WO1998003676A1 - Process for detecting effectors of intra- and/or intercellular protein-protein interactions - Google Patents

Process for detecting effectors of intra- and/or intercellular protein-protein interactions Download PDF

Info

Publication number
WO1998003676A1
WO1998003676A1 PCT/EP1997/003839 EP9703839W WO9803676A1 WO 1998003676 A1 WO1998003676 A1 WO 1998003676A1 EP 9703839 W EP9703839 W EP 9703839W WO 9803676 A1 WO9803676 A1 WO 9803676A1
Authority
WO
WIPO (PCT)
Prior art keywords
protein
ser
gin
hybrid
polypeptide
Prior art date
Application number
PCT/EP1997/003839
Other languages
German (de)
French (fr)
Inventor
Hanspaul Hagenmaier
Susanne Hagenmaier
Dieter Schrenk
Original Assignee
Hagenmaier Hans Paul
Susanne Hagenmaier
Dieter Schrenk
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Hagenmaier Hans Paul, Susanne Hagenmaier, Dieter Schrenk filed Critical Hagenmaier Hans Paul
Publication of WO1998003676A1 publication Critical patent/WO1998003676A1/en

Links

Classifications

    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/5005—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells
    • G01N33/5008—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics
    • G01N33/5014—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics for testing toxicity
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/10—Processes for the isolation, preparation or purification of DNA or RNA
    • C12N15/1034—Isolating an individual clone by screening libraries
    • C12N15/1055—Protein x Protein interaction, e.g. two hybrid selection
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/62—DNA sequences coding for fusion proteins
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/80—Vectors or expression systems specially adapted for eukaryotic hosts for fungi
    • C12N15/81—Vectors or expression systems specially adapted for eukaryotic hosts for fungi for yeasts
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6897—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids involving reporter genes operably linked to promoters
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/5005—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells
    • G01N33/5008—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/5005—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells
    • G01N33/5008—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics
    • G01N33/502—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics for testing non-proliferative effects
    • G01N33/5032—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics for testing non-proliferative effects on intercellular interactions
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2319/00—Fusion polypeptide
    • C07K2319/35—Fusion polypeptide containing a fusion for enhanced stability/folding during expression, e.g. fusions with chaperones or thioredoxin
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2319/00—Fusion polypeptide
    • C07K2319/61—Fusion polypeptide containing an enzyme fusion for detection (lacZ, luciferase)
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2319/00—Fusion polypeptide
    • C07K2319/70—Fusion polypeptide containing domain for protein-protein interaction
    • C07K2319/71—Fusion polypeptide containing domain for protein-protein interaction containing domain for transcriptional activaation, e.g. VP16
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2319/00—Fusion polypeptide
    • C07K2319/70—Fusion polypeptide containing domain for protein-protein interaction
    • C07K2319/735—Fusion polypeptide containing domain for protein-protein interaction containing a domain for self-assembly, e.g. a viral coat protein (includes phage display)
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2319/00—Fusion polypeptide
    • C07K2319/80—Fusion polypeptide containing a DNA binding domain, e.g. Lacl or Tet-repressor
    • C07K2319/81—Fusion polypeptide containing a DNA binding domain, e.g. Lacl or Tet-repressor containing a Zn-finger domain for DNA binding

Definitions

  • the invention relates to a genetic detection method for effectors of intra- and / or intercellular protein-protein interactions. It is particularly applicable in the context of the so-called stress screening for effectors of intra- and / or intercellular protein-protein interactions.
  • the detection method according to the invention can also be used in the search for and isolation of unknown effectors of already known intra- and / or intercellular interactions at the protein level.
  • the invention also relates to nucleic acid sequences and analysis kits which are required for carrying out the detection method according to the invention.
  • Protein-protein interactions and the stable or transient protein complexes formed in this way are of crucial importance in the entire biosphere.
  • the formation, development and reproduction of organisms at the most diverse stages of development would not be conceivable without protein-protein interactions.
  • Protein-protein interactions are central cuts in biochemical processes such as DNA replication, transcription and translation, secretory processes, signal transduction, cell metabolism and cell cycle.
  • the ability of protein-protein interactions to be influenced by effectors can be explained, for example, using the cytoskeleton of eukaryotic cells.
  • the cytoskeleton not only contributes to the stability of eukaryotic cells, but also performs other important functions, such as the transport of vesi- none, changes in cell shape as well as the movement of cells.
  • This dynamic structure is formed by three classes of filamentous assemblies: the microfilament, the intermediate filament and the microtubule. Microfilaments are formed by polymerizing a protein called actin.
  • actin The protein-protein interaction of actin proteins required for the polymerization can be inhibited, for example, by the fungal alkaloid cytochalasin B. Cyto-chalasin interferes with the assembly of the actin filaments by binding (capping) to the free end of the last actin protein, which is important for further polymerization.
  • TCDD dioxin 2,3,7,8-tetrachlorodibenzo-p-dioxin
  • TCDD and other dioxins are effective inducers of the transcription of a number of molecules at the molecular level
  • target genes encoding metabolic enzymes such as glutathione-S-transferase Ya, aldehyde dehydrogenase and quinone oxidoreductase (Landers, JP and Bunce, NJ (1991) Biochem. J. 276, 273 to 287).
  • Viruses are known to be pathogens for humans, animals and plants. They can cause relatively harmless illnesses like colds, but also life-threatening illnesses like polio or AIDS.
  • a virus is an intracellular parasite that can exist in two fundamentally different forms inside and outside a cell. The extracellular form is called virion or virus particle.
  • Virione consist of the viral genome, which with Proteins and sometimes associated with other chemical substances such as lipids. The proteins protect the genome from destruction in the extracellular space, allow entry into the host cell and often perform preliminary steps in the viral replication cycle. During the infection, the virion structure is largely or completely destroyed, so that the genome is freely available in the cell for transcription and replication.
  • virus particles which is made up of virus-coding proteins, the capsid, must be made up of one or a few different, repeating protein building blocks. This limitation is limited by the virus
  • the virion capsids have a basic blueprint with the following two properties: a) a narrow helix of undefined length with the genome in the center and b) a quasi-spherical icosaidric structure.
  • Virions of animal viruses can additionally differ due to the presence or absence of an outer membrane jacket. Virions that do not have this membrane envelope are called “naked”. Viruses that have this envelope, also called envelope, acquire it from the host's membrane using a two-step process called "budding”. First, viral glycoproteins are inserted into the membrane, which, by interacting with capsid proteins, coat the capsid with the membrane and release the finished virus particle to the outside.
  • capsid proteins associate with each other to form the capsid;
  • viral glycoproteins from the membrane of the infected cell interact with viral capsid proteins;
  • Virion proteins interact with cell surface antigens of the host cell to be infected.
  • the two-hybrid technique is a genetic method with which a protein-protein interaction is determined via the transcriptional activity of a hybrid protein complex produced in cell culture.
  • the technology is based on the modular structure of many site-specific transcription factors (transcription activators), consisting of a DNA binding domain and an activation domain.
  • transcription activators transcription activators
  • the two-hybrid technique is based on the observation that a direct covalent connection between these two domains is not required, but that a spatial proximity, caused by the interaction of any two other proteins, is sufficient to induce transcription.
  • it is necessary to construct two hybrid proteins and to express them together in a suitable host cell system, such as in yeast cells.
  • a sequence encoding a first protein involved in a protein-protein interaction is fused while maintaining the reading frame with the coding sequence of the DNA binding domain of the transcription factor, such as the yeast transcription factor GAL4, whereby the coding sequence for receives a first hybrid protein.
  • the coding sequence for a second hybrid protein is produced by fusing the coding sequence for the second protein involved in the interaction with the coding sequence for the activator domain of the transcription factor in the same reading frame.
  • a functional activator is generated in the host system after co-expression when the DNA binding domain and the activation domain come into spatial proximity due to the physical interactions between the two foreign protein components.
  • a reporter gene is expressed which is under the genetic control of an upstream activation sequence, such as GAL1 UAS, to which the DNA binding domain of the transcription factor binds.
  • the reconstitution of the function of the transcription factor caused by the interaction of the two foreign proteins thus causes the transcription of the reporter gene (such as lacZ or HIS 3).
  • the reporter gene such as lacZ or HIS 3
  • Its gene product, such as ⁇ -galactosidase can then be detected in a conventional manner.
  • the two-hybrid technique can also be used to detect those protein-protein interactions which are prevented in the presence of a known low molecular weight ligand (such as for example in the case of cyclosporin A) or only in the presence of the ligand (as in the case of rapamycin). Both works, however, have in common the search for a previously unknown protein binding partner. Without providing concrete examples, Chiu et al. that the two-hybrid technique could be used for tests with and the design of low molecular weight modulators of a protein-protein interaction, whereby the investigated modulators should have potential therapeutic value.
  • WO 95/26400 describes a method known as a reverse two-hybrid method which is intended to enable the search for molecules which inhibit protein-protein interactions.
  • the test system described therein is characterized in that a so-called signal inverter gene (or M relay gene ”) is used as an essential component in addition to the reporter gene. This measure is intended to prevent possible negative influences of cell toxins or translation inhibitors which could be present in a sample.
  • Screening procedures are usually one of them characterized in that the potential effector is not present as a pure substance but in a mixture with other compounds and in an extremely low concentration. This is particularly the case if new resources are examined for unknown effectors or if samples of the same type obtained in the same way are screened for a known effector.
  • the object of the present invention is therefore to provide a detection method for low-molecular effectors of intra- and / or intercellular protein-protein interactions, with the aid of which, in particular, mixtures of substances quickly and with high sensitivity to the presence of a known or unknown effector for a given protein protein - Interaction system can be examined.
  • the method according to the invention should be applicable in particular for so-called stress screening methods which can be used in the context of epidemiological studies.
  • the method according to the invention should also be suitable for carrying out so-called natural product screening methods in order to localize and subsequently analyze novel therapeutic active substances.
  • the object according to the invention is achieved by providing a genetic detection method for effectors of intra- and / or intercellular protein-protein interactions, wherein a) in a host cell in the presence of an analyte in which one suspects the effector function, two polypeptide hybrids A 1 A 2 and B- j ⁇ , whose domains A ⁇ and B- ⁇ together form a functional transcription-activator complex, if the domains A 2 and B 2 , which the intra- and / or intercellular interaction, as they for example takes place under physiological conditions, imitate, interact with one another, the interaction between the polypeptide domains A 2 and B 2 being observed only in the absence or presence of the effector function, ie at least one effector, in the analyte; and b) analyzed for expression of a reporter gene under the genetic control of an upstream transcription activation sequence to which the (in transcription activator complex formed in situ, expression of the reporter gene product indicating the presence or absence of the effector function in the an
  • Another object of the present invention relates to a method for isolating the effectors detected in this way and the new effectors of protein-protein interactions isolated using this method.
  • the invention relates also to nucleic acid sequences which encode the present invention used in the detection methods or hybrid proteins Polypeptidhybride A 1 A 2 and B ⁇ j. Finally, the invention relates to an analysis kit for carrying out the detection method according to the invention.
  • FIG. 1 shows the construction scheme of two expression vectors that can be used according to the invention before insertion of the coding sequence for the second hybrid protein component:
  • (A) shows the 5523 bp plasmid pGBT9, which contains the coding sequence for the DNA binding domain (bd) of the eukaryotic transcription activator GAL4.
  • (B) shows the 6659 bp plasmid pGAD424, which contains the coding sequence for the transcription activation domain (ad) of GAL4.
  • MSC stands for the multiple cloning site
  • p for the promoter
  • T for the telomerepression domain
  • Figure 2 shows the construction scheme of the expression vectors of Figure 1 after insertion of the coding sequence for the second hybrid protein component:
  • A illustrates the insertion of the coding sequence for the ARNT protein into the BamHI site of the MSC from pGBT9.
  • B shows the insertion of the coding sequence for the Ah protein into the Sall site of the MSC of pGAD424.
  • the detection method according to the invention offers the surprising advantage that effectors of a given protein-protein interaction can be detected qualitatively in an efficient manner, that is to say quickly and generally without separating the other low or high molecular weight components present in the analyte being examined.
  • a separation of the analyte or a further limitation of the effector is only necessary if it should be shown that more than one
  • effector of the protein-protein interaction in question is contained in the analyte or individual components of the analytes interfere with the test system.
  • the expert can easily determine the latter by means of a few control experiments.
  • the protein-protein interaction artificially induced in the test system according to the invention "imitates" or imitates the natural or physiological interaction insofar as at least the binding specificity of the interacting protein components observed under natural or physiological conditions is essentially retained in the test system.
  • the strength of the interaction in the test system can vary compared to the physiological process. It is therefore essential that the protein-protein interaction takes place functionally equivalent to the natural or physiological interaction under the test conditions.
  • the protein-protein interaction specified according to the present invention is of course not restricted to pure proteins or polypeptides.
  • the invention is also applicable to those interactions in which, for example, glycoproteins or lipoproteins are involved.
  • Test systems which can be used according to the invention can moreover not only be established as binding partners with complete proteins. Rather, functional equivalents, such as fragments, mutants and other derivatives, are also factors involved in the native protein-protein interaction.
  • Functional fragments can include partial sequences, such as certain domains, of the factor to which the binding function required for the interaction is located. Suitable fragments can be generated, for example, by genetic engineering or in the classical manner by enzymatic or chemical fragmentation.
  • Functional equivalents according to the invention also include derivatives of the binding partners generated by amino acid substitution, addition, insertion and / or deletion while maintaining the binding specificity, for example genetically or chemically.
  • the effector or modulator to be detected is preferably a low-molecular component which initiates, stimulates or inhibits the protein-protein interaction. So it can be a positive or negative effector of the interaction.
  • the analyte to be investigated according to the invention is preferably a mixture of substances, it being assumed that at least one of these substances has a positive or negative effector function on the predetermined protein-protein interaction.
  • This active substance is particularly preferably a low-molecular inorganic, preferably organic compound.
  • the molecular weight of the effector can be up to about 5000 g / mol, such as up to 2000 g / mol, and e.g. are in the range of about 10 to 1000 g / mol.
  • the analyte investigated according to the invention is selected, for example, from body fluid samples, such as whole blood, breast milk, cerebrospinal fluid, saliva and urine.
  • extracts or homogenates of procaryotic or eukaryotic cells such as bacterial homogenates, homogenates from plant cells or homogenates from lower eukaryotes, such as yeasts, or higher eukaryotes, such as animal or human cells, can be examined with the method according to the invention.
  • procaryotic or eukaryotic cells such as bacterial homogenates, homogenates from plant cells or homogenates from lower eukaryotes, such as yeasts, or higher eukaryotes, such as animal or human cells.
  • higher molecular components such as cell fragments, organo-le, or macromolecules, such as proteins and nucleic acids. separate.
  • Environmental analytical samples such as e.g. Water, air and soil samples, residues from industrial plants, e.g. liquid or solid special waste, filter dust from flue gas filter systems.
  • Food samples can also be analyzed according to the invention.
  • reaction mixtures of chemical syntheses if appropriate after suitable preparation, such as Exchange of solvent, concentration or dilution, to examine for effector function.
  • Reporter genes which can be used according to the invention for various host cell systems are known to the person skilled in the art from the specialist literature cited above, to which reference is hereby made. Examples are lacZ from E. coli and HIS3 and LEU2 from yeast. The only decisive factor is that the expression of the reporter gene allows the presence of an effector of the protein-protein interaction in the analyte examined in each case to be specifically indicated.
  • the predetermined intra- and / or intercellular protein-protein interaction is a process that occurs under physiological conditions in prokaryotic, e.g. bacterial cell systems, in eukaryotic cells, e.g. Yeast cells or human cells, or in viral microorganisms or in the interaction of different of these cell systems, e.g. an interaction of viral proteins with eukaryotic proteins takes place.
  • prokaryotic e.g. bacterial cell systems
  • eukaryotic cells e.g. Yeast cells or human cells
  • viral microorganisms e.g. an interaction of viral proteins with eukaryotic proteins takes place.
  • Test system in particular the host cells to be transformed, can mimic the protein-protein interaction under as physiological conditions as possible.
  • different types of protein-protein interactions can be used.
  • a first embodiment of the method according to the invention is based on such interactions that only occur when an effector is present in the analyte.
  • a po- Positive detection of the protein-protein interaction is therefore synonymous with positive effector detection.
  • the effector acts as a mediator or activator of the interaction.
  • Such a system is therefore particularly suitable for screening for mediators which initiate or stimulate a protein-protein interaction.
  • inhibitors of the interaction can also be detected.
  • a known mediator can be used in the test system and an analyte can be tested for the presence of an inhibitor of the mediator-dependent interaction, the inhibitor competing with the mediator, for example competitively, for binding to one of the protein components of the test system.
  • a second embodiment is based on interactions that are prevented in the presence of an effector.
  • a positive detection of the protein-protein interaction is then synonymous with a negative effector detection. If no protein-protein interaction is detectable, this indicates the presence of an inhibitor of the interaction in the analyte.
  • the methods according to the invention are preferably carried out in such a way that a first and a second nucleic acid sequence are introduced into a suitable prokaryotic or eukaryotic host cell system, the first nucleic acid sequence coding for the polypeptide hybrid A 1 A 2 , which codes the transcriptional Activation domain A j of the transcription factor, such as GAL4, and the polypeptide domain A 2 ; and the second nucleic acid sequence encodes the polypeptide hybrid B 1 B, which comprises the DNA binding domain B of a transcription factor, such as GAL4, and the polypeptide domain B 2 .
  • the two nucleic acid sequences can be present separately from one another or can be located on a single polynucleotide chain.
  • the sequences are introduced using known standard methods, preferably by transforming the host with a suitable vector.
  • (A 1 A 2 / B 1 B 2 ) essentially corresponds to the native transcription activator from which the hybrid protein domains A and B- ⁇ are derived.
  • Functional equivalents of these domains can also be used, which can be produced by amino acid addition, deletion and / or substitution while maintaining the characteristic properties, such as binding specificity and activation specificity, by genetic engineering or in another manner.
  • the analyte can be added to the test system before, with or after the introduction of the nucleic acid sequences.
  • the most suitable procedure for the particular analyte can easily be determined by a person skilled in the art on the basis of a few preliminary tests.
  • suitable solvents are unbuffered or buffered aqueous solutions, which may contain a solubilizer, such as e.g. an organic solvent, such as DMSO, or a cationic, anionic or nonionic surface-active compound, e.g. long chain fatty acids or salts thereof.
  • the host cell system can be applied or fixed to a solid or semi-solid support, such as, for example, poly beads or agar gels.
  • a solid or semi-solid support such as, for example, poly beads or agar gels.
  • the detection method according to the invention with host cells in suspended form. This is particularly suitable for screening procedures.
  • a fresh transformed host cell culture is prepared, the cell suspension is incubated with the analyte, if appropriate with gentle heating and / or gentle shaking or stirring.
  • the incubation time can vary over a wide range and can be, for example, 1 minute to 24 hours.
  • the detection of expression of the reporter gene is carried out.
  • effectors of cell-physiological interactions between proteins that can be detected in or between eukaryotic or prokaryotic cells, in virus particles or between virus particles articles and eukaryotic cells can in principle be a well-characterized, known substance or a substance not previously described in the specialist world.
  • 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD) can be mentioned as a preferred example of an effector which influences a cell-physiological process which takes place in eukaryotic cells.
  • TCDD 2,3,7,8-tetrachlorodibenzo-p-dioxin
  • the cellular dioxin receptor system is a typical example of a signal-controlled dimerization of basic helix-loop-helix (bHLH) factors.
  • the cytosolic receptor molecule Before binding a Dioxin molecule, the cytosolic receptor molecule is composed of three subunits: the dioxin-binding Ah receptor and two molecules of the 90 kDa heat shock protein HSP90.
  • the HSP90 subunits have the function of keeping the Ah receptor in an inactive state in the absence of a ligand.
  • the two HSP90 molecules dissociate from the Ah receptor, which activates it and enables it to bind to the so-called Arnt protein.
  • the dioxin-laden complex thus formed is then capable of translocation from the cytosol into the cell nucleus.
  • XRE Xenobiotic responsible Element
  • a 2 is the first hybrid protein domain uses the Ah receptor or a binding fragment thereof and uses either HSP 90 or ds Arnt protein or a binding fragment of one of the two factors as the second hybrid protein domain B.
  • Nucleic acid and amino acid sequences of the Ah receptor, the HSP 90 and the Arnt protein are known from the prior art, so that the nucleic acid sequences required for carrying out the test for the production of the two polypeptide hybrids A 1 A 2 and B j ⁇ B- j can be easily provided.
  • two different test systems are conceivable for the dioxin detection according to the invention.
  • the binding of the dioxin molecule to the Ah receptor removes a protein-protein interaction, which has the consequence that the Expression of the reporter gene is prevented.
  • a binding of the dioxin molecule to the Ah receptor builds up a protein-protein interaction so that the expression of a reporter gene can be detected in the test system.
  • Two-hybrid test systems which have already been established for protein-protein binding tests, can be used to carry out the dioxin detection. For example, under the trade name MATCHMAKER Two Hybrid System from Clontech Laboratories Inc., Paolo
  • the system comprises two different expression vectors (pGBT9 and pGAD424), which genes for the DNA binding domain (pGBT9) and for the activation domain (pGAD424) of the yeast transcription - wear factor GAL4.
  • the pGBT vector is used to produce a first nucleic acid sequence which, for a hybrid, consists of a Gal4 DNA binding domain and Arnt protein.
  • a PCR polymerase chain reaction
  • H3 and H4 of the following sequence is to be constructed in vector:
  • H3 5'CGGGATCCCCGAAATGACATCAGATGT (SEQ ID NO: 3)
  • H4 5'CGGGATCCACCTGCTGGGCAGAAAAG (SEQ ID NO: 4)
  • the specific primers allow amplification of the Arnt reading frame with BamHI cleavage sites at its 5 'and 3' ends.
  • the ligation with the BamHI-treated pGBT9 vector takes place via the BamHI interfaces.
  • the pGAD424 expression vector of the matchmaker system is used to produce a second nucleic acid sequence which is used for a hybrid of the GAL4 activation domain and the Ah receptor.
  • the reading frame of the Ah receptor is based on the Ah cDNA with the help of the specific oligonucleotides Hl and H2
  • H2 5'AGGTCGACTTATGAGCAGCGGCGCCAACAT (SEQ ID NO: 2)
  • oligonucleotides provide the reading frame of the Ah receptor with Sall cleavage sites.
  • the Ah sequence modified in this way can be ligated with the Sall-cut pGAD424 vector.
  • the two hybrid vectors pGBT9-Arnt and pGAD424-Ah produced in this way are first transformed, propagated and purified in E. coli. If the isolated plasmids show the desired constructs, pGBT9-Arnt and pGAD424-Ah are cotransformed in SFY526 yeast host cells. If dioxin is present in the growth medium, the result is a dimerization of the two expressed fusion proteins. The dimerization of the two GAL4 domains in the two hybrid proteins leads to the activation of the transcription of the reporter gene ⁇ -galactosidase, the formation of which is verified in the usual way by means of a color reaction. will be shown.
  • the detection sensitivity for 2,3,7,8-TCDD per batch is in the lower femtomol to upper atomol range and thus in the range of the detection limit of the most sensitive mass spectrometers currently available on the market.
  • HSP90 protein not only shows a regulatory effect on the Ah receptor, the natural ligands of which are unknown, but can be detected using the screening method according to the invention.
  • HSP90 also acts as a repressor for steroid receptors such as the estrogen and androgen receptors. Since more and more xenobiotics are identified for which an estrogen or androgen-like effect is suspected, a detection method according to the invention would also be suitable for screening for such substances.
  • the effector to be identified should have an inhibitory effect on an interacting hybrid protein pair, comprising the hybrid proteins steroid receptor-Al and HSP90-B1, where AI and B1 together should form the functional transcription activator complex.
  • a detection method for effectors of viral protein-protein interactions is provided. This can be carried out in complete analogy to the dioxin test described above.
  • interactions between the poliovirus capsid proteins VP1 and VP3 and between two pl ⁇ -capsid proteins or two p24-capsid proteins from HIV-1 are tested.
  • Examples of the composition in a hybrid construct A 1 A 2 and B 1 B which can be used for the detection of viral protein-protein interactions according to the invention are given in Table 1 below. Table 1
  • a l DNA binding domain
  • a 2 first viral target protein
  • Bl activator domain
  • VP1 and VP3 can also be interchanged in the above hybrids.
  • the coding and provided with suitable restriction cleavage DNA sequences for the viral hybrid protein components A2 and B2 can be prepared and inserted into the vectors pGBT9 and pGAD424 described above.
  • the two-hybrid test for detecting an effector of the viral protein-protein interaction is then carried out in analogy to the dioxin test described above.
  • This test system can also be applied to all other protein-protein interactions involving viral proteins.
  • Viruses which, in addition to the protein capsid, also have an envelope with glycoproteins can also be used as the basis for a method according to the invention.
  • the glycoproteins of the envelope interact with the capsid proteins. This interaction is necessary to equip the virus with the envelope structure and at the same time to remove it from the cell.
  • the Semliki Forest virus shows two spike glycoproteins El and E2, which, like many other viral envelope glycoproteins, consist of three domains: one external, one transmembrane and one internal domain. The internal, C-terminal domain interacts with the capsid proteins.
  • a two-hybrid test for the detection of effectors of this interaction can be established in such a way that the coding sequence for the capsid protein and the envelope glycoprotein, or preferably the DNA sequence of interacting fragments of these two proteins in the Vectors described above inserted and the genetic information contained on the vectors expressed in the presence of an analyte.
  • Envelope proteins thus represent another preferred embodiment.
  • test systems which are based on defined protein-protein interactions with the participation of eukaryotic, prokaryotic, and / or viral proteins.
  • the invention is not restricted to the use of the specific vectors and host cells described above, but rather all other comparable test systems, such as e.g. the expression vectors and host cells described so far in the specialist literature can be used.
  • the present invention further relates to a method for isolating new effectors of intra- and / or intercellular protein-protein interactions, in which a) an analyte is subjected to a detection method as defined above; b) with positive proof of an effector function in the
  • Analytes are limited using conventional preparative methods, if necessary by further separation of the analyte, and the effector, if necessary with the aid of the detection method as defined above, or in another way, such as by spectroscopy, high-pressure liquid chromatography, thin-layer chromatography, localized and isolated using conventional preparative methods such as chromatography.
  • the invention further relates to nucleic acid sequences, such as, for example, DNA, RNA or cDNA sequences, which code for polypeptide hybrids which contain polypeptide domains as defined above or functional equivalents thereof.
  • nucleic acid sequences are the sequences coding for the polypeptide hybrids GAL4 binding domain / Arnt and GAL4 activation domain / Ah.
  • the invention also relates to an analysis kit for carrying out one of the detection methods described above.
  • the analysis kit according to the invention is characterized in that it comprises, preferably in separate compartments: a) a first coding nucleic acid sequence, such as, for example, a transformation vector coding for a polypeptide hybrid A 1 A 2 , b) a second nucleic acid sequence, such as for example a transformation vector coding for a polypeptide hybrid B 1 B 2 and optionally c) a host cell culture which contains the genetic information for a reporter gene which is under the genetic control of an upstream transcription activation sequence to which, after introduction of the first and second nucleic acid sequence, for example by transformation, the transcription-activator complex A- j ⁇ binds into the host cell if the hybrid protein domains A 2 and B 2 interact with one another in the presence or in the absence of an effector .
  • a first coding nucleic acid sequence such as, for example, a transformation vector coding for a polypeptide hybrid A 1 A 2
  • b) a second nucleic acid sequence such as for example a transformation vector
  • first and second nucleic acid sequences can also be arranged on a single vector.
  • the vectors used according to the invention usually contain the coding sequences under the control of customary regulatory sequences known to the person skilled in the art which control the expression of the hybrid proteins in the respective host.
  • the present invention will now be explained in more detail with reference to the following exemplary embodiments, which relate to the establishment of a dioxin screening system. example 1
  • oligonucleotide Hl 5'AGGTCGACACTCTGCACCTTGCTTAGGAAT oligonucleotide H2: 5'AGGTCGACTTATGAGCAGCGGCGCCAACAT oligonucleotide H3: 5 'CGGGATCCCCGAAATGACATCAGATGGGATCCAGAAGATGCT 5GAGGACACAQGGGAGGACACA
  • the PCR protocol was carried out in a slightly modified form in accordance with the information from Perkin-Elmer-Cetus (protocol for DNA amplification). The following reaction mixture was pipetted for the amplification of a DNA fragment using PCR:
  • the reaction was carried out in a final volume of 100 ⁇ l in siliconized, autoclaved reaction vessels.
  • the PCR was carried out in the DNA thermal cycler for 1 min at 95 ° C, 3 min at 60 ° C and 2.5 min at 72 ° C.
  • the 72 ° C step was extended by 2 s per cycle.
  • the PCR comprised a total of 30 cycles.
  • the PCR was started with a "hot start” (at the beginning 5 minutes at 95 ° C.) and ended after 10 minutes at 72 ° C.
  • the plasmids pGAD424 and pGBT9 (Fig. 1 (A) and (B) are available from Clontech Laboratories, Inc., Palo Alto, CA, USA.
  • Ah cDNA and Arnt cDNA can be isolated in a conventional manner from cells expressing Ah and Arnt protein.
  • the cDNA cloning and DNA and amino acid sequence of murine Ah protein are described, for example, by Erna, M. et al. In Biochem. Biophys. Res. Communications (1992), Vol. 184, 246-253, the content of which is hereby expressly incorporated by reference.
  • the murine Ah protein is a polypeptide of 805 amino acids with a calculated molecular weight of 90380 daltons.
  • Arnt protein contains 789 amino acids and has a calculated molecular weight of 86637 daltons.
  • the coding sequence of the Ah receptor was amplified using the PCR method using the specific oligonucleotides H1 and H2, starting from the Ah cDNA matrix.
  • the synthetic oligonucleotides were constructed so that Sall interfaces were introduced into the amplified Ah fragment at the 3 'and 5' ends.
  • the purified PCR Ah fragment was subjected to a Sall restriction digest and ligated into the pGAD424 vector, which was also cut with Sall (FIG. 2 (B)).
  • the clones obtained after transformation into the E. coli strain MC4lrF '(selection for amp resistance) were examined with regard to their plasmids.
  • the coding Sequence of the Arnt receptor (SEQ ID NO: 6) amplified.
  • the synthetic oligonucleotides were constructed so that BamHI cleavage sites were introduced into the amplified Arnt fragment at the 3 'and 5' ends.
  • the purified PCR-Arnt fragment was subjected to a Ba HI restriction digest and ligated into the pGBT9 vector which had also been cut with BamHI (FIG. 2 (A)). The clones obtained after transformation into the E.
  • coli strain MC41rF '(selection for amp resistance) were examined with regard to their plasmids. Using an EcoRI restriction digest, it was possible to determine which bacterial clones contained the desired construct pGBT9-Arnt. The corresponding bacterial clone was expanded and the plasmid pGBT9 Arnt DNA was isolated.
  • the QIAGEN plasmid kit in combination with QIAGEN-Tip-200 columns was used for the plasmid isolation from transformed E. coli cells. The plasmid DNA was isolated according to the manufacturer's instructions. A 150 ml overnight culture of the transformed E. coli cells was used for plasmid isolation. The plasmid yield of isolation for pGBT9-Arnt was between 0.5 and 1 mg / ml.
  • 20 ml of YPD medium were inoculated with a single yeast colony and shaken at 30 ° C. overnight.
  • the 20 ml overnight culture should have reached the stationary phase after this time, ie show an OD> 1.5.
  • the overnight culture was used to inoculate 300 ml of fresh YPD medium; this 300 ml culture with an OD 60 o of 0.2-0.3 was shaken at 30 ° C. for 3 hours.
  • the cells were centrifuged off, the pellet was washed twice in 50 ml of sterile, double-distilled water and in 1.5 ml of fresh, sterile IxTE - " iAC buffer (prepared immediately before use from 10XTE buffer (0.1 M Tris HC1, lO M EDTA, pH 7.5) and lOxLiAC buffer (IM lithium acetate, pH 7.5)).
  • the competent yeast cells were used immediately for the transformation.
  • 0.1 ml of competent yeast cells were pipetted into 0.1 ⁇ g of plasmid DNA and 100 ⁇ g of carrier DNA (“herring testes carrier DNA”) and 0.6 ml of PEG / LiAc solution (40% PEG 4000, IxTE, lx LiAC, fresh) manufactured) .
  • carrier DNA herein carrier DNA
  • PEG / LiAc solution 50% PEG 4000, IxTE, lx LiAC, fresh
  • the mixture was mixed well and shaken at 30 ° C. for 30 minutes. After the addition of 70 ⁇ l DMSO, there was a 15 min heat shock at 42 * C.
  • the cells were then cooled on ice, centrifuged and the pellet resuspended in 0.5 ml TE buffer. 0.25 ml of the transformed cells were plated out on SD plates (-Leu, -Trp) and the plates were incubated for 2-4 days at 30 ° C. until the first colonies appeared.
  • pLAM 5 encodes a hybrid of GAL4 binding domain and human Lamin C
  • pTDl codes for a hybrid of GAL4 activator domain and SV40 large T antigen
  • pCLl codes for a full-length GAL 4.
  • the plasmids pLAM5 ', pTDl and pCLl are also available from Clontech Laboratories Inc.
  • the SSX indicator plates (Chien et al. 1991) have the following composition:
  • the SSX plates contain the substance X-Gal, which is converted into a blue dye after interaction of the fusion proteins. While the control yeasts (pLAM5 '/ P CL -L) showed a clear blue color after growth (o / n) on SSX plates, this was not the case with the other plasmid combinations.
  • the pGAD424-Ah / pGBT9 type SFY5426 yeasts were placed on the SSX plates after placing 2, 3,7, 8-tetrachlorodibenzo-p-dioxin (TCDD) containing pads (TCDD was applied to the pads in 10% DMSO) Recognize specific, concentration-dependent blue staining in the area of the contact areas, but not the control yeasts (pGAD424 / pGBT9-Arnt; pGAD424-Ah / pGBT9, pLAM 5 '/ pTDl), the detection limit for 2,3,7,8-TCDD was in the range of 0.1 ng per pad.
  • the yeast strain SFY526 cotransformed with pGAD424-Ah and pGBT9-Arnt was cultivated overnight at 30 'C in SD medium -Leu, -Trp.
  • the cotransformations a) to d) mentioned under 1.3.3 served as a control.
  • the enzyme reaction was started by adding 0.16 ml of ONPG solution (4 mg / ml o-nitrophenyl- ⁇ -D-galactopyranoside in Z buffer).
  • ONPG solution 4 mg / ml o-nitrophenyl- ⁇ -D-galactopyranoside in Z buffer.
  • the release of ONP is concentration-dependent in the range from 50 to 500 fg 2,3,7,8-TCDD.
  • the liquid test turned out to be very sensitive for the detection of the dioxin ligand.
  • the controls which had been incubated without dioxin only with the solvent 5% DMSO
  • the sample was divided into 3 aliquots, the solvent was removed in a stream of nitrogen and the residue was taken up in the 3 vials with 10 ⁇ l, 30 ⁇ l and 100 ⁇ l 5% DMSO in water. 5 ⁇ l of the respective sample was introduced into liquid culture in the test described under 1.4.2 above.
  • TCCCTTCCCT CACCCCTGAC ATGTACCCCC TTTCCCTTCT GGCTGTTCCC CTGCTCTGTT 2583 GCCTCCTAAG GTAACATTTA TAAAAAAAAA AAA 2616

Abstract

A genetic engineering process is disclosed for detecting effectors of protein-protein interactions, as well as a process for isolating new effectors, nucleic acid sequences which code for the hybrid proteins used in the disclosed detection process, and a test kit for carrying out the detection process.

Description

Verfahren zum Nachweis für Effektoren intra- und/oder interzellulärer Protei.n-Protein-Wechselwirkungen Method for detection of effectors of intra- and / or intercellular protein-protein interactions
Die Erfindung betrifft ein genetisches Nachweisverfahren für Effektoren intra- und/oder interzellulärer Protein-Protein- Wechselwirkungen. Es ist insbesondere anwendbar im Rahmen des sogenannten Belastungs-Screenings für Effektoren intra- und/- oder interzellulärer Protein-Protein-Wechselwirkungen. Das erfindungsgemäße Nachweisverfahren ist auch einsetzbar bei der Suche nach und Isolierung von unbekannten Effektoren bereits bekannter intra- und/oder interzellulärer Wechselwirkungen auf Proteinebene. Gegenstand der Erfindung sind außerdem Nukleinsäuresequenzen und Analysen-Kits, welche zur Durchführung des erfindungsgemäßen Nachweisverfahrens benötigt werden.The invention relates to a genetic detection method for effectors of intra- and / or intercellular protein-protein interactions. It is particularly applicable in the context of the so-called stress screening for effectors of intra- and / or intercellular protein-protein interactions. The detection method according to the invention can also be used in the search for and isolation of unknown effectors of already known intra- and / or intercellular interactions at the protein level. The invention also relates to nucleic acid sequences and analysis kits which are required for carrying out the detection method according to the invention.
Aus dem Stand der Technik ist seit langem bekannt, daß Protein-Protein-Wechselwirkungen und die dabei gebildeten stabilen oder transienten Proteinkomplexe von entscheidender Bedeutung in der gesamten Biosphäre sind. Entstehung, Entwicklung und Reproduktion von Organismen der unterschiedlichsten Entwicklungsstufen wäre ohne Protein-Protein-Wechselwirkungen nicht denkbar. Protein-Protein-Wechselwirkungen stellen in biochemischen Prozessen, wie DNA-Replikation, -Transkription und - Translation, sekretorischen Vorgängen, Signaltransduktion, Zellstoffwechsel und Zellzyklus, zentrale Schnitte dar.It has long been known from the prior art that protein-protein interactions and the stable or transient protein complexes formed in this way are of crucial importance in the entire biosphere. The formation, development and reproduction of organisms at the most diverse stages of development would not be conceivable without protein-protein interactions. Protein-protein interactions are central cuts in biochemical processes such as DNA replication, transcription and translation, secretory processes, signal transduction, cell metabolism and cell cycle.
Diese Schlüsselfunktion von Protein-Protein-Wechselwir- kungen bringt es mit sich, daß Effektoren, welche, meist hoch spezifisch, eine bestimmte Wechselwirkung fördern, bzw. vermitteln oder inhibieren, einen wesentlichen Einfluß auf den betreffenden Organismus auszuüben vermögen.This key function of protein-protein interactions means that effectors which, mostly highly specific, promote, mediate or inhibit a certain interaction are able to exert a significant influence on the organism in question.
Die Beeinflußbarkeit von Protein-Protein-Wechselwirkun- gen durch Effektoren kann z.B. anhand des Cytoskeletts eukaryo- tischer Zellen erläutert werden. Das Cytoskelett trägt nicht nur zur Stabilität eukaryotischer Zellen bei, sondern übernimmt auch andere wichtige Funktionen, wie den Transport von Vesi- kein, Veränderungen der Zellform sowie die Bewegung von Zellen. Diese dynamische Struktur wird durch drei Klassen filamentöser Zusammenlagerungen gebildet: den Mikrofila enten, den Inter- ediärfilamenten und den Mikrotubuli. Mikrofila ente werden durch Polymerisation eines Proteins, des sogenannten Aktins gebildet. Die für die Polymerisation erforderliche Protein-Protein-Wechselwirkung von Aktinproteinen kann beispielsweise durch das Pilz-Alkaloid Cytochalasin B inhibiert werden. Cyto- chalasin stört den Zusammenbau der Aktinfilamente durch die Bindung (Capping) an das für die weitere Polymerisation wichtige freie Ende des letzten Aktinproteins.The ability of protein-protein interactions to be influenced by effectors can be explained, for example, using the cytoskeleton of eukaryotic cells. The cytoskeleton not only contributes to the stability of eukaryotic cells, but also performs other important functions, such as the transport of vesi- none, changes in cell shape as well as the movement of cells. This dynamic structure is formed by three classes of filamentous assemblies: the microfilament, the intermediate filament and the microtubule. Microfilaments are formed by polymerizing a protein called actin. The protein-protein interaction of actin proteins required for the polymerization can be inhibited, for example, by the fungal alkaloid cytochalasin B. Cyto-chalasin interferes with the assembly of the actin filaments by binding (capping) to the free end of the last actin protein, which is important for further polymerization.
Ein Verständnis des Zusammenspiels der an einer Protein- Protein-Wechselwirkung beteiligten Protein-Faktoren einerseits und der positiven oder negativen Effektoren andererseits ermög- licht die Nutzung dieser Erkenntnis in verschiedener Hinsicht. Versteht man nämlich, wie eine Protein-Protein-Wechselwirkung unter normalen Umständen, das heißt physiologisch verläuft, oder hat man physiologische Effektoren der Wechselwirkung analysiert, so besteht die Möglichkeit, diese Wechselwirkung gezielt zu manipulieren. Diese Manipulation kann darin bestehen, bekannte Effektoren durch gezielt modifizierte Effektoren zu ersetzen oder erstmals Effektoren für eine bekannte Protein- Protein-Wechselwirkung bereitzustellen. Darüber hinaus eröffnet ein Verständnis der Protein-Protein-Wechselwirkungen unter phy- Biologischen Bedingungen die Möglichkeit, Störungen des Organismus durch äußere Einflüsse zu verstehen und diesen gegebenenfalls vorzubeugen.An understanding of the interaction of the protein factors involved in a protein-protein interaction on the one hand and the positive or negative effectors on the other hand enables the use of this knowledge in various ways. If one understands how a protein-protein interaction takes place under normal circumstances, that is, physiologically, or if one has analyzed physiological effectors of the interaction, there is the possibility to manipulate this interaction in a targeted manner. This manipulation can consist of replacing known effectors with specifically modified effectors or, for the first time, providing effectors for a known protein-protein interaction. In addition, an understanding of the protein-protein interactions under physiological conditions opens up the possibility of understanding disorders of the organism due to external influences and, if necessary, of preventing them.
Eine Umsetzung der grundlegenden Erkenntnisse über das Zusammenspiel von Proteinen auf zellulärer Ebene in praktischen Nutzen wird bisher dadurch behindert, daß die damit verbundenen Untersuchungen hohen zeitlichen und/oder experimentellen Aufwand erfordern. Dies gilt insbesondere dann, wenn die Notwendigkeit besteht, Effektoren einer bekannten Protein-Protein- Wechselwirkung nachzuweisen. Handelt es sich beispielsweise um künstlich erzeugte Effektoren, wie zum Beispiel Umweltschadstoffe, welche bereits in geringsten Mengen eine physiologische Protein-Protein-Wechselwirkung beeinflussen und in der Folge einen Organismus schädigen können, besteht hierbei das Problem, den künstlichen Effektor zunächst einmal um mehrere Zehnerpotenzen anzureichern, um ihn dann chromatographisch, εpektrome- trisch oder enzymatiεch nachweisen zu können. Ein klassisches Beispiel für einen derartigen Effektor stellt Dioxin, das heißt 2,3,7,8-Tetrachlordibenzo-p-dioxin (TCDD) dar. Es ist mittlerweile bekannt, daß TCDD und andere Dioxine auf molekularer Ebene wirksame Induktoren der Transkription einer Reihe von Target-Genen darstellen, die für metabolische Enzyme, wie zum Beispiel Glutathion-S-Transferase Ya, Aldehyd-Dehydrogenase und Chinon-Oxidoreduktase kodieren (Landers, J.P. und Bunce, N. J. (1991) Biochem. J. 276, 273 bis 287). Mittlerweile ist auch bekannt, daß diese Dioxineffekte über den sogenannten intrazellulären Dioxinrezeptor, den sogenannten Ah (Arylhydrocarbon) - Rezeptor verlaufen. Es wurde festgestellt, daß dieser Rezeptor unter dem Einfluß von Dioxin an einen zweiten Proteinf ktor, das sogenannte Arnt-Protein bindet. Der auf diese Weise gebildete Komplex gelangt dann in den Zellkern, bindet an die Target-DNA und induziert auf diese Weise die oben beschriebene Transkription verschiedener weiterer biologischer Faktoren (vgl. Whitelaw, M. et al. (1993) Molecular and Cellular Biolo- gy, 2504 bis 2514; Mason, G.G. F., et al. (1994), J. Biol. Che . Band 269, Nr. 6, 4438 bis 4449) . Gerade auf dem Gebiet der Untersuchung von Umweltschadstoffen besteht ein großer Bedarf an geeigneten Screening-Methoden, um im Rahmen von dringend erfor- derliehen epidemiologischen Studien die Umweltbelastung, an weit größeren Populationen als bisher, im Rahmen eines sogenannten Belastungs-Screenings durchführen zu können.Implementation of the basic knowledge about the interaction of proteins at the cellular level in practical use has hitherto been hampered by the fact that the associated investigations require a great deal of time and / or experimentation. This is especially true when there is a need to detect effectors of a known protein-protein interaction. If, for example, there are artificially produced effectors, such as environmental pollutants, which influence the physiological protein-protein interaction even in the smallest amounts and can consequently damage an organism, the problem is that first enrich the artificial effector by several powers of ten in order to then be able to detect it chromatographically, spectrometrically or enzymatically. A classic example of such an effector is dioxin, ie 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD). It is now known that TCDD and other dioxins are effective inducers of the transcription of a number of molecules at the molecular level Represent target genes encoding metabolic enzymes such as glutathione-S-transferase Ya, aldehyde dehydrogenase and quinone oxidoreductase (Landers, JP and Bunce, NJ (1991) Biochem. J. 276, 273 to 287). In the meantime it is also known that these dioxin effects run via the so-called intracellular dioxin receptor, the so-called Ah (arylhydrocarbon) receptor. It was found that this receptor binds to a second protein factor, the so-called Arnt protein, under the influence of dioxin. The complex formed in this way then gets into the cell nucleus, binds to the target DNA and in this way induces the above-described transcription of various other biological factors (cf. Whitelaw, M. et al. (1993) Molecular and Cellular Biology) , 2504 to 2514; Mason, GGF, et al. (1994), J. Biol. Che. Volume 269, No. 6, 4438 to 4449). In the field of the study of environmental pollutants in particular, there is a great need for suitable screening methods in order to be able to carry out the environmental pollution in much larger populations than previously within the framework of so-called pollution screening in the context of urgently required epidemiological studies.
Die potentielle Nutzbarkeit von Erkenntnissen über Effektoren spezieller Protein-Protein-Wechselwirkungen kann an- hand einiger Beispiele aus dem Gebiet der Virologie weiter veranschaulicht werden. Viren sind bekanntlich Krankheitserreger für Mensch, Tier und Pflanze. Sie können relativ harmlose Erkrankungen, wie Erkältungen, aber auch lebensbedrohliche Krankheiten, wie Polio oder AIDS, verursachen. Ein Virus ist ein intrazellulärer Parasit, der innerhalb und außerhalb einer Zelle in zwei fundamental unterschiedlichen Formen existieren kann. Die extrazelluläre Form wird Virion oder Viruspartikel genannt. Virione bestehen aus dem viralen Genom, welches mit Proteinen und zuweilen auch mit anderen chemischen Substanzen, wie Lipiden, assoziiert ist. Die Proteine schützen das Genom vor Zerstörung im extrazellulärem Raum, ermöglichen den Eintritt in die Wirtszelle und üben oftmals einleitende Schritte beim viralen Replikationszyklus aus. Während der Infektion wird die Virionstruktur größtenteils oder komplett zerstört, so daß das Genom in der Zelle frei zur Transkription und Replikation vorliegt.The potential usability of knowledge about the effectors of special protein-protein interactions can be further illustrated with the help of some examples from the field of virology. Viruses are known to be pathogens for humans, animals and plants. They can cause relatively harmless illnesses like colds, but also life-threatening illnesses like polio or AIDS. A virus is an intracellular parasite that can exist in two fundamentally different forms inside and outside a cell. The extracellular form is called virion or virus particle. Virione consist of the viral genome, which with Proteins and sometimes associated with other chemical substances such as lipids. The proteins protect the genome from destruction in the extracellular space, allow entry into the host cell and often perform preliminary steps in the viral replication cycle. During the infection, the virion structure is largely or completely destroyed, so that the genome is freely available in the cell for transcription and replication.
Auf den ersten Blick erscheinen Virione von tierischen Viren eine hohe Variabilität zu besitzen. Bei näherer Betrachtung sind jedoch wesentliche Gemeinsamkeiten erkennbar. Der Teil des Viruspartikels, welcher von Virus-kodierenden Proteinen aufgebaut wird, das Capsid, muß aus einem oder wenigen verschiedenen, sich wiederholenden Proteinbausteinen aufgebaut sein. Diese Beschränkung ist dem Virus durch die limitierteAt first glance, virions of animal viruses appear to be highly variable. On closer inspection, however, significant similarities can be seen. The part of the virus particle which is made up of virus-coding proteins, the capsid, must be made up of one or a few different, repeating protein building blocks. This limitation is limited by the virus
Größe seines Genoms vorgegeben und führt dazu, daß die Virion- Capside einen Grundbauplan mit folgenden zwei Eigenschaften besitzen: a) eine enge Helix Undefinierter Länge mit dem Genom im Zentrum und b) eine quasi-sphärische ikosaidrische Struktur. Virione tierischer Viren können sich durch An- bzw. Abwesenheit eines äußeren Membranmantels zusätzlich unterscheiden. Virione, welche diese Membranhülle nicht besitzen, werden als "nackt" bezeichnet. Viren, die diesen auch Envelope genannten Membranmantel aufweisen, erwerben diesen aus der Membran des Wirts über einen 2-Schritt-Prozeß, der "budding" genannt wird. Zunächst werden virale Glykoproteine in die Membran insertiert, welche durch Wechselwirkung mit Capsid-Proteinen das Capsid mit der Membran umhüllen und das nun fertige Viruspartikel nach außen freisetzen. Es zeigt sich also, daß bei viralen Prozessen Protein- Protein-Wechselwirkungen eine entscheidende Funktion besitzen: Es assoziieren Capsid-Proteine unter gegenseitiger Wechselwirkung zum Capsid; während des "budding"-Prozesses wechselwirken virale Glykoproteine aus der Membran der infizierten Zelle mit viralen Capsidproteinen; Virion-Proteine wechselwirken mit Zelloberflächenantigenen der zu infizierenden Wirtszelle.Given the size of its genome, the virion capsids have a basic blueprint with the following two properties: a) a narrow helix of undefined length with the genome in the center and b) a quasi-spherical icosaidric structure. Virions of animal viruses can additionally differ due to the presence or absence of an outer membrane jacket. Virions that do not have this membrane envelope are called "naked". Viruses that have this envelope, also called envelope, acquire it from the host's membrane using a two-step process called "budding". First, viral glycoproteins are inserted into the membrane, which, by interacting with capsid proteins, coat the capsid with the membrane and release the finished virus particle to the outside. It turns out that protein-protein interactions have a crucial function in viral processes: capsid proteins associate with each other to form the capsid; During the "budding" process, viral glycoproteins from the membrane of the infected cell interact with viral capsid proteins; Virion proteins interact with cell surface antigens of the host cell to be infected.
Dieses Wissen über zentrale Schlüsseleraignisse könnte dazu dienen," Viren auf eben dieser Basis zu bekämpfen, indem man nämlich diese wichtigen Protein-Protein-Wechselwirkungen durch Inhibitoren gezielt unterbindet. Die modernen Methoden der Molekularbiologie machten es möglich, die cDNA- bzw. Proteinsequenz viraler Proteine aufzuklären. Bisher fehlt es je- doch an geeigneten Testverfahren, um systematisch und mit vertretbarem experimentellem Aufwand nach geeigneten Effektoren dieser viralen Protein-Protein-Wechselwirkungen suchen zu können. Ein schnelles, nachweisempfindliches in-vivo-Screeningver- fahren, für diesen Zweck wäre äußerst wünschenswert. Aus dem Stand der Technik ist seit einigen Jahren die sogenannte Two-Hybrid-Technik bekannt, welche auf Arbeiten von Fields, S. und Song, O., veröffentlicht in Nature (1989), 340, S. 245 bis 246, zurückgeht. Die Two-Hybrid-Technik wurde entwickelt, um Wechselwirkungen zwischen bekannten Proteinen bes- ser untersuchen zu können oder um bisher unbekannte Proteine zu identifizieren, welche mit einem bestimmten bekannten Protein in Wechselwirkung treten.This knowledge of key key events could serve to " fight viruses on this very basis by specifically, these important protein-protein interactions are specifically prevented by inhibitors. The modern methods of molecular biology made it possible to elucidate the cDNA or protein sequence of viral proteins. So far, however, there has been a lack of suitable test methods to be able to search systematically and with reasonable experimental effort for suitable effectors of these viral protein-protein interactions. A quick, detection-sensitive in vivo screening procedure for this purpose would be extremely desirable. The so-called two-hybrid technique has been known from the prior art for a few years, which goes back to works by Fields, S. and Song, O., published in Nature (1989), 340, pp. 245 to 246. The two-hybrid technique was developed to better investigate interactions between known proteins or to identify previously unknown proteins that interact with a certain known protein.
Die Two-Hybrid-Technik ist eine genetische Methode, mit welcher eine Protein-Protein-Wechselwirkung über die transkrip- tionale Aktivität eines in Zellkultur produzierten Hybridprotein-Komplexes bestimmt wird. Die Technik beruht auf dem modu- laren Aufbau vieler ortsspezifischer Transkriptionsfaktoren (Transkriptionsaktivatoren) , bestehend aus einer DNA-Bindungsdomäne und einer Aktivierungsdomäne. Die Two-Hybrid-Technik basiert auf der Beobachtung, daß eine direkte kovalente Verbindung zwischen diesen beiden Domänen nicht erforderlich ist, sondern daß eine räumliche Nähe, bewirkt durch Wechselwirkung zweier beliebiger anderer Proteine, ausreicht, um Transkription zu induzieren. Zur Durchführung des Verfahrens ist es erforder- lieh, zwei Hybridproteine zu konstruieren und diese in einem geeigneten Wirtszellsystem, wie z.B. in Hefezellen, gemeinsam zu exprimieren. Eine Sequenz, die für ein erstes an einer Protein-Protein-Wechselwirkung beteiligtes Protein kodiert, wird unter Beibehaltung des Leserahmens mit der kodierenden Sequenz der DNA-Bindungsdomäne des Transkriptionsfaktors, wie z.B. des Hefe-Transkriptionsfaktors GAL4, fusioniert, wobei man die kodierende Sequenz für ein erstes Hybridprotein erhält. Die kodierende Sequenz für ein zweites Hybridprotein stellt man her, indem man die kodierende Sequenz für das zweite an der Wechselwirkung beteiligte Protein mit der kodierenden Sequenz für die Aktivator-Domäne des Transkriptionsfaktors im gleichen Leserahmen fusioniert. Ein funktionaler Aktivator wird nach Co-Ex- pression in dem Wirtsystem erzeugt, wenn DNA-Bindungsdomäne und Aktivierungs-Domäne aufgrund der physikalischen Wechselwirkungen zwischen den beiden Fremdproteinkomponenten miteinander in räumliche Nähe treten. Ist dies der Fall, so wird ein Reportergen exprimiert, das unter der gentischen Kontrolle einer stromaufwärts gelegenen Aktivierungsseguenz, wie zum Beispiel GAL1 UAS steht, an welche die DNA-Bindungsdomäne des Transkriptionsfaktors bindet. Die durch die Wechselwirkung der beiden Fremdproteine bedingte Rekonstitution der Funktion des Transkriptionsfaktors bewirkt somit die Transkription des Reporter- gens (wie zum Beispiel lacZ oder HIS 3) . Dessen Genprodukt, wie zum Beispiel ß-Galactosidase, kann dann in herkömmlicher Weise nachgewiesen werden.The two-hybrid technique is a genetic method with which a protein-protein interaction is determined via the transcriptional activity of a hybrid protein complex produced in cell culture. The technology is based on the modular structure of many site-specific transcription factors (transcription activators), consisting of a DNA binding domain and an activation domain. The two-hybrid technique is based on the observation that a direct covalent connection between these two domains is not required, but that a spatial proximity, caused by the interaction of any two other proteins, is sufficient to induce transcription. To carry out the method, it is necessary to construct two hybrid proteins and to express them together in a suitable host cell system, such as in yeast cells. A sequence encoding a first protein involved in a protein-protein interaction is fused while maintaining the reading frame with the coding sequence of the DNA binding domain of the transcription factor, such as the yeast transcription factor GAL4, whereby the coding sequence for receives a first hybrid protein. The coding sequence for a second hybrid protein is produced by fusing the coding sequence for the second protein involved in the interaction with the coding sequence for the activator domain of the transcription factor in the same reading frame. A functional activator is generated in the host system after co-expression when the DNA binding domain and the activation domain come into spatial proximity due to the physical interactions between the two foreign protein components. If this is the case, a reporter gene is expressed which is under the genetic control of an upstream activation sequence, such as GAL1 UAS, to which the DNA binding domain of the transcription factor binds. The reconstitution of the function of the transcription factor caused by the interaction of the two foreign proteins thus causes the transcription of the reporter gene (such as lacZ or HIS 3). Its gene product, such as β-galactosidase, can then be detected in a conventional manner.
Die eben beschriebene Two-Hybrid-Technik wurde bisher ausschließlich bei der Identifizierung und Untersuchung ver- schiedener Protein-Protein-Wechselwirkungen erfolgreich eingesetzt. Staudinger et al. beschreiben in J. Biol. Chem. (1993), Bd. 268, S. 4608 bis 4611 die Verwendung der GAL4-Two-Hybrid- Technik zum Screening auf neue Zelltyp-spezifische Bindungspartner für das Helix-Loop-Helix (HLH) -Protein E12. Vojtek, A.B. et al. beschreiben in Cell (1993), Bd. 74, S. 205 bis 214 die Identifikation neuer, mit H-Ras wechselwirkenden Proteinen unter Verwendung der Two-Hybrid-Technik, wobei eine Maus-cDNA- Genbank gescreent wurde. Yang, X., et al. schlagen in Science (1992), Bd. 257, S. 680 bis 682 die Verwendung der Two-Hybrid- Technik zum Nachweis physikalischer Wechselwirkungen zwischen ProteinKinasen und funkionell verwandten Substrat-Proteinen vor. Li. B. und Fields, S. berichten in The FASEB Journal (1993) Bd. 7, S. 957 bis 963 über Untersuchungen des Einflusses von Mutationen im Tumorsuppressor-Protein p53 auf dessen Wech- selwirkung mit dem T-Antigen, einem viralen Oncogenprodukt aus SV 40. Chardin, P. et al. berichten in Science (1993), Bd. 260, S. 1338 bis 1343 über die Verwendung der Two-Hybrid-Technik zum Nachweis der Wechselwirkung des Proteins hSosl mit dem Wachs- tu sfaktorrezeptor-gebundenen Protein 2 (GRB2) . Hardy, C. F. J. et al. beschreiben in Genes & Development (1992) Bd. 6, S. 801 bis 814 eine Mutante des Proteins RIF 1, welche mit einer Mu- tante des Sequenz-spezifischen DNA-Bindungsproteins RAP 1 wechselwirkt. Der oben beschriebene Stand der Technik benutzt somit die Two-Hybrid-Technik ausschließlich in der von Fields und Song bereits 1989 vorgeschlagenen Art und Weise, nämlich zum Screening einer DNA-Genbank um neue Protein-Bindungspartner eines bereits bekannten Proteins ausfindig zu machen und um bekannte Protein-Protein-Bindung näher zu charakterisieren. Als weitere Anwendungsmöglichkeit wurde von Fiels und Song (1989, a.a.O.) die Anwendung der Two-Hybrid-Technik im Rahmen des Designs therapeutisch wirksamer Peptide vorgeschlagen, die mit Proteinen bakteriellen oder viralen Ursprungs wechselwirken. Ausführungsbeispiele zu ihren Vorschlag liefern die Autoren jedoch nicht.The two-hybrid technique just described has so far only been used successfully in the identification and investigation of various protein-protein interactions. Staudinger et al. describe in J. Biol. Chem. (1993), vol. 268, pp. 4608 to 4611 the use of the GAL4 two-hybrid technique for screening for new cell type-specific binding partners for the helix-loop-helix (HLH) - Protein E12. Vojtek, AB et al. describe in Cell (1993), Vol. 74, pp. 205 to 214 the identification of new proteins interacting with H-Ras using the two-hybrid technique, a mouse cDNA library being screened. Yang, X., et al. in Science (1992), Vol. 257, pp. 680 to 682 suggest the use of the two-hybrid technique for the detection of physical interactions between protein kinases and functionally related substrate proteins. Li. B. and Fields, S. report in The FASEB Journal (1993) Vol. 7, pp. 957 to 963 about studies of the influence of mutations in the tumor suppressor protein p53 on its interaction with the T antigen, a viral Oncogen product from SV 40. Chardin, P. et al. report in Science (1993), vol. 260, pp. 1338 to 1343 about the use of the two-hybrid technique for demonstrating the interaction of the protein hSosl with the wax factor receptor-bound protein 2 (GRB2). Hardy, CFJ et al. in Genes & Development (1992) Vol. 6, pp. 801 to 814 describe a mutant of the RIF 1 protein which interacts with a mutant of the sequence-specific DNA binding protein RAP 1. The prior art described above thus uses the two-hybrid technique exclusively in the manner proposed by Fields and Song as early as 1989, namely for screening a DNA gene bank in order to find new protein binding partners of an already known protein and for known ones Characterize protein-protein binding in more detail. As a further possible application, Fiels and Song (1989, op. Cit.) Proposed the use of the two-hybrid technique in the design of therapeutically effective peptides that interact with proteins of bacterial or viral origin. However, the authors do not provide examples of their proposal.
Eine gewisse Erweiterung des klassischen Anwendungsgebietes der Two-Hybrid-Technik stellen die Arbeiten von Luban et al. sowie von Chiu et al. dar. Luban, J. et al. beschreiben in Cell, (1993) Bd. 73, S. 1068 bis 1078 die Verwendung des GAL4- Two-Hybrid-Systems zum Screening einer cDNA-Bank und die Identifikation von Cyclophilin A und B als Proteine, die mit dem Gag Polyprotein Pr55^at? aus HIV-1 wechselwirken. Es wurde weiterhin festgestellt, daß die Gag-Cyclophilin A Wechselwirkung durch Cyclosporin A unterbunden werden kann, wobei jedoch bereits aus früheren Arbeiten bekannt war, daß Cyclosporin A an Cyclophiline bindet.The work by Luban et al. Represents a certain expansion of the classic application area of two-hybrid technology. and by Chiu et al. Luban, J. et al. describe in Cell, (1993) Vol. 73, pp. 1068 to 1078 the use of the GAL4 two-hybrid system for screening a cDNA library and the identification of cyclophilin A and B as proteins which are associated with the Gag polyprotein Pr55 ^ at ? interact from HIV-1. It was also found that the Gag-cyclophilin A interaction can be prevented by cyclosporin A, although it was already known from previous work that cyclosporin A binds to cyclophilins.
Chiu, M.I. et al. beschreiben in Proc. Natl. Acad. Sei. USA (1994), Bd. 91, S. 12574 bis 12578 die Suche nach einem Bindungsprotein, das mit dem FKBP12/Rapamycin-Komplex wechselwirkt. Rapamycin ist ein bekanntes Immunsuppressivum, das mit seinem Rezeptorprotein FKBP12 einen Komplex bildet, der, wie von Chiu et al. festgestellt, an ein weiteres bis dahin nicht bekanntes Protein, nämlich RAPT 1, bindet. Die Arbeiten von Lu- ban et al. bzw. Chiu et al. haben somit gezeigt, daß die Two- Hybrid-Technik auch zum Nachweis solcher Protein-Protein-Wechselwirkungen eingesetzt werden kann, welche in Gegenwart eines bekannten niedermolekularen Liganden unterbunden werden (wie z.B. im Falle von Cyclosporin A) oder erst in Gegenwart des Liganden beobachtet werden können (wie im Falle von Rapamycin) . Beiden Arbeiten gemeinsam ist jedoch die Suche nach einem bisher nicht bekannten Protein-Bindungspartner. Ohne konkrete Bei- spiele zu liefern, spekulieren Chiu et al. daß die Two-Hybrid- Technik für Tests mit und das Design von niedermolekularen Modulatoren einer Protein-Protein-Wechselwirkung eingesetzt werden könnte, wobei die untersuchten Modulatoren potentiellen therapeutischen Wert besitzen sollten. Voraussetzung für solche Untersuchungen wäre jedoch, den zu testenden Modulator in isolierter Form, d.h. als Reinεubstanz und vor allem in ausreichender Menge, zur Verfügung zu haben, um ihn dann zur Untersuchung seines Einflusses auf die Protein-Protein-Wechselwirkung im Test einsetzen zu können. In der WO 95/26400 wird ein als reverse Two-Hybrid-Me- thode bezeichnetes Verfahren beschrieben, das die Suche nach Molekülen ermöglichen soll, welche Protein-Protein-Wechselwirkungen inhibieren. Das darin beschriebene Testsystem ist dadurch gekennzeichnet, daß neben dem Reportergen ein sogenanntes Signal Inverter Gen (oder Mrelay gene") als wesentliche Komponente eingesetzt wird. Diese Maßnahme soll möglichen negativen Einflüssen von Zellgiften oder Translationshemmern, die in einer Probe vorliegen könnten, vorbeugen. Ausführungsbeispiele, welche die angebliche Brauchbarkeit dieses System, insbesondere in Screeningverfahren glaubhaft belegen, werden jedoch nicht beschrieben. Es ist vielmehr davon auszugehen, daß das vorgeschlagene Testsystem aufgrund der zusätzlich erforderlichen Testkomponente störanfälliger als das konventionelle Two-Hy- brid-System sein dürfte. Zusammenfassend ist somit festzustellen, daß der diskutierte Stand der Technik keinerlei brauchbare Hinweise enthält, daß die Two-Hybrid-Technik erfolgreich bei der Suche nach niedermolekularen, bekannten oder unbekannten, Effektoren definierter Protein-Protein-Wechselwirkungen eingesetzt werden kann. Insbesondere gibt es keinen Hinweis im Stand der Technik, die Two-Hybrid-Technik im Rahmen echter Screeningverfahren für niedermolekulare Effektoren von Protein-Protein-Wechselwirkungen einzusetzen. Screeningverfahren sind in der Regel dadurch gekennzeichnet, daß der potentielle Effektor nicht als Reinsub- stanz sondern im Gemisch mit anderen Verbindungen und in äußerst geringer Konzentration vorliegt. Dies ist insbesondere der Fall, wenn man neue Resourcen auf unbekannte Effektoren hin untersucht oder in identischer Weise gewonnene Proben gleichen Typs auf einen bekannten Effektor screent.Chiu, MI et al. describe in Proc. Natl. Acad. Be. USA (1994), Vol. 91, pp. 12574 to 12578 the search for a binding protein which interacts with the FKBP12 / rapamycin complex. Rapamycin is a well-known immunosuppressant that forms a complex with its receptor protein FKBP12, which, as described by Chiu et al. found, binds to another previously unknown protein, namely RAPT 1. The work of Luban et al. and Chiu et al. have thus shown that the two-hybrid technique can also be used to detect those protein-protein interactions which are prevented in the presence of a known low molecular weight ligand (such as for example in the case of cyclosporin A) or only in the presence of the ligand (as in the case of rapamycin). Both works, however, have in common the search for a previously unknown protein binding partner. Without providing concrete examples, Chiu et al. that the two-hybrid technique could be used for tests with and the design of low molecular weight modulators of a protein-protein interaction, whereby the investigated modulators should have potential therapeutic value. However, the prerequisite for such tests would be to have the modulator to be tested available in isolated form, ie as a pure substance and above all in sufficient quantity, so that it could then be used in the test to investigate its influence on the protein-protein interaction. WO 95/26400 describes a method known as a reverse two-hybrid method which is intended to enable the search for molecules which inhibit protein-protein interactions. The test system described therein is characterized in that a so-called signal inverter gene (or M relay gene ") is used as an essential component in addition to the reporter gene. This measure is intended to prevent possible negative influences of cell toxins or translation inhibitors which could be present in a sample. However, exemplary embodiments which provide credible evidence of the alleged usability of this system, in particular in screening processes, are not described, but rather it can be assumed that the proposed test system may be more susceptible to failure than the conventional two-hybrid system due to the additional test components required it can thus be stated that the prior art discussed contains no useful evidence that the two-hybrid technique can be successfully used in the search for low-molecular, known or unknown, effectors of defined protein-protein interactions. In particular, there is no reference in the prior art to use the two-hybrid technique in the context of real screening processes for low-molecular effectors of protein-protein interactions. Screening procedures are usually one of them characterized in that the potential effector is not present as a pure substance but in a mixture with other compounds and in an extremely low concentration. This is particularly the case if new resources are examined for unknown effectors or if samples of the same type obtained in the same way are screened for a known effector.
Aufgabe der vorliegenden Erfindung ist somit die Bereitstellung eines Nachweisverfahrens für niedermolekulare Effektoren intra- und/oder interzellulärer Protein-Protein-Wechselwir- kungen mit dessen Hilfe insbesondere Substanzgemische schnell und mit hoher Nachweisempfindlichkeit auf das Vorhandensein eines bekannten oder unbekannten Effektors für ein vorgegebenes Protein-Protein-Wechselwirkungssystem untersucht werden können. Das erfindungsgemäße Verfahren soll insbesondere anwendbar sein für sogenannte Belastungsscreeningsverfahren, die im Rahmen epidemiologischer Untersuchungen eingesetzt werden können. Das erfindungsgemäße Verfahren soll außerdem geeignet sein zur Durchführung sogenannter Naturstoffscreeningverfahren, um neuartige therapeutische Wirksubstanzen lokalisieren und an- schließend analysieren zu können.The object of the present invention is therefore to provide a detection method for low-molecular effectors of intra- and / or intercellular protein-protein interactions, with the aid of which, in particular, mixtures of substances quickly and with high sensitivity to the presence of a known or unknown effector for a given protein protein - Interaction system can be examined. The method according to the invention should be applicable in particular for so-called stress screening methods which can be used in the context of epidemiological studies. The method according to the invention should also be suitable for carrying out so-called natural product screening methods in order to localize and subsequently analyze novel therapeutic active substances.
Überraschenderweise wird die erfindungsgeroäße Aufgabe gelöst durch Bereitstellung eines genetischen Nachweisverfahrens für Effektoren intra- und/oder interzellulärer Protein- Protein-Wechselwirkungen, wobei man a) in einer Wirtszelle in Gegenwart eines Analyten, in dem man die Effektorfunktion vermutet, zwei Polypeptid-Hybride A1A2 und B-j^ exprimiert, deren Domänen A^ und B-^ zusammen einen funktionellen Transkriptions-Aktivator-Komplex bilden, wenn die Domänen A2 und B2, welche die intra- und/oder interzelluläre Wechselwirkung, so wie sie beispielsweise unter physiologischen Bedingungen abläuft, imitieren, miteinander wechselwirken, wobei die Wechselwirkung zwischen den Polypeptiddomänen A2 und B2 nur bei Fehlen oder Vorliegen der Effektorfunktion, d.h. wenigstens eines Effektors, in dem Analyten zu beobachten ist; und b) auf Expression eines Reporter-Gens analysiert, das unter der genetischen Kontrolle einer stromaufwärts gelegenen Transkriptions-Aktivierungssequenz steht, an welche der (in situ gebildete) Transkriptions-Aktivator-Ko plex bindet, wobei Expression des Reportergen-Produkts auf Vorliegen oder Fehlen der Effektorfunktion im Analyten hinweist. Die Expression eines Signal Inverter Gens wie bei der sogenannten reversen Two-Hy- brid-Methode ist erfindungsgemäß nicht erforderlich.Surprisingly, the object according to the invention is achieved by providing a genetic detection method for effectors of intra- and / or intercellular protein-protein interactions, wherein a) in a host cell in the presence of an analyte in which one suspects the effector function, two polypeptide hybrids A 1 A 2 and B- j ^, whose domains A ^ and B- ^ together form a functional transcription-activator complex, if the domains A 2 and B 2 , which the intra- and / or intercellular interaction, as they for example takes place under physiological conditions, imitate, interact with one another, the interaction between the polypeptide domains A 2 and B 2 being observed only in the absence or presence of the effector function, ie at least one effector, in the analyte; and b) analyzed for expression of a reporter gene under the genetic control of an upstream transcription activation sequence to which the (in transcription activator complex formed in situ, expression of the reporter gene product indicating the presence or absence of the effector function in the analyte. The expression of a signal inverter gene as in the so-called reverse two-hybrid method is not necessary according to the invention.
Ein weiterer Gegenstand der vorliegenden Erfindung betrifft ein Verfahren zur Isolierung der auf diese Weise nachgewiesenen Effektoren sowie die unter Anwendung dieses Verfahrens isolierten neuen Effektoren von Protein-Protein-Wechsel- Wirkungen.Another object of the present invention relates to a method for isolating the effectors detected in this way and the new effectors of protein-protein interactions isolated using this method.
Gegenstand der Erfindung sind außerdem Nukleinsäuresequenzen, welche für die im erfindungsgemäßen Nachweisverfahren verwendete Hybridproteine oder Polypeptidhybride A1A2 und B-j^ kodieren. Schließlich ist Gegenstand der Erfindung ein Analysenkit zur Durchführung des erfindungsgemäßen Nachweisverfahrens.The invention relates also to nucleic acid sequences which encode the present invention used in the detection methods or hybrid proteins Polypeptidhybride A 1 A 2 and B ^ j. Finally, the invention relates to an analysis kit for carrying out the detection method according to the invention.
Kurze Beschreibung der Figuren;Brief description of the figures;
Figur 1 zeigt das Konstruktionsschema zweier erfindungsgemäß anwendbarer Expressionsvektoren vor Insertion der kodierenden Sequenz für die zweite Hybridprotein-Komponente: (A) zeigt das 5523 bp Plasmid pGBT9, das die kodierende Sequenz für die DNA-Bindungsdomäne (bd) des eukaryotisehen Transkriptionsaktivators GAL4 enthält. (B) zeigt das 6659 bp Plasmid pGAD424, das die kodierende Sequenz für die Transkriptions-Akti- vierungsdomäne (ad) von GAL4 enthält. In den Figuren 1(A) und 1(B) steht "MSC" für die Multiple Klo- nierungsstelle, "p" für die Promotor, "T" für dieFIG. 1 shows the construction scheme of two expression vectors that can be used according to the invention before insertion of the coding sequence for the second hybrid protein component: (A) shows the 5523 bp plasmid pGBT9, which contains the coding sequence for the DNA binding domain (bd) of the eukaryotic transcription activator GAL4. (B) shows the 6659 bp plasmid pGAD424, which contains the coding sequence for the transcription activation domain (ad) of GAL4. In FIGS. 1 (A) and 1 (B), "MSC" stands for the multiple cloning site, "p" for the promoter, and "T" for the
Transkriptions-Terminationssequenz und "A" für das SV40 Kernlokalisierungssignal.Transcription termination sequence and "A" for the SV40 nuclear localization signal.
Figur 2 zeigt das Konstruktionsschema der Expressionsvektoren von Figur 1 nach Insertion der kodierenden Sequenz für die zweite Hybridprotein-Komponente: (A) veranschaulicht die Insertion der kodierenden Sequenz für das ARNT-Protein in die BamHI-Schnittstelle der MSC von pGBT9. (B) zeigt die Insertion der kodierenden Sequenz für das Ah-Protein in die Sall Schnittstelle der MSC von pGAD424.Figure 2 shows the construction scheme of the expression vectors of Figure 1 after insertion of the coding sequence for the second hybrid protein component: (A) illustrates the insertion of the coding sequence for the ARNT protein into the BamHI site of the MSC from pGBT9. (B) shows the insertion of the coding sequence for the Ah protein into the Sall site of the MSC of pGAD424.
Die Erfindung wird in den nun folgenden Abschnitten näher erläutert.The invention is explained in more detail in the following sections.
Das erfindungsgemäße Nachweisverfahren bietet den überraschenden Vorteil, daß Effektoren einer vorgegebenen Protein- Protein-Wechselwirkung in effizienter Weise, das heißt schnell und, in der Regel ohne Abtrennung der in dem untersuchten Analyten vorhandenen weiteren nieder- oder hochmolekularen Komponenten qualitativ erfaßt werden können. Eine Auftrennung des Analyten bzw. eine weitere Eingrenzung des Effektors ist nur dann angesagt, wenn sich zeigen sollte, daß mehr als einThe detection method according to the invention offers the surprising advantage that effectors of a given protein-protein interaction can be detected qualitatively in an efficient manner, that is to say quickly and generally without separating the other low or high molecular weight components present in the analyte being examined. A separation of the analyte or a further limitation of the effector is only necessary if it should be shown that more than one
Effektor der betreffenden Protein-Protein-Wechselwirkung in dem Analyten enthalten ist oder einzelne Komponenten der Analyten das Testsystem stören. Letzteres kann der Fachmann durch wenige Kontrollversuche leicht feststellen. Durch die im erfindungsgemäßen Testsystem künstlich induzierte Protein-Protein-Wechselwirkung wird die die natürliche, bzw. physiologische Wechselwirkung insofern "imitiert" oder nachgeahmt, als zumindest die unter natürlichen oder physiologischen Bedingngen beobachtete Bindungsspezifität der wechselwirkenden Proteinkomponenten im Testsystem im wesentlichen erhalten bleibt. Die Stärke der Wechselwirkung im Testsystem kann im Vergleich zum physiologischen Prozeß variieren. Wesentlich ist somit, daß die Protein-Protein-Wechselwirkung unter den Testbedingungen funktional äquivalent zur natürli- chen, bzw. physiologischen Wechselwirkung erfolgt.Effector of the protein-protein interaction in question is contained in the analyte or individual components of the analytes interfere with the test system. The expert can easily determine the latter by means of a few control experiments. The protein-protein interaction artificially induced in the test system according to the invention "imitates" or imitates the natural or physiological interaction insofar as at least the binding specificity of the interacting protein components observed under natural or physiological conditions is essentially retained in the test system. The strength of the interaction in the test system can vary compared to the physiological process. It is therefore essential that the protein-protein interaction takes place functionally equivalent to the natural or physiological interaction under the test conditions.
Die gemäß vorliegender Erfindung vorgegebene Protein- Protein-Wechselwirkung ist natürlich nicht beschränkt auf reine Proteine oder Polypeptide. Die Erfindung ist ebenfalls anwendbar auf solche Wechselwirkungen, an denen z.B. Glykoproteine oder Lipoproteine beteiligt sind. Erfindungsgemäß brauchbare Testsysteme sind außerdem nicht nur mit vollständigen Proteinen als Bindungspartner etablierbar. Vielmehr sind auch funktionale Äquivalente, wie z.B. Fragmente, Mutanten und andere Derivate, von an der nativen Protein-Protein-Wechselwirkung beteiligten Faktoren brauchbar. Funktionalen Fragmente können Teilsequenzen, wie z.B. bestimmte Domänen, des Faktors umfassen, auf welche die zur Wechselwirkung benötigte Bindungsfunktion lokali- siert ist. Geeignete Fragmente können z.B. gentechnisch oder in klassischer Weise durch enzy atische oder chemische Fragmentierung erzeugt werden. Erfindungsgemäße funktionale Äquivalente umfassen außerdem durch Aminosäure-Substitution, -Addition, - Insertion und/oder -Deletion unter Beibehaltung der Bindungs- spezifitat, z.B. gentechnisch oder auf chemischem Weg, erzeugte Derivate der Bindungspartner.The protein-protein interaction specified according to the present invention is of course not restricted to pure proteins or polypeptides. The invention is also applicable to those interactions in which, for example, glycoproteins or lipoproteins are involved. Test systems which can be used according to the invention can moreover not only be established as binding partners with complete proteins. Rather, functional equivalents, such as fragments, mutants and other derivatives, are also factors involved in the native protein-protein interaction. Functional fragments can include partial sequences, such as certain domains, of the factor to which the binding function required for the interaction is located. Suitable fragments can be generated, for example, by genetic engineering or in the classical manner by enzymatic or chemical fragmentation. Functional equivalents according to the invention also include derivatives of the binding partners generated by amino acid substitution, addition, insertion and / or deletion while maintaining the binding specificity, for example genetically or chemically.
Der nachzuweisende Effektor oder Modulator ist vorzugsweise eine niedermolekulare Komponente, welche die Protein-Protein-Wechselwirkung initiiert, stimuliert oder inhibiert. Es kann sich also um einen positiven oder negativen Effektor der Wechselwirkung handeln.The effector or modulator to be detected is preferably a low-molecular component which initiates, stimulates or inhibits the protein-protein interaction. So it can be a positive or negative effector of the interaction.
Der erfindungsgemäß zu untersuchende Analyt ist vorzugsweise ein Gemisch von Substanzen, wobei man vermutet, daß wenigstens eine dieser Substanzen einen positiven oder negativen Effektor-Funktion auf die vorgegebene Protein-Protein-Wechselwirkung ausübt. Insbesondere bevorzugt ist diese wirksame Substanz eine niedermolekulare anorganische, vorzugsweise organische Verbindung. Beispielsweise kann das Molekulargewicht des Effektors bis zu etwa 5000 g/Mol, wie beispielsweise bis zu 2000 g/Mol betragen, und z.B. im Bereich von etwa 10 bis 1000 g/Mol liegen.The analyte to be investigated according to the invention is preferably a mixture of substances, it being assumed that at least one of these substances has a positive or negative effector function on the predetermined protein-protein interaction. This active substance is particularly preferably a low-molecular inorganic, preferably organic compound. For example, the molecular weight of the effector can be up to about 5000 g / mol, such as up to 2000 g / mol, and e.g. are in the range of about 10 to 1000 g / mol.
Der erfindungsgemäß untersuchte Analyt ist beispielsweise ausgewählt unter Körperflüssigkeitsproben, wie z.B. Gesamtblut, Muttermilch, Liquor, Speichel und Urin. Außerdem sind mit dem erfindungsgemäßen Verfahren Extrakte oder Homogenate proka- ryotischer oder eukaryotischer Zellen, wie z.B. bakterielle Homogenate, Homogenate aus Pflanzenzellen oder Homogenate aus niederen Eukaryoten, wie zum Beispiel Hefen, oder höheren Euka- ryoten, wie zum Beispiel tierischen oder menschlichen Zellen untersuchbar. Bevor man die oben beschriebenen Analyten im erfindungsgemäßen Verfahren einsetzt, kann es von Vorteil sein, höhermolekulare Komponenten, wie z.B. Zellfragmente, Organel- leh, oder Makromoleküle, wie Proteine und Nukleinsäuren, abzu- trennen .The analyte investigated according to the invention is selected, for example, from body fluid samples, such as whole blood, breast milk, cerebrospinal fluid, saliva and urine. In addition, extracts or homogenates of procaryotic or eukaryotic cells, such as bacterial homogenates, homogenates from plant cells or homogenates from lower eukaryotes, such as yeasts, or higher eukaryotes, such as animal or human cells, can be examined with the method according to the invention. Before the analytes described above are used in the method according to the invention, it can be advantageous to remove higher molecular components, such as cell fragments, organo-le, or macromolecules, such as proteins and nucleic acids. separate.
Erfindungsgemäß untersuchbar sind ebenfalls umweltanalytische Proben, wie z.B. Wasser-, Luft- und Bodenproben, Rückstände aus Industrieanlagen, wie z.B. flüssiger oder fester Sondermüll, Filterstäube aus Rauchgasfilteranlagen. Außerdem sind erfindungsgemäß analysierbar Lebensmittelproben. Auch für die Untersuchung von Bodenproben, Rückständen aus Industrieanlagen sowie Lebensmittelproben ist es zweckmäßig, vor der Untersuchung einen geeigneten Extrakt herzustellen. Schließlich besteht die Möglichkeit mit Hilfe des erfin- dungεge äßen Verfahrens Reaktionsgemische chemischer Synthesen, gegebenenfalls nach geeigneter Aufbereitung, wie z.B. Austausch von Lösungsmittel, Aufkonzentrieren oder Verdünnen, auf Effektorfunktion zu untersuchen. Erfindungsgemäß brauchbare Reportergene für verschiedene Wirtszellsysteme sind dem Fachmann aus der oben zitierten Fachliteratur bekannt, worauf hiermit Bezug genommen wird. Beispiele sind lacZ aus E. coli, sowie HIS3 und LEU2 aus Hefe. Entscheidend ist lediglich, daß die Expression des Reportergens erlaubt, das Vorliegen eines Effektors der Protein-Protein- Wechselwirkung im jeweils untersuchten Analyten spezifisch anzuzeigen.Environmental analytical samples, such as e.g. Water, air and soil samples, residues from industrial plants, e.g. liquid or solid special waste, filter dust from flue gas filter systems. Food samples can also be analyzed according to the invention. For the analysis of soil samples, residues from industrial plants as well as food samples, it is advisable to prepare a suitable extract before the analysis. Finally, it is possible with the aid of the process according to the invention, reaction mixtures of chemical syntheses, if appropriate after suitable preparation, such as Exchange of solvent, concentration or dilution, to examine for effector function. Reporter genes which can be used according to the invention for various host cell systems are known to the person skilled in the art from the specialist literature cited above, to which reference is hereby made. Examples are lacZ from E. coli and HIS3 and LEU2 from yeast. The only decisive factor is that the expression of the reporter gene allows the presence of an effector of the protein-protein interaction in the analyte examined in each case to be specifically indicated.
Die vorgegebene intra- und/oder interzelluläre Protein- Protein-Wechselwirkung ist ein Vorgang, der unter physiologi- sehen Bedingungen in prokaryotischen, wie z.B. bakteriellen Zellsystemen, in eukaryotischen Zellen, wie z.B. Hefezellen oder menschlichen Zellen, oder in viralen Mikroorganismen oder bei der Wechselwirkung verschiedener dieser Zellsysteme untereinander, wie z.B. eine Wechselwirkung viraler Proteine mit eukaryotischen Proteinen, abläuft. Durch geeignete Wahl desThe predetermined intra- and / or intercellular protein-protein interaction is a process that occurs under physiological conditions in prokaryotic, e.g. bacterial cell systems, in eukaryotic cells, e.g. Yeast cells or human cells, or in viral microorganisms or in the interaction of different of these cell systems, e.g. an interaction of viral proteins with eukaryotic proteins takes place. By appropriate choice of
Testsystems, insbesondere der zu transformierenden Wirtszellen, kann die Protein-Protein-Wechεelwirkung unter möglichst physiologischen Bedingungen nachgeahmt werden. Erfindungsgemäß sind unterschiedliche Arten von Protein-Protein-Wechselwirkungen anwendbar.Test system, in particular the host cells to be transformed, can mimic the protein-protein interaction under as physiological conditions as possible. According to the invention, different types of protein-protein interactions can be used.
Ein erste Ausführungsform des erfindungsgemäßen Verfahrens basiert auf solchen Wechselwirkungen, die nur dann zustande kommen, wenn ein Effektor im Analyten anwesend ist. Ein po- sitiver Nachweis der Protein-Protein-Wechεelwirkung ist somit gleichbedeutend mit einem positiven Effektor-Nachweis. Der Effektor fungiert in diesem Fall als Mediator oder Aktivator der Wechselwirkung. Ein solches System eignet sich somit besonders zum Screening auf Mediatoren, welche eine Protein-Protein-Wechselwirkung initiieren oder stimulieren. In einer Abwandlung diese Testsystems sind jedoch auch Inhibitoren der Wechselwirkung nachweisbar. Beispielsweise kann man in dem Testsystem einen bekannten Mediator einsetzen und einen Analyten auf Vor- liegen eines Inhibitors der mediatorabhängigen Wechselwirkung testen, wobei der Inhibitor mit dem Mediator, z.B. kompetitiv, um die Bindung an eine der Proteinkomponenten des Testsystems konkurriert.A first embodiment of the method according to the invention is based on such interactions that only occur when an effector is present in the analyte. A po- Positive detection of the protein-protein interaction is therefore synonymous with positive effector detection. In this case, the effector acts as a mediator or activator of the interaction. Such a system is therefore particularly suitable for screening for mediators which initiate or stimulate a protein-protein interaction. In a modification of this test system, however, inhibitors of the interaction can also be detected. For example, a known mediator can be used in the test system and an analyte can be tested for the presence of an inhibitor of the mediator-dependent interaction, the inhibitor competing with the mediator, for example competitively, for binding to one of the protein components of the test system.
Eine zweite Ausführungsform basiert auf Wechselwirkun- gen, die in Gegenwart eines Effektors unterbunden werden. Ein positiver Nachweis der Protein-Protein-Wechselwirkung ist dann gleichbedeutend mit einem negativen Effektor-Nachweis. Ist keine Protein-Protein-Wechselwirkung nachweisbar, so deutet dies auf das Vorliegen eines Inhibitors der Wechselwirkung im Analy- ten hin.A second embodiment is based on interactions that are prevented in the presence of an effector. A positive detection of the protein-protein interaction is then synonymous with a negative effector detection. If no protein-protein interaction is detectable, this indicates the presence of an inhibitor of the interaction in the analyte.
Die erfindungsgemäßen Verfahren werden vorzugsweise so durchgeführt, daß man in ein geeignetes prokaryotisches oder eukaryotisches Wirtszellsystem eine erste und eine zweiten Nu- kleinsäure-Sequenz einführt, wobei die erste Nukleinsäurese- quenz für das Polypeptid-Hybrid A1A2 kodiert, welches die Transkriptions-Aktivierungsdomäne Aj des Transkriptionsfaktors, wie z.B. GAL4, und die Polypeptid-Domäne A2 umfaßt; und die zweite Nukleinsäuresequenz für das Polypeptid-Hybrid B1B kodiert, welches die DNA-Bindungsdomäne B eines Transkriptionsfaktors, wie z.B. GAL4, und die Polypeptid-Domäne B2 umfaßt. Die beiden Nukleinsäuresequenzen können getrennt voneinander vorliegen oder auf einer einzigen Polynukleotidkette lokalisiert sein. Die Einführung der Sequenzen erfolgt nach bekannten Standardverfahren, vorzugsweise durch Transformation des Wirts mit einem ge- eigneten Vektor.The methods according to the invention are preferably carried out in such a way that a first and a second nucleic acid sequence are introduced into a suitable prokaryotic or eukaryotic host cell system, the first nucleic acid sequence coding for the polypeptide hybrid A 1 A 2 , which codes the transcriptional Activation domain A j of the transcription factor, such as GAL4, and the polypeptide domain A 2 ; and the second nucleic acid sequence encodes the polypeptide hybrid B 1 B, which comprises the DNA binding domain B of a transcription factor, such as GAL4, and the polypeptide domain B 2 . The two nucleic acid sequences can be present separately from one another or can be located on a single polynucleotide chain. The sequences are introduced using known standard methods, preferably by transforming the host with a suitable vector.
Der durch Wechselwirkung die Hybridprotein-Domänen A2 und B2 induzierte "funktionelle Transkriptionsaktivatorkomplexw (A1A2/B1B2) entspricht hinsichtlich seiner Funktion im wesentlichen dem nativen Transkriptionsaktivator, von dem die Hybridprotein-Domänen A und B-^ abgeleitet sind. Ebenfalls anwendbar sind funktionelle Äquivalente dieser Domänen, die man durch Aminosäure-Addition, -Deletion und/oder -Substitution unter Beibehaltung der charakteristischen Eigenschaften, wie Bin- dungsspezifität und Aktivierungsspezifität, gentechnisch oder in anderer Weise, herstellen kann.The "functional transcription activator complex w. Induced by the interaction of the hybrid protein domains A 2 and B 2 In terms of its function, (A 1 A 2 / B 1 B 2 ) essentially corresponds to the native transcription activator from which the hybrid protein domains A and B- ^ are derived. Functional equivalents of these domains can also be used, which can be produced by amino acid addition, deletion and / or substitution while maintaining the characteristic properties, such as binding specificity and activation specificity, by genetic engineering or in another manner.
Der Analyt kann vor, mit oder nach Einführung der Nu- kleinsäure-Sequenzen zum Testsystem zugegeben werden. Die für den jeweiligen Analyten geeignetste Verfahrensweise läßt sich anhand weniger Vorversuche vom Fachmann leicht ermitteln. In der Regel ist es von Vorteil, den Analyten verdünnt in einem geeigneten, für das Wirtszellsystem verträglichen Lösungsmittel einzusetzen. Beispiele für geeignete Lösungsmittel sind unge- pufferte oder gepufferte wässrige Lösungen, die gegebenenfalls einen Lösungsvermittler, wie z.B. ein organisches Lösungsmittel, wie beispielsweise DMSO, oder eine kationische, anionische oder nichtionische oberflächenaktive Verbindung , wie z.B. langkettige Fettsäuren oder Salze davon, enthalten.The analyte can be added to the test system before, with or after the introduction of the nucleic acid sequences. The most suitable procedure for the particular analyte can easily be determined by a person skilled in the art on the basis of a few preliminary tests. As a rule, it is advantageous to use the analyte diluted in a suitable solvent that is compatible with the host cell system. Examples of suitable solvents are unbuffered or buffered aqueous solutions, which may contain a solubilizer, such as e.g. an organic solvent, such as DMSO, or a cationic, anionic or nonionic surface-active compound, e.g. long chain fatty acids or salts thereof.
Zur Durchführung des Tests kann das Wirtszellsystem auf einen festen oder halbfesten Träger, wie z.B. Poly erkügelchen oder Agargele, aufgebracht oder fixiert werden. Ebenso besteht die Möglichkeit, das erfindungsgemäße Nachweisverfahren mit Wirtszellen in suspendierter Form durchzuführen. Dies ist für Screening-Verfahren besonders geeignet. Hierzu stellt man beispielsweise eine frische transformierte Wirtszellkultur her, inkubiert die Zellsuspension, gegebenenfalls unter leichtem Erwärmen und/oder leichtem Schütteln oder Rühren, mit dem Ana- lyten. Die Inkubationszeit kann über einen weiten Bereich schwanken und beispielsweise 1 Minute bis 24 Stunden betragen. Anschließend führt man mit der behandelten Zellkultur, gegebenenfalls nach Aufschluß der Zellen, den Nachweis auf Expression des Reportergens durch. Mit dem erfindungsgemäßen Verfahren sind insbesondere Effektoren zellphysiologischer Wechselwirkungen zwischen Proteinen nachweisbar, die in oder zwischen eukaryotischen oder prokaryotischen Zellen, in Viruspartikeln oder zwischen Virusp- artikeln und eukaryotischen Zellen ablaufen. Bei dem Effektor dieser Wechselwirkung kann es sich prinzipiell um eine wohl charakterisierte, bekannte Substanz oder um eine bisher in der Fachwelt nicht beschriebene Substanz handeln. Als ein bevorzugtes Beispiel für einen Effektor, der einen zellphyεiologischen Prozeß beeinflußt, welcher in eukaryotischen Zellen abläuft, kann 2,3,7,8-Tetrachlordibenzo-p- dioxin (TCDD) genannt werden. Das zelluläre Dioxin-Rezeptor- System stellt ein typisches Beispiel für eine Signal-kontrol- lierte Dimerisierung von basischen Helix-Loop-Helix (bHLH) -Faktoren dar. Der Ablauf der durch Dioxin vermittelten zellulären Signaltransduktion läßt sich folgendermaßen zusammenfassen: Vor der Bindung eines Dioxinmoleküls setzt sich das zytosolische Rezeptormolekül aus drei Untereinheiten zusammen: dem Dioxin- bindenden Ah-Rezeptor und zwei Molekülen des 90 kDa-Hitze- schockproteins HSP90. Den HSP90-Untereinheiten kommt dabei die Funktion zu, den Ah-Rezeptor in Abwesenheit eines Liganden in einem inaktiven Zustand zu halten. Nach Bindung eines Dioxin- Moleküls an den Ah-Rezeptor dissoziieren die beiden HSP90-Mole- küle vom Ah-Rezeptor ab, wodurch dieser aktiviert und zur Bindung an das sogenannte Arnt-Protein befähigt wird. Der so gebildete, Dioxin-beladene Komplex ist dann zur Translokation aus dem Zytosol in den Zellkern befähigt. Wie die Deletionsversuche zeigten, erfolgt die Proteindimerisierung über Wechselwirkung der beiden basischen Helix-Loop-Helix-Domänen im Ah-Rezeptor und im Arnt-Protein. Der Dioxin-beladene heterodimere Rezeptorkomplex erkennt eine spezifische DNA-Sequenz, nämlich das sogenannte Xenobiotic Responsible Element (XRE) . Die Bindung an das XRE führt zur Induktion einer Reihe von Zielgenen, u.a. des Gens für das Enzym Aryl Hydrocarbon Hydroxylase (AHH) das am Metabolismus polycyclischer aromatischer Kohlenwasserstoffe beteiligt ist. Die durch die Metabolisierung polychlorierter polycyclischer Aromate, wie TCDD, ausgelösten Pathomechanismen, die z.B. zu Im unsuppression oder Tumorpromotion führen können, sind noch nicht vollständig aufgeklärt.To carry out the test, the host cell system can be applied or fixed to a solid or semi-solid support, such as, for example, poly beads or agar gels. There is also the possibility of carrying out the detection method according to the invention with host cells in suspended form. This is particularly suitable for screening procedures. For this purpose, for example, a fresh transformed host cell culture is prepared, the cell suspension is incubated with the analyte, if appropriate with gentle heating and / or gentle shaking or stirring. The incubation time can vary over a wide range and can be, for example, 1 minute to 24 hours. Then, using the treated cell culture, if appropriate after disruption of the cells, the detection of expression of the reporter gene is carried out. With the method according to the invention, in particular, effectors of cell-physiological interactions between proteins that can be detected in or between eukaryotic or prokaryotic cells, in virus particles or between virus particles articles and eukaryotic cells. The effector of this interaction can in principle be a well-characterized, known substance or a substance not previously described in the specialist world. 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD) can be mentioned as a preferred example of an effector which influences a cell-physiological process which takes place in eukaryotic cells. The cellular dioxin receptor system is a typical example of a signal-controlled dimerization of basic helix-loop-helix (bHLH) factors. The course of the cellular signal transduction mediated by dioxin can be summarized as follows: Before binding a Dioxin molecule, the cytosolic receptor molecule is composed of three subunits: the dioxin-binding Ah receptor and two molecules of the 90 kDa heat shock protein HSP90. The HSP90 subunits have the function of keeping the Ah receptor in an inactive state in the absence of a ligand. After a dioxin molecule has bound to the Ah receptor, the two HSP90 molecules dissociate from the Ah receptor, which activates it and enables it to bind to the so-called Arnt protein. The dioxin-laden complex thus formed is then capable of translocation from the cytosol into the cell nucleus. As the deletion experiments showed, protein dimerization occurs via interaction of the two basic helix-loop-helix domains in the Ah receptor and in the Arnt protein. The dioxin-loaded heterodimeric receptor complex recognizes a specific DNA sequence, namely the so-called Xenobiotic Responsible Element (XRE). Binding to the XRE leads to the induction of a number of target genes, including the gene for the enzyme aryl hydrocarbon hydroxylase (AHH), which is involved in the metabolism of polycyclic aromatic hydrocarbons. The pathomechanisms triggered by the metabolism of polychlorinated polycyclic aromatics, such as TCDD, which can lead to, for example, Im unsuppression or tumor promotion, have not yet been fully elucidated.
Eine Ausführungsform des erfindungsgemäßen Nachweisverfahrens wurde auf Basis des oben beschriebenen Two-Hybrid-Test- systems etabliert, worin man als erste Hybridproteindomäne A2 den Ah-Rezeptor oder ein Bindungεfragment davon verwendet und als zweite Hybridproteindomäne B entweder HSP 90 oder d s Arnt-Protein oder ein bindendes Fragment eines der beiden Faktoren verwendet. Nukleinsäure- und Aminosäuresequenzen des Ah- Rezeptors, des HSP 90 sowie des Arnt-Proteins sind aus dem Stand der Technik bekannt, so daß die zur Durchführung des Tests erforderlichen Nukleinsäuresequenzen für die Herstellung der beiden Polypeptid-Hybride A1A2 und Bj^B-j leicht zur Verfügung gestellt werden können. Für den erfindungsgemäßen Dioxinnachweis sind somit grundsätzlich zwei verschiedene Teεtsyste e denkbar. Im ersten Fall, das heißt bei Verwendung von HSP90 und dem Ah-Rezeptor als Bindungspartner, wird durch die Bindung des Dioxin-Moleküls an den Ah-Rezeptor eine Protein-Protein-Wechselwirkung aufgeho- ben, was zur Folge hat, daß im Testsystem die Expression des Reporter-Gens unterbunden wird. Im zweiten Fall, das heißt bei Verwendung von Arnt-Protein und Ah-Rezeptor als Bindungspartner, wird durch die Bindung des Dioxinmoleküls an den Ah-Rezeptor eine Protein-Protein-Wechselwirkung aufgebaut, so daß im Testsystem die Expression eines Reportergens nachgewiesen werden kann. Für die Durchführung des Dioxinnachweises kann auf Two-Hybrid-Testsysteme zurückzugegriffen werden, welche für Protein-Protein-Bindungstests bereits etabliert wurden. So wird beispielsweise unter der Handelsbezeichnung MATCHMAKER Two-Hy- brid-System von der Firma Clontech Laboratories Inc. , PaoloAn embodiment of the detection method according to the invention was established on the basis of the two-hybrid test system described above, in which A 2 is the first hybrid protein domain uses the Ah receptor or a binding fragment thereof and uses either HSP 90 or ds Arnt protein or a binding fragment of one of the two factors as the second hybrid protein domain B. Nucleic acid and amino acid sequences of the Ah receptor, the HSP 90 and the Arnt protein are known from the prior art, so that the nucleic acid sequences required for carrying out the test for the production of the two polypeptide hybrids A 1 A 2 and B j ^ B- j can be easily provided. In principle, two different test systems are conceivable for the dioxin detection according to the invention. In the first case, that is to say when HSP90 and the Ah receptor are used as binding partners, the binding of the dioxin molecule to the Ah receptor removes a protein-protein interaction, which has the consequence that the Expression of the reporter gene is prevented. In the second case, that is to say when the Arnt protein and Ah receptor are used as binding partners, a binding of the dioxin molecule to the Ah receptor builds up a protein-protein interaction so that the expression of a reporter gene can be detected in the test system. Two-hybrid test systems, which have already been established for protein-protein binding tests, can be used to carry out the dioxin detection. For example, under the trade name MATCHMAKER Two Hybrid System from Clontech Laboratories Inc., Paolo
Alto, USA, ein geeignetes Testsystem vertrieben. Auf die Angaben der Herstellerfirma, insbesondere auf das dem vertriebenen Testsystem beigefügten Versuchsprotokoll wird hiermit vollinhaltlich Bezug genommen. Die Durchführung des Dioxinnachweises unter Verwendung des MATCHMAKER-Systems läßt sich wie folgt zusammenfassen: Das System umfaßt zwei verschiedene ExpressionsVektoren (pGBT9 und pGAD424) , welche Gene für die DNA-Bindungsdomäne (pGBT9) bzw. für die Aktivierungsdomäne (pGAD424) des Hefe-Transkriptions- faktors GAL4 tragen.Alto, USA, a suitable test system sold. Reference is hereby made in full to the information provided by the manufacturer, in particular to the test protocol attached to the test system sold. The implementation of the dioxin detection using the MATCHMAKER system can be summarized as follows: The system comprises two different expression vectors (pGBT9 and pGAD424), which genes for the DNA binding domain (pGBT9) and for the activation domain (pGAD424) of the yeast transcription - wear factor GAL4.
Der pGBT-Vektor wird zur Herstellung einer ersten Nu- kleinsäuresequenz verwendet, welche für ein Hybrid aus Gal4- DNA-Bindungsdomäne und Arnt-Protein besteht. Um diesen Hybrid- vektor zu konstruieren wird eine PCR (Polymerase Chain Reaction) mit den spezifischen Oligonukleotiden H3 und H4 folgender Sequenz:The pGBT vector is used to produce a first nucleic acid sequence which, for a hybrid, consists of a Gal4 DNA binding domain and Arnt protein. To this hybrid A PCR (polymerase chain reaction) with the specific oligonucleotides H3 and H4 of the following sequence is to be constructed in vector:
H3: 5'CGGGATCCCCGAAATGACATCAGATGT (SEQ ID NO: 3)H3: 5'CGGGATCCCCGAAATGACATCAGATGT (SEQ ID NO: 3)
H4: 5'CGGGATCCACCTGCTGGGCAGAAAAG (SEQ ID NO: 4)H4: 5'CGGGATCCACCTGCTGGGCAGAAAAG (SEQ ID NO: 4)
mit der Arnt-cDNA als Matrix durchgeführt. Die spezifischen Primer erlauben Amplifikation des Arnt-Leserasters mit BamHI- Schnittstellen an dessen 5'- und 3 '-Ende. Über die BamHI- Schnittstellen erfolgt die Ligation mit dem BamHI-behandelten pGBT9-Vektor.performed with the Arnt cDNA as a matrix. The specific primers allow amplification of the Arnt reading frame with BamHI cleavage sites at its 5 'and 3' ends. The ligation with the BamHI-treated pGBT9 vector takes place via the BamHI interfaces.
Der pGAD424-Expressionsvektor des Matchmaker-Systems wird verwendet zur Herstellung einer zweiten Nucleinsäurese- quenz, welche für ein Hybrid aus GAL4-Aktivierungsdomäne und dem Ah-Rezeptor dient. Der Leεeraster des Ah-Rezeptors wird ausgehend von der Ah-cDNA mit Hilfe der spezifischen Oligonu- kleotide Hl und H2The pGAD424 expression vector of the matchmaker system is used to produce a second nucleic acid sequence which is used for a hybrid of the GAL4 activation domain and the Ah receptor. The reading frame of the Ah receptor is based on the Ah cDNA with the help of the specific oligonucleotides Hl and H2
Hl: 5,AGGTCGACACTCTGCACCTTGCTTAGGAAT (SEQ ID NO:l)Hl: 5 , AGGTCGACACTCTGCACCTTGCTTAGGAAT (SEQ ID NO: l)
H2: 5'AGGTCGACTTATGAGCAGCGGCGCCAACAT (SEQ ID NO: 2)H2: 5'AGGTCGACTTATGAGCAGCGGCGCCAACAT (SEQ ID NO: 2)
durch PCR amplifiziert. Diese Oligonucleotide versehen den Leseraster des Ah-Rezeptor mit Sall-Schnittstellen. Die auf diese Weise modifizierte Ah-Sequenz kann mit dem Sall-geschnittenen pGAD424-Vektor ligiert werden.amplified by PCR. These oligonucleotides provide the reading frame of the Ah receptor with Sall cleavage sites. The Ah sequence modified in this way can be ligated with the Sall-cut pGAD424 vector.
Die beiden auf diese Weise hergestellten Hybridvektoren pGBT9-Arnt und pGAD424-Ah werden zunächst in E. coli transformiert, vermehrt und gereinigt. Zeigen die isolierten Plasmide die gewünschten Konstrukte, werden pGBT9-Arnt und pGAD424-Ah in SFY526-Hefewirtszellen cotransformiert. Ist Dioxin im Wachstumsmedium anwesend, so ist eine Dimerisierung der beiden ex- pri ierten Fusionsproteine die Folge. Die Dimerisierung der beiden GAL4-Domänen in den beiden Hybrid-Proteine führt zur Aktivierung der Transkription des Reportergens ß-Galactosidase, dessen Bildung in üblicher Weise mittels Farbreaktion nachge- wiesen wird.The two hybrid vectors pGBT9-Arnt and pGAD424-Ah produced in this way are first transformed, propagated and purified in E. coli. If the isolated plasmids show the desired constructs, pGBT9-Arnt and pGAD424-Ah are cotransformed in SFY526 yeast host cells. If dioxin is present in the growth medium, the result is a dimerization of the two expressed fusion proteins. The dimerization of the two GAL4 domains in the two hybrid proteins leads to the activation of the transcription of the reporter gene β-galactosidase, the formation of which is verified in the usual way by means of a color reaction. will be shown.
Erfindungsgemäß wurde überraschenderweise festgestellt, daß die Nachweisempfindlichkeit für 2,3,7,8-TCDD pro Ansatz im unteren Femtomol- bis oberem Atomol-Bereich und somit im Be- reich der Nachweisgrenze der derzeit auf dem Markt erhältlichen empfindlichsten Massenspektrometer liegt.According to the invention, it was surprisingly found that the detection sensitivity for 2,3,7,8-TCDD per batch is in the lower femtomol to upper atomol range and thus in the range of the detection limit of the most sensitive mass spectrometers currently available on the market.
Das oben genannte HSP90 Protein zeigt nicht nur eine regulatorische Wirkung auf den Ah-Rezeptor, dessen natürliche Liganden unbekannt sind, jedoch mit Hilfe des erfindungsgemäßen Screening-Verfahrens nachweisbar sind. HSP90 fungiert auch als Repressor für Steroidrezeptoren, wie z.B. den Östrogen- und den Androgen-Rezeptor. Da immer mehr Xenobiotika identifiziert werden, für die eine östrogen- oder androgenähnliche Wirkung vermutet wird, wäre ein erfindungsgemäßes Nachweisverfahren auch zum Sreening auf solche Substanzen geeignet. In diesem Fall sollte der zu identifizierende Effektor einen inhibitorischen Effekt auf ein interagierendes Hybridproteinpaar besitzen, umfassend die Hybridproteine Steroidrezeptor-Al und HSP90-B1, wobei AI und Bl zusammen den funktionalen Transkriptionsaktiva- tor-Komplex bilden sollten.The above-mentioned HSP90 protein not only shows a regulatory effect on the Ah receptor, the natural ligands of which are unknown, but can be detected using the screening method according to the invention. HSP90 also acts as a repressor for steroid receptors such as the estrogen and androgen receptors. Since more and more xenobiotics are identified for which an estrogen or androgen-like effect is suspected, a detection method according to the invention would also be suitable for screening for such substances. In this case, the effector to be identified should have an inhibitory effect on an interacting hybrid protein pair, comprising the hybrid proteins steroid receptor-Al and HSP90-B1, where AI and B1 together should form the functional transcription activator complex.
Gemäß einer weiteren bevorzugten Ausführungsform wird ein Nachweisverfahren für Effektoren viraler Protein-Protein- Wechselwirkungen bereitgestellt. Dieses kann in völliger Analogie zu dem oben beschriebenen Dioxintest durchgeführt werden. Insbesondere werden gemäß dieser Ausführungsform Wechselwirkungen zwischen den Poliovirus-Capsidproteinen VP1 und VP3 sowie zwischen zwei plδ-Capsidproteinen bzw. zwei p24-Capsidproteinen aus HIV-1 getestet. Beispiele für die Zusammensetzung in einem die erfindungsgemäßen Verfahren zum Nachweis viraler Protein- Protein-Wechselwirkungen anwendbarer Hybrid-Konstrukte A1A2 und B1B sind in folgender Tabelle 1 angegeben. Tabelle 1According to a further preferred embodiment, a detection method for effectors of viral protein-protein interactions is provided. This can be carried out in complete analogy to the dioxin test described above. In particular, according to this embodiment, interactions between the poliovirus capsid proteins VP1 and VP3 and between two plδ-capsid proteins or two p24-capsid proteins from HIV-1 are tested. Examples of the composition in a hybrid construct A 1 A 2 and B 1 B which can be used for the detection of viral protein-protein interactions according to the invention are given in Table 1 below. Table 1
Domäne Al A2 Bl B2 Domain Al A 2 B l B 2
Poliovirus GAL4-BD VP1 GAL4-AD VP3Poliovirus GAL4-BD VP1 GAL4-AD VP3
HIV-1 GAL4-BD pl8 GAL4-AD pl8HIV-1 GAL4-BD pl8 GAL4-AD pl8
HIV-1 GAL4-BD p24 GAL4-AD p24HIV-1 GAL4-BD p24 GAL4-AD p24
Al = DNA-Bindungsdomäne A2 = erstes virales Zielprotein Bl = Aktivatordomäne A l = DNA binding domain A 2 = first viral target protein Bl = activator domain
B2 = zweites virales Zielprotein BD = Bindungsdomäne AD = Aktivatordomäne B 2 = second viral target protein BD = binding domain AD = activator domain
VP1 und VP3 können in den obengenannten Hybriden auch gegeneinander vertauscht sein.VP1 and VP3 can also be interchanged in the above hybrids.
Wie oben für den Dioxin-Test beschrieben, können die kodierenden und mit geeigneten Restriktionsschnittstellen versehenen DNA-Sequenzen für die viralen Hybridproteinkomponenten A2 und B2 hergestellt und in die oben beschriebenen Vektoren pGBT9 bzw. pGAD424 insertiert werden. Die Durchführung des Two- Hybrid-Tests zum Nachweis eines Effektors der viralen Protein- Protein-Wechselwirkung erfolgt dann in Analogie zum oben beschriebenen Dioxin-Test. Dieses Testsystem ist auch auf alle anderen Protein-Protein-Wechselwirkungen unter Beteiligung viraler Proteine übertragbar.As described above for the dioxin test, the coding and provided with suitable restriction cleavage DNA sequences for the viral hybrid protein components A2 and B2 can be prepared and inserted into the vectors pGBT9 and pGAD424 described above. The two-hybrid test for detecting an effector of the viral protein-protein interaction is then carried out in analogy to the dioxin test described above. This test system can also be applied to all other protein-protein interactions involving viral proteins.
Viren, welche neben dem Proteincapsid zusätzlich über einen Envelope mit Glykoproteinen verfügen, können ebenfalls als Grundlage für ein erfindungsgemäßes Verfahren verwendet werden. Die Glykoproteine des Envelopes wechselwirken bekanntlich mit den Capsidproteinen. Diese Wechselwirkung ist notwendig, um das Virus mit der Envelope-Struktur auszustatten und gleichzeitig aus der Zelle auszuschleusen. So zeigt beispielsweise der Semliki-Forest-Virus zwei Spike-Glykoproteine El und E2, die, wie viele andere virale Hüll-Glykoproteine, aus drei Domänen bestehen: einer externen, einer Transmembran- und einer internen Domäne. Die interne, C-terminale Domäne tritt in Wechselwirkung mit den Capsid-Proteinen. Ein Two-Hybrid-Test zum Nachweis von Effektoren dieser Wechselwirkung kann in der Weise etabliert werden, daß man die kodierende Sequenz für das Cap- sid-Protein und das Envelope-Glykoprotein, oder bevorzugt die DNA-Sequenz wechselwirkender Fragmente dieser beiden Proteine in die oben beschriebenen Vektoren insertiert und die auf den Vektoren enthaltene genetische Information in Gegenwart eines Analyten exprimiert. Ein Two-Hybrid Verfahren zum Nachweis von Effektoren der Wechselwirkung zwiεchen viralen Capεiden undViruses which, in addition to the protein capsid, also have an envelope with glycoproteins can also be used as the basis for a method according to the invention. As is known, the glycoproteins of the envelope interact with the capsid proteins. This interaction is necessary to equip the virus with the envelope structure and at the same time to remove it from the cell. For example, the Semliki Forest virus shows two spike glycoproteins El and E2, which, like many other viral envelope glycoproteins, consist of three domains: one external, one transmembrane and one internal domain. The internal, C-terminal domain interacts with the capsid proteins. A two-hybrid test for the detection of effectors of this interaction can be established in such a way that the coding sequence for the capsid protein and the envelope glycoprotein, or preferably the DNA sequence of interacting fragments of these two proteins in the Vectors described above inserted and the genetic information contained on the vectors expressed in the presence of an analyte. A two-hybrid method for the detection of effectors of the interaction between viral capsids and
Envelope-Proteinen εtellt εomit eine weitere bevorzugte Ausführungsform dar.Envelope proteins thus represent another preferred embodiment.
Für den Fachmann wird aus obigen Ausführungen ersichtlich, daß die vorliegende Erfindung nicht auf die oben be- schriebenen konkreten Ausführungsformen und die beiliegenden Beispiele beschränkt ist. Vielmehr können unter Anwendung des erfindungεgemäßen Testprinzips weitere Testsysteme etabliert werden, welche auf definierten Protein-Protein-Wechselwirkungen unter Beteiligung eukaryotischer, prokaryotischer, und/oder viraler Proteine beruhen. Die Erfindung ist außerdem nicht auf die Verwendung der oben beschriebenen konkreten Vektoren und Wirtszellen beschränkt, vielmehr sind auch alle anderen vergleichbaren Testsysteme, wie z.B. die bisher in der Fachliteratur beschriebenen Expressionsvektoren und Wirtszellen anwend- bar.It will be apparent to those skilled in the art from the above that the present invention is not limited to the specific embodiments described above and the accompanying examples. Rather, using the test principle according to the invention, further test systems can be established which are based on defined protein-protein interactions with the participation of eukaryotic, prokaryotic, and / or viral proteins. Furthermore, the invention is not restricted to the use of the specific vectors and host cells described above, but rather all other comparable test systems, such as e.g. the expression vectors and host cells described so far in the specialist literature can be used.
Ein weiterer Gegenstand der vorliegenden Erfindung betrifft ein Verfahren zur Isolierung neuer Effektoren intra- und/oder interzellulärer Protein-Protein-Wechselwirkungen, wobei man a) einen Analyten einem Nachweisverfahren gemäß obiger Definition unterzieht; b) bei positivem Nachweis einer Effektorfunktion in demThe present invention further relates to a method for isolating new effectors of intra- and / or intercellular protein-protein interactions, in which a) an analyte is subjected to a detection method as defined above; b) with positive proof of an effector function in the
Analyten diese mit herkömmlichen präparativen Methoden, gegebenenfalls durch weitere Auftrennung des Analyten, eingrenzt und den Effektor, gegebenenfalls mit Hilfe des Nachweisverfahrens gemäß obiger Definition, oder in anderer Weise, wie z.B. durch Spektroskopie, Hochdrucksflüssigkeitschromatographie, Dünnschichtchromatographie, lokalisiert und mit herkömmlichen präparativen Methoden, wie z.B. Chromatographie, isoliert.Analytes are limited using conventional preparative methods, if necessary by further separation of the analyte, and the effector, if necessary with the aid of the detection method as defined above, or in another way, such as by spectroscopy, high-pressure liquid chromatography, thin-layer chromatography, localized and isolated using conventional preparative methods such as chromatography.
Ein weiterer Gegenstand der Erfindung betrifft Nucleinsauresequenzen, wie z.B. DNA-, RNA- oder cDNA-Sequenzen, welche für Polypeptid-Hybride kodieren, die Polypeptid-Domänen gemäß obiger Definition oder funktionale Äquivalente davon enthalten. Bevorzugte Beispiele für Nucleinsauresequenzen sind die für die Polypeptid-Hybride GAL4-Bindungsdomäne/Arnt und GAL4-Aktivierungsdomäne/Ah kodierenden Sequenzen. Gegenstand der Erfindung ist außerdem ein Analysenkit zur Durchführung eines der oben beschriebenen Nachweisverfahren. Der erfindungsgemäße Analysenkit ist dadurch gekennzeichnet, daß er, vorzugsweise in getrennten Ko partimenten, umfaßt: a) eine erste kodierende Nukleinsäuresequenz, wie z.B. ei- nen Transformationsvektor, kodierend für ein Polypeptid- Hybrid A1A2, b) eine zweite Nukleinsäuresequenz, wie z.B. einen Transformationsvektor, kodierend für ein Polypeptid-Hybrid B1B2 und gegebenenfalls c) eine Wirtszellkultur, die die genetische Information für ein Reporter-Gen enthält, das unter der genetischen Kontrolle einer stromaufwärts gelegenen Transkriptions-Ak- tivierungssequenz steht, an welche, nach Einführung der ersten und zweiten Nukleisäuresequenz, z.B. durch Trans- formation, in die Wirtszelle der Transkriptions-Aktiva- tor-Komplex A-j^ bindet, wenn die Hybridprotein-Domänen A2 und B2 in Gegenwart oder in Abwesenheit eines Effektors miteinander wechselwirken.The invention further relates to nucleic acid sequences, such as, for example, DNA, RNA or cDNA sequences, which code for polypeptide hybrids which contain polypeptide domains as defined above or functional equivalents thereof. Preferred examples of nucleic acid sequences are the sequences coding for the polypeptide hybrids GAL4 binding domain / Arnt and GAL4 activation domain / Ah. The invention also relates to an analysis kit for carrying out one of the detection methods described above. The analysis kit according to the invention is characterized in that it comprises, preferably in separate compartments: a) a first coding nucleic acid sequence, such as, for example, a transformation vector coding for a polypeptide hybrid A 1 A 2 , b) a second nucleic acid sequence, such as for example a transformation vector coding for a polypeptide hybrid B 1 B 2 and optionally c) a host cell culture which contains the genetic information for a reporter gene which is under the genetic control of an upstream transcription activation sequence to which, after introduction of the first and second nucleic acid sequence, for example by transformation, the transcription-activator complex A- j ^ binds into the host cell if the hybrid protein domains A 2 and B 2 interact with one another in the presence or in the absence of an effector .
Die erste und zweite Nukleinsäuresequenz können aber auch auf einem einzigen Vektor angeordnet sein. Die erfindungsgemäß verwendeten Vektoren enthalten die kodierenden Sequenzen üblicherweise unter der Kontrolle von üblichen, dem Fachmann bekannten, regulatorischen Sequenzen, welche die Expression der Hybridproteine im jeweiligen Wirt steuern. Die vorliegende Erfindung wird nun anhand der folgenden Ausführungsbeispiele, welche die Etablierung eines Dioxin- Screening-Systems betreffen, näher erläutert. Beispiel 1However, the first and second nucleic acid sequences can also be arranged on a single vector. The vectors used according to the invention usually contain the coding sequences under the control of customary regulatory sequences known to the person skilled in the art which control the expression of the hybrid proteins in the respective host. The present invention will now be explained in more detail with reference to the following exemplary embodiments, which relate to the establishment of a dioxin screening system. example 1
Bereitstellung eineε Testsystems für den genetischen Pioxin-NachweiεProvision of a test system for the genetic Pioxinverweis
1. Herstellung der Plasmidkonstrukte pGAD424-Ah und pGBT9- Arnt 1.1 Allgemeine Vorschrift für die Durchführung der Polymera- se Chain Reaction (PCR)1. Preparation of the plasmid constructs pGAD424-Ah and pGBT9-Arnt 1.1 General instructions for carrying out the polymer chain reaction (PCR)
Es wurden folgende Primer synthetisiert: Oligonucleotid Hl: 5'AGGTCGACACTCTGCACCTTGCTTAGGAAT Oligonucleotid H2: 5'AGGTCGACTTATGAGCAGCGGCGCCAACAT Oligonucleotid H3 : 5 'CGGGATCCCCGAAATGACATCAGATGT Oligonucleotid H4: 5'CGGGATCCACCTGCTGGGCAGAAAAGThe following primers were synthesized: oligonucleotide Hl: 5'AGGTCGACACTCTGCACCTTGCTTAGGAAT oligonucleotide H2: 5'AGGTCGACTTATGAGCAGCGGCGCCAACAT oligonucleotide H3: 5 'CGGGATCCCCGAAATGACATCAGATGGGATCCAGAAGATGCT 5GAGGACACAQGGGAGGACACA
Das PCR-Protokoll wurde in etwas veränderter Form entsprechend den Angaben von Perkin-Elmer-Cetus (Protokoll für DNA Amplifikation) durchgeführt. Für die Ampli- fikation eines DNA-Fragments mit Hilfe der PCR wurde folgender Reaktionsansatz pipettiert:The PCR protocol was carried out in a slightly modified form in accordance with the information from Perkin-Elmer-Cetus (protocol for DNA amplification). The following reaction mixture was pipetted for the amplification of a DNA fragment using PCR:
Figure imgf000025_0001
Figure imgf000025_0001
Die Reaktion erfolgte in 100 μl Endvolumen in silico- nisierten, autoklavierten Reaktionsgefäßen. Die PCR wurde im DNA Thermocycler 1 min bei 95°C, 3 min bei 60°C und 2,5 min bei 72°C durchgeführt. Der 72°C-Schritt wurde pro Zyklus um 2 s verlängert. Insgesamt umfaßte die PCR 30 Zyklen. Die PCR wurde mit einem "Hot start" (zu Beginn 5 min 95°C) gestartet und nach 10 min bei 72°C beendet. 1.2 Synthese der Plasmidkonstrukte pGAD424-Ah und pGBT9-ArntThe reaction was carried out in a final volume of 100 μl in siliconized, autoclaved reaction vessels. The PCR was carried out in the DNA thermal cycler for 1 min at 95 ° C, 3 min at 60 ° C and 2.5 min at 72 ° C. The 72 ° C step was extended by 2 s per cycle. The PCR comprised a total of 30 cycles. The PCR was started with a "hot start" (at the beginning 5 minutes at 95 ° C.) and ended after 10 minutes at 72 ° C. 1.2 Synthesis of the plasmid constructs pGAD424-Ah and pGBT9-Arnt
1.2.1 Materialen1.2.1 materials
Die Plasmide pGAD424 und pGBT9 (Fig. 1 (A) und (B) ) sind von der Firma Clontech Laboratories, Inc., Palo Alto, CA, USA erhältlich. Ah-cDNA und Arnt-cDNA können in herkömmlicher Weise aus Ah- und Arnt-Protein expri- mierenden Zellen isoliert werden. Die cDNA Klonierung sowie DNA- und Aminosäuresequenz von murinen Ah-Protein werden beispielsweise beschrieben von Erna, M. et al., in Biochem. Biophys. Res. Communications (1992), Bd. 184, 246-253, auf dessen Inhalt hiermit ausdrücklich Bezug genommen wird. Das murine Ah-Pro- tein stellt ein Polypeptid aus 805 Aminosäuren mit einem berechneten Molekulargewicht von 90380 Dalton dar.The plasmids pGAD424 and pGBT9 (Fig. 1 (A) and (B)) are available from Clontech Laboratories, Inc., Palo Alto, CA, USA. Ah cDNA and Arnt cDNA can be isolated in a conventional manner from cells expressing Ah and Arnt protein. The cDNA cloning and DNA and amino acid sequence of murine Ah protein are described, for example, by Erna, M. et al. In Biochem. Biophys. Res. Communications (1992), Vol. 184, 246-253, the content of which is hereby expressly incorporated by reference. The murine Ah protein is a polypeptide of 805 amino acids with a calculated molecular weight of 90380 daltons.
Die cDNA Klonierung des humanen Arnt-Proteins wird beispielsweise beschrieben von Hoffman, E.C. et al. in Science (1991), Bd. 252, 954-958, auf dessen Inhalt hiermit ausdrücklich Bezug genommen wird. Das humaneThe cDNA cloning of the human Arnt protein is described, for example, by Hoffman, E.C. et al. in Science (1991), Vol. 252, 954-958, the content of which is hereby expressly incorporated by reference. The humane
Arnt-Protein umfaßt 789 Aminosäuren und besitzt ein berechnetes Molekulargewicht von 86637 Dalton.Arnt protein contains 789 amino acids and has a calculated molecular weight of 86637 daltons.
Da die kodierenden DNA-Sequenzen außerdem aus dem Stand der Technik bekannt sind, können die zur Durchfüh- rung der folgenden Beispiele erforderlichen DNA-Moleküle auch auf synthetischem Weg bereitgestellt werden.Since the coding DNA sequences are also known from the prior art, the DNA molecules required to carry out the following examples can also be provided synthetically.
1.2.2 Allgemeine Vorschrift für Restriktionsverdau und Liga- tion zur Herstellung der Plasmidkonstrukte1.2.2 General instructions for restriction digestion and ligation for the preparation of the plasmid constructs
Zu ca. 2 mg DNA in bidestilliertem Wasser wurden 2 ml Restriktionsenzympuffer (lOx) und 10-20 ü der betreffenden Restriktionsenzyme gegeben, mit bidestilliertem Wasser auf 20 ml aufgefüllt, vorsichtig gemischt und bei 37 'C 1-2 Stunden inkubiert. Die entsprechend behandelte DNA wurde auf einem 0,8 % Agarose-TBE Gel aufgetrennt und mit dem QIAEX-Gel-Extraction-Kit (QIAGEN) nach Angaben des Herstellers aufgereinigt. Die Ligation der isolierten DNA-Fragmente erfolgte in lxLigasepuf er in einem Volumen von maximal 20 μl mit l U T4-Ligase bei 16 'C über Nacht. In der Regel lagen Vektor und Insert in einem stöchiometrischen Verhältnis von 1:3 vor.2 ml of restriction enzyme buffer (10x) and 10-20 μl of the restriction enzymes in question were added to about 2 mg of DNA in double-distilled water, made up to 20 ml with double-distilled water, mixed carefully and incubated at 37 ° C. for 1-2 hours. The correspondingly treated DNA was separated on a 0.8% agarose TBE gel and purified using the QIAEX gel extraction kit (QIAGEN) according to the manufacturer's instructions. The isolated DNA fragments were ligated in lx ligase buffer in a maximum volume of 20 μl with 1 U T4 ligase at 16 ° C. overnight. As a rule, the vector and insert were present in a stoichiometric ratio of 1: 3.
1.2.3 Herstellung von pGAD424-Ah1.2.3 Production of pGAD424-Ah
Mit Hilfe der PCR-Methode wurde unter Verwendung der spezifischen Oligonucleotide Hl und H2 , ausgehend von der Ah-cDNA-Matrix, die codierende Sequenz des Ah-Rezep- tors amplifiziert. Die synthetischen Oligonucleotide wurden so konstruiert, daß in das amplifizierte Ah-Frag- ent am 3'- und 5 '-Ende Sall Schnittstellen eingeführt wurden. Das gereinigte PCR-Ah-Fragment wurde einem Sall- Restriktionsverdau unterworfen und in den ebenfalls mit Sall geschnittenen pGAD424-Vektor ligiert (Fig. 2(B)). Die nach Transformation in den E. coli Stamm MC4lrF' erhaltenen Klone (Selektion auf Amp-Resistenz) wurden hin- sichtlich ihrer Plasmide untersucht. Anhand eines EcoRI Restriktionsverdaus konnte bestimmt werden, welche Bak- terienklone das gewünschte Konstrukt pGAD424-Ah enthielten. Der entsprechende Bakterienklon wurde vermehrt und die Plasmid-pGAD424-Ah-DNA isoliert. Für die Plasmid- Isolierung aus transformierten E.coli Zellen wurde der QIAGEN-Plasmid-Kit in Kombination mit QIAGEN-Tip-200 Säulen verwendet. Die Isolierung der Plasmid-DNA erfolgte nach den Angaben des Herstellers. Für die Plasmidis- olierung wurde eine 150 ml Übernachtkultur der transfor- mierten E.coli Zellen verwendet. Die Plasmidausbeute einer Isolierung lag für Plasmid pGAD424-Ah zwischen 0,5 und 1 mg/ml.The coding sequence of the Ah receptor was amplified using the PCR method using the specific oligonucleotides H1 and H2, starting from the Ah cDNA matrix. The synthetic oligonucleotides were constructed so that Sall interfaces were introduced into the amplified Ah fragment at the 3 'and 5' ends. The purified PCR Ah fragment was subjected to a Sall restriction digest and ligated into the pGAD424 vector, which was also cut with Sall (FIG. 2 (B)). The clones obtained after transformation into the E. coli strain MC4lrF '(selection for amp resistance) were examined with regard to their plasmids. Using an EcoRI restriction digest, it was possible to determine which bacterial clones contained the desired construct pGAD424-Ah. The corresponding bacterial clone was grown and the plasmid pGAD424-Ah DNA isolated. The QIAGEN plasmid kit in combination with QIAGEN-Tip-200 columns was used for plasmid isolation from transformed E. coli cells. The plasmid DNA was isolated according to the manufacturer's instructions. A 150 ml overnight culture of the transformed E. coli cells was used for the plasmid isolation. The plasmid yield of an isolation for plasmid pGAD424-Ah was between 0.5 and 1 mg / ml.
1.2.4 Herstellung von pGBT9-Arnt1.2.4 Production of pGBT9-Arnt
Mit Hilfe der PCR-Methode wurde unter Verwendung der spezifischen Oligonucleotide H3 und H4, ausgehend von der Arnt-cDNA-Matrix (SEQ ID NO: 5), die codierende Sequenz des Arnt-Rezeptors (SEQ ID NO: 6) amplifiziert. Die synthetischen Oligonucleotide wurden so konstruiert, daß in das amplifizierte Arnt-Fragment am 3'- und 5'- Ende BamHI Schnittstellen eingeführt wurden. Das gerei- nigte PCR-Arnt-Fragment wurden einem Ba HI-Restriktions- verdau unterworfen und in den ebenfalls mit BamHI geschnittenen pGBT9-Vektor ligiert (Fig. 2 (A) ) . Die nach Transformation in den E. coli Stamm MC41rF' erhaltenen Klone (Selektion auf Amp-Resistenz) wurden hinsichtlich ihrer Plaεmide untersucht. Anhand eines EcoRI Restriktionsverdaus konnte bestimmt werden, welche Bakterien- klone das gewünschte Konstukt pGBT9-Arnt enthielten. Der entsprechende Bakterienklon wurde vermehrt und die Plas- mid-pGBT9-Arnt-DNA isoliert. Für die Plasmid-Isolierung aus transformierten E.coli Zellen wurde der QIAGEN-Plas- mid-Kit in Kombination mit QIAGEN-Tip-200 Säulen verwendet. Die Isolierung der Plasmid-DNA erfolgte nach den Angaben des Herstellers. Für die Plasmidisolierung wurde eine 150 ml Übernachtkultur der transformierten E.coli Zellen verwendet. Die Plasmidausbeute einer Isolierung lag für pGBT9-Arnt zwischen 0,5 und 1 mg/ml.Using the PCR method, using the specific oligonucleotides H3 and H4, starting from the Arnt cDNA matrix (SEQ ID NO: 5), the coding Sequence of the Arnt receptor (SEQ ID NO: 6) amplified. The synthetic oligonucleotides were constructed so that BamHI cleavage sites were introduced into the amplified Arnt fragment at the 3 'and 5' ends. The purified PCR-Arnt fragment was subjected to a Ba HI restriction digest and ligated into the pGBT9 vector which had also been cut with BamHI (FIG. 2 (A)). The clones obtained after transformation into the E. coli strain MC41rF '(selection for amp resistance) were examined with regard to their plasmids. Using an EcoRI restriction digest, it was possible to determine which bacterial clones contained the desired construct pGBT9-Arnt. The corresponding bacterial clone was expanded and the plasmid pGBT9 Arnt DNA was isolated. The QIAGEN plasmid kit in combination with QIAGEN-Tip-200 columns was used for the plasmid isolation from transformed E. coli cells. The plasmid DNA was isolated according to the manufacturer's instructions. A 150 ml overnight culture of the transformed E. coli cells was used for plasmid isolation. The plasmid yield of isolation for pGBT9-Arnt was between 0.5 and 1 mg / ml.
1.3. Transformation der Plasmide pGAD424-Ah und pGBT9-Arnt in dem Hefestamm SFY5261.3. Transformation of the plasmids pGAD424-Ah and pGBT9-Arnt in the yeast strain SFY526
1.3.1 Herstellung kompetenter Hefezellen1.3.1 Production of competent yeast cells
20 ml YPD Medium wurden mit einer Hefe-Einzelkolonie angeimpft und über Nacht bei 30 'C geschüttelt. Die 20 ml Übernachtkultur sollte nach dieser Zeit die stationäre Phase erreicht haben, d.h. eine OD > 1,5 zeigen. Die Übernachtkultur wurde verwendet, um 300 ml frisches YPD Medium anzuimpfen; diese 300 ml Kultur mit einer OD60o von 0,2-0,3 wurde 3 Stunden bei 30 *C geschüttelt. Die Zellen wurden abzentrifugiert, das Pellet in 50 ml sterilem, bidestilliertem Wasser zweimal gewaschen und in 1,5 ml frischem, sterilem IxTE -" iAC-Puffer (unmittelbar vor Verwendung hergestellt aus lOxTE-Puffer (0,1 M Tris- HC1, lO M EDTA, pH 7,5) und lOxLiAC-Puffer (IM Lithium- acetat, pH 7,5)) resuspendiert. Die kompetenten Hefezellen wurden sofort für die Transformation verwendet.20 ml of YPD medium were inoculated with a single yeast colony and shaken at 30 ° C. overnight. The 20 ml overnight culture should have reached the stationary phase after this time, ie show an OD> 1.5. The overnight culture was used to inoculate 300 ml of fresh YPD medium; this 300 ml culture with an OD 60 o of 0.2-0.3 was shaken at 30 ° C. for 3 hours. The cells were centrifuged off, the pellet was washed twice in 50 ml of sterile, double-distilled water and in 1.5 ml of fresh, sterile IxTE - " iAC buffer (prepared immediately before use from 10XTE buffer (0.1 M Tris HC1, lO M EDTA, pH 7.5) and lOxLiAC buffer (IM lithium acetate, pH 7.5)). The competent yeast cells were used immediately for the transformation.
1.3.2 Transformation kompetenter Hefezellen1.3.2 Transformation of competent yeast cells
Zu 0,1 μg Plasmid-DNA und 100 μg Carrier DNA ("herring testes carrier DNA") wurden 0,1 ml kompetente Hefezellen pipettiert sowie 0,6 ml PEG/LiAc Lösung (40% PEG 4000, IxTE, lx LiAC, frisch hergestellt) . Der Ansatz wurde gut gemischt und bei 30 'C 30 min geschüttelt. Nach der Zugabe von 70 μl DMSO folgte ein 15 min Hitzeschock bei 42 *C. Die Zellen wurden anschließend auf Eis abgekühlt, abzentrifugiert und das Pellet in 0,5 ml TE-Puf- fer resuspendiert. 0,25 ml der transformierten Zellen wurden auf SD-Platten (-Leu, -Trp) ausplattiert und die Platten 2-4 Tage bei 30' C inkubiert, bis sich die ersten Kolonien zeigten.0.1 ml of competent yeast cells were pipetted into 0.1 μg of plasmid DNA and 100 μg of carrier DNA (“herring testes carrier DNA”) and 0.6 ml of PEG / LiAc solution (40% PEG 4000, IxTE, lx LiAC, fresh) manufactured) . The mixture was mixed well and shaken at 30 ° C. for 30 minutes. After the addition of 70 μl DMSO, there was a 15 min heat shock at 42 * C. The cells were then cooled on ice, centrifuged and the pellet resuspended in 0.5 ml TE buffer. 0.25 ml of the transformed cells were plated out on SD plates (-Leu, -Trp) and the plates were incubated for 2-4 days at 30 ° C. until the first colonies appeared.
1.3.3 Cotransformationen1.3.3 Cotransformations
Zusätzlich zur Cotransformation mit den Plas iden pGAD424-Ah und pGBT9-Arnt wurden als negative bzw. positive Kontrollen folgende Plasmidkombinationen ebenfalls in SFY526 transformiert.In addition to the cotransformation with the plasmids pGAD424-Ah and pGBT9-Arnt, the following plasmid combinations were also transformed into SFY526 as negative or positive controls.
a ) pGAD424 /pGBT9-Amt b) pGAD424-Ah/pGBT9 c) pLAM 5'/pTDl d) pLAM δ'/pCLla) pGAD424 / pGBT9-Amt b) pGAD424-Ah / pGBT9 c) pLAM 5 '/ pTDl d) pLAM δ' / pCLl
pLAM 5' kodiert für ein Hybrid aus GAL4 Bindungsdomäne und humanem Lamin C; pTDl kodiert für ein Hybrid aus GAL4 Aktivatordomäne und SV40 large T-Antigen; pCLl kodiert für ein full-length GAL 4. Die Plaεmide pLAM5', pTDl und pCLl sind ebenfalls von der Fa. Clontech Laboratories Inc. erhältlich.pLAM 5 'encodes a hybrid of GAL4 binding domain and human Lamin C; pTDl codes for a hybrid of GAL4 activator domain and SV40 large T antigen; pCLl codes for a full-length GAL 4. The plasmids pLAM5 ', pTDl and pCLl are also available from Clontech Laboratories Inc.
1.4 Dioxin-Nachweis durch Bestimmung der Interaktion des Gal4-DNA-Bindungsdomäne/Arnt-Fusionsproteins (kodiert von pGBT9-Arnt) mit dem Gal4-Transkriptions-Akti- vierungsdomäne/Ah-Fusionsprotein (kodiert von pGAD424- Ah) .1.4 Detection of dioxin by determining the interaction of the Gal4 DNA binding domain / Arnt fusion protein (encoded by pGBT9-Arnt) with the Gal4 transcription activation domain / Ah fusion protein (encoded by pGAD424-Ah).
1.4.1 Nachweis auf Agarplatten1.4.1 Detection on agar plates
Die erfolgreich transformierten SFY 526 Hefen wurden auf SSX-Indikator-Platten ausgestrichen.The successfully transformed SFY 526 yeasts were streaked on SSX indicator plates.
Die SSX-Indikator-Platten (Chien et al. 1991) weisen folgende Zusammensetzung auf:The SSX indicator plates (Chien et al. 1991) have the following composition:
Yeast-Nitrogen-Base 6,7 gYeast nitrogen base 6.7 g
Agar 14 g
Figure imgf000030_0001
lOxAminosäuren (-Leu-Trp) 100 mlAgar 14 g
Figure imgf000030_0001
lOxAmino acids (-Leu-Trp) 100 ml
20 % Sucrose 100 ml20% sucrose 100 ml
5-Brom-4-chlor-3-indolyl-ß- -D- -galaktosid5-bromo-4-chloro-3-indolyl-β- -D- galactoside
(X-Gal) 40 mg(X-Gal) 40 mg
H 0 bidest. ad 1 1H 0 bidest. ad 1 1
Die SSX Platten enthalten die Substanz X-Gal, welche nach Interaktion der Fusionsproteine zu einem blauen Farbstoff umgesetzt wird. Während die Kontroll-Hefen (pLAM5'/PCL-L) nach Wachstum (o/n) auf SSX Platten eine eindeutige Blaufärbung zeigten, war dies bei den anderen Plasmidkombinationen nicht der Fall.The SSX plates contain the substance X-Gal, which is converted into a blue dye after interaction of the fusion proteins. While the control yeasts (pLAM5 '/ P CL -L) showed a clear blue color after growth (o / n) on SSX plates, this was not the case with the other plasmid combinations.
Die pGAD424-Ah/pGBT9-Arnt SFY5426 Hefen ließen nach Auflegen von 2, 3,7, 8-Tetrachlordibenzo-p-dioxin (TCDD) enthaltenden Pads (TCDD wurde in 10 % DMSO auf die Pads aufgetragen) auf die SSX-Platten eine spezifische, konzentrationsabhängige Blaufärbung im Bereich der Kontaktflächen erkennen, nicht jedoch die Kontroll-Hefen (pGAD424/pGBT9-Arnt; pGAD424-Ah/pGBT9 , pLAM 5'/pTDl), Die Nachweisgrenze für 2,3,7,8-TCDD lag im Bereich von 0, 1 ng pro Pad.The pGAD424-Ah / pGBT9 type SFY5426 yeasts were placed on the SSX plates after placing 2, 3,7, 8-tetrachlorodibenzo-p-dioxin (TCDD) containing pads (TCDD was applied to the pads in 10% DMSO) Recognize specific, concentration-dependent blue staining in the area of the contact areas, but not the control yeasts (pGAD424 / pGBT9-Arnt; pGAD424-Ah / pGBT9, pLAM 5 '/ pTDl), the detection limit for 2,3,7,8-TCDD was in the range of 0.1 ng per pad.
1.4.2 Nachweis in Flüssigkultur1.4.2 Detection in liquid culture
Die Effektorwirkung des Dioxinliganden auf die Interaktion von Ah- und Arnt-Protein konnte auch mit Hilfe des ß-Galaktosidase-Aktivitätstests in Flüssigkultur nachgewiesen werden. Folgendes Protokoll wurde verwendet:The effector effect of the dioxin ligand on the interaction of Ah and Arnt protein could also be demonstrated using the ß-galactosidase activity test in liquid culture. The following protocol was used:
Der mit pGAD424-Ah und pGBT9-Arnt cotransformierte Hefestamm SFY526 wurde über Nacht bei 30 'C in SD-Medium -Leu, -Trp kultiviert. Als Kontrolle dienten die unter 1.3.3 genannten Cotransformationen a) bis d) .The yeast strain SFY526 cotransformed with pGAD424-Ah and pGBT9-Arnt was cultivated overnight at 30 'C in SD medium -Leu, -Trp. The cotransformations a) to d) mentioned under 1.3.3 served as a control.
Jeweils 2 ml der Übernachtkultur wurden in 8 ml YPD Flüssigmedium (20g/l Difco Pepton, 10 g/1 Hefeextrakt) pipettiert und 3-5 Stunden bei 30 *C geschüttelt, bis sie eine OD60o von 0/5-0,7 aufwies. 1,5 ml der Kultur wurden im folgenden mit verschiedenen Dioxinmengen bei 30 'C 32 ml of the overnight culture was inoculated into 8 ml of YPD liquid medium (20g / l Difco peptone, 10 g / 1 yeast extract) was pipetted and shaken for 3-5 hours at 30 * C until an OD of 60 o 0/5 to 0.7 exhibited. 1.5 ml of the culture were subsequently mixed with different amounts of dioxin at 30 'C 3
Stunden unter Schütteln inkubiert. Nach der Inkubationszeit wurden die Zellen abzentrifugiert in 1,5 ml Z-Puf- fer ( 16,1 g/1 Na2HP04 *7H20, 5,5 g/1 NaH2P04 *H20, 0,75 g/1 KCl, 0,246 g/1 MgS04 *7H20, pH 7,0) gewaschen, erneut abzentrifugiert und in 0,3 ml Z-Puffer Endvolumen aufgenommen. 0,1 ml dieser Zellsuspension wurden für den ß- Galaktosidase-Aktivitätstest verwendet. Die Zellsuspension wurde zu diesem Zweck in Trockeneis schockgefroren und sofort auf 37 *C wieder aufgetaut. Zu der Zellsuspen- sion wurden anschließend 0,7 al Z-Puffer pipettiert. Die Enzymreaktion wurde durch Zugabe von 0,16 ml ONPG-Lösung (4mg/ml o-Nitrophenyl-ß-D-galactopyranosid in Z-Puffer) gestartet. Die Freisetzung von ONP ist im Bereich von 50 bis 500 fg 2,3,7,8-TCDD konzentrationsabhängig. Der Flüssigtest erwies sich als sehr sensitiv für den Nachweis des Dioxinliganden. In den Kontrollen, die ohne Dioxin inkubiert worden waren (nur mit dem Lösungsmittel 5 % DMSO) , war keine Aktivität des Reporterproteins ß- Gal zu beobachten.Incubated for hours with shaking. After the incubation period, the cells were centrifuged in 1.5 ml Z buffer (16.1 g / 1 Na 2 HP0 4 * 7H 2 0, 5.5 g / 1 NaH 2 P0 4 * H 2 0, 0, 75 g / 1 KCl, 0.246 g / 1 MgS0 4 * 7H 2 0, pH 7.0) washed, centrifuged again and taken up in 0.3 ml Z-buffer final volume. 0.1 ml of this cell suspension was used for the β-galactosidase activity test. For this purpose, the cell suspension was snap-frozen in dry ice and immediately thawed to 37 ° C. 0.7 al Z buffer was then pipetted into the cell suspension. The enzyme reaction was started by adding 0.16 ml of ONPG solution (4 mg / ml o-nitrophenyl-β-D-galactopyranoside in Z buffer). The release of ONP is concentration-dependent in the range from 50 to 500 fg 2,3,7,8-TCDD. The liquid test turned out to be very sensitive for the detection of the dioxin ligand. In the controls which had been incubated without dioxin (only with the solvent 5% DMSO), there was no activity of the reporter protein ß- Watching Gal.
Bezüglich weiterer Details zur Durchführung des Two- Hybrid-Tests wird auf die Produktbeschreibung zum MATCH- MAKER Two-Hybrid System der Firma Clontech Laboratories, Inc. , Palo Alto, CA, USA verwiesen.With regard to further details on the implementation of the two-hybrid test, reference is made to the product description of the MATCH-MAKER two-hybrid system from Clontech Laboratories, Inc., Palo Alto, CA, USA.
Beispiel 2 Screening von Bodenproben auf DioxinkontaminationExample 2 Screening of Soil Samples for Dioxin Contamination
3 Bodenproben, deren Dioxingehalt bereits zuvor mittels GC/MS ermittelt worden war, wurden einem Screening- test nach dem beschriebenen Verfahren unterworfen. Probe3 soil samples, the dioxin content of which had previously been determined by GC / MS, were subjected to a screening test using the described method. sample
1 hatte einen PCDD/PCDF-Gehalt von 25 ng I-TEQ/kg, Probe1 had a PCDD / PCDF content of 25ng I-TEQ / kg, sample
2 von 457 ng I-TEQ/kg und Probe 3 von 1950 ng I-TEQ/kg. Jeweils 1 g der Probe wurde mit 2 ml Benzol 5 min im2 of 457ng I-TEQ / kg and sample 3 of 1950ng I-TEQ / kg. 1 g of the sample was mixed with 2 ml of benzene in 5 min
Ultraschallbad extrahiert. Der Extrakt wurde mit 0,5 ml konzentrierter Schwefelsäure bei 70 'C 10 min behandelt. Der klare Überstand wurde in ein Probengläschen mit 100 mg K2C03 transferiert, geschüttelt und in ein weiteres Probengläschen überführt. Das Lösungsmittel wurde imUltrasonic bath extracted. The extract was treated with 0.5 ml of concentrated sulfuric acid at 70 ° C for 10 minutes. The clear supernatant was transferred into a sample vial with 100 mg K 2 CO 3 , shaken and transferred into another sample vial. The solvent was in
Stickstoffström entfernt und der "Rückstand" in 300 μl Hexan aufgenommen. Die Probe wurde in 3 Aliquote aufgeteilt, das Lösungsmittel im Stickstoffström entfernt und der Rückstand in den 3 Gläschen mit 10 μl, 30 μl und 100 μl 5 % DMSO in Wasser aufgenommen. 5 μl der jeweiligen Probe wurde in den oben unter 1.4.2 beschriebenen Test in Flüssigkultur eingeschleust.Nitrogen stream removed and the "residue" taken up in 300 ul hexane. The sample was divided into 3 aliquots, the solvent was removed in a stream of nitrogen and the residue was taken up in the 3 vials with 10 μl, 30 μl and 100 μl 5% DMSO in water. 5 μl of the respective sample was introduced into liquid culture in the test described under 1.4.2 above.
Die erhaltene Gelbfärbungen waren proportional zu den zuvor bestimmten I-TEQ-Werten. Allerdings wurde bei den beiden Proben mit der höchsten Konzentration ein Inhibitionseffekt beobachtet. In der Praxis ist deshalb eine noch stärkere Abstufung der Konzentrationen für die einzelnen Aliquote einer Probe erforderlich, damit man stets in einem Bereich bleibt, in dem keine Inhibition erfolgt. SEQUENZPROTOKOLLThe yellow colorations obtained were proportional to the previously determined I-TEQ values. However, an inhibition effect was observed in the two samples with the highest concentration. In practice, therefore, an even greater gradation of the concentrations for the individual aliquots of a sample is necessary so that one always stays in a range in which no inhibition takes place. SEQUENCE LOG
(1) ALLGEMEINE ANGABEN:(1. GENERAL INFORMATION:
(i) ANMELDER:(i) APPLICANT:
(A) NAME: Hanspaul Hagenmaier(A) NAME: Hanspaul Hagenmaier
(B) STRASSE: Liegnitzerstr . 8(B) STREET: Liegnitzerstr. 8th
(C) ORT: Tuebingen(C) LOCATION: Tuebingen
( E) LAND : Deutschland(E) COUNTRY: Germany
(F) POSTLEITZAHL : 72072(F) POSTAL NUMBER: 72072
(ii) BEZEICHNUNG DER ERFINDUNG: Verfahren zum Nachweis fuer Effektoren intra- und/oder interzellulaerer Protein-Protein-Wechselwirkungen(ii) NAME OF THE INVENTION: Method of detection for effectors of intra- and / or intercellular protein-protein interactions
(iii) ANZAHL DER SEQUENZEN: 6(iii) NUMBER OF SEQUENCES: 6
(iv) COMPUTER-LESBARE FASSUNG:(iv) COMPUTER READABLE VERSION:
(A) DATENTRÄGER: Floppy dis(A) DISK: Floppy dis
(B) COMPUTER: IBM PC compatible(B) COMPUTER: IBM PC compatible
(C) BETRIEBSSYSTEM: PC-DOS/MS-DOS(C) OPERATING SYSTEM: PC-DOS / MS-DOS
(D) SOFTWARE: Patentin Release #1.0, Version #1.30 (EPA)(D) SOFTWARE: Patentin Release # 1.0, Version # 1.30 (EPA)
(2) ANGABEN ZU SEQ ID NO: 1:(2) INFORMATION ON SEQ ID NO: 1:
(i) SEQUENZKENNZEICHEN:(i) SEQUENCE LABEL:
(A) LÄNGE: 30 Basenpaare(A) LENGTH: 30 base pairs
(B) ART: Nucleotid(B) TYPE: nucleotide
(C) STRANGFORM: Einzelstrang(C) STRAND FORM: Single strand
(D) TOPOLOGIE: linear(D) TOPOLOGY: linear
(ii) ART DES MOLEKÜLS: Sonstige Nucleinsäure(ii) MOLECULE TYPE: Other nucleic acid
(A) BESCHREIBUNG: /desc = "synthetisches Oligonucleotid" (xi) SEQUENZBESCHREIBUNG: SEQ ID NO: 1:(A) DESCRIPTION: / desc = "synthetic oligonucleotide" (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 1:
AGGTCGACAC TCTGCACCTT GCTTAGGAAT 30AGGTCGACAC TCTGCACCTT GCTTAGGAAT 30
(2) ANGABEN ZU SEQ ID NO: 2:(2) INFORMATION ON SEQ ID NO: 2:
(i) SEQUENZKENNZEICHEN:(i) SEQUENCE LABEL:
(A) LÄNGE: 30 Basenpaare(A) LENGTH: 30 base pairs
(B) ART: Nucleotid(B) TYPE: nucleotide
(C) STRANGFORM: Einzelstrang(C) STRAND FORM: Single strand
(D) TOPOLOGIE: linear(D) TOPOLOGY: linear
(ii) ART DES MOLEKÜLS: Sonstige Nucleinsäure(ii) MOLECULE TYPE: Other nucleic acid
(A) BESCHREIBUNG: /desc = "synthetisches Oligonukleotid"(A) DESCRIPTION: / desc = "synthetic oligonucleotide"
(Xi) SEQUENZBESCHREIBUNG: SEQ ID NO: 2:(Xi) SEQUENCE DESCRIPTION: SEQ ID NO: 2:
AGGTCGACTT ATGAGCAGCG GCGCCAACAT 30AGGTCGACTT ATGAGCAGCG GCGCCAACAT 30
(2) ANGABEN ZU SEQ ID NO: 3:(2) INFORMATION ON SEQ ID NO: 3:
(i) SEQUENZKENNZEICHEN:(i) SEQUENCE LABEL:
(A) LÄNGE: 27 Basenpaare(A) LENGTH: 27 base pairs
(B) ART: Nucleotid(B) TYPE: nucleotide
(C) STRANGFORM: Einzelstrang(C) STRAND FORM: Single strand
(D) TOPOLOGIE: linear(D) TOPOLOGY: linear
( ii) ART DES MOLEKÜLS : Sonstige Nucleinsäure(ii) MOLECULE TYPE: Other nucleic acid
(A) BESCHREIBUNG : /desc = "synthetisches Oligonucleotid" (Xi) SEQUENZBESCHREIBUNG: SEQ ID NO: 3:(A) DESCRIPTION: / desc = "synthetic oligonucleotide" (Xi) SEQUENCE DESCRIPTION: SEQ ID NO: 3:
CGGGATCCCC GAAATGACAT CAGATGT 27CGGGATCCCC GAAATGACAT CAGATGT 27
(2) ANGABEN ZU SEQ ID NO: 4:(2) INFORMATION ON SEQ ID NO: 4:
(i) SEQUENZKENNZEICHEN:(i) SEQUENCE LABEL:
(A) LÄNGE: 26 Baεenpaare(A) LENGTH: 26 base pairs
(B) ART: Nucleotid(B) TYPE: nucleotide
(C) STRANGFORM: Einzelstrang(C) STRAND FORM: Single strand
(D) TOPOLOGIE: linear(D) TOPOLOGY: linear
(ii) ART DES MOLEKÜLS: Sonstige Nucleinsäure(ii) MOLECULE TYPE: Other nucleic acid
(A) BESCHREIBUNG: /desc = "synthetisches Oligonucleotid"(A) DESCRIPTION: / desc = "synthetic oligonucleotide"
(xi) SEQUENZBESCHREIBUNG: SEQ ID NO: 4:(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 4:
CGGGATCCAC CTGCTGGGCA GAAAAG 26CGGGATCCAC CTGCTGGGCA GAAAAG 26
(2) ANGABEN ZU SEQ ID NO: 5:(2) INFORMATION ON SEQ ID NO: 5:
(i) SEQUENZKENNZEICHEN:(i) SEQUENCE LABEL:
(A) LÄNGE: 2616 Basenpaare(A) LENGTH: 2616 base pairs
(B) ART: Nucleotid(B) TYPE: nucleotide
(C) STRANGFORM: Einzelstrang(C) STRAND FORM: Single strand
(D) TOPOLOGIE: linear(D) TOPOLOGY: linear
(ii) ART DES MOLEKÜLS: cDNA zu mRNA(ii) MOLECULE TYPE: cDNA to mRNA
(iii) HYPOTHETISCH: NEIN(iii) HYPOTHETICAL: NO
(iv) ANTISENSE: NEIN(iv) ANTISENSE: NO
(vi) URSPRÜNLICHE HERKUNFT: (A) ORGANISMUS: Homo sapiens(vi) ORIGINAL ORIGIN: (A) ORGANISM: Homo sapiens
(F) GEWEBETYP: Liver(F) TISSUE TYPE: Liver
(G) ZELLTYP: Hepatocyte (H) ZELLLINIE: HepG2(G) CELL TYPE: Hepatocyte (H) CELL LINE: HepG2
(viii) POSITION IM GENOM:(viii) POSITION IN THE GENOME:
(B) KARTENPOSITION: Ip36-ql2(B) CARD POSITION: Ip36-ql2
(ix) MERKMAL:(ix) FEATURE:
(A) NAME/ SCHLÜSSEL: terminator(A) NAME / KEY: terminator
(B) LAGE:2424..2426(B) LOCATION: 2424..2426
(ix) MERKMAL:(ix) FEATURE:
(A) NAME/SCHLÜSSEL: 5'UTR(A) NAME / KEY: 5'UTR
(B) LAGE: 1..56(B) LOCATION: 1..56
(ix) MERKMAL:(ix) FEATURE:
(A) NAME/SCHLÜSSEL: CDS(A) NAME / KEY: CDS
(B) LAGE:57..2423(B) LOCATION: 57..2423
(xi) SEQUENZBESCHREIBUNG: SEQ ID NO: 5:(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 5:
ATGGCGGCTC CTCCCACTGG GGGGGGGGTG GCGCGGCGGC GGTGGCATCT GCGGCC 56ATGGCGGCTC CTCCCACTGG GGGGGGGGTG GCGCGGCGGC GGTGGCATCT GCGGCC 56
ATG GCG GCG ACT ACT GCC AAC CCC GAA ATG ACA TCA GAT GTA CCA TCA 104 Met Ala Ala Thr Thr Ala Asn Pro Glu Met Thr Ser Asp Val Pro Ser 1 5 10 15ATG GCG GCG ACT ACT GCC AAC CCC GAA ATG ACA TCA GAT GTA CCA TCA 104 Met Ala Ala Thr Thr Ala Asn Pro Glu Met Thr Ser Asp Val Pro Ser 1 5 10 15
CTG GGT CCA GCC ATT GCC TCT GGA AAC TCT GGA CCT GGA ATT CAA GGT 152 Leu Gly Pro Ala Ile Ala Ser Gly Asn Ser Gly Pro Gly Ile Gin Gly 20 25 30CTG GGT CCA GCC ATT GCC TCT GGA AAC TCT GGA CCT GGA ATT CAA GGT 152 Leu Gly Pro Ala Ile Ala Ser Gly Asn Ser Gly Pro Gly Ile Gin Gly 20 25 30
GGA GGA GCC ATT GTC CAG AGG GCT ATT AAG CGG CGA CCA GGG CTG GAT 200 Gly Gly Ala Ile Val Gin Arg Ala Ile Lys Arg Arg Pro Gly Leu Asp 35 40 45GGA GGA GCC ATT GTC CAG AGG GCT ATT AAG CGG CGA CCA GGG CTG GAT 200 Gly Gly Ala Ile Val Gin Arg Ala Ile Lys Arg Arg Pro Gly Leu Asp 35 40 45
TTT GAT GAT GAT GGA GAA GGG AAC AGT AAA TTT TTG AGG TGT GAT GAT 248 Phe Asp Asp Asp Gly Glu Gly Asn Ser Lys Phe Leu Arg Cys Asp Asp 50 55 60TTT GAT GAT GAT GGA GAA GGG AAC AGT AAA TTT TTG AGG TGT GAT GAT 248 Phe Asp Asp Asp Gly Glu Gly Asn Ser Lys Phe Leu Arg Cys Asp Asp 50 55 60
GAT CAG ATG TCT AAC GAT AAG GAG CGG TTT GCC AGG TCG GAT GAT GAG 296 Asp Gin Met Ser Asn Asp Lys Glu Arg Phe Ala Arg Ser Asp Asp Glu 65 70 75 80GAT CAG ATG TCT AAC GAT AAG GAG CGG TTT GCC AGG TCG GAT GAT GAG 296 Asp Gin Met Ser Asn Asp Lys Glu Arg Phe Ala Arg Ser Asp Asp Glu 65 70 75 80
CAG AGC TCT GCG GAT AAA GAG AGA CTT GCC AGG GAA AAT CAC AGT GAA 344 Gin Ser Ser Ala Asp Lys Glu Arg Leu Ala Arg Glu Asn His Ser GluCAG AGC TCT GCG GAT AAA GAG AGA CTT GCC AGG GAA AAT CAC AGT GAA 344 Gin Ser Ser Ala Asp Lys Glu Arg Leu Ala Arg Glu Asn His Ser Glu
85 90 9585 90 95
ATT GAA CGG CGG CGA CGG AAC AAG ATG ACA GCC TAC ATC ACA GAA CTG 392 Ile Glu Arg Arg Arg Arg Asn Lys Met Thr Ala Tyr Ile Thr Glu Leu 100 105 110ATT GAA CGG CGG CGA CGG AAC AAG ATG ACA GCC TAC ATC ACA GAA CTG 392 Ile Glu Arg Arg Arg Arg Asn Lys Met Thr Ala Tyr Ile Thr Glu Leu 100 105 110
TCA GAT ATG GTA CCC ACC TGT AGT GCC CTG GCT CGA AAA CCA GAC AAG 440 Ser Asp Met Val Pro Thr Cys Ser Ala Leu Ala Arg Lys Pro Asp Lys 115 120 125TCA GAT ATG GTA CCC ACC TGT AGT GCC CTG GCT CGA AAA CCA GAC AAG 440 Ser Asp Met Val Pro Thr Cys Ser Ala Leu Ala Arg Lys Pro Asp Lys 115 120 125
CTA ACC ATC TTA CGC ATG GCA GTT TCT CAC ATG AAG TCC TTG CGG GGA 488 Leu Thr Ile Leu Arg Met Ala Val Ser His Met Lys Ser Leu Arg Gly 130 135 140CTA ACC ATC TTA CGC ATG GCA GTT TCT CAC ATG AAG TCC TTG CGG GGA 488 Leu Thr Ile Leu Arg Met Ala Val Ser His Met Lys Ser Leu Arg Gly 130 135 140
ACT GGC AAC ACA TCC ACT GAT GGC TCC TAT AAG CCG TCT TTC CTC ACT 536 Thr Gly Asn Thr Ser Thr Asp Gly Ser Tyr Lys Pro Ser Phe Leu Thr 145 150 155 160ACT GGC AAC ACA TCC ACT GAT GGC TCC TAT AAG CCG TCT TTC CTC ACT 536 Thr Gly Asn Thr Ser Thr Asp Gly Ser Tyr Lys Pro Ser Phe Leu Thr 145 150 155 160
GAT CAG GAA CTG AAA CAT TTG ATC TTG GAG GCA GCA GAT GGC TTT CTG 584 Asp Gin Glu Leu Lys His Leu Ile Leu Glu Ala Ala Asp Gly Phe Leu 165 170 175GAT CAG GAA CTG AAA CAT TTG ATC TTG GAG GCA GCA GAT GGC TTT CTG 584 Asp Gin Glu Leu Lys His Leu Ile Leu Glu Ala Ala Asp Gly Phe Leu 165 170 175
TTT ATT GTC TCA TGT GAG ACA GGC AGG GTG GTG TAT GTG TCT GAC TCC 632 Phe Ile Val Ser Cys Glu Thr Gly Arg Val Val Tyr Val Ser Asp Ser 180 185 190TTT ATT GTC TCA TGT GAG ACA GGC AGG GTG GTG TAT GTG TCT GAC TCC 632 Phe Ile Val Ser Cys Glu Thr Gly Arg Val Val Tyr Val Ser Asp Ser 180 185 190
GTG ACT CCT GTT TTG AAC CAG CCA CAG TCT GAA TGG TTT GGC AGC ACA 680 Val Thr Pro Val Leu Asn Gin Pro Gin Ser Glu Trp Phe Gly Ser Thr 195 200 205 CTC TAT GAT CAG GTG CAC CCA GAT GAT GTG GAT AAA CTT CGT GAG CAG 728 Leu Tyr Asp Gin Val His Pro Asp Asp Val Asp Lys Leu Arg Glu Gin 210 215 220GTG ACT CCT GTT TTG AAC CAG CCA CAG TCT GAA TGG TTT GGC AGC ACA 680 Val Thr Pro Val Leu Asn Gin Pro Gin Ser Glu Trp Phe Gly Ser Thr 195 200 205 CTC TAT GAT CAG GTG CAC CCA GAT GAT GTG GAT AAA CTT CGT GAG CAG 728 Leu Tyr Asp Gin Val His Pro Asp Asp Val Asp Lys Leu Arg Glu Gin 210 215 220
CTT TCC ACT TCA GAA AAT GCC CTG ACA GGG CGT ATC CTG GAT CTA AAG 776 Leu Ser Thr Ser Glu Asn Ala Leu Thr Gly Arg Ile Leu Asp Leu Lys 225 230 235 240CTT TCC ACT TCA GAA AAT GCC CTG ACA GGG CGT ATC CTG GAT CTA AAG 776 Leu Ser Thr Ser Glu Asn Ala Leu Thr Gly Arg Ile Leu Asp Leu Lys 225 230 235 240
ACT GGA ACA GTG AAA AAG GAA GGT CAG CAG TCT TCC ATG AGA ATG TGT 824 Thr Gly Thr Val Lys Lys Glu Gly Gin Gin Ser Ser Met Arg Met Cys 245 250 255ACT GGA ACA GTG AAA AAG GAA GGT CAG CAG TCT TCC ATG AGA ATG TGT 824 Thr Gly Thr Val Lys Lys Glu Gly Gin Gin Ser Ser Met Arg Met Cys 245 250 255
ATG GGC TCA AGG AGA TCG TTT ATT TGC CGA ATG AGG TGT GGC AGT AGC 872 Met Gly Ser Arg Arg Ser Phe Ile Cys Arg Met Arg Cys Gly Ser Ser 260 265 270ATG GGC TCA AGG AGA TCG TTT ATT TGC CGA ATG AGG TGT GGC AGT AGC 872 Met Gly Ser Arg Arg Ser Phe Ile Cys Arg Met Arg Cys Gly Ser Ser 260 265 270
TCT GTG GAC CCA GTT TCT GTG AAT AGG CTG AGC TTT GTG AGG AAC AGA 920 Ser Val Asp Pro Val Ser Val Asn Arg Leu Ser Phe Val Arg Asn Arg 275 280 285TCT GTG GAC CCA GTT TCT GTG AAT AGG CTG AGC TTT GTG AGG AAC AGA 920 Ser Val Asp Pro Val Ser Val Asn Arg Leu Ser Phe Val Arg Asn Arg 275 280 285
TGC AGG AAT GGA CTT GGC TCT GTA AAG GAT GGG GAA CCT CAC TTC GTG 968 Cys Arg Asn Gly Leu Gly Ser Val Lys Asp Gly Glu Pro His Phe Val 290 295 300TGC AGG AAT GGA CTT GGC TCT GTA AAG GAT GGG GAA CCT CAC TTC GTG 968 Cys Arg Asn Gly Leu Gly Ser Val Lys Asp Gly Glu Pro His Phe Val 290 295 300
GTG GTC CAC TGC ACA GGC TAC ATC AAG GCC TGG CCC CCA GCA GGT GTT 1016 Val Val His Cys Thr Gly Tyr Ile Lys Ala Trp Pro Pro Ala Gly Val 305 310 315 320GTG GTC CAC TGC ACA GGC TAC ATC AAG GCC TGG CCC CCA GCA GGT GTT 1016 Val Val His Cys Thr Gly Tyr Ile Lys Ala Trp Pro Pro Ala Gly Val 305 310 315 320
TCC CTC CCA GAT GAT GAC CCA GAG GCT GGC CAG GGA AGC AAG TTT TGC 1064 Ser Leu Pro Asp Asp Asp Pro Glu Ala Gly Gin Gly Ser Lys Phe Cys 325 330 335TCC CTC CCA GAT GAT GAC CCA GAG GCT GGC CAG GGA AGC AAG TTT TGC 1064 Ser Leu Pro Asp Asp Asp Pro Glu Ala Gly Gin Gly Ser Lys Phe Cys 325 330 335
CTA GTG GCC ATT GGC AGA TTG CAG GTA ACT AGT TCT CCC AAC TGT ACA 1112 Leu Val Ala Ile Gly Arg Leu Gin Val Thr Ser Ser Pro Asn Cys Thr 340 345 350CTA GTG GCC ATT GGC AGA TTG CAG GTA ACT AGT TCT CCC AAC TGT ACA 1112 Leu Val Ala Ile Gly Arg Leu Gin Val Thr Ser Ser Pro Asn Cys Thr 340 345 350
GAC ATG AGT AAT GTT TGT CAA CCA ACA GAG TTC ATC TCC CGA CAC AAC 1160 Asp Met Ser Asn Val Cys Gin Pro Thr Glu Phe Ile Ser Arg His Asn 355 360 365GAC ATG AGT AAT GTT TGT CAA CCA ACA GAG TTC ATC TCC CGA CAC AAC 1160 Asp Met Ser Asn Val Cys Gin Pro Thr Glu Phe Ile Ser Arg His Asn 355 360 365
ATT GAG GGT ATC TTC ACT TTT GTG GAT CAC CGC TGT GTG GCT ACT GTT 1208 Ile Glu Gly Ile Phe Thr Phe Val Asp His Arg Cys Val Ala Thr Val 370 375 380ATT GAG GGT ATC TTC ACT TTT GTG GAT CAC CGC TGT GTG GCT ACT GTT 1208 Ile Glu Gly Ile Phe Thr Phe Val Asp His Arg Cys Val Ala Thr Val 370 375 380
GGC TAC CAG CCA CAG GAA CTC TTA GGA AAG AAT ATT GTA GAA TTC TGT 1256 Gly Tyr Gin Pro Gin Glu Leu Leu Gly Lys Asn Ile Val Glu Phe Cys 385 390 395 400GGC TAC CAG CCA CAG GAA CTC TTA GGA AAG AAT ATT GTA GAA TTC TGT 1256 Gly Tyr Gin Pro Gin Glu Leu Leu Gly Lys Asn Ile Val Glu Phe Cys 385 390 395 400
CAT CCT GAA GAC CAG CAG CTT CTA AGA GAC AGC TTC CAA CAG GTA GTG 1304 His Pro Glu Asp Gin Gin Leu Leu Arg Asp Ser Phe Gin Gin Val Val 405 410 415CAT CCT GAA GAC CAG CAG CTT CTA AGA GAC AGC TTC CAA CAG GTA GTG 1304 His Pro Glu Asp Gin Gin Leu Leu Arg Asp Ser Phe Gin Gin Val Val 405 410 415
AAA TTA AAA GGC CAA GTG CTG TCT GTC ATG TTC CGG TTC CGG TCT AAG 1352 Lys Leu Lys Gly Gin Val Leu Ser Val Met Phe Arg Phe Arg Ser Lys 420 425 430AAA TTA AAA GGC CAA GTG CTG TCT GTC ATG TTC CGG TTC CGG TCT AAG 1352 Lys Leu Lys Gly Gin Val Leu Ser Val Met Phe Arg Phe Arg Ser Lys 420 425 430
AAC CAA GAA TGG CTC TGG ATG AGA ACC AGC TCC TTT ACT TTC CAG AAC 1400 Asn Gin Glu Trp Leu Trp Met Arg Thr Ser Ser Phe Thr Phe Gin Asn 435 440 445AAC CAA GAA TGG CTC TGG ATG AGA ACC AGC TCC TTT ACT TTC CAG AAC 1400 Asn Gin Glu Trp Leu Trp Met Arg Thr Ser Ser Phe Thr Phe Gin Asn 435 440 445
CCT TAC TCA GAT GAA ATT GAG TAC ATC ATC TGT ACC AAC ACC AAT GTG 1448 Pro Tyr Ser Asp Glu Ile Glu Tyr Ile Ile Cys Thr Asn Thr Asn Val 450 455 460CCT TAC TCA GAT GAA ATT GAG TAC ATC ATC TGT ACC AAC ACC AAT GTG 1448 Pro Tyr Ser Asp Glu Ile Glu Tyr Ile Ile Cys Thr Asn Thr Asn Val 450 455 460
AAG AAC TCT AGC CAA GAA CCA CGG CCT ACA CTC TCC AAC ACA ATC CAG 1496 Lys Asn Ser Ser Gin Glu Pro Arg Pro Thr Leu Ser Asn Thr Ile Gin 465 470 475 480AAG AAC TCT AGC CAA GAA CCA CGG CCT ACA CTC TCC AAC ACA ATC CAG 1496 Lys Asn Ser Ser Gin Glu Pro Arg Pro Thr Leu Ser Asn Thr Ile Gin 465 470 475 480
AGG CCA CAA CTA GGT CCC ACA GCT AAT TTA CCC CTG GAG ATG GGC TCA 1544 Arg Pro Gin Leu Gly Pro Thr Ala Asn Leu Pro Leu Glu Met Gly Ser 485 490 495AGG CCA CAA CTA GGT CCC ACA GCT AAT TTA CCC CTG GAG ATG GGC TCA 1544 Arg Pro Gin Leu Gly Pro Thr Ala Asn Leu Pro Leu Glu Met Gly Ser 485 490 495
GGA CAG CTG GCA CCC AGG CAG CAG CAA CAG CAA ACA GAA TTG GAC ATG 1592 Gly Gin Leu Ala Pro Arg Gin Gin Gin Gin Gin Thr Glu Leu Asp Met 500 505 510 GTA CCA GGA AGA GAT GGA CTG GCC AGC TAC AAT CAT TCC CAG GTG GTT 1640 Val Pro Gly Arg Asp Gly Leu Ala Ser Tyr Asn His Ser Gin Val Val 515 520 525GGA CAG CTG GCA CCC AGG CAG CAG CAA CAG CAA ACA GAA TTG GAC ATG 1592 Gly Gin Leu Ala Pro Arg Gin Gin Gin Gin Gin Thr Glu Leu Asp Met 500 505 510 GTA CCA GGA AGA GAT GGA CTG GCC AGC TAC AAT CAT TCC CAG GTG GTT 1640 Val Pro Gly Arg Asp Gly Leu Ala Ser Tyr Asn His Ser Gin Val Val 515 520 525
CAG CCT GTG ACA ACC ACA GGA CCA GAA CAC AGC AAG CCC CTT GAG AAG 1688 Gin Pro Val Thr Thr Thr Gly Pro Glu His Ser Lys Pro Leu Glu Lys 530 535 540CAG CCT GTG ACA ACC ACA GGA CCA GAA CAC AGC AAG CCC CTT GAG AAG 1688 Gin Pro Val Thr Thr Thr Gly Pro Glu His Ser Lys Pro Leu Glu Lys 530 535 540
TCA GAT GGT TTA TTT GCC CAG GAT AGA GAT CCA AGA TTT TCA GAA ATC 1736 Ser Asp Gly Leu Phe Ala Gin Asp Arg Asp Pro Arg Phe Ser Glu Ile 545 550 555 560TCA GAT GGT TTA TTT GCC CAG GAT AGA GAT CCA AGA TTT TCA GAA ATC 1736 Ser Asp Gly Leu Phe Ala Gin Asp Arg Asp Pro Arg Phe Ser Glu Ile 545 550 555 560
TAT CAC AAC ATC AAT GCG GAT CAG AGT AAA GGC ATC TCC TCC AGC ACT 1784 Tyr His Asn Ile Asn Ala Asp Gin Ser Lys Gly Ile Ser Ser Ser Thr 565 570 575TAT CAC AAC ATC AAT GCG GAT CAG AGT AAA GGC ATC TCC TCC AGC ACT 1784 Tyr His Asn Ile Asn Ala Asp Gin Ser Lys Gly Ile Ser Ser Ser Thr 565 570 575
GTC CCT GCC ACC CAA CAG CTA TTC TCC CAG GGC AAC ACA TTC CCT CCT 1832 Val Pro Ala Thr Gin Gin Leu Phe Ser Gin Gly Asn Thr Phe Pro Pro 580 585 590GTC CCT GCC ACC CAA CAG CTA TTC TCC CAG GGC AAC ACA TTC CCT CCT 1832 Val Pro Ala Thr Gin Gin Leu Phe Ser Gin Gly Asn Thr Phe Pro Pro 580 585 590
ACC CCC CGG CCG GCA GAG AAT TTC AGG AAT AGT GGC CTA GCC CCT CCT 1880 Thr Pro Arg Pro Ala Glu Asn Phe Arg Asn Ser Gly Leu Ala Pro Pro 595 600 605ACC CCC CGG CCG GCA GAG AAT TTC AGG AAT AGT GGC CTA GCC CCT CCT 1880 Thr Pro Arg Pro Ala Glu Asn Phe Arg Asn Ser Gly Leu Ala Pro Pro 595 600 605
GTA ACC ATT GTC CAG CCA TCA GCT TCT GCA GGA CAG ATG TTG GCC CAG 1928 Val Thr Ile Val Gin Pro Ser Ala Ser Ala Gly Gin Met Leu Ala Gin 610 615 620GTA ACC ATT GTC CAG CCA TCA GCT TCT GCA GGA CAG ATG TTG GCC CAG 1928 Val Thr Ile Val Gin Pro Ser Ala Ser Ala Gly Gin Met Leu Ala Gin 610 615 620
ATT TCC CGC CAC TCC AAC CCC ACC CAA GGA GCA ACC CCA ACT TGG ACC 1976 Ile Ser Arg His Ser Asn Pro Thr Gin Gly Ala Thr Pro Thr Trp Thr 625 630 635 640ATT TCC CGC CAC TCC AAC CCC ACC CAA GGA GCA ACC CCA ACT TGG ACC 1976 Ile Ser Arg Arg Ser Ser Asn Pro Thr Gin Gly Ala Thr Pro Thr Trp Thr 625 630 635 640
CCT ACT ACC CGC TCA GGC TTT TCT GCC CAG CAG GTG GCT ACC CAG GCT 2024 Pro Thr Thr Arg Ser Gly Phe Ser Ala Gin Gin Val Ala Thr Gin Ala 645 650 655CCT ACT ACC CGC TCA GGC TTT TCT GCC CAG CAG GTG GCT ACC CAG GCT 2024 Pro Thr Thr Arg Ser Gly Phe Ser Ala Gin Gin Val Ala Thr Gin Ala 645 650 655
ACT GCT AAG ACT CGT ACT TCC CAG TTT GGT GTG GGC AGC TTT CAG ACT 2072 Thr Ala Lys Thr Arg Thr Ser Gin Phe Gly Val Gly Ser Phe Gin Thr 660 665 670ACT GCT AAG ACT CGT ACT TCC CAG TTT GGT GTG GGC AGC TTT CAG ACT 2072 Thr Ala Lys Thr Arg Thr Ser Gin Phe Gly Val Gly Ser Phe Gin Thr 660 665 670
CCA TCC TCC TTC AGC TCC ATG TCC CTC CCT GGT GCC CCA ACT GCA TCG 2120 Pro Ser Ser Phe Ser Ser Met Ser Leu Pro Gly Ala Pro Thr Ala Ser 675 680 685CCA TCC TCC TTC AGC TCC ATG TCC CTC CCT GGT GCC CCA ACT GCA TCG 2120 Pro Ser Ser Phe Ser Ser Met Ser Leu Pro Gly Ala Pro Thr Ala Ser 675 680 685
CCT GGT GCT GCT GCC TAC CCT AGT CTC ACC AAT CGT GGA TCT AAC TTT 2168 Pro Gly Ala Ala Ala Tyr Pro Ser Leu Thr Asn Arg Gly Ser Asn Phe 690 695 700CCT GGT GCT GCT GCC TAC CCT AGT CTC ACC AAT CGT GGA TCT AAC TTT 2168 Pro Gly Ala Ala Ala Tyr Pro Ser Leu Thr Asn Arg Gly Ser Asn Phe 690 695 700
GCT CCT GAG ACT GGA CAG ACT GCA GGA CAA TTC CAG ACA CGG ACA GCA 2216 Ala Pro Glu Thr Gly Gin Thr Ala Gly Gin Phe Gin Thr Arg Thr Ala 705 710 715 720GCT CCT GAG ACT GGA CAG ACT GCA GGA CAA TTC CAG ACA CGG ACA GCA 2216 Ala Pro Glu Thr Gly Gin Thr Ala Gly Gin Phe Gin Thr Arg Thr Ala 705 710 715 720
GAG GGT GTG GGT GTC TGG CCA CAG TGG CAG GGC CAG CAG CCT CAT CAT 2264 Glu Gly Val Gly Val Trp Pro Gin Trp Gin Gly Gin Gin Pro His His 725 730 735GAG GGT GTG GGT GTC TGG CCA CAG TGG CAG GGC CAG CAG CCT CAT CAT 2264 Glu Gly Val Gly Val Trp Pro Gin Trp Gin Gly Gin Gin Pro His His 725 730 735
CGT TCA AGT TCT AGT GAG CAA CAT GTT CAA CAA CCG CCA GCA CAG CAA 2312 Arg Ser Ser Ser Ser Glu Gin His Val Gin Gin Pro Pro Ala Gin Gin 740 745 750CGT TCA AGT TCT AGT GAG CAA CAT GTT CAA CAA CCG CCA GCA CAG CAA 2312 Arg Ser Ser Ser Ser Glu Gin His Val Gin Gin Pro Pro Ala Gin Gin 740 745 750
CCT GGC CAG CCT GAG GTC TTC CAG GAG ATG CTG TCC ATG CTG GGA GAT 2360 Pro Gly Gin Pro Glu Val Phe Gin Glu Met Leu Ser Met Leu Gly Asp 755 760 765CCT GGC CAG CCT GAG GTC TTC CAG GAG ATG CTG TCC ATG CTG GGA GAT 2360 Pro Gly Gin Pro Glu Val Phe Gin Glu Met Leu Ser Met Leu Gly Asp 755 760 765
CAG AGC AAC AGC TAC AAC AAT GAA GAA TTC CCT GAT CTA ACT ATG TTT 2408 Gin Ser Asn Ser Tyr Asn Asn Glu Glu Phe Pro Asp Leu Thr Met Phe 770 775 780CAG AGC AAC AGC TAC AAC AAT GAA GAA TTC CCT GAT CTA ACT ATG TTT 2408 Gin Ser Asn Ser Tyr Asn Asn Glu Glu Phe Pro Asp Leu Thr Met Phe 770 775 780
CCC CCC TTT TCA GAA TAGAACTATT GGGGTGAGGA TAAGGGGTGG GGGAGAAAAA 2463CCC CCC TTT TCA GAA TAGAACTATT GGGGTGAGGA TAAGGGGTGG GGGAGAAAAA 2463
Pro Pro Phe Ser GluPer Pro Phe Ser Glu
785785
ATCACTGTTT GTTTTTAAAA AGCAAATCTT TCTGTAAACA GAATAAAAGT TCCTCTCCCT 2523ATCACTGTTT GTTTTTAAAA AGCAAATCTT TCTGTAAACA GAATAAAAGT TCCTCTCCCT 2523
TCCCTTCCCT CACCCCTGAC ATGTACCCCC TTTCCCTTCT GGCTGTTCCC CTGCTCTGTT 2583 GCCTCCTAAG GTAACATTTA TAAAAAAAAA AAA 2616TCCCTTCCCT CACCCCTGAC ATGTACCCCC TTTCCCTTCT GGCTGTTCCC CTGCTCTGTT 2583 GCCTCCTAAG GTAACATTTA TAAAAAAAAA AAA 2616
(2) ANGABEN ZU SEQ ID NO: 6:(2) INFORMATION ON SEQ ID NO: 6:
(i) SEQUENZKENNZEICHEN:(i) SEQUENCE LABEL:
(A) LANGE: 789 Aminosäuren(A) LONG: 789 amino acids
(B) ART: Aminosäure (D) TOPOLOGIE: linear(B) TYPE: amino acid (D) TOPOLOGY: linear
(ii) ART DES MOLEKÜLS: Protein(ii) MOLECULE TYPE: Protein
(xi) SEQUENZBESCHREIBUNG: SEQ ID NO: 6:(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 6:
Met Ala Ala Thr Thr Ala Asn Pro Glu Met Thr Ser Asp Val Pro Ser 1 5 10 15Met Ala Ala Thr Thr Ala Asn Pro Glu Met Thr Ser Asp Val Pro Ser 1 5 10 15
Leu Gly Pro Ala Ile Ala Ser Gly Asn Ser Gly Pro Gly Ile Gin Gly 20 25 30Leu Gly Pro Ala Ile Ala Ser Gly Asn Ser Gly Pro Gly Ile Gin Gly 20 25 30
Gly Gly Ala Ile Val Gin Arg Ala Ile Lys Arg Arg Pro Gly Leu Asp 35 40 45Gly Gly Ala Ile Val Gin Arg Ala Ile Lys Arg Arg Pro Gly Leu Asp 35 40 45
Phe Asp Asp Asp Gly Glu Gly Asn Ser Lys Phe Leu Arg Cys Asp Asp 50 55 60Phe Asp Asp Asp Gly Glu Gly Asn Ser Lys Phe Leu Arg Cys Asp Asp 50 55 60
Asp Gin Met Ser Asn Asp Lys Glu Arg Phe Ala Arg Ser Asp Asp Glu 65 70 75 80Asp Gin Met Ser Asn Asp Lys Glu Arg Phe Ala Arg Ser Asp Asp Glu 65 70 75 80
Gin Ser Ser Ala Asp Lys Glu Arg Leu Ala Arg Glu Asn His Ser GluGin Ser Ser Ala Asp Lys Glu Arg Leu Ala Arg Glu Asn His Ser Glu
85 90 9585 90 95
Ile Glu Arg Arg Arg Arg Asn Lys Met Thr Ala Tyr Ile Thr Glu Leu 100 105 110Ile Glu Arg Arg Arg Arg Asn Lys Met Thr Ala Tyr Ile Thr Glu Leu 100 105 110
Ser Asp Met Val Pro Thr Cys Ser Ala Leu Ala Arg Lys Pro Asp Lys 115 120 125Ser Asp Met Val Pro Thr Cys Ser Ala Leu Ala Arg Lys Pro Asp Lys 115 120 125
Leu Thr Ile Leu Arg Met Ala Val Ser His Met Lys Ser Leu Arg Gly 130 135 140Leu Thr Ile Leu Arg Met Ala Val Ser His Met Lys Ser Leu Arg Gly 130 135 140
Thr Gly Asn Thr Ser Thr Asp Gly Ser Tyr Lys Pro Ser Phe Leu Thr 145 150 155 160Thr Gly Asn Thr Ser Thr Asp Gly Ser Tyr Lys Pro Ser Phe Leu Thr 145 150 155 160
Asp Gin Glu Leu Lys His Leu Ile Leu Glu Ala Ala Asp Gly Phe Leu 165 170 175Asp Gin Glu Leu Lys His Leu Ile Leu Glu Ala Ala Asp Gly Phe Leu 165 170 175
Phe Ile Val Ser Cys Glu Thr Gly Arg Val Val Tyr Val Ser Asp Ser 180 185 190Phe Ile Val Ser Cys Glu Thr Gly Arg Val Val Tyr Val Ser Asp Ser 180 185 190
Val Thr Pro Val Leu Asn Gin Pro Gin Ser Glu Trp Phe Gly Ser Thr 195 200 205Val Thr Pro Val Leu Asn Gin Pro Gin Ser Glu Trp Phe Gly Ser Thr 195 200 205
Leu Tyr Asp Gin Val His Pro Asp Asp Val Asp Lys Leu Arg Glu Gin 210 215 220Leu Tyr Asp Gin Val His Pro Asp Asp Val Asp Lys Leu Arg Glu Gin 210 215 220
Leu Ser Thr Ser Glu Asn Ala Leu Thr Gly Arg Ile Leu Asp Leu Lys 225 230 235 240Leu Ser Thr Ser Glu Asn Ala Leu Thr Gly Arg Ile Leu Asp Leu Lys 225 230 235 240
Thr Gly Thr Val Lys Lys Glu Gly Gin Gin Ser Ser Met Arg Met Cys 245 250 255Thr Gly Thr Val Lys Lys Glu Gly Gin Gin Ser Ser Met Arg Met Cys 245 250 255
Met Gly Ser Arg Arg Ser Phe Ile Cys Arg Met Arg Cys Gly Ser Ser 260 265 270Met Gly Ser Arg Arg Ser Phe Ile Cys Arg Met Arg Cys Gly Ser Ser 260 265 270
Ser Val Asp Pro Val Ser Val Asn Arg Leu Ser Phe Val Arg Asn Arg 275 280 285Ser Val Asp Pro Val Ser Val Asn Arg Leu Ser Phe Val Arg Asn Arg 275 280 285
Cys Arg Asn Gly Leu Gly Ser Val Lys Asp Gly Glu Pro His Phe Val 290 295 300Cys Arg Asn Gly Leu Gly Ser Val Lys Asp Gly Glu Pro His Phe Val 290 295 300
Val Val His Cys Thr Gly Tyr Ile Lys Ala Trp Pro Pro Ala Gly Val 305 310 315 320Val Val His Cys Thr Gly Tyr Ile Lys Ala Trp Pro Pro Ala Gly Val 305 310 315 320
Ser Leu Pro Asp Asp Asp Pro Glu Ala Gly Gin Gly Ser Lys Phe CysSer Leu Pro Asp Asp Asp Pro Glu Ala Gly Gin Gly Ser Lys Phe Cys
325 330 335 Leu Val Ala Ile Gly Arg Leu Gin Val Thr Ser Ser Pro Asn Cys Thr 340 345 350325 330 335 Leu Val Ala Ile Gly Arg Leu Gin Val Thr Ser Ser Pro Asn Cys Thr 340 345 350
Asp Met Ser Asn Val Cys Gin Pro Thr Glu Phe Ile Ser Arg His Asn 355 360 365Asp Met Ser Asn Val Cys Gin Pro Thr Glu Phe Ile Ser Arg His Asn 355 360 365
Ile Glu Gly Ile Phe Thr Phe Val Asp His Arg Cys Val Ala Thr Val 370 375 380Ile Glu Gly Ile Phe Thr Phe Val Asp His Arg Cys Val Ala Thr Val 370 375 380
Gly Tyr Gin Pro Gin Glu Leu Leu Gly Lys Asn Ile Val Glu Phe Cys 385 390 395 400Gly Tyr Gin Pro Gin Glu Leu Leu Gly Lys Asn Ile Val Glu Phe Cys 385 390 395 400
His Pro Glu Asp Gin Gin Leu Leu Arg Asp Ser Phe Gin Gin Val Val 405 410 415His Pro Glu Asp Gin Gin Leu Leu Arg Asp Ser Phe Gin Gin Val Val 405 410 415
Lys Leu Lys Gly Gin Val Leu Ser Val Met Phe Arg Phe Arg Ser Lys 420 425 430Lys Leu Lys Gly Gin Val Leu Ser Val Met Phe Arg Phe Arg Ser Lys 420 425 430
Asn Gin Glu Trp Leu Trp Met Arg Thr Ser Ser Phe Thr Phe Gin Asn 435 440 445Asn Gin Glu Trp Leu Trp Met Arg Thr Ser Ser Phe Thr Phe Gin Asn 435 440 445
Pro Tyr Ser Asp Glu Ile Glu Tyr Ile Ile Cys Thr Asn Thr Asn Val 450 455 460Pro Tyr Ser Asp Glu Ile Glu Tyr Ile Ile Cys Thr Asn Thr Asn Val 450 455 460
Lys Asn Ser Ser Gin Glu Pro Arg Pro Thr Leu Ser Asn Thr Ile Gin 465 470 475 480Lys Asn Ser Ser Gin Glu Pro Arg Pro Thr Leu Ser Asn Thr Ile Gin 465 470 475 480
Arg Pro Gin Leu Gly Pro Thr Ala Asn Leu Pro Leu Glu Met Gly Ser 485 490 495Arg Pro Gin Leu Gly Pro Thr Ala Asn Leu Pro Leu Glu Met Gly Ser 485 490 495
Gly Gin Leu Ala Pro Arg Gin Gin Gin Gin Gin Thr Glu Leu Asp Met 500 505 510Gly Gin Leu Ala Pro Arg Gin Gin Gin Gin Gin Thr Glu Leu Asp Met 500 505 510
Val Pro Gly Arg Asp Gly Leu Ala Ser Tyr Asn His Ser Gin Val Val 515 520 525Val Pro Gly Arg Asp Gly Leu Ala Ser Tyr Asn His Ser Gin Val Val 515 520 525
Gin Pro Val Thr Thr Thr Gly Pro Glu His Ser Lys Pro Leu Glu Lys 530 535 540 Ser Asp Gly Leu Phe Ala Gin Asp Arg Asp Pro Arg Phe Ser Glu Ile 545 550 555 560Gin Pro Val Thr Thr Thr Gly Pro Glu His Ser Lys Pro Leu Glu Lys 530 535 540 Ser Asp Gly Leu Phe Ala Gin Asp Arg Asp Pro Arg Phe Ser Glu Ile 545 550 555 560
Tyr His Asn Ile Asn Ala Asp Gin Ser Lys Gly Ile Ser Ser Ser Thr 565 570 575Tyr His Asn Ile Asn Ala Asp Gin Ser Lys Gly Ile Ser Ser Ser Thr 565 570 575
Val Pro Ala Thr Gin Gin Leu Phe Ser Gin Gly Asn Thr Phe Pro Pro 580 585 590Val Pro Ala Thr Gin Gin Leu Phe Ser Gin Gly Asn Thr Phe Pro Pro 580 585 590
Thr Pro Arg Pro Ala Glu Asn Phe Arg Asn Ser Gly Leu Ala Pro Pro 595 600 605Thr Pro Arg Pro Ala Glu Asn Phe Arg Asn Ser Gly Leu Ala Pro Pro 595 600 605
Val Thr Ile Val Gin Pro Ser Ala Ser Ala Gly Gin Met Leu Ala Gin 610 615 620Val Thr Ile Val Gin Pro Ser Ala Ser Ala Gly Gin Met Leu Ala Gin 610 615 620
Ile Ser Arg His Ser Asn Pro Thr Gin Gly Ala Thr Pro Thr Trp Thr 625 630 635 640Ile Ser Arg His Ser Asn Pro Thr Gin Gly Ala Thr Pro Thr Trp Thr 625 630 635 640
Pro Thr Thr Arg Ser Gly Phe Ser Ala Gin Gin Val Ala Thr Gin Ala 645 650 655Pro Thr Thr Arg Ser Gly Phe Ser Ala Gin Gin Val Ala Thr Gin Ala 645 650 655
Thr Ala Lys Thr Arg Thr Ser Gin Phe Gly Val Gly Ser Phe Gin Thr 660 665 670Thr Ala Lys Thr Arg Thr Ser Gin Phe Gly Val Gly Ser Phe Gin Thr 660 665 670
Pro Ser Ser Phe Ser Ser Met Ser Leu Pro Gly Ala Pro Thr Ala Ser 675 680 685Pro Ser Ser Phe Ser Ser Met Ser Leu Pro Gly Ala Pro Thr Ala Ser 675 680 685
Pro Gly Ala Ala Ala Tyr Pro Ser Leu Thr Asn Arg Gly Ser Asn Phe 690 695 700Pro Gly Ala Ala Ala Tyr Pro Ser Leu Thr Asn Arg Gly Ser Asn Phe 690 695 700
Ala Pro Glu Thr Gly Gin Thr Ala Gly Gin Phe Gin Thr Arg Thr Ala 705 710 715 720Ala Pro Glu Thr Gly Gin Thr Ala Gly Gin Phe Gin Thr Arg Thr Ala 705 710 715 720
Glu Gly Val Gly Val Trp Pro Gin Trp Gin Gly Gin Gin Pro His His 725 730 735Glu Gly Val Gly Val Trp Pro Gin Trp Gin Gly Gin Gin Pro His His 725 730 735
Arg Ser Ser Ser Ser Glu Gin His Val Gin Gin Pro Pro Ala Gin Gin 740 745 750 Pro Gly Gin Pro Glu Val Phe Gin Glu Met Leu Ser Met Leu Gly Asp 755 760 765Arg Ser Ser Ser Ser Glu Gin His Val Gin Gin Pro Pro Ala Gin Gin 740 745 750 Pro Gly Gin Pro Glu Val Phe Gin Glu Met Leu Ser Met Leu Gly Asp 755 760 765
Gin Ser Asn Ser Tyr Asn Asn Glu Glu Phe Pro Asp Leu Thr Met Phe 770 775 780Gin Ser Asn Ser Tyr Asn Asn Glu Glu Phe Pro Asp Leu Thr Met Phe 770 775 780
Pro Pro Phe Ser Glu 785 Per Pro Phe Ser Glu 785

Claims

Patentansprüche claims
1. Nachweisverfahren für Effektoren intra- und/oder inter- zellulärer Protein-Protein-Wechselwirkungen, wobei man a) in einer Wirtszelle in Gegenwart eines Analyten, in dem man die Effektorfunktion vermutet, zwei Polypeptid-Hybride A1A2 und Bj^ exprimiert, deren Domänen A^ und B-^ zusammen einen funktioneilen Transkriptions- aktivator-Ko plex bilden, wenn die Domänen A2 und B2, welche die intra- und/oder interzelluläre Wechselwirkung imitieren, miteinander wechselwirken, wobei die Wechselwirkung zwischen den Polypeptiddo änen A2 und B2 nur bei Fehlen oder Vorliegen der Effektorfunktion in dem Analyten zu beobachten ist; und b) auf Expression eines Reportergens analysiert, das unter der genetischen Kontrolle einer stromaufwärts gelegenen Transkriptions-Aktivierungsseguenz steht, an welche der funktionelle Transkriptionsaktivator- Komplex bindet, wobei eine Expression des Reportergen-Produkts auf Vorliegen oder Fehlen der Effektorfunktion im Analyten hinweist.1. Detection method for effectors of intra- and / or intercellular protein-protein interactions, whereby a) in a host cell in the presence of an analyte in which one suspects the effector function, two polypeptide hybrids A 1 A 2 and B j ^ expressed whose domains A ^ and B- ^ together form a functional transcription activator complex when the domains A 2 and B 2 , which mimic the intra- and / or intercellular interaction, interact with each other, the interaction between the polypeptides A 2 and B 2 can only be observed in the analyte in the absence or presence of the effector function; and b) analyzed for expression of a reporter gene under the genetic control of an upstream transcription activation sequence to which the functional transcription activator complex binds, expression of the reporter gene product indicating the presence or absence of effector function in the analyte.
2. Verfahren nach Anspruch 1, wobei man in die Wirtszelle eine erste und eine zweite Nukleinsäure-Sequenz einführt, wobei die erste Nukleinsäuresequenz für das Polypeptid-Hybrid A1A2 kodiert, welches die Transkriptions- Aktivierungsdomäne A^ des Transkriptionsaktivators und die Polypeptid-Domäne A2 umfaßt; und die zweite Nu- kleinsauresequenz für das Polypeptid-Hybrid B1B2 kodiert, welches die DNA-Bindungsdomäne B^ des Transkriptionsaktivators und die Polypeptid-Domäne B2 umfaßt.2. The method of claim 1, wherein introducing a first and a second nucleic acid sequence into the host cell, the first nucleic acid sequence coding for the polypeptide hybrid A 1 A 2 , which encodes the transcription activation domain A ^ of the transcription activator and the polypeptide domain 2 comprises A; and the second nucleic acid sequence encodes the polypeptide hybrid B 1 B 2 , which comprises the DNA binding domain B ^ of the transcription activator and the polypeptide domain B 2 .
3. Verfahren nach einem der vorhergehenden Ansprüche, wobei der Analyt ausgewählt ist unter Körperflüssigkeitsproben, umweltanalytischen Proben, Reaktionsgemischen chemischer Synthesen, Lebensmittelproben, Extrakten obiger Proben, und Extrakten oder Homogenaten prokaryotischer oder eukaryotischer menschlicher, tierischer oder pflanzlicher Zellen.3. The method according to any one of the preceding claims, wherein the analyte is selected from body fluid samples, environmental analysis samples, reaction mixtures of chemical syntheses, food samples, extracts above Samples, and extracts or homogenates of prokaryotic or eukaryotic human, animal or plant cells.
4. Verfahren nach einem der vorhergehenden Ansprüche, wobei der Analyt ein Gemisch von Substanzen oder eine Einzelsubstanz umfaßt, für die man die Effektorfunktion vermutet.4. The method according to any one of the preceding claims, wherein the analyte comprises a mixture of substances or a single substance for which the effector function is suspected.
5. Verfahren nach einem der vorhergehenden Ansprüche, wobei der Effektor zellphysiologische Wechselwirkungen eukaryotischer oder prokaryotischer Zellen oder virale Prozesse beeinflußt.5. The method according to any one of the preceding claims, wherein the effector influences cell-physiological interactions of eukaryotic or prokaryotic cells or viral processes.
6. Verfahren nach Anspruch 5, wobei der Effektor ein Schadstoff, wie insbesondere Dioxin, ist.6. The method according to claim 5, wherein the effector is a pollutant, in particular dioxin.
7. Verfahren nach Anspruch 5, wobei der Effektor den Zusammenbau von Viruspartikeln oder die Bindung von Virus- partikeln an zelluläre Rezeptoren beeinflußt.7. The method of claim 5, wherein the effector affects the assembly of virus particles or the binding of virus particles to cellular receptors.
8. Verfahren nach einem der vorhergehenden Ansprüche, wobei das Wirtssystem ein prokaryotisches oder eukaryotisches Wirtssystem ist.8. The method according to any one of the preceding claims, wherein the host system is a prokaryotic or eukaryotic host system.
9. Verfahren nach Anspruch 8, wobei als Wirtssystem ein Hefe-Wirtsstamm, ausgewählt unter SFY526 und HF7c, verwendet wird.9. The method according to claim 8, wherein a yeast host strain selected from SFY526 and HF7c is used as the host system.
10. Verfahren nach einem der vorhergehenden Ansprüche, wobei Aktivierungs-Domäne A^^ abgeleitet ist vom Transkriptionsaktivator GAL4 aus Hefe oder VP16 aus Herpes Simplex Virus.10. The method according to any one of the preceding claims, wherein activation domain A ^ ^ is derived from the transcription activator GAL4 from yeast or VP16 from herpes simplex virus.
11. Verfahren nach einem der vorhergehenden Ansprüche, wobei die DNA-Bindungsdomäne B^ abgeleitet ist vom Transkriptionsaktivator GAL4 aus Hefe oder LexA aus E. coli. 11. The method according to any one of the preceding claims, wherein the DNA binding domain B ^ is derived from the transcription activator GAL4 from yeast or LexA from E. coli.
12. Verfahren nach einem der vorhergehenden Ansprüche, wobei das Reportergen ausgewählt ist unter lacZ aus E. coli oder HIS3 und LEU2 aus Hefe.12. The method according to any one of the preceding claims, wherein the reporter gene is selected from lacZ from E. coli or HIS3 and LEU2 from yeast.
13. Verfahren nach einem der vorhergehenden Ansprüche, wobei die Hybrid A1A2-kodierende Nukleinsäure abgeleitet ist von Plasmid pGAD424.13. The method according to any one of the preceding claims, wherein the hybrid A 1 A 2 coding nucleic acid is derived from plasmid pGAD424.
14. Verfahren nach einem der vorhergehenden Ansprüche, wobei die Hybrid B1B2-kodierende Nukleinsäure abgeleitet ist von Plasmid pGBT9.14. The method according to any one of the preceding claims, wherein the hybrid B 1 B 2 coding nucleic acid is derived from plasmid pGBT9.
15. Verfahren nach einem der Ansprüche 1 bis 14, wobei die Polypeptid-Domäne A2 ausgewählt ist unter dem Ah-Rezeptor oder einem funktionalen Äquivalent davon; und die Polypeptid-Domäne B2 ausgewählt ist unter dem Arndt-Protein und HSP90 und den funktionalen Äquivalenten davon.15. The method according to any one of claims 1 to 14, wherein the polypeptide domain A 2 is selected from the Ah receptor or a functional equivalent thereof; and the polypeptide domain B 2 is selected from the Arndt protein and HSP90 and the functional equivalents thereof.
16. Verfahren nach einem der Ansprüche 1 bis 14, wobei die Polypeptid-Domänen A2 und B2 ausgewählt sind unter viralen Capsid-Proteinen und viralen Envelope-Gykoproteinen und den funktionalen Äquivalenten davon; wobei die Domänen so gewählt sind, daß sie eine intermolekulare Bindung eingehen können.16. The method according to any one of claims 1 to 14, wherein the polypeptide domains A 2 and B 2 are selected from viral capsid proteins and viral envelope gycoproteins and the functional equivalents thereof; the domains are chosen so that they can form an intermolecular bond.
17. Verfahren nach Anspruch 16, wobei die Kombinationen von A2 und B2 ausgewählt ist unter folgenden Polypeptid-Kom- binationen VP1/VP3, VP3/VP1, pl8/pl8 und p24/p24.17. The method according to claim 16, wherein the combinations of A 2 and B 2 is selected from the following polypeptide combinations VP1 / VP3, VP3 / VP1, pl8 / pl8 and p24 / p24.
18. Verfahren zur Isolierung eines Effektors intra- und/oder interzellulärer Protein-Protein-Wechselwirkungen, wobei man a) einen Analyten einem Nachweisverfahren gemäß einem der Ansprüche l bis 17 unterzieht; b) bei positivem Nachweis einer Effektorfunktion in dem Analyten diese mit herkömmlichen präparativen Methoden, gegebenenfalls durch weitere Auftrennung des Analyten, eingrenzt und den Effektor gegebenenfalls mit Hilfe des Nachweisverfahrens gemäß einem der Ansprüche 1 bis 17 lokalisiert und dann mit herkömmlichen präparativen Methoden isoliert.18. A method for isolating an effector of intra- and / or intercellular protein-protein interactions, wherein a) subjecting an analyte to a detection method according to one of claims 1 to 17; b) in the event of positive detection of an effector function in the analyte, this is narrowed down using conventional preparative methods, if appropriate by further separation of the analyte, and the effector if necessary localized using the detection method according to one of claims 1 to 17 and then isolated using conventional preparative methods.
19. Nukleinsäure-Sequenz, kodierend für ein Polypeptid-Hybrid, das Polypeptid-Domänen gemäß der Definition in einem der Ansprüche 13 und 17 umfaßt.19. A nucleic acid sequence coding for a polypeptide hybrid comprising polypeptide domains as defined in one of claims 13 and 17.
20. Nukleinsäure-Sequenz kodierend für ein Polypeptid-Hybrid ausgewählt unter GAL4-Bindungsdomäne/Arnt und GAL4-Akti- vierungsdomäne/Ah.20. Nucleic acid sequence coding for a polypeptide hybrid selected from GAL4 binding domain / Arnt and GAL4 activation domain / Ah.
21. Analysen-Kit zur Durchführung eines Verfahrens gemäß einem der Ansprüche 1 bis 17, umfassend a) eine erste Nukleinsäuresequenz, kodierend für eine Polypeptid-Hybrid A1A2 , b) eine zweite Nukleinsäuresequenz, kodierend für eine Polypeptid-Hybrid B1B2, und gegebenenfalls c) eine Wirtszelle, enthaltend die genetische Informa- tion für ein Reportergen, das unter der genetischen21. Analysis kit for carrying out a method according to one of claims 1 to 17, comprising a) a first nucleic acid sequence, coding for a polypeptide hybrid A 1 A 2 , b) a second nucleic acid sequence, coding for a polypeptide hybrid B 1 B 2 , and optionally c) a host cell containing the genetic information for a reporter gene that is under the genetic
Kontrolle einer stromaufwärts gelegenen Transkriptions-Aktivierungssequenz steht, an welche, nach Einführung der ersten und zweiten Nukleinsäuresequenz in die Wirtszelle der Transkriptionsaktivator-Komplex A1B1 bindet, wenn die Hybridprotein-Domänen A und B2 in Gegenwart oder Abwesenheit eines Effektors miteinander wechselwirken.Control of an upstream transcription activation sequence is available, to which, after the introduction of the first and second nucleic acid sequences into the host cell, the transcription activator complex A 1 B 1 binds when the hybrid protein domains A and B 2 interact with one another in the presence or absence of an effector.
22. Verwendung eines Analysen-Kits nach Anspruch 21 in einem Belastungs- oder Naturstoff-Screeinig-Verfahren. 22. Use of an analysis kit according to claim 21 in a stress or natural product screening process.
PCT/EP1997/003839 1996-07-17 1997-07-17 Process for detecting effectors of intra- and/or intercellular protein-protein interactions WO1998003676A1 (en)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
DE19628894A DE19628894A1 (en) 1996-07-17 1996-07-17 Method of detection for effectors of intra- and / or intercellular protein-protein interactions
DE19628894.0 1996-07-17

Publications (1)

Publication Number Publication Date
WO1998003676A1 true WO1998003676A1 (en) 1998-01-29

Family

ID=7800115

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/EP1997/003839 WO1998003676A1 (en) 1996-07-17 1997-07-17 Process for detecting effectors of intra- and/or intercellular protein-protein interactions

Country Status (2)

Country Link
DE (1) DE19628894A1 (en)
WO (1) WO1998003676A1 (en)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2002037077A2 (en) * 2000-11-06 2002-05-10 Medexbio Co. Screening methods based on transcriptional regulation analysis system using transformed cell lines

Families Citing this family (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP0921192A1 (en) * 1997-12-03 1999-06-09 Leadd B.V. Molecules interacting with apoptin
WO2000046406A2 (en) * 1999-02-05 2000-08-10 Alphagene, Inc. Arrays for investigating protein protein interactions

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5283173A (en) * 1990-01-24 1994-02-01 The Research Foundation Of State University Of New York System to detect protein-protein interactions
US5378822A (en) * 1993-04-08 1995-01-03 Wisconsin Alumni Research Nucleic acids encoding murine and human Ah receptors
WO1995026400A1 (en) * 1994-03-29 1995-10-05 Onyx Pharmaceuticals, Inc. Reverse two-hybrid method

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5283173A (en) * 1990-01-24 1994-02-01 The Research Foundation Of State University Of New York System to detect protein-protein interactions
US5378822A (en) * 1993-04-08 1995-01-03 Wisconsin Alumni Research Nucleic acids encoding murine and human Ah receptors
WO1995026400A1 (en) * 1994-03-29 1995-10-05 Onyx Pharmaceuticals, Inc. Reverse two-hybrid method

Non-Patent Citations (4)

* Cited by examiner, † Cited by third party
Title
GHARAKHANIAN ET AL.: "In vitro assay for protein-protein interaction: carboxyl-terminal 40 residues of simian virus 40 structural protein VP3 contain a determinant for interaction with VP1.", PROCEEDINGS OF THE NATIONAL ACADEMY OF SCIENCE USA, vol. 85, no. 18, September 1988 (1988-09-01), WASHINGTON, DC, pages 6607 - 6611, XP002048680 *
HOFFMAN E C ET AL: "CLONING OF A FACTOR REQUIRED FOR ACTIVITY OF THE AH (DIOXIN) RECEPTOR", SCIENCE, vol. 252, 17 May 1991 (1991-05-17), pages 954 - 958, XP000674442 *
RODER ET AL.: "Refinement of vectors for use in the yeast two-hybrid system", ANALYTICAL BIOCHEMISTRY, vol. 241, no. 2, 1996, pages 260 - 262, XP002048681 *
ZHANG ET AL.: "Gag-Gag interactions in the C-terminal domain of human immunodeficiency virus type 1 p24 capsid antigen are essential for Gag particle assembly", JOURNAL OF GENERAL VIROLOGY, vol. 77, no. 4, 1996, pages 743 - 751, XP002048679 *

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2002037077A2 (en) * 2000-11-06 2002-05-10 Medexbio Co. Screening methods based on transcriptional regulation analysis system using transformed cell lines
WO2002037077A3 (en) * 2000-11-06 2002-11-07 Medexbio Co Screening methods based on transcriptional regulation analysis system using transformed cell lines

Also Published As

Publication number Publication date
DE19628894A1 (en) 1998-01-22

Similar Documents

Publication Publication Date Title
DE69333969T2 (en) Interactive trap system for the isolation of proteins
DE69830497T2 (en) Library for the in-vitro expression of peptides or proteins
DE60014166T2 (en) METHOD FOR MEASURING DEACETYLASE ACTIVITY AND METHOD FOR SCREENING INHIBITORS OR PROMOTERS OF THIS ENZYME
EP0621901B1 (en) Process for screening substances capable of modulating a receptor-dependent cellular signal transduction pathway
DE19502584C2 (en) Method for determining the activity of a regulatory factor and use of this method
DE19641876A1 (en) Streptavidin muteins
DD291093A5 (en) RECOMBINATIVE DNA SEQUENCES AND METHOD FOR THE PRODUCTION OF HUMAN PROAPOLIPOPROTEIN A-I
DE69935313T2 (en) PROOF OF PROOF FOR PEPTIDES
DE69434492T2 (en) PHOSPHODIESTERASE OF THE HUMAN BRAIN
DE10393473T5 (en) Trap tagging: a novel method for the identification and purification of RNA-protein complexes
DE69728802T2 (en) Active ingredient immobilized particles and methods for purifying proteins
DE69936867T2 (en) DNS SEQUENCE, METHOD FOR DETECTION AND MANUFACTURE AND USE
EP1307482B1 (en) Two coloured fluorimetric protease assay
WO1998003676A1 (en) Process for detecting effectors of intra- and/or intercellular protein-protein interactions
WO2004029631A2 (en) Method for identifying bhs-specific proteins and fragments thereof
EP1721974B1 (en) Competitive n-hybrid system
DE19717656A1 (en) DNA sequences coding for the subunit CHLD of plant magnesium chelatases, as well as methods for determining the activity of plant magnesium chelatases
EP0729580B1 (en) Method of identifying hdm-2-specific antibodies
DE10113042B4 (en) HIV inhibitor screening system
EP2304045B1 (en) Chaperone toolbox
JP2000516085A (en) Screen for Ultraspiracle inhibitors
EP1430301B1 (en) Method for producing a normalized gene library from nucleic acid extracts of soil samples and the use thereof
DE69938242T2 (en) REGIONS OF THE PAPILLOMAIRUS E1 HELICASE INVOLVES E1 OLIGOMERIZATION
DE4342769A1 (en) Isolation and cloning of cDNA encoding RNA binding protein (RBP)
DE10222714B4 (en) Cofactors that specifically interact with the glucocorticoid receptor and methods for their identification

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): JP US

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): AT BE CH DE DK ES FI FR GB GR IE IT LU MC NL PT SE

DFPE Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101)
121 Ep: the epo has been informed by wipo that ep was designated in this application
NENP Non-entry into the national phase

Ref country code: JP

Ref document number: 1998506553

Format of ref document f/p: F

122 Ep: pct application non-entry in european phase