WO1998008857A1 - Solid phase synthesis - Google Patents
Solid phase synthesis Download PDFInfo
- Publication number
- WO1998008857A1 WO1998008857A1 PCT/SE1997/001418 SE9701418W WO9808857A1 WO 1998008857 A1 WO1998008857 A1 WO 1998008857A1 SE 9701418 W SE9701418 W SE 9701418W WO 9808857 A1 WO9808857 A1 WO 9808857A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- support
- synthesis
- support system
- oligonucleotides
- oligonucleotide
- Prior art date
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07H—SUGARS; DERIVATIVES THEREOF; NUCLEOSIDES; NUCLEOTIDES; NUCLEIC ACIDS
- C07H21/00—Compounds containing two or more mononucleotide units having separate phosphate or polyphosphate groups linked by saccharide radicals of nucleoside groups, e.g. nucleic acids
Definitions
- the present invention relates to a support system for solid phase synthesis of oligomers, such as oligonucleotides. Furthermore, the invention relates to a method for synthesis of oligonucleotides on a solid support.
- Oligonucleotides are polymers built up by polycondensation of ribonucleoside (RNA) or deoxyribonucleoside (DNA) phosphates .
- Oligonucleotides can be assembled by repetitive addition of nucleotide monomers using solid-phase methods. Since the introduction of solid-phase synthesis [R.B. Kerrifield, J .
- the solid support must be insoluble and preferably unswellable in the solvent used.
- the solid support must be chemically inert to all reagents used during synthesis and deprotection.
- the most commonly used supports are controlled pore glass beads (CPG) , silica, or polystyrene beads.
- the capping reagent is removed by washing
- the process is repeated until the desired oligonucleotide sequence has been synthesized. Afte synthesis, al. protecting groups are removed and the oligonucleotide is cleaved from the solid support.
- Preparative gel electrophoresis provides the best resolution for purification of oligonucleotides.
- the method is however laborious, often leading to considerable loss of material, and it is poorly suited for automation and scale-up.
- Chromatographic separation can solve some of these problems, offering a potential for scale-up with minimal losses and using fully automatized instruments. These positive aspects are off-set by the rather poor resolving power of most chromatographic systems.
- chromatographic separation of oligonucleotides labeled with affinity tags has been used.
- WO92/09615 there is described the use of an alkoxysilyl group as a linker of the oligonuciecti e to the support.
- This linker is inert during the synthetic cycles and it resists conditions that cleave apurinic sites.
- the linker is finally cleaved from the solid support with tetra butyl ammonium fluoride (TBAF) to obtain, after reversed-pha ⁇ e separation of DMTr-containing material, an oligonucleotide with both 3'- and 5'- ends intact.
- TBAF tetra butyl ammonium fluoride
- synthesis of this support was laborious and inconvenient . Due to lov; reactivity of the functional group of the linker the degree of substitution of the support becomes low which leads to insufficient nucleoside loadings of the support. Thus, this method is not suitable for preparation of support useful for large scale synthesis.
- the invention provides a support system for solid phase synthesis of oligomers.
- the support system comprises a support, a linker * and a starting compound of the oligomer.
- the starting compound is bound to the support via a disiloxyl linkage.
- Tne disiloxyl function is linked to a hydroxyl group on the support.
- the functional groups connected to the disiloxyl group are very reactive allowing for reproducible and controlled loading of the starting compounds.
- the support system of the invention is easier to produce compared to prior art systems and provides for high loadings to the support. According to the invention high loading values are obtained for the starting nucleoside. These loadings, often higher than 200 ⁇ mol/g, are required for cost-effective large scale synthesis.
- the linkage is inert during the synthesis cycles and resists conditions that cleave apurinic sites
- the starting compound is a nucleoside and the solid phase synthesis is used for the synthesis of oligonucleotides.
- Supports with immobilized oligonucleotides can be used as hybridization affinity matrices. Some possible applications of such supports are: purification of DNA-binding proteins, affinity purification of plasmids, as a support for gene assembly (from oligonucleotides) and for diagnostic purposes, etc.
- the first nucleoside is bound to the support via a disiloxyl linkage and the system is preferably represented by the following formula (I) .
- B is a ribonucle ⁇ side or deoxyribonucleoside base
- R2 is -H
- R7 is a protecting group
- R ⁇ is a protecting group
- R3 , R4 , R5, Re taken separately each represent alkyl, aryl, cycloalkyl, alkenyl, aralkyl, cycloalkylalkyl, alkyloxy, aryloxy, cycloalkyloxy, alkenyloxy and aralkyloxy
- Supp is a solid support
- X is an anchoring group used for covalent bonding to the support
- (p-Y) n and (p-Z) m are oligophosphotriester linkers, wherein p represents a phosphotriester, Y and Z are independently selected from a nucleoside and a rest of a diol,
- A is an alifatic or aromatic group
- n is a number between 0-50, preferably 0-10, and k, 1, m are each a number of 0 or 1, with the proviso that when m and n are 0 then
- the protecting groups Ri and R 7 are protecting groups usually used for protection of 5 'and 2' position of ribo- and deoxiribonucleosides Rj_ may bee selected from a tuty-., monomethoxy trityl, dimethoxytrityl , pixyl or other hignei alkoxy-substituted trityl- protecting groups
- R7 may bee selected from tertbutyldimehylsilyl (TBDM ⁇ , methoxytetrahydropyranoyl (MTHP) , tetrahydropyranoyl , methyl or allyl
- R3 , R , R5 , Rg are 1sopropy1.
- the choice of R3 , R 4 , R5, Rg is dictated by stability vs lability requirements of the disiloxyl linker It is known that these properties can easily be controlled by modifying electron donating parameters of tre ⁇ ubstitu ⁇ nts
- X can be any anchoring group, preferably O, S or an amide function, provided it is stable to the conditions used under synthesis and the reagent to cleave apurinic sites
- the sane proviso applies also to the (p-Y) n linker and (p-Z)n-.
- Y and Z there are no other restrictions on Y and Z
- a wide range of porous as well as non-porous solid supports can be used as supports m methods according to the present invention .
- the group of preferred supports includes cross linked polystyrenes , silica , polysaccharides , crosslmked polysaccharides and various glasses
- This linker gives improved contact between the starting nucleoside and an incoming reagent and ensures that also oligonucleotides starting from sites not intended for synthesis on tne support none the less contribute to the production of tne desired oligonucleotide.
- the invention provides a method for oligonucleotide synthesis on a solid support Supp.
- Tne method comprises the steps- d) preparing a support system as defined above, (n) condensation of nucleotides onto the first nucleoside of the support system to synthesize an oligonucleotide; (m) removal of all protecting groups on the oligonucleotide exept the 5 ' -protecting group, and cleavage of apurinic sites formed during acid-catalysed deprotection, (IV) cleavage of the full length product from the support, and (v) purification of the oligonucleotide
- step ( ⁇ ) an oligophosphotriester linker (p-Y)n 1S synthesized on the solid support and a starting nucleosi ⁇ e is bound to the linker via a (p-z)* ⁇ linkei ana a disiloxyl group
- the disiloxyl linkage is cleaved selectively according to known methods (Markiewicz W.T., 1979, Journal of Chemical Reserche (M) 0181-0197) with a compound containing fluoride ions, before step (v .
- a preferred fluoride containing compound is tetra alkyl ammonium fluoride. Trityl ammonium hydrogene fluoride is also suitable
- the purification is performed by reversed phase cnromatography, using the 5 ' -protectirg group as an affinity handle.
- step 'v is performed by exonuclease treatment whereby non-protected oligonucleotides will be digested.
- This embodiment is especially suitable fo. m situ synthesis where chromatography is ntt possible.
- Figure 2 shows the results of synthesis of a pu ⁇ ne rich (G )4Q oligonucleotide.
- A) A reverse phase HPLC chromatogram showing the trityl containing material. The product from a standard support appears as a much broader peak with a large proportion of material appearing later compared to the sharp and symmetrical peak from the novel support.
- B) Products collected from trie peaks in A were 5' labelled and separated o a denaturing polyacrylamide gel. An autoradiogra showing the oligonucleotide obtame ⁇ using a standard support on the top and material synthesized on the novel support belov;
- C and D The same gel as m B was scanned on a Phosphorimager (Molecular Dynamics) . The data are presented as line graphs with standard support m C and the novel support in D The n-1 and n-2 peaks are marked in C.
- Figure 3 shows circularizat ion of a 91-mer padlock probe.
- the terr "padlock probe” means a probe which s able to circularize on its target sequence and is described in Niisson, M., Mal gren, K , Samiotaki, K , K iatkowski, M , Chowdahry, B.P. and andegren, ⁇ . (1994) Science, 265
- This procedure comprises the following steps:
- the homobifunctional , readily available reagent 1 , 3 -dichloro-1 , 1 , 3 , 3 - tetraisopropyl disiloxane (2) (scheme 1) was used.
- the reagent used in the present invention has two reactive functions which enables high and controllable substitution.
- Controlled-pore glass (CPG) 1000 A was obtained from CPG Inc. (Fairfield, USA) and was ammopropylsilanized according to Pon et al . [Pon, 1993, supra] Crossl ked polystyrene particles (10 ⁇ m diameter) derivatized with hydroxylalkyl functions (Mono R) (from Pharmacia, Uppsala, Sweden) .
- Example 3 Construction of hydroxyalkyl-derivatized CPG support (14) (See Fig. 1)
- Asymmetrical anhydride (11) (see Scheme 2) was used for derivatization of aminopropylated CPG. The substitution level was analyzed based on DMTr cation release as described in [Gait, (ed) (1984) Oligonucleotide synthesis; a practical approach.. IRL Press] . CPG derivatized to the extent of 28 ⁇ mol/g was selected for further experiments. Several DNA synthesis columns were loaded with this support (ca 10 mg each) , and they were subjected to 10 coupling cycles with a standard thymidine amidite, followed by coupling of one of the nucleoside amidites (5) to obtain support (14) . These supports were used for oligonucleotide synthesis.
- the CPG support (14) described above was used for oligonucleotide synthesis. All couplings were performed using amidites protected by a benzoyl group at the exocyclic amine functions, under conditions recommended by the manufacturer for 0.2 ⁇ mol scale synthesis, except that nucleoside amidites were used at half the recommended concentrations. The final DMTr groups were left on the synthesized oligonucleotide.
- the cleavage of the disiloxyl linker could alternatively be done using 5 200 ml of 0.5 M TBAF in dry DMF at 65°C for 30 min.
- Concentrated aq. NH3 (2 ml) was introduced and the mixture was placed in a 65°C oven for 12 hrs. After partial concentration the oligonucleotide was desalted on a NAP 10 Sephadex column (Pharmacia Biotech AB) and analyzed by HPLC 0 on a RP 18 column.
- a 91-mer oligonucleotide (M13C91: 5'-P- GCCTGCAGGTCGACTCTAGA(T) 50CGGCCAGTGCCAAGCTTGCA-3 ' ) were synthesized according to the invention in order to test how it would work as a padlock probe [Nilsson et al (1994), supra] that is able to circularize presence of an oligonucleotide template (M1350comp: 5'- TTTTTCTAGAGTCGACCTGCAGGCATGCAAGCTTGGCACTGGCCGTTTTT-3 ' ) and a DNA- ligase.
- Fig. 3 The result of the ligation is shown Fig. 3 which clearly shows that all full-length oligonucleotides are ligatable as well as most of the n-1 products, as would be expected if the deletions were evenly distributed throughout the sequence. It also shows the presence of many shorter products that are ligatable and thus having intact 5'- and 3 ' - ends thereby revealing deletion events of more than one nucleotide. Consequently, all nonligating shorter sequences must contain deletions that prevent effective hybridization to the targed DNA.
- the present invention delivers products free of truncated and post-depurination cleaved fragments, morover, the isolated products contain much less n-1 fragments.
- the amount of this n-1 material was estimated, in a study performed on a short 5-mer sequence and using a standard synthesis protocol ([Iyer et al, (1995), 14(6) 1349-1357]), to be roughly 3 to 5 %.
- a standard synthesis protocol [Iyer et al, (1995), 14(6) 1349-1357]
- the support system of the present invention is not limited to the solid-phase synthesis of oligonucleotides described above. Another contemplated possibility is to use it as a linker between support and hydroxyl containing components in the combinatorial chemistry ( [Plunkett et al, (1995), J. Org. Chem. , 60(19), 6006-6007] ) .
Abstract
Description
Claims
Priority Applications (6)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CA002264154A CA2264154A1 (en) | 1996-08-30 | 1997-08-27 | Solid phase synthesis |
EP97936002A EP0925306B1 (en) | 1996-08-30 | 1997-08-27 | Solid phase synthesis |
AT97936002T ATE253074T1 (en) | 1996-08-30 | 1997-08-27 | SOLID PHASE SYNTHESIS |
JP51155998A JP2001505543A (en) | 1996-08-30 | 1997-08-27 | Solid phase synthesis method |
DE69725866T DE69725866T2 (en) | 1996-08-30 | 1997-08-27 | SOLID PHASE SYNTHESIS |
US09/254,048 US6291669B1 (en) | 1996-08-30 | 1997-08-27 | Solid phase synthesis |
Applications Claiming Priority (2)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
SE9603171A SE9603171D0 (en) | 1996-08-30 | 1996-08-30 | Solid phase synthesis |
SE9603171-1 | 1996-08-30 |
Related Child Applications (2)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
US09/254,048 A-371-Of-International US6291669B1 (en) | 1996-08-30 | 1997-08-27 | Solid phase synthesis |
US09/921,203 Division US6429309B1 (en) | 1996-08-30 | 2001-08-02 | Solid phase synthesis |
Publications (1)
Publication Number | Publication Date |
---|---|
WO1998008857A1 true WO1998008857A1 (en) | 1998-03-05 |
Family
ID=20403732
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
PCT/SE1997/001418 WO1998008857A1 (en) | 1996-08-30 | 1997-08-27 | Solid phase synthesis |
Country Status (9)
Country | Link |
---|---|
US (4) | US6291669B1 (en) |
EP (1) | EP0925306B1 (en) |
JP (1) | JP2001505543A (en) |
AT (1) | ATE253074T1 (en) |
CA (1) | CA2264154A1 (en) |
DE (1) | DE69725866T2 (en) |
ES (1) | ES2210555T3 (en) |
SE (1) | SE9603171D0 (en) |
WO (1) | WO1998008857A1 (en) |
Cited By (4)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO2001025247A1 (en) * | 1999-10-05 | 2001-04-12 | Quiatech Ab | Compounds for protecting hydroxyls and methods for their use |
WO2003066651A1 (en) * | 2002-02-08 | 2003-08-14 | Marek Kwiatkowski | Methods for separating oligonucleotides |
WO2004020449A1 (en) * | 2002-08-28 | 2004-03-11 | Quiatech Ab | Process for separating and deprotecting oligonucleotides |
EP1781808A1 (en) * | 2004-07-15 | 2007-05-09 | Lumigen, Inc. | Methods of using cleavable solid phases for isolating nucleic acids |
Families Citing this family (30)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
SE9603171D0 (en) | 1996-08-30 | 1996-08-30 | Marek Kwiatkowski | Solid phase synthesis |
US7572642B2 (en) * | 2001-04-18 | 2009-08-11 | Ambrigen, Llc | Assay based on particles, which specifically bind with targets in spatially distributed characteristic patterns |
US7297485B2 (en) * | 2001-10-15 | 2007-11-20 | Qiagen Gmbh | Method for nucleic acid amplification that results in low amplification bias |
US6617137B2 (en) | 2001-10-15 | 2003-09-09 | Molecular Staging Inc. | Method of amplifying whole genomes without subjecting the genome to denaturing conditions |
US6977148B2 (en) * | 2001-10-15 | 2005-12-20 | Qiagen Gmbh | Multiple displacement amplification |
WO2004011474A1 (en) * | 2002-07-31 | 2004-02-05 | Isis Pharmaceuticals, Inc. | Universal support media for synthesis of oligomeric compounds |
US20040242897A1 (en) * | 2002-07-31 | 2004-12-02 | Guzaev Andrei P. | Universal support media for synthesis of oligomeric compounds |
US6653468B1 (en) * | 2002-07-31 | 2003-11-25 | Isis Pharmaceuticals, Inc. | Universal support media for synthesis of oligomeric compounds |
US20040115643A1 (en) * | 2002-12-12 | 2004-06-17 | Lizardi Paul M. | Thermodynamic equilibrium extension of primers |
US7955795B2 (en) * | 2003-06-06 | 2011-06-07 | Qiagen Gmbh | Method of whole genome amplification with reduced artifact production |
CA2510587A1 (en) | 2002-12-20 | 2004-07-15 | Qiagen Gmbh | Nucleic acid amplification |
US9487823B2 (en) | 2002-12-20 | 2016-11-08 | Qiagen Gmbh | Nucleic acid amplification |
US7202264B2 (en) * | 2003-01-31 | 2007-04-10 | Isis Pharmaceuticals, Inc. | Supports for oligomer synthesis |
US8043834B2 (en) | 2003-03-31 | 2011-10-25 | Qiagen Gmbh | Universal reagents for rolling circle amplification and methods of use |
US20040248103A1 (en) * | 2003-06-04 | 2004-12-09 | Feaver William John | Proximity-mediated rolling circle amplification |
US20050130736A1 (en) * | 2003-12-12 | 2005-06-16 | Lottofone, Inc. | Prepaid wagering card |
WO2005113804A1 (en) * | 2004-05-20 | 2005-12-01 | Trillion Genomics Limited | Use of mass labelled probes to detect target nucleic acids using mass spectrometry |
US20060003651A1 (en) * | 2004-07-01 | 2006-01-05 | Building Materials Investment Corporation | Coating for granulated products to improve granule adhesion, staining, and tracking |
WO2006099537A2 (en) * | 2005-03-15 | 2006-09-21 | Applera Corporation | The use of antibody-surrogate antigen systems for detection of analytes |
US8309303B2 (en) | 2005-04-01 | 2012-11-13 | Qiagen Gmbh | Reverse transcription and amplification of RNA with simultaneous degradation of DNA |
EP1762627A1 (en) | 2005-09-09 | 2007-03-14 | Qiagen GmbH | Method for the activation of a nucleic acid for performing a polymerase reaction |
US20080057499A1 (en) * | 2006-02-06 | 2008-03-06 | Affymetrix, Inc. | Methods for high specificity whole genome amplification and hybridization |
CA2541567C (en) * | 2006-03-31 | 2012-07-17 | University Of Waterloo | Parallel soft spherical mimo receiver and decoding method |
AU2010208386B2 (en) | 2009-01-27 | 2016-08-11 | Qiagen Gaithersburg | Thermophilic helicase dependent amplification technology with endpoint homogenous fluorescent detection |
WO2011150227A1 (en) | 2010-05-26 | 2011-12-01 | Qiagen Gaithersburg, Inc. | Quantitative helicase assay |
US20140038182A1 (en) | 2012-07-17 | 2014-02-06 | Dna Logix, Inc. | Cooperative primers, probes, and applications thereof |
US10114015B2 (en) | 2013-03-13 | 2018-10-30 | Meso Scale Technologies, Llc. | Assay methods |
KR20220038550A (en) | 2013-03-13 | 2022-03-28 | 메소 스케일 테크놀러지즈, 엘엘시 | Improved assay methods |
KR20230022268A (en) | 2014-05-15 | 2023-02-14 | 메소 스케일 테크놀러지즈, 엘엘시 | Improved assay methods |
CN112105628A (en) | 2018-03-13 | 2020-12-18 | 耶路撒冷希伯来大学伊森姆研究发展有限公司 | High shear solid phase synthesis |
Citations (3)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO1992004364A1 (en) * | 1990-09-12 | 1992-03-19 | Sterling Winthrop Inc. | A method of linking nucleosides with a siloxane bridge |
WO1992009615A1 (en) * | 1990-11-26 | 1992-06-11 | Pharmacia Lkb Biotechnology Ab | Method and means for oligonucleotide synthesis |
WO1993013220A1 (en) * | 1991-12-24 | 1993-07-08 | Tepnel Medical Limited | Manipulating nucleic acid sequences |
Family Cites Families (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
SE9603171D0 (en) * | 1996-08-30 | 1996-08-30 | Marek Kwiatkowski | Solid phase synthesis |
-
1996
- 1996-08-30 SE SE9603171A patent/SE9603171D0/en unknown
-
1997
- 1997-08-27 ES ES97936002T patent/ES2210555T3/en not_active Expired - Lifetime
- 1997-08-27 CA CA002264154A patent/CA2264154A1/en not_active Abandoned
- 1997-08-27 JP JP51155998A patent/JP2001505543A/en not_active Abandoned
- 1997-08-27 WO PCT/SE1997/001418 patent/WO1998008857A1/en active IP Right Grant
- 1997-08-27 DE DE69725866T patent/DE69725866T2/en not_active Expired - Fee Related
- 1997-08-27 US US09/254,048 patent/US6291669B1/en not_active Expired - Fee Related
- 1997-08-27 EP EP97936002A patent/EP0925306B1/en not_active Expired - Lifetime
- 1997-08-27 AT AT97936002T patent/ATE253074T1/en not_active IP Right Cessation
-
2001
- 2001-08-02 US US09/921,203 patent/US6429309B1/en not_active Expired - Fee Related
-
2002
- 2002-03-25 US US10/106,832 patent/US6646118B2/en not_active Expired - Fee Related
-
2003
- 2003-10-14 US US10/685,331 patent/US20050027116A1/en not_active Abandoned
Patent Citations (3)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO1992004364A1 (en) * | 1990-09-12 | 1992-03-19 | Sterling Winthrop Inc. | A method of linking nucleosides with a siloxane bridge |
WO1992009615A1 (en) * | 1990-11-26 | 1992-06-11 | Pharmacia Lkb Biotechnology Ab | Method and means for oligonucleotide synthesis |
WO1993013220A1 (en) * | 1991-12-24 | 1993-07-08 | Tepnel Medical Limited | Manipulating nucleic acid sequences |
Cited By (11)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO2001025247A1 (en) * | 1999-10-05 | 2001-04-12 | Quiatech Ab | Compounds for protecting hydroxyls and methods for their use |
US6309836B1 (en) | 1999-10-05 | 2001-10-30 | Marek Kwiatkowski | Compounds for protecting hydroxyls and methods for their use |
US6639088B2 (en) | 1999-10-05 | 2003-10-28 | Quiatech Ab | Compounds for protecting hydroxyls and methods for their use |
US7279563B2 (en) | 1999-10-05 | 2007-10-09 | Helicos Biosciences Corporation | Compounds for protecting hydroxyls and methods for their use |
WO2003066651A1 (en) * | 2002-02-08 | 2003-08-14 | Marek Kwiatkowski | Methods for separating oligonucleotides |
WO2004020449A1 (en) * | 2002-08-28 | 2004-03-11 | Quiatech Ab | Process for separating and deprotecting oligonucleotides |
US7345163B2 (en) | 2002-08-28 | 2008-03-18 | Quiatech Ab | Process for separating and deprotecting oligonucleotides |
EP1781808A1 (en) * | 2004-07-15 | 2007-05-09 | Lumigen, Inc. | Methods of using cleavable solid phases for isolating nucleic acids |
EP1789578A2 (en) * | 2004-07-15 | 2007-05-30 | Lumigen, Inc. | Cleavable solid phases for isolating nucleic acids |
EP1781808A4 (en) * | 2004-07-15 | 2007-08-29 | Lumigen Inc | Methods of using cleavable solid phases for isolating nucleic acids |
EP1789578A4 (en) * | 2004-07-15 | 2008-02-27 | Nexgen Diagnostics Llc | Cleavable solid phases for isolating nucleic acids |
Also Published As
Publication number | Publication date |
---|---|
EP0925306A1 (en) | 1999-06-30 |
ATE253074T1 (en) | 2003-11-15 |
CA2264154A1 (en) | 1998-03-05 |
US6429309B1 (en) | 2002-08-06 |
ES2210555T3 (en) | 2004-07-01 |
US6291669B1 (en) | 2001-09-18 |
JP2001505543A (en) | 2001-04-24 |
DE69725866T2 (en) | 2004-09-09 |
EP0925306B1 (en) | 2003-10-29 |
US20020035247A1 (en) | 2002-03-21 |
US20050027116A1 (en) | 2005-02-03 |
US20020177698A1 (en) | 2002-11-28 |
SE9603171D0 (en) | 1996-08-30 |
DE69725866D1 (en) | 2003-12-04 |
US6646118B2 (en) | 2003-11-11 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
EP0925306B1 (en) | Solid phase synthesis | |
US4959463A (en) | Intermediates | |
US4659774A (en) | Support for solid-phase oligonucleotide synthesis | |
EP0514513B1 (en) | Method and means for oligonucleotide synthesis | |
EP0101985B1 (en) | Oligonucleotide derivatives and production thereof | |
AU712779C (en) | Method for solution phase synthesis of oligonucleotides | |
US5874532A (en) | Method for solution phase synthesis of oligonucleotides and peptides | |
US6001966A (en) | Method for solution phase synthesis of oligonucleotides and peptides | |
US5552539A (en) | Process for the synthesis of ribonucleic acid (RNA) using a novel deprotection reagent | |
US7098326B2 (en) | Methods for the integrated synthesis and purification of oligonucleotides | |
CA2424716A1 (en) | Process for producing multiple oligonucleotides on a solid support | |
US6153742A (en) | General process for the preparation of cyclic oligonucleotides | |
WO1989009780A1 (en) | Site-specific tritium-labeled oligodeoxynucleotides |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
AK | Designated states |
Kind code of ref document: A1 Designated state(s): CA JP US |
|
AL | Designated countries for regional patents |
Kind code of ref document: A1 Designated state(s): AT BE CH DE DK ES FI FR GB GR IE IT LU MC NL PT SE |
|
DFPE | Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101) | ||
121 | Ep: the epo has been informed by wipo that ep was designated in this application | ||
ENP | Entry into the national phase |
Ref document number: 2264154 Country of ref document: CA Ref country code: CA Ref document number: 2264154 Kind code of ref document: A Format of ref document f/p: F |
|
ENP | Entry into the national phase |
Ref country code: JP Ref document number: 1998 511559 Kind code of ref document: A Format of ref document f/p: F |
|
WWE | Wipo information: entry into national phase |
Ref document number: 1997936002 Country of ref document: EP |
|
WWP | Wipo information: published in national office |
Ref document number: 1997936002 Country of ref document: EP |
|
WWE | Wipo information: entry into national phase |
Ref document number: 09254048 Country of ref document: US |
|
WWG | Wipo information: grant in national office |
Ref document number: 1997936002 Country of ref document: EP |