WO1998002523A1

WO1998002523A1 - Vaccine preparations

Info

Publication number: WO1998002523A1
Application number: PCT/GB1997/001932
Authority: WO
Inventors: Paul Andrew Barrow; Margaret Ann Lovell; Arthur Keith Turner
Original assignee: The Minister Of Agriculture Fisheries And Food In Her Britannic Majesty's Government Of The United Kingdom Of Great Britain And Northern Ireland
Priority date: 1996-07-17
Filing date: 1997-07-15
Publication date: 1998-01-22
Also published as: GB9615022D0; GB9900976D0; EP0912721A1; AU3552797A; GB2331521A; GB2331521B

Abstract

The invention provides a live gut-colonising microorganism (e.g. Salmonella) capable of evoking an immune response in an animal (e.g. a chicken) for use as a vaccine, characterised in that the microorganism has a specific mutation which impairs its ability to colonise the alimentary tract of the animal. Preferably the microorganism is attenuated, and/or has a negative serological marker, and/or expresses antigens from heterologous organisms. Preferably the mutation comprises the inactivation of a gene selected from: hupA, dksA, rfaY, sipC or clpB. Also disclosed are associated methods generating the vaccines, pharmaceutical preparations, methods of protecting aninals and the products of these methods.

Description

VACCINE PREPARATIONS

The present invention relates to live vaccines, methods of generating them and applications for them. The invention further relates to genes and polynucleotides which may be used to manipulate such vaccines.

Poultry is a significant source of food-poisomng organisms, including Salmonella s, in man. Poisoning occurs following ingestion of Salmonella organisms with poultry meat. Contamination of the meat often stems from contamination of the carcass with faecal material.

Additional contamination can occur when highly invasive strains penetrate tne alimentary mucosa and become localised m internal organs used in cooking, such as the liver, heart cr ovaries (whicn can also produce infected eggs). Most serotypes, however, are confined to the alimentary tract of poultry and only exceptionally produce clinical disease in the bird.

Present methods for controlling faecal shedding of Salmonell a serotypes by commercial poultry, or for preventing initial infection, are either inadequately carried out, not completely effective or produce logistical problems. With the technology and information already available it would be feasible to rear chickens completely free of Salmonella and also Campyl oba cter . However, the hygiene and management restrictions would place considerable constraints on an industry with alreaαy small profit margins.

Another approacn has been antibiotic therapy to rid the poultry of infection. However this can induce antibiotic resistance in the Salmonella organisms themselves or in others such as Escheri chi a coll and Campy loba cter. Antibiotics may also be relatively ineffective in reducing faecal excretion.

Competitive exclusion of undesirable microorganisms can be used on its own m newly hatched broilers or in conjunction w th antibiotics in breeders. This has been applied extensively in some countries, but is not yet used in many parts of the broiler industry. There are two standard methods whereby th s can be done. The first is based upon the fact that newly hatched chicks are far more susceptible to Salmonella infection than are adult birds, the difference being the result of the normal adult intestinal microbial flora possessed by the adult. Administration of this flora to chicks gives them , within a few hours, the full resistance of the adult bird.

The second method utilises bacteria which are sai/nσneila-like in their colonisation characteristics but which are avirulent (Barrow et al . , Epidemiol. Infect. 1987, 98, 311-322; and A Berchieri Jnr et al. Epidemiol. Infect. 1990, 104, 427-441).

Immunisation with killed vaccines is used on an ad hoc basis with varying degrees of success. However, some objections exist to the use of live, attenuated vaccines with poultry (see Barrow (1990) "Immunological control of Salmonella in poultry" Proceedings of the International Symposium on control of Human Bacterial Enteropathogens in poultry: Atlanta, Georgia, USA, 1989. In particular, because the vaccine organisms are shed m considerable numbers following immunisation, there is a risk that they will enter the food chain with possible, unknown, effects on consumer. The risk is particularly disturbmα when the vaccine contains uncharacterised mutations.

Notwithstanding this a number of live, attenuated vaccines are currently commercially available. These include Zoosaloral H (TM) from Impfstoffwerk Dessau-Tornau Gmbh and also TAD Salmonella vac (RTM) T from TAD Pharma .

The general principles of colonisation by microorganisms of the alimentary tract of a host animal have been the subject of a number of papers, particularly as regards Salmonella in chickens.

It is known that following infection with a Salmonella serotype that characteristically produces systemic disease typhoid-like disease, or with a vaccine strain derived from that serotype, a variety of animals develop a strong immunity against reinfection. Such serotypes, which include S . gallmarum and S . chol erae-suis , tend to colonise the gut poorly in the absence of clinical disease (e.g. excreted for only 2 to 3 days). A contribution to the relatively poor intestinal colonising ability in chickens by S. gallmarum has been shown to be made by the virulence- associated plasmid

In contrast to the above, Salmonella serotypes associated with food-poisoning {mainly S . typhimuri um and S . enteri tidi s) rarely produce systemic diseases unless very young chicks are infected. These serotypes tend to colonise the alimentary tract of poultry well, that is they are excreted in the faeces for many weeks (e.g. 7 to 11 weeks) and in considerable numbers after oral inoculation. Such serotypes are usually isolated from the caeca and, to a lesser extent, the crop.

Some work has been published relating to one mutant of S . typnimuπ um having reduced colonising ability (Craven (1994)

Avian Diseases 38:401-408), this work was essentially concerned with the underlying methods by which the bacteria adhere to cecal mucus .

The applicants have found that impaired colonisation is useful in the field of live vaccines.

The present invention provides a live microorganism for use as a vaccine, said microorganism comprising a gut-colonising microorganism which is capable of evoking a protective immune response n an animal to which it is administered, cnaracterised n that the microorganism is a mutant organism whose ability to colonise the alimentary tract of said animal is inhibited as a result of a mutation.

Mutation of a microorganism so as to inhibit the colonisation of the alimentary tract of an animal can be achieved using various techniques. For example, following random mutation, for instance using transposons, suitable mutants can be identified by testing the gut colonising properties as illustrated hereinafter.

In particular, impaired ability of mutants to colonise the alimentary tract of an animal is indicated by the observation that the mutant microorganisms are excreted in smaller quantities and/or for a shorter time scale following challenge than are the parent strain (i.e. a similar strain which does not include the mutation) . This can be assessed without undue burden by the methods employed in "Chromosomal transposon mutations affecting intestinal colonisation of chickens by S. Typhimurium" by Barrow and Lovell in CNEVA/INRA Reports and Communications: Salmonella and Salmonellosis (Septernoer 15-17, 1992; Ploufragan/Saint- Brieuc-France) or methods analogous to these for non-Salmonella microorganisms. In that study cloacal swabs were taken at various intervals from a statistically significant group following challenge w th mutant ard parent strains. Swabs were plated out and the presence of sa lmonella organisms (either as colonies or organisms detected by e^ππcnπent culture) was assessed. Preferably tne time scale over which excretion (for instance as measured by one of these methods) occurs is reduced by at least 50% or more preferably 63, ^" , 80 or 90* compared to the parent strain.

Most preferably the number of chickens excreting the microorganism is reduced to less than 20^a of that found with parent strain as measured 3 weeks after inoculation

In general, impairment cf tie ability of the microorganism to colonise the alimentar tract of an animal will arise as a result of a specific mutation wnicn affects a gene associated with gut colonising activity. In particular, the specific mutation in the microorganism results in the inactivation of one or more genes associated with colonisation of the alimentary tract of the animal .

As used herein, the terr 'inactivation' means that the gene function is significantly impaired, for instance by down- regulating, mutating or deleting the gene itself or associated nucleotide sequence elements which control its transcription, translation or translocation within the microorganism. Mutations include point mutations, partial deletion or insertion mutations as would be understood in the art. Thus the vaccine microorganisms of the present invention differ from the corresponding wild type strain or vaccine or parent strains from which they are derived, in that they have been altered to have a specific mutation which gives them an impaired ability to colonise the alimentary tract of t^he animal.

By 'alimentary tract' is meant any part of the intestine or the caeca - the main site of colonisation.

Once suitable genes have been identified, mutants of the invention can be produced using recombinant DMA technology as illustrated hereinafter.

Microorganisms used in the present invention are suitably those which cause food poisoning or other pathoαer.: Microorganisms which colonise the gut e.g. enterobacteriaceae sjch as Salmonella , Yersima , E. coll , Campy lobacte r , i steπa , Bacillus cereus, Shigella etc. In particular, the bacteria comprise

Salmonella , E. coli , Campylobacter , Li steri a or Bacillus cereus . Preferably the microorganism comprises a mutart salmonella strain.

Examples of suitable genes which can be mutateα so as to inhibit the ability of the microorganisms to colonise ^e alimentary tract of an animal include nupA, dksA, rfa i , si cC and clpB . In particular, the animal will be an animal possessing a normal adult gut flora.

The present inventors have established that -^activation of the following genes in S . typhimuri um can generate mutants having impaired ability to colonise the alimentary tract of chickens: hupA, dksA, rfa Y, sipC and clpB . All of these αenes have been previously characterised. However there role m colonisation was previously unknown. These genes and suitable mutants are described more fully below.

Gene inactivation may be carried out by a number of techniques such as are well known to those skilled in the art (see the latest Edition of Sambrook, Fritsch & Maniatis "Molecular Cloning: A Laboratory Manual", Cold Spring Harbour Laboratory, Cold Spring Harbour, N.Y.). One suitable method entails allele exchange between the parent Salmonel la strain and a suicide vector incorporating a mutated, inactivated, form of the gene.

Host animals which could be protected include any animals which are susceptible to colonisation by such microorganisms e.g. mammals such as humans or companion animals. Preferably, though, the animals are food animals such as poultry, cattle, pigs or sheep, in particular poultry such as chickens or turkeys.

It has been found that by impairing the ability of the microorganism to colonise the alimentary tract of an animal, the microorganisms are attenuated to some extent. This means that the virulence of the microorganism has been reduced whilst the ability of the microorganism to elicit antibodies against the virulent form has been retained. However, the microorganisms may include further attenuations, i.e. modifications in other genes which lead to reduced virulence. Suitable further attenuations embrace not only those which are characterised in existing commercially available live vaccines, but also those which may later oe characterised. Examples of known attenuations include mutations in the aro A, gal E and pur A genes. Also known are those which comprise mutations in the electron transport genes.

The use of organisms which colonise the alimentary tract such as salmonella, as 'carriers' for lmmunogemc proteins which can give rise to other immunity is well known. In these cases, the carrier microorganism is engineered to express antigens from foreign organisms (e.g. from Shi gella , cholera, malaria sporozoites) . Such vaccines may further include the specific mutation of the present invention. In such cases, it would be necessary for the attenuation to reduce the virulence of the microorganism without significantly reducing the effectiveness of these antigens.

Preferably the microorganisms are further characterised in that they exhibit a negative serological marker and/or are otherwise differentiable from parental or wild-type strains. This allows vaccinated animals to be distinguished by serology from animais which had been infected for example with wild-type strains. Examples of such markers may be roughness, non-flagellation, non- flmbriation.

One suitable marker antigen which could be disabled is the

Salmonella Enteri tidi s Fimbπal Antigen (SEFA) disclosed in WO 92/06197 of M.A.F.F. An alternative marker could be certain rfa or rfb mutants described hereinafter which allow mutated strains to be recognised serologically as a result of the alteration in the lipopolysaccharide coat of the organism. Again however, the mutation should not significantly affect the ability of the microorganism to produce the desired immune response in an animal to which it is administered.

1. Certain mutant gut-colonismg microrganisms as used above are novel and these form a further aspect of the invention. In particular the invention provides a mutant gut-colonising microorgansim, such as a mutant Salmonella, E. coll , Campylobacter _. liste ia or Bacillus cereus , wherein at least one of the genes selected from hupA, dksA, rfa Y, sipC or clpB has been down-regulated or inactivated so as to inhibit the ability of the microorganism to colonise the alimentary tract of an animal. These microrganisms may comprises further mutations which attenuate the microorganism and/or provide a negative serological marker as described above.

Microorganisms of the invention are suitably used in the form of pharmaceutical preparations or vaccines. Thus the invention further provides a vaccine comprising a microorganism according to any one of the preceding claims in combination with a pharmaceutically acceptable carrier or diluent. The pharmaceutical preparation or vaccine is is preferably in dosage unit form, containing an amount of any of the live vaccine microorganisms as described above in a non-toxic quantity which s suitable to evoke a protective response in an animal.

Preferably the dosage unit contains around between 1 x 10¹ and 1 x 10^a' preferably around 1 x 10^θ colony forming units of the microorganism in a form aαaDted for direct administration to the animal, for instance wnicn is suitable for oral administration as a tablet, or in arouⁿα O.l-i ml of an aqueous carrier. A stock suspension contaimnα precise multiples (e.g. 100, 500, 1000) of dosage units forms a f rther embodiment of this aspect of the invention.

In a further aspect cf the irvention there is provided a method of protecting an animal comprising administering a live vaccine microorganism as descnoed above to said animal. Depending on the animal it may be advantaαeous to administer the live vaccine on more than one, for instance two, three or four, separate occasions in order to increase the protective response. In addition, the vaccine may be administered in combination with other killed vaccires which may aiso increase the response. Preferably the timin of the administration ( s ) is selected such as to maximise the effect. For instance in vaccinating chickens it may be preferaole *-o g-^e the first administration to chicks as early as possible (e.α within the first day or few days of hatching) . This may enco_raαe a more systemic establishment of the vaccine strain t-ereC_j, --creasing the protective lmmunogenic response. Additional-/ early administration may lead to a competitive exclusior effect of non-vaccine organisms.

Preferably the live vacc-^e Ticrcorganism is administered orally to the animal e.g. _.n dπrκi"α water, with feed, or as a spray

A further aspect of the inveⁿtion provides a method of compromising the aDii__ty of αut-colomsing microorganisms to colonise the alimentary tract cf a animal comprising the specific inactivation of any one of t"e above-mentioned genes. In particular, this method will be used in connection with very young animals, and will comprise oral administration of the microorganism to the young animal.

Yet a further aspect of the invention provides a method of generating the live vaccine microorganisms of the first aspect comprising: (a) selecting a αut-colonismg microorganism, (b) treating said microorganism so as to produce mutants in which one or more genes associated with colonisation of the alimentary tract have been inactivated, (c) selecting and culturing a mutant with the desired properties.

Preferably the microorganisms and genes are those described above .

An animal protected as above forms a further aspect of the invention. Preferably the protected animal is a foodstuff animal, and a foodstuff substantially free of contaminating organisms prepared from a slaughtered animal as above forms a yet further aspect of the invention.

The methods and materials of the present invention will now be described, by way of illustration onl , with reference to the following non-limitmg examples. Other

falling within the scope of the invention will occur tc those sxilled n the art in the light of these.

EXAMPLES

EXAMPLE 1: IDENTIFICATION OF A VARIETY OF COLONISATION GENES IN S. TYPHIMURIUM

MATERIALS AND METHODS

Chickens : all chickens were from a specified pathogen free flock. Their methods of rearinα and diet have been described previously (Smith and Tucker (1975) J Hygiene, Cambridge 75: 275-292. All feed was unmedicated.

Bacterial cultures : the bacterial culture used .vas S . typhimuri um F98 which was cultured as described in "Chromosomal transposon mutations affecting intestinal colonisation of chickens by S. typhimurium" by Barrow and Lovell in CNEVA/INRA Reports and Communications: Salmonella and Salmonellosis (September 15-17, 1992; Ploufragan/Saint-Brieuc-France) , the entire technical content of which is incorporated herein by reference.

Production of transposon mutants: the method employed was that used in Barrow and Lovell (1992) supra. Briefly, mutagenesis was carried out using Tn_5 in which the kanamycm resistance gene had been replaced by that for tetracyclme resistance. The transposon Tn5_-Tc was present on pCHR71 which is a ther osensitive replication mutant of the broad host range transmissible plasmid R388 encoding trimethopri resistance. The whole plasmid, designated pCHR82, present in E. coll K12 strain MC1061, was used as a suicide vector for delivering the modified Tn5. The plasmid pCHR82 was transferred to S. typhimuri um using standard broth conjugation incubating statically overnight at 30 "C. After isolating the transcipient on L-agar containing tetracyclme and sodium nalidixate, many separate cultures of this were set up in nutrient broth containing tetracyclme in the wells of a sterile haemagglutmation tray incubated overnight at 43^'C. Cultures from each well were tested for a loss of trimethoprim and for the maintenance of tetracyclme resistance. Such cultures were considered to be transposon mutants and were stored at -70'C.

Assessment of intestinal colonisation: this was assessed as in Barrow and Lovell (1992) supra. Essentially the method used entailed the oral inoculation of individual three-week-old chickens witn 0.5ml of a broth culture of the strain to be tested. Chickens were housed together. Two days later the cloaca of the chickens were swabbed and this eluted in 1 ml phospnate buffered saline. This was then plated in a standard manner (Smith and Tucker (1975) supra) on to plates of brilliant green agar (Oxoid) containing nalidixic acid (20pg per m] ) . Mutants of interest were retested in increasing numbers of chickens .

Assessment cf virulence: newly hatched (less than 1 day old) chicks were inoculated orally with 10⁹ c.f.u. of the strain to be tested in 0.1 ml carrier. Mortality was measured over a three week period.

Production of transductant mutant: positive results with transposon mutants were confirmed by transducing the mutated gene into a fresh parental background. The method employed was that using phage P22, as described in Barrow et al (1990) Epidemiol. Infect. 104: 413-426, the entire technical content of which is incorporated herein by reference.

Production of defined mutants:

Results with transposon mutants and transductants were further confirmed in some cases with defined mutants, which were prepared as follows:

METHOD USED FOR hupA, sipC, clpB AND rfbK

Fragments of the genes concerned were amplified by PCR using oligonucleotide primers 1 and 2 for each gene. These were digested with Xbal ( clpB primer 1, rfbK primer 1 , and sipC primer 1), EcoRI (clpB primer 2, rfbK primer 2, hupA primer 1 , sipC primer 2) or Sail (hupA primer 2) and ligated into the suicide vector pGP704 digested with Xbal and EcoRI (for clpB, rfbK, sipC) or EcoRI and Sail (for hupA) .

A kanamycin resistance GenBlock (Pharmacia Biotech) was amplified by PCR using oligonucleotide primers which have Kpnl sites included in their 5 ' ends . This was ligated into the Kpnl sites in the cloned rfbK, h upA and sipC fragments of the recombinant plasmids. The kanamycin resistance GenBlock was digested from a pBluescπpt (Stratagene Ltd) derivative and ligated into the EcoRV site in the clpB gene fragment. E. coll SY327 λ pi r was used in the different stages of the construction, bacterial cells being made competent by treatment with 50 mM calcium chloride solution.

One recombinant plasmid of the correct construction was chosen for each gene concerned and was transformed into E. coli SM10 λ pir (Simon et al (1983) Bio/Technology 1: 784-789) as described above. Defined mutations were then transferred to the wild-type S. typhimuri um strain by conjugation; defined S. typhimurium mutants were selected with kanamycin, and those which showed loss of the pGP704 vector (ampicillin sensitivity) were chosen. The construction of the mutants was confirmed by PCR using primers 1 and 2 together, and in combination with the kanamycin resistance GenBlock primers.

Oligonucleotide primers for hupA (Higg s & Hillyard (1988) J. Bacteriol. 170: 5751-5758, fig 2.)

Primer 1: nucleotide positions -175 to - 154 has a natural EcoRI site at the 5 ' end

Primer 2: nucleotide positions 291 to 314 has a natural Sail site at the 5 ' end

The Kpnl site is at nucleotide positions 142-147 in the gene

Oligonucleotide primers for sipC ( DNA database entry code newembl : st25631, last updated 6' September 1995, Version 1)

Primer 1: nucleotide positions 2627-2646 Xbal added to 5'end

Primer 2: nucleotide positions 3600-3619 EcoRI added to 5' end

The Kpnl site is at nucleotide positions 3136-3141.

Oligonucleotide primers for clpB (from E. coli sequence; DNA database entry code em_ba:ecclpB last updated 23 November 1993, Version 6)

Primer 1: nucleotide positions 1385-1405 Xbal site added to 5' end

Primer 2: nucleotide positions 2625-2645 EcoRI site added to 5' end

The £coRV site is at nucleotide positions 1909-1914

Oligonucleotide primers for rfJK (DNA database entry code em_ba:serfbb last updated 23^'d November 1993, Version 1)

Primer 1: nucleotide positions 18,678-18,698 ibal site added to 5' end Primer 2: nucleotide positions 19,722-19,741 EcoRI site added to 5' end

The Kpnl site is at nucleotide positions 19,075-19,080

Kanamycin cassette oliqonucleotides

Primer 1 GAATTCGGTACCCGCTGAGGTCTGCCTCGTGAAGG

Primer 2 GAATTCGGTACCAAAGCCACGTTGTGTCTAAAATC

RESULTS

The results are shown in Table 1 below.

The mutated genes are as follows:

hupA: this gene encodes a polypeptide of the nucleoprotein HU which is involved in maintaining the structure of the nucleoid. It is possible that HU, as with other nucleoproteins, effects changes in gene expression through changes DNA supercoiling (see Higgins & Hillyard (1988) J. Bacteriol 170: 5751-5758).

dksA: in E. coli it was found that, at high copy number, the dksA gene suppressed some cf the mutant phenotypes associated with the dnaK, dnaJ and grpE genes which are involved in control of the heat shock response (see Kanji & Craig (1990) J. Bacteriol 172: 2055-2064). The S . typhimuri um dksA mutant does not grow on minimal medium but requires the addition of amino acids.

Table 1

The figures brackets show the results in a subsequent mortality trial using oral administration cf a larger batch of newly hatched chicks.

sipC: the gene product is required for Salmonella invasion of host cells (see Kamga et al (1985) J. Bacteriol. 177: 3965- 3971) .

clpB : the E. coli gene product alters the specificity of the ClpP protease. In addition, ClpB protein possesses chaperone activity, and is probably expressed during the heat shock response (see Kitagawa et al (1991) J. Bacteriol. 173:4247-4253).

rfa and rfb genes: these genes are required for the synthesis of lipopolysaccharide (LPS) . The role of the rfa Y gene product is not known, but it is though that it may regulate activity of RfaJ. The rfa Y mutant shows normal LPS with SDS-PAGE, while the rfaK, rfbB and rfbK mutants show the rough phenotype (see MacLachlan et al (1991) J. Bacteriol. 173:7151-7163 for rfa genes; Jiang et al (1991) Mol. Microbiol. 5:695-713 for rfJb genes) .

EXAMPLE 2: PREPARATION OF LIVE VACCINE ORGANISM

A strain is selected which has a high mvasiveness and the ability to demonstrate a specific competitive exclusion effect. A specific attenuating, colonisation-impairing mutation (e.g. in clp B) is introduced. Alternatively a non-colonis g mutation, not associated with attenuation, is introduced into the strain which has been mutated in some other way. A negative serological marker (e.g. non-flagellation or roughness) is also introduced.

EXAMPLE 3: PREPARATION OF VACCINE

The vaccine strain is suspended in a storage medium such as are well known to those skilled in the art, or lyophilised for reconstitution prior to use.

EXAMPLE 4: INOCULATION PROTOCOL

For day-old chicks the vaccine is used as a spray such that each bird receives at least 10 c.f.u. If breeding or layer birds are being vaccinated a second parentaral vaccination is given at the age of 12-14 weeks consisting of 10⁷ c.f.u. in 0.1 ml given intra-muscularly or subcutaneously.

Claims

1. A live microorganism for use as a vaccine, said microorganism comprising a gut-colonising microorganism which is capable of evoking a protective immune response in an animal to which it is administered, characterised in that the microorganism is a mutant organism whose ability to colonise the alimentary tract of said animal is inhibited as a result of a mutation.

2. A microorganism as claimed in claim 1 wherein mutation is such that, as a result of its presence, the time scale over which the microorganism is excreted from the alimentary tract of the animal following inoculation is reduced by at least 50⁵;.

3. A microorganism as claimed in claim 1 or claim 2 wherein the mutation is such that, as a result of its presence, the quantity of microorganism is reduced to less than 20* of that found with a similar organism without said mutation, as measured 3 weeks after inoculation.

4. A microorganism as claimed in any one of the preceding claims wherein the microorganism is an Enterobacteriaceae .

5. A microrganism according to claim 4 selected from the group: Salmonella , E. coli , Yersinia , Campylobacter , Listeπa , Bacillus cereus or Shigella .

6. A microorganism according to claim 5 which is a Salmonella .

7. A microorganism as claimed in any one of the preceding claims wherein the mutation results in the down-regulation or inactivation of one or more genes associated with colonisation of the alimentary tract of the animal.

8. A microorganism as claimed in claim 7 wherein said gene associated with colonisation of the alimentary tract is hupA, dksA, rfaY, sipC or clpB.

9. A microorganism as claimed in any one of the preceding claims wherein said microorganism has at least one further mutation which attenuates said organism.

10.A microorganism as claimed in claim 7 wherein the said further mutation comprises one or more mutations in the aro A, gal E or pur A or in an electron transport gene.

11. A microorganism as claimed in any one of the preceding claims wherein the microorganism expresses heterologous antigens.

12.A microorganism as claimed in any one of the preceding claims wherein the microorganism further comprises a negative serological marker.

13. A microorganism as claimed in claim 12 wnerein the negative serological marker is selected from the group: roughness, non- flagellate, non-fimbriate, mutated SEFA.

14. A mutant gut-colonising microrganism wnerein at least one of the genes selected from hupA, dksA, rfa Y, sipC or clpB has been down-regulated or inactivated so as to inhibit the ability of the microorganism to colonise the alimentary tract of an animal possessing a normal adult gut flora.

15. A mutant microrganism according to claim 14 which comprises a mutant Enterobacteri a ceae.

16. A mutant microorganism according to claim 14 which is selected from Salmonella , Yersmia, E. coli , Campylobacter , lxsteria , Bacill us cereus or Shigella .

17. A mutant microorganism according to any one of claims 14 or claim 16 which comprises further mutations which attenuate the microorganism and/or provide a negative seroloαical marker.

18. A mutant microorganism according to claim 17 wherein the said further mutations one or more mutations the aro A, gal E, pur A or an electron transport gene.

19. A vaccine comprising a microorganism according to any one of the preceding claims in combination with a pharmaceutically acceptable carrier or diluent.

20. A vaccine according to claim 19 dosage unit form.