed the bamboo shoot diet II. It appears that whereas the triglyceride component of

the total liver lipid does not change with high dosage bamboo shoot diet II, the cholesterol

levels are significantly changed. These data indicate that bamboo shoot, in a dose-

dependent manner, played an important role in reducing liver lipid content and preventing

cholesterol infiltration in the liver of cholesterol-fed rats.

3) Liver Triglycerides and Liver Cholesterol

Liver triglycerides were significantly lower in rats fed the bamboo shoot diet II

(43.6 mg/g) compared to controls. The triglyceride value for bamboo shoot diet I (63.4

mg/g) was not significantly different from the two control diets. Additional bamboo shoot

(increased dose) appears to lower liver triglycerides, as well as liver weight.

There were significant decreases in liver cholesterol in the bamboo shoot diet I (46

mg/g), and bamboo shoot diet II (24 mg/g) as compared to the control diets. This result

is consistent with earlier observations that the presence of dietary bamboo shoots

significantly decrease liver cholesterol content compared to control diets.

4) Total Serum Cholesterol Levels

Serum cholesterol concentrations changed over time in the four experimental

groups (FIG. 6). When 1% cholesterol and 0.1 % sodium cholate were added to the wheat

bran and oat bran diets, elevated serum cholesterol levels were observed, but bamboo shoot diets I and II inhibited this elevation.

As shown in FIG. 6, the effect of bamboo shoot diet I (BS I) on serum cholesterol

was flat at 80 mg/dl, indicating that this amount of bamboo shoot suppressed cholesterol

elevation expected with a hypercholesterolemic diet. Higher doses of bamboo shoots (BS

II - 30%) bamboo shoot) overcame the cholesterol and cholate addition and serum

cholesterol decreased.

EXAMPLE 2 Effect of Dietary Bamboo Shoot on Fecal Steroid Excretion in the Rat

Adult male Wistar rats were obtained, divided into 4 experimental groups and fed

4 different diets as set forth in FIG. 3 and described in detail in Example 1.

Preparation of Fecal Sample Neutral and Acid Sterols

Rat feces were collected for 7 consecutive days of the last week of the experiment

and stored at -20°C for further analysis. For sterol and bile acid extraction, fecal samples

from individual rats were weighed and dried, and ground in a homogenizer. Neutral and

acidic sterols were determined according to the methods of Grundy (1965), Miettinen and

Ahrens (1965), Miettinen et al, (1982) and Czubayko et al, (1991). Briefly, fecal samples

were thawed overnight and homogenized with distilled water (1:1, w/w). 1 mg 5 alpha-

cholestane (Fisher Scientific Co., Pittsburgh, PA) and 1 mg 23-nordeoxycholic acid (Fisher

Scientific Co., Pittsburgh, PA) were added to the feces samples as internal standards for neutral and acidic sterols, respectively. A 1 gram sample was hydrolyzed in mild alkali

(10 ml 1 N NaOH in 90% ethanol) for 1 hour in a water bath at 67°C. After the sample was

cooled to room temperature, 5 ml of water was added and the neutral sterols were extracted

3 times with 10 ml cyclohexane. The lower aqueous phase was stored for acidic sterol

analysis. Cyclohexane phases were combined and evaporated to dryness under a stream of

dry N₂. 1.5 ml of TMS-reagent (dry pyridine-hexamethyldisilazane-trichlorosilane, 9:3:1

(Supelco, Bellefonte, PA)] was added to the sample in order to convert it to trimethylsilyl

(TMS)-ether. After 30 min. at room temperature, the mixture was evaporated to dryness

under dry N₂. 2 ml of n-decane was used to dissolve TMS-derivatives, followed by a 10-

min centrifugation at 2000 U/min. A 1 ml sample was transferred to a glass vial for

subsequent gas-liquid chromatographic (GLC) analysis.

2 ml IO N NaOH was added to the lower aqueous phase. After heating for 3 h at

120°C, 5 ml H₂O was added to the mixture. After cooling to room temperature, the

samples were acidified to pH<l .5 with 25% HCl. The acidic sterols were extracted

three times with 10 ml diethyl ether. The combined ether phases were evaporated to

dryness under N₂. For methylation, 2 ml dried methanol, 1.4 ml dimethoxypropane, and

20 ul concentrated HCl were added to the sample. The sample was mixed thoroughly

and allowed to stand at room temperature for at least 1 h. After evaporation to dryness,

bile acids were derivatized to their respective TMS-ethers as described for neutral

sterols. 2 ml of n-decane was added to the sample, centrifuged and a 1.0 ml aliquot was

transferred to glass vials for GLC analysis. By comparing peak retention times (e.g., relative to 5 alpha-cholestane) in gas

chromatograms with those of pure commercial standards, four free fecal neutral sterols

and four free fecal acidic sterols were identified. No attempt was made to identify the

other peaks in the chromatogram representing keto- and other bile acids.

GLC analysis of neutral and acidic sterols

Gas chromatograph analysis of fecal neutral and acidic sterols was carried out on

a Hewlett Packard Gas Chromatograph model 5809. The chromatograph was equipped

with a hydrogen flame ionization detector. Hydrogen was used as carrier gas at a flow rate

of 2 ml/ min. Neutral and acidic sterols were separated on a 30-m fused silica capillary

column (BD-1, inner diameter of 0.32 mm, Chrompack, U.S.A). For optimal separation

of the relevant compounds, different temperature programs were selected for neutral and

acidic sterols (Czubayko et al., 1991).

The following parameters were used for analysis of neutral steroids:

Temp. Program: 100 °C for 3 min, 150 °C @ 10 °C /min, stay at 270°C for 40 minutes Inj. Temp: 265°C

Inlet pressure: 11 psi. FID temp: 325 °C Split Ratio: 1 :1

The following parameters were used for analysis of acidic steroids:

Temp. Program: 3 min at 150°C, 240°C @ 30°C /min (15 min), then 3°C/min to a final temperature of 270°C; Inj. Temp: 265°C

Inlet pressure: 15 psi FID temp: 325 °C

Split Ratio: 1 :1 Concentrations of different free fecal steroids were calculated from the -

appropriate neutral steroids (coprostanol, coprostanone, cholesterol, cholestanol,

sitosterol, and campesterol, stigmasterol) and acidic steroids (deoxycholic acid,

lithocholic acid, chenodeoxycholic acid, cholic acid).

Statistical Analyses

All data were expressed as mean ± SEM. Total fecal steroids, fecal bile acids

and fecal neutral sterols were calculated both as 7 day average output (mg/d) (FIG. 8)

and as average concentration (mg/g dry fecal weight) (data not shown). Statistical

differences were analyzed by analyses of variance and by Scheffe's test utilizing a SAS

program.

Fecal Weight

The average daily output of feces (dry weight) at the fourth week was 1.42 ±0.21

g/day on the wheat bran diet; 1.01 ± 0.14 g/day on the oat bran diet; 1.15 ± 0.17g/day on

the bamboo shoot diet I and 1.23 ± 0.19 g/day on the bamboo shoot diet II. Wheat bran

resulted in a significantly higher daily output of feces. The bamboo shoot diet II had a

concentration of insoluble fiber similar to that of the wheat bran fiber, however, the fecal

output was relatively lower. This may indicate that bamboo shoot fiber has a different

(lower) physiological impact compared to wheat bran fiber. Some studies report that the

wheat bran matrix structure rather than the quantity of insoluble hemicellulose is responsible for the increased fecal bulk (Kritchevsky and Story, 1993). Thus, the-data in

FIGS. 8-12 indicate that phytosterols rather than insoluble dietary fiber in bamboo shoot

have a key impact on fecal weight output.

Fecal neutral steroids

The effects of the 4 diets set forth in FIG. 3 on fecal steroid excretion (average

mg/day) and steroid concentration (average mg/g dry weight) in feces are summarized

in FIG. 8. Total fecal steroid output (g dry wt/d) was significantly higher in the rats fed

the diet supplemented with both dosages of bamboo shoot. With respect to fecal steroid

concentration, both bamboo shoot diets led to significantly higher fecal steroid

concentration compared with the control diets. Overall, the excretion of feces with

lower steroid concentrations occurred in rats supplemented with wheat bran.

As set forth above, data on the total output (mg/d) are shown in FIG. 8. Dietary

treatments with bamboo shoots and oat bran all resulted in higher fecal outputs of total

neutral steroids compared to rats fed the 15% wheat bran diet. Bamboo shoot diet II (30%)

resulted in significantly higher output of neutral steroids. Thus, in the rats fed a bamboo

shoot diet, the higher outputs of cholesterol and cholestanol can be attributed to the high

fecal neutral steroid output compared to rats fed control diets.

Moreover, it was found that fecal cholesterol increased from 26.0 mg/day to 30.0

mg/day in response to the low (15%) and high (30%) doses of bamboo shoots (data not

shown), suggesting that cholesterol is the major neutral steroid excreted. Daily outputs of both the bacterial metabolites coprostanol and coprostanone on both bamboo shoot diets

are significantly higher than that of wheat bran diet, suggesting that other compounds,

rather than the insoluble dietary fibers components, play an important role. Coprostanone

output is significantly (p< 0.001) increased in rats fed oat bran compared to the wheat bran

diet and the low dosage bamboo shoot diet. Compared to oat bran diet, the high dosage

bamboo shoot diet II had a higher daily output of the bacterial metabolite coprostanone.

This indicates that coprostanone is an important neutral steroid of oat bran. The difference

in the pattern (levels) of the neutral sterol excretion in different treatment groups indicates

that bamboo shoot has a different cholesterol absorption pattern compared to wheat bran

and oat bran. This result also suggests that bamboo shoot may have a effect on the

microbial floras of the gut compared to oat bran (soluble dietary fiber) and wheat bran

(insoluble dietary fiber).

FIG. 9 shows the phytosterol profile of three major plant sterols in feces. Rats in

both the bamboo shoot diet I and II groups had a significantly higher output of phytosterols

than that of the rats fed the control diets. As the data indicate, fecal sitosterol and

campesterol were major components in the feces of the four diet groups. The fecal

phytosterol level in bamboo shoot diet II is twice that of bamboo shoot diet II. This

increase is dose-dependent. The data indicate that phytosterols in bamboo shoot interfere

with neutral steroid absorption. Thus, phytosterols in bamboo shoots play a role in the

inhibition of cholesterol absorption.

With respect to fecal steroid concentration (FIG. 10), if fecal phytosterols are included, both bamboo shoot treatments induce a significantly higher total neutral -steroid

excretion than wheat bran. The high dosage bamboo shoot diet (30%) led to a high

concentration (and output) of fecal cholesterol compared with the control diets. This

indicates that the increasing dosages of bamboo shoot significantly inhibit neutral steroid

absorption. The wheat bran diet had the lowest fecal neutral steroid concentration

compared to the other three diets. This result may be due to the increased levels of

insoluble dietary fiber which in return, dilutes the intestinal contents.

Bile Acids

The composition of acidic steroids in feces - primarily bile acids and their

derivatives is summarized in FIG. 11. Rats fed both bamboo shoot diets I and II had

significantly higher outputs of fecal cholic acid (12.1 and 21.1 mg/d, respectively) as

compared to rats fed the control diets. This effect was dose dependent. Rats fed the oat

bran diet had the lowest cholic acid output (2.67 mg/d), but had the highest

chenodeoxycholic acid fecal output. Rats fed bamboo shoot diet I had a similar pattern of

chenodeoxycholic acid fecal output compared to the rats fed the oat bran diet. The

chenodeoxycholic acid fecal output (5.4 mg/d) in rats fed bamboo shoot diet II, however,

was significantly lower than rats fed bamboo shoot diet I, as well as rats fed the control

diets. This indicates that both phytosterol and dietary fiber in bamboo shoots affect bile

acid metabolism.

The data further indicate that high dosages of bamboo shoot may affect both endogenous and exogenous cholesterol. Bamboo shoot at a low dose (15%) may-be at a

l e v e l that j ust affe cts exo genous cho l e stero l .

For secondary bile acid, both bamboo shoot diets I and II and the oat bran diet led

to significantly lower lithocholic acid outputs compared to that of the wheat bran

treatment. For deoxy cholic acid, there was no differences observed among the four diets.

With wheat bran (insoluble fiber) and with oat bran (soluble fiber), there were

indications of altered bacterial production of secondary bile acids. Rats fed wheat bran had

significantly higher total bile acid output. Both bamboo shoot diets had less bile acid

output than that of wheat bran due to less output of secondary bile acids (lithocholic acid

and deoxycholic acid). Rats fed bamboo shoot diet II (30%) had a high primary bile acid

output, especially cholic acid (80% of total primary acid). This indicates that either cholic

acid was poorly absorbed and/or it was excreted from the intestine.

FIG. 12 shows the ratio of secondary bile acids (SB A) to total bile acid (TBA); the

chenodeoxycholic acid (CDCA)/cholic acid (CA) ratio and LCA (Lithocholic acid)/DCA

(Deoxycholic acid) ratio. Compared to that of wheat bran, the ratio of SBA to TBA is

significantly smaller in both bamboo shoot diets I and II. Compared to the oat bran diet,

the CDCA/CA ratio was significantly lower in both bamboo diets. There was no significant

difference observed among the four diets with respect to the LCA/DCA ratio.

In summary, these data indicate that dietary bamboo shoot in a hypercholesterolemic rat model significantly increased fecal cholesterol, coprostanol,

cholic acid and phytosterol outputs compared with that observed with wheat bran or oat

bran fiber control diets. Bamboo shoot diet I (15%) in the diet significantly increased fecal

chenodeoxycholic acid output, indicating that it inhibits cholesterol absorption. Bamboo

shoot diet II (30%>), however, significantly increased cholic acid output, indicating that

bamboo shoot affects both cholesterol absorption and hepatic cholesterol synthesis.

The data indicate that phytosterols in bamboo shoot play a key role in causing the

hypocholesterolemic effects observed for the bamboo shoot I and II diets. Dietary fiber in

bamboo shoot appears to play a minor role in lower cholesterol in the present model.

Furthermore, the bamboo shoot diets I and II significantly decreased the ratio of secondary

bile acids to total bile acid and the ratio of chenodeoxycholic acid to cholic acid,

suggesting that dietary bamboo shoot can benefit colon health.

EXAMPLE 3

Identification and In Vitro Evaluation of the Hypocholesterolemic Effect of Bamboo Shoot Phytosterols

The hypocholesterolemic effects of phytosterol extracts isolated from bamboo

shoots were evaluated in vitro on a human hepatoma cell line (Hep G2) that is an accepted

model for studying lipid metabolism, especially the expression of HMG-CoA reductase

in human hepatocytes. In particular, bamboo shoots were extracted and fractionated.

Certain of these fractions where then added to the Hep G2 cell lines and the expression

activity of HMG-CoA reductase mRNA evaluated using RT PCR. The extracted bamboo

fractions were also analyzed for content using HPLC techniques. All the tissue culture reagents including, RPMI 1640, fetal calf serum and

antibiotics - antimycotic were purchased from Gibco BRL (Gaithersburg, MD).

Restriction enzyme, T4 kinase, superscript II RNAse H^" reverse transcriptase and 5X first

stand buffer were also purchased from Gibco BRL. Hep G2 cells were purchased from

American Type Culture Collection (Rockville, MD). Random primer was from Promega

(Madison, WI). All of the chemicals used were purchased from Fisher Scientific

(Pittsburgh, PA).

Bamboo Shoots

Canned winter bamboo shoot {Phyllostachys edulis) was obtained and processed

as set forth in Example 1.

Cell Culture

Hep-G2 cells were cultured in RPMI 1640 containing 10% fetal bovine serum, 292

ug of glutamine/ml, 100 units of penicillin/ml and 100 ug of streptomycin/ml

supplemented with 10% fetal calf serum. The cells were incubated at 37 °C under a

humidified atmosphere of 95% air and 5 % CO₂.

The cells were seeded at a density of 20-30 x 10³ /cm² and were allowed to attach

to the plate for 24 hours. Bamboo shoot fractions (described in more detail below) were

applied daily to the cells with a fresh change of media. The control group received the

equivalent amount of medium in lieu of a fractionated bamboo shoot sample. All biochemical assays were performed using a standard format with 3 ml medium per 60 mm

tissue culture plate.

Preparation and Fractionation of Bamboo Shoot

The scheme for the bamboo shoot fractionation is shown in FIG. 13. Briefly, 10

grams of dry bamboo shoot powder were homogenized in 300-ml of distilled water for 30

minutes using a POLYTRON homogenizer. The solution was then filtered through a

vacuum filter with a coarse porosity (particle retention > 10 um) filter paper. The water

fraction was condensed in a rotary evaporator below 40°C. The water extraction (WE)

filtrates were stored at 4°C until biological screening (cell culture) and chemical (column

chromatography) assay could be carried out.

The remaining residues were further extracted with 300 ml of 100% ethanol for 4

hours. The extract was condensed to 100 ml by rotary evaporation and slightly saponified

with 5 ml of 50%) KOH, refluxed for 30 min with moderate stirring in a water cooled reflux

column on a water bath at 75 °C. This solution was extracted six times with 150 ml of

petroleum ether. The petroleum ether extract was condensed by evaporation and dried

under N₂. The crude saponified products (total crude fraction or TCE) were further

extracted with methanol and methylene chloride according to their polarity. After

condensation in a rotary evaporator below 40°C and drying under N₂ two semi-fractions

were obtained: total methanol soluble fraction (TMS) and total methanol insoluble, i.e.,

methylene chloride soluble fraction (TMIS). Fractions TMS and TMIS were further fractionated by reverse phase and normal phase column chromatography technologies,

respectively.

TMS was further fractionated into FI, F2, F3, F4 and F5 fractions and dried under

N₂. It was not possible to fractionate and isolate TMIS further because the chemical

structures of these compounds were too similar. Overall, 9 fractions were obtained for cell

culture screening and GC-MS and LC-MS analysis.

Fractionation of Bamboo Shoot Methanol Soluble Fraction by Column Chromatography and Analysis by HPLC and ApcI-LC-MS

The equipment used for fractionating the bamboo shoots is set forth below:

Varian VISTA 5500 HPLC Solvent Delivery System with a Variable Wavelength UV-VIS Detector, Retriever II Sample Collector and Varian 4290 Integrator

Fractionation Parameters:

Column: Microsorb C18 (Rainin Instrument Co., Inc., MA) dp=5 um, 250 mm x 4.6 mm (i.d.) Mobile phase: 100% methanol

Wavelength: 210 nm Flow rate (Pressure): 1.0 mL /min. Injection vol.: 200 u Collection: Manually collected every 4.2 minutes as peak eluted

Varian Vista 5500 HPLC Parameters:

Column: Microsorb C18 (Rainin Instrument Co. Inc., MA), dp=5 um, 250 mm x 4.6 mm (i.d.) Mobile phase: 100% methanol

Wavelength: 210 nm Flow rate (Pressure): 1.0 mL /min. Injection vol.: 5 wL for LC and LC-MS analysis

VG Platform II Quadrupole Mass Spectrometer parameters:

Masses Scanned (time): 150 - 800 amu (3.00 min.) Cone Voltage: 10 V

Corona discharge: 3.0 KV Source temperature: 150 °C Probe temperature: 450 °C Analyzer Pressure: 4.3 x 10 ^"5 torr Mode: AP⁺

Fractionation of Bamboo Shoot Methanol Insoluble Fraction (Methylene Chloride Soluble Fraction) by Column Chromatography and Analysis by GC and

GC-MS

Equipment Used:

Varian VISTA 5500 HPLC Solvent Delivery System with a Variable Wavelength

UV-VIS Detector and a Retriever II Sample Collector

Fractionation Parameters:

Column: Zorbax silica column (Dupont Instruments Co. Inc., DW), dp = 5 um,

150 mm x 4.6 mm (i.d.)

Mobile phase and Gradient:

A: Hexane

B: Acetone

Isocratic: 8% B Flow: 1.OmL/min. Injection Vol.: 250 uL Wavelength: 210 nm Attenuation: 64

Fractions: Manually collected as peak eluted

Varian 3400 GC Parameters: Column: DB-1, 30 m x 320 (i.d.) capillary column

Temp. Program: 100 °C for 3 min. 300°C @ 10°C/min, stay at 300°C for 20 min Inj. Temp: 265°C FID Temp: 325°C Split Ratio: 1 :1

Finnigan MAT 8230 Mass Spectrometer Parameters:

Masses Scanned: 35-550 amu

El-mode: 70 eV@ 1 mA GC-MS Interface line: 280°C

MS Inlet Temp.: 240°C

Ion Source Temp.: 280°C

Cell Membrane Sterol Analysis by GC

Preparation of Cell Membrane sterols

Hep G2 cell media was removed and the cells were washed with 2 ml of ice-cold

PBS (phosphate buffed saline) 3 times. After removal from the dishes, the cells were

suspended into 1 ml of 20-mM mannitol and 2 mM HEPES. The cell suspension was

sonicated on ice for 45 seconds at 50% duty cycle. The cell homogenate was stored in

small aliquots at -70°C for further analysis.

Measurement of Cell Cholesterol

Sterols were extracted from the membrane homogenates by the method of Bligh

and Dyer (1979) and quantified by gas liquid chromatography. An internal standard (5

alpha- cholestane) was added to the cell suspension before extraction. The gas

chromatograph (H&P GC 5809) was equipped with a flame ionization detector. The

injection port, detector and oven temperatures were maintained at 265 °C, 325 °C and 300 °C, respectively. Data were expressed per mg of membrane protein, which was-assayed

by the method of Bradford (1976) using Bio RAD Kit (Richmond, CA).

To determine cellular sterol content and composition, aliquots of cell homogenate

were saponified for 1 h with 10 ml of 1 N ethanolic NaOH using 5 alpha-cholestane as an

internal standard and sterol was extracted by using petroleum ether. The GC parameters

were as follows:

Column: DB-1, 30m x 320 um (i.d.) capillary column

Carrier Gas: Helium (20 ml/min) Temp. Program: 100°C for 3 min, 300°C @ 10°C/min, holding at 300 °C for 20 minutes Injection Temperature: 265 °C

Flame Ion Detection Temperature: 325°C Split Ratio: 1 :20

RT-PCR Determination of the Effect of Bamboo Shoot Crude Extraction on HMG- CoA Reductase mRNA

RT-PCR

The PT-PCR method used in the present invention is based on the method of Tian

et al. (1998) with a slight modification. Cells were incubated for three days in RPMI 1640

medium containing bamboo shoot extract. The total RNA was isolated from sample cells,

followed by washing and incubation with fresh RPMI 1640 for 15-min (Chomczynski and

Sacchi, 1987).

The PCR oligonucleotide primers used are set forth below:

For HMG Co A reductase- 1 : (GACAATCCTGGAGAAAACGCAC);

For HMG Co A reductase-2: (AGAACACAGCACGGAAAGAAC) These sequences correspond to the gene-specific primer pairs for human HMG-

CoA reductase. Both primer pairs cross introns. Amplification with human genomic DNA

as the template yielded no PCR products. The isolated RNA in each sample was

transcribed into first strand cDNA under the following conditions: 500 ng random primer,

lug total RNA, 4 u {5X) first strand buffer, 3 wL bamboo shoot extract, 2 wL 10 mM

dNTP mixture, 200 Unit Superscript II RNAse H^" reverse transcriptase. The reaction was

incubated at 42 °C for 60 minutes. Equal aliquots of the reverse-transcribed product were

amplified in the following PCR reaction containing: lx Taq buffer, 200 wM dNTP, 2wL of

reverse-transcribed product, 0.2 wM each of the primers. The thermal profile consisted of

92°C (45 s), 56°C (60 s), and 72°C (45 s) for 30 cycles. As precautions against

contamination, reverse-transcriptase minus and template minus controls were routinely

included in the PCR runs.

The PCR products were separated on 1.5% agarose gels and visualized by

ethidium bromide staining. The results were recorded on Polaroid Positive/Negative film,

and the intensity values were obtained by scanning with a densitometer (Biolmage, Ann

Arbor, MI).

Statistical Methods

Data were analyzed by a one-way ANOVA. In the case of comparisons, SAS

provided Scheffe's multiple comparison test. Fraction of Crude Bamboo Shoot Extract by LC Normal Phase and LC Reverse Phase

Utilizing HPLC reverse phase chromatography (FIG. 13), the methanol soluble

fraction was fractionated into 5 semi crude fractions. The location of these cuts is shown

FIG. 13. Fractions within a cut were combined to yield semi-crude fractions and were

labeled as fraction 1, 2, 3, 4 and 5, respectively. Each semi-crude fraction was

concentrated by rotary evaporation and blown to dryness with nitrogen at room

temperature. Fractions 1 and 2 were semisolid yellow oily residues. Fractions 3, 4 and 5

were solid and had a much lighter yellow color.

Further fractionation of the methanol soluble fraction (FIG. 15) (total methylene

chloride fraction) was not possible because the fractions were too close to each other to

permit collecting cuts.

Determination of the Optimal Dosage and Time Course of Crude Bamboo Shoot Extract on Cell Cholesterol Content

To evaluate the effect of bamboo shoot on Hep G2 cell cholesterol levels and

identify active phytochemicals, optimal dosages and time courses were determined using

the crude bamboo shoot extract.

To mirror the animal study conditions as closely as possible, the Hep G2 cells were

maintained in a serum cholesterol containing media. When crude bamboo shoot extract

was applied to Hep G2 cells, a significant reduction of cholesterol content occurred in a dose dependent manner.

Crude bamboo shoot extract significantly decreased cell cholesterol level at a

concentration of 77.5 mg/ml in 3 mL medium (FIG. 16).

As FIG. 17 demonstrates, cell cholesterol content was significantly decreased at

day 3 when 3 u bamboo shoot crude extract was applied and at day 2 when 9 u crude

bamboo shoot applied. Based on the data set forth in FIGS. 16 and 17 ', 3 wL and 3 days

were the optimal conditions chosen for subsequent cell culture evaluations.

The effects of the bamboo shoot fractions on Hep G2 cholesterol concentration {ug

/mg cell protein) is shown in FIG. 18. The amounts of the different fractions and the

physical properties of these fractions were quite different. Each sub-fraction contained

substantially equivalent concentrations of bamboo shoot crude extract.

Statistically, five out of nine bamboo shoot (BS) fractions significantly decreased

Hep G2 cell cholesterol content. These fractions corresponded to the methanol soluble

fraction, the methylene soluble fraction, the total crude bamboo shoot fraction and the

methanol soluble sub fractions 1 and 5 at a dosage of 3 wL per day. Fraction 2 and

Fraction 3 appeared to elevate cell cholesterol levels.

Using GC and LC-MS, the chemical composition of the active components of

each of the 5 fractions was partially identified as set forth below. Primary Determination of Chemical Structure of Five Active Fractions by GC, GC-MS and LC, LC-MS

FIG. 19 shows the HPLC chromatogram of the methanol soluble fraction of

bamboo shoot. Many compounds of intermediate polarity are evident.

FIGS. 20 and 21 are the GC chromatograms of total crude bamboo shoot extract

and methanol insoluble bamboo shoot extract, respectively. GC and GC-MS analysis

results are found in FIGS. 14 and 15, respectively.

These results reveal that bamboo shoot contains a significant amount (2% of dried

body weight) of phytosterols. Among these phytosterols, sitosterol and stigmasterol, their

derivatives and isomers are major components. As set forth previously, these data

represent the first demonstration of the phytosterol profiles in bamboo shoot.

Two GC-MS profiles of total crude bamboo shoot (FIGS. 23 and 21, respectively)

and the methylene insoluble bamboo shoot fraction (FIG. 20) indicate that there are

significant differences in the lipid profile between the two fractions. In addition to

phytosterols, major fatty acids, such as for example, linoleic and palmitic acid are present

in bamboo shoot (FIG. 20). It is believed that these phytosterols exist in the ester form.

Two GC-MS profiles of total crude bamboo shoot (FIG. 21) and the methylene

insoluble bamboo shoot fraction (FIG. 20) indicate that there are significant differences in

the lipid profile between the two fractions. In addition to phytosterols, major fatty acids,

such as linoleic and palmitic acid, are present in bamboo shoot. Again, it is believed that these phytosterols exist in the ester form.

The mass spectra of FI is shown in FIG. 24. Even though it was not possible to

fully characterize these compositions, it was evident that they were phytosterols. For

example, FI is a phytosterol with M⁺ at 414(100%)), the major peaks are at 55 (56%), 81

(35%), 95 (30%), 218 (10%), 234 (2.9%), 313 (3.5%), 396 (1.9%) and 414 (2.5%). F5

(FIG. 25) is a phytosterol with M⁺is at 414 (30%), the major peaks are at 396 (20%), 385

(18%), 313 (45%), 133 (64%), 95 (50%), 75 (68%), 43 (100%).

Surprisingly, only the total crude bamboo shoot extract significantly down

regulated the HMG-CoA reductase mRNA transcription (FIG. 26). These results indicate

that the bamboo shoot mixture, rather than any single fraction, down regulated HMG-CoA

reductase. Other fractions, however, such as for example, the methanol soluble fractions

or the methylene chloride fraction may be affecting other enzymes in the cholesterol

synthesis pathway.

In summary, the mass spectra data indicate that the identified compounds are a

mixture of plant sterols, oxygenated sterols and their ketone and aldehyde metabolites. The

active compounds are likely a series of ester forms of phytosterols. Only the crude bamboo

shoot extract (with both methanol soluble fraction and methylene chloride soluble fraction)

significantly decreased the cholesterol content (synthesis) in the Hep G2 cell line while

significantly down regulating HMG-CoA reductase mRNA expression. significantly decreased the cholesterol content (synthesis) in the Hep G2 cell line while

significantly down regulating HMG-CoA reductase mRNA expression.

The methanol soluble fraction (less polar) and the methylene chloride soluble

fraction (more non-polar fraction) both decreased the cell cholesterol level but had no

effect on cell HMG-CoA reductase mRNA expression.

The polar (water fraction) fraction had no effect on Hep G2 cell cholesterol activity.

One of the chemical differences between the crude bamboo shoot extract and the methanol

soluble fraction /methylene chloride soluble fraction was the presence of ester forms of the

sterol in the methanol soluble fraction. In the methylene chloride soluble fraction,

phytosterols exist in the hydrophobic form. In the methanol soluble fraction, part of the

sterols likely exist as an ester form (MSF1) and part of the sterols (methanol soluble

fraction F5) exist as a straight hydrophobic form.

These results show that bamboo shoot is an excellent source of phytosterols.

Activity for the present compositions has been demonstrated both in vivo (rat studies), as

well as in vitro (Hep G2 studies). Bamboo shoot non saponifiable sterols in the methanol

soluble fraction and the methylene chloride soluble fraction have hypocholesterolemic

properties. Through column fractionation and GC and LC-MS techniques, the effective

compounds were identified and confirmed to be phytosterols. No effect upon HMG-CoA

reductase transcription level, however, was observed for the individual fractions tested.

The down regulation of HMG-CoA reductase was surprisingly only observed in the crude bamboo shoot fraction, indicating that extracts of bamboo shoot may be the preferred

hypocholesterolemic agent compared with fractions thereof.

The invention being thus described, it will be obvious that the same may be varied

in many ways. Such variations are not to be regarded as a departure from the spirit and

scope of the invention and all such modifications are intended to be included within the

scope of the following claims.

Claims

WHAT IS CLAIMED IS:

1. A composition for reducing cholesterol levels in a mammal comprising a

phytosterol-containing extract isolated from bamboo shoot.

2. The composition of claim 1, wherein said cholesterol levels include serum

total cholesterol, LDL cholesterol and total liver lipids.

3. The composition of claim 2, wherein said total liver lipids include liver

cholesterol and liver triglycerides.

4. The composition of claim 1, wherein said extract is a crude extract.

5. The composition of claim 1, wherein said extract comprises one or more

fractions containing one or more phytosterols in each of said fractions.

6. The composition of claim 1, wherein said extract further comprises

sitosterol, sitostanol, stigmasterol and derivatives and isomers thereof.

7. The composition of claim 1, wherein said extract further comprises a

mixture of phytosterols including beta-sitosterol, stigmasta-3,5-dien-7 one, stigmast-4-en-

3-one, stigmasta-5,22-dien-3-ol, campesterol, and derivatives and isomers thereof.

8. The composition of claim 1 , further comprising chemically modified forms

of phytosterols including esterified, glycosidic, saturated or unsaturated and oxysterol forms thereof.

9. The composition of claim 1, wherein said bamboo shoot belongs to the

family Gramineae.

10. The composition of claim 1, wherein said bamboo shoot is selected from

the group consisting of Bambusa oldhami Nakai, Bambusa edulis, Pseudosas usawai,

Zizania latiflia, Saccharum officinarum, Dendrocalamus latiflorus Munro, Phyllostachys

edulis, Phyllostachys pubescens, and Phyllostachys makinoi.

11. A pharmaceutical composition comprising an effective cholesterol-lowering

amount of the extract of claim 1 together with a pharmaceutically acceptable carrier.

12. A dietary supplement comprising as an active agent a cholesterol lowering

amount of a phytosterol-containing extract isolated from bamboo shoot.

13. The dietary supplement of claim 12, wherein said extract lowers serum total

cholesterol, LDL cholesterol and total liver lipids.

14. The dietary supplement of claim 13, wherein said total liver lipids include

liver cholesterol and liver triglycerides

15. The dietary supplement of claim 12, wherein said extract is a crude extract.

16. The dietary supplement of claim 12, wherein said extract contains one or

more phytosterols.

17. The dietary supplement of claim 12, wherein said extract further comprises

sitosterol, sitostanol, stigmasterol and derivatives and isomers thereof.

18. The dietary supplement of claim 12, wherein said extract further comprises

a mixture of phytosterols including beta-sitosterol, stigmasta-3, 5 -dien-7 one, stigmast-4-

en-3-one, stigmasta-5,22-dien-3-ol, campesterol, and derivatives and isomers thereof.

19. The composition of claim 12, wherein said extract further comprising

chemically modified forms of said phytosterols including esterified, glycosidic, saturated

or unsaturated and oxysterol forms of said thereof.

20. A pharmaceutically useful composition comprising an extract containing

one or more phytosterols isolated from bamboo shoots.

21. The pharmaceutical composition of claim 20, further including

pharmaceutically acceptable derivatives and salts of said extract.

22. The pharmaceutical composition of claim 20, further comprising chemically

modified forms of said phytosterols including esterified, glycosidic, saturated or

unsaturated and oxysterol forms of said phytosterols.

23. A method for lowering cholesterol levels in a mammal comprising

administering to said mammal a composition comprising an effective amount of a

phytosterol-containing extract isolated from bamboo shoots sufficient to lower said

cholesterol levels.

24. A method of making a composition for lowering cholesterol levels in a

mammal comprising:

1 ) obtaining an extract of phytosterols from a source of bamboo shoots;

and

2) combining said extract with a suitable delivery vehicle for

administering cholesterol-lowering amounts of said extract to said mammal.

25. A method of inhibiting cholesterol absorption and/or increasing fecal

excretion of neutral and acid steroids in a mammal comprising administering to said

mammal an effective amount of a composition having as its primary active agent one or

more phytosterols isolated as an extract from bamboo shoots.

26. The method of claim 25, wherein said composition is a pharmaceutical or

a dietary supplement.

27. The method of claim 25, wherein composition decreases serum total and

LDL cholesterol and total liver lipids in said mammal.

28. The method of claim 27, wherein said total liver lipids further includes liver

cholesterol and liver triglycerides.

29. A method of inhibiting cholesterol synthesis by administering to a mammal

a cholesterol inhibiting amount of a composition comprising an extract containing one or

more phytosterols isolated from bamboo shoot.

30. A method for reducing cholesterol levels in a mammal comprising in

combination inhibiting cholesterol absoφtion and inhibiting cholesterol synthesis by

administering to said mammal an effective amount of a composition comprising an extract

of one or more phytosterols isolated from bamboo shoot.

31. The method of claim 30, wherein said composition inhibits said cholesterol

synthesis by suppressing or decreasing expression of one or more enzymes in the

cholesterol synthesis pathway.

32. The method of claim 31 , wherein said composition inhibits 3-hydroxy-3-

methylglutaryl-CoA (HMG-CoA) reductase mRNA activity.

33. The composition of claim 30, wherein said composition is a pharmaceutical

or dietary supplement in combination with a suitable carrier.

34. A method for lowering cholesterol levels in a mammal by reducing or inhibiting cholesterol synthesis and cholesterol absoφtion comprising administering to

said mammal cholesterol lowering amounts of bamboo shoots.

35. The method of claim 34, wherein said bamboo shoots are formed into a

powder and combined with a food source, a dietary supplement or a pharmaceutical

composition.

36. The method of claim 34, wherein bamboo shoots are fresh.

37. The method of claim 34, wherein said bamboo shoots are dried.