WO1997043617A2 - Method for dissociating biotin complexes - Google Patents
Method for dissociating biotin complexes Download PDFInfo
- Publication number
- WO1997043617A2 WO1997043617A2 PCT/US1997/008052 US9708052W WO9743617A2 WO 1997043617 A2 WO1997043617 A2 WO 1997043617A2 US 9708052 W US9708052 W US 9708052W WO 9743617 A2 WO9743617 A2 WO 9743617A2
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- biotin
- biotinylated
- compound
- complex
- nucleic acid
- Prior art date
Links
Classifications
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6813—Hybridisation assays
- C12Q1/6816—Hybridisation assays characterised by the detection means
- C12Q1/6823—Release of bound markers
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6813—Hybridisation assays
- C12Q1/6834—Enzymatic or biochemical coupling of nucleic acids to a solid phase
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6869—Methods for sequencing
Definitions
- Detection techniques are under development which will enhance signal acquisition and provide automated and parallel sample processing, and will likely lead to cost-efficient and time-saving sample processing in diagnostic and forensic applications. Also, large DNA sequencing projects, such as the Human Genome Initiative, that seek to sequence genes or entire genomes, for research or diagnostic purposes, require automated techniques with a high throughput to ensure timely completion of the project.
- MALDI-TOF matrix assisted laser desorption/ionization time-of-flight
- biotin-streptavidin system is a common and useful tool for the purification of biotinylated materials (X. Tong and L.M. Smith (1992) Anal.Chem., 64,
- Streptavidin and also avidin are bacterial proteins which form tight complexes with biotin, including biotin conjugated to other molecules such as nucleic acids.
- the stability of the biotin- streptavidin complex during intensive washing permits removal of non-specif ⁇ cally bound and non-biotinylated material, which is of great importance for the success of reaction product analysis.
- the properties of the biotin-streptavidin complex can be used in systems employing biotin binding to streptavidin on a solid support and immobilization of biotinylated molecules.
- biotin-streptavidin complex is the result of non-covalent bonding
- affinity of streptavidin for biotin is about one million times more powerful than those of most antibody-antigen interactions.
- it is important to provide conditions for an effective dissociation of the complex to recover the analyte molecules without modification.
- biotinylated substances are based on biotin- streptavidin complex dissociation using substances like phenol, urea or most preferably 95% formamide at temperatures between 25 and 100°C. (Cocuzza et al., U.S. Patent No. 5,484,701 , 1996).
- formamide has been shown to be harmful for sample crystallization, a necessary process for MALDI-TOF analysis, and for various enzymatic reactions (e.g. reactions employing alkaline phosphatase). Therefore methods based on the use of formamide are only useful for subsequent gel electrophoretic analysis, but are harmful if enzymatic reactions should be performed involving the isolated material or other analytical tools are applied.
- the endo- or exonucleolytic digest, for example, of PCR products would benefit from a method allowing isolation of single stranded PCR products which can be digested after purification.
- the invention provides a method for dissociating a complex comprising a biotin compound and a biotin-binding compound.
- the method includes contacting the complex with an effective amount of an amine, under conditions such that the complex is dissociated, thereby forming a biotin compound and a biotin-binding compound.
- the complex is contacted with an amine at a temperature of between about 25° and about 100°.
- the biotin compound is a biotinylated macromolecule.
- the biotinylated macromolecule is selected from the group consisting of a biotinylated nucleic acid sequence, a biotinylated protein, a biotinylated carbohydrate, and a biotinylated lipid.
- the biotin-binding compound is selected from the group consisting of avidin, streptavidin, and derivatives thereof.
- the biotin-binding compound is immobilized on a solid support.
- the solid support is a magnetic bead.
- the biotin compound is separated from the biotin-binding compound.
- the biotin compound is purified.
- the biotin compound is purified by a method selected from the group consisting of lyophilization, precipitation, filtration, and dialysis.
- the biotin compound is immobilized on a solid support.
- At least one of the biotin compound and the biotin-binding compound is analyzed by mass spectrometry.
- the biotin-binding compound after dissociation of the complex, retains biotin-binding activity. In preferred embodiments, after dissociation of the complex, the biotin moiety of the biotin compound remains substantially intact.
- the amine is ammonia. In other preferred embodiments, the amine is a primary amine
- the invention provides a method for analyzing a biotinylated nucleic acid.
- the method includes the steps of contacting the biotinylated nucleic acid with a biotin-binding compound, thereby forming a biotinylated nucleic acid:biotin-binding compound complex and contacting the complex with an effective amount of an amine, under conditions such that the complex is dissociated, thereby releasing a biotinylated nucleic acid and a biotin-binding compound; and analyzing the biotinylated nucleic acid.
- the nucleic acid is DNA.
- the biotin-binding compound is immobilized.
- the biotinylated nucleic acid is analyzed by mass spectrometry.
- the amine is ammonia.
- the subject method provides a process for isolating biotinylated single stranded or double stranded DNA from enzymatic reactions for the purpose of purification and sample conditioning, which can be followed by subsequent analysis (e.g., by mass spectrometry) or further enzymatic reactions.
- Figure 1 is a schematic drawing of the purification of biotinylated PCR products where the reaction was carried out in solution.
- Figure 2 is a schematic drawing of two different means for detecting
- Figure 3 is a schematic drawing of different means for detecting PCR digest products with single- or double-stranded specific endo- or exonucleases to generate DNA sequence information.
- Figure 4 shows a MALDI-TOF MS spectrum of a biotinylated 20mer oligodeoxynucleotide (SEQ ID NO: 1) immobilized on streptavidin Dynabeads and recovered using the method as described in Example 1.
- Figure 5 shows a MALDI-TOF MS spectrum of a PCR product from the hepatitis B core antigen coding DNA region, purified with streptavidin Dynabeads and recovered from the beads using ammonium hydroxide, as described in Example 2.
- Figure 6 shows a mass spectrum of the A-reaction of the S anger sequencing reaction purified with M-280 streptavidin Dynabeads.
- Figure 7 shows a mass spectrum of an exonucleolytic digest of a 60 mer
- Figure 8 shows a mass spectrum of an exonucleolytic digest of a biotinylated 25mer immobilized on Dynabeads.
- the invention features a method for dissociating biotin compounds, including biotin conjugated (biotinylated) carbohydrates, proteins, polypeptides, peptides and nucleic acid molecules (e.g., double-stranded or single- stranded DNA or RNA), from biotin-binding compounds, including streptavidin or avidin compounds.
- biotin compounds including biotin conjugated (biotinylated) carbohydrates, proteins, polypeptides, peptides and nucleic acid molecules (e.g., double-stranded or single- stranded DNA or RNA)
- biotin-binding compounds including streptavidin or avidin compounds.
- biotin compound refers to biotin and biotin derivatives and analogs.
- biotin compounds include compounds such as biotin, imminobiotin, and covalent or non-covalent adducts of biotin with other moieties.
- preferred biotin compounds retain the ability to bind to avidin or streptavidin, or other biotin-binding compounds.
- biotin has been used to derivatize a variety of molecules, including both small molecules (for example, chelating agents, e.g., 186 Re- chelators conjugated to biotin, see, e.g., U.S.
- Patent 5,283,342 to Gustavson et al. as well as large molecules, including biomolecules (e.g., nucleic acids (including DNA, RNA, DNA/RNA chimeric molecules, nucleic acid analogs, and peptide nucleic acids), proteins
- biotinylation including enzymes and antibodies, carbohydrates, lipids, and the like.
- a variety of coupling or crosslinking agents such as protein A, carbodiimide, dimaleimide, dithio-bis-nitrobenzoic acid (DTNB), N-succinimidyl-S-acetyl-thioacetate (SATA), and N-succinimidyl-3-(2-pyridyldithio) propionate (SPDP), 6- hydrazinonicotimide (HYNIC), N 3 S and N 2 S 2 can be used in well-known procedures to synthesize biotin amide analogs or biotin compounds.
- biotin can be conjugated via DTP A using the bicyclic anhydride method of Hnatowich et al Int. J. Appl. Radial Isotop.
- biotin a lysine conjugate of biotin
- NHS-LC-biotin which can be purchased from Pierce
- biocytin a lysine conjugate of biotin
- biotin compounds due to the availability of a primary amine.
- biotin acid chloride or acid precursors can be coupled with an amino derivative by known methods.
- preparation of a variety of moieties conjugated to a biotin compound is possible.
- a biotin compound can be conjugated to a solid support, if desired.
- conjugated means ionically or covalently linked or attached (e.g., by use of a derivatizing reagent).
- biotin-binding compound refers to a compound which can tightly but non-covalently conjugate with biotin compounds.
- Biotin-binding compounds include avidin and streptavidin, as well as derivatives and analogs thereof, including avidin or streptavidin conjugated to other moieties (such as other proteins).
- Preferred biotin- binding compounds include avidin, streptavidin, covalent adducts of avidin and streptavidin, and fusion proteins having a domain which has biotin-binding activity.
- anti-biotin antibodies can be used as the biotin-binding compound.
- solid support refers to a support which is solid or insoluble material (e.g. a material that can be separated from a reaction mixture by filtration, precipitation, magnetic separation, or the like).
- Exemplary solid supports include beads (such as Sepharose, Sephadex, polystyrene, polyacrylamide, cellulose, Teflon, glass, (including controlled pore glass), gold, or platinum); flat supports such as membranes (e.g., of cellulose, nitrocellulose, polystyrene, polyester, polycarbonate, polyamide, nylon, glass fiber, polydivinylidene difluoride, and Teflon); glass plates, metal plates (including gold, platinum, silver, copper, and stainless steel); silicon wafers, mictrotiter plates, and the like.
- Flat solid supports can be provided with pits, channels, filter bottoms, and the like, as is known in the art.
- biotin compound :biottn-binding compound complex refers to a non- covalent complex formed by the binding of a biotin compound to a biotin-binding compound.
- analyzing refers to detection of, or characterization of, a molecule or moiety.
- a molecule can be analyzed by a variety of known techniques, including spectrometric techniques such as UV/VIS, IR, or NMR spectroscopy, mass spectrometry, chromatography, electrophoresis, or other methods known in the art, or combinations thereof.
- spectrometric techniques such as UV/VIS, IR, or NMR spectroscopy, mass spectrometry, chromatography, electrophoresis, or other methods known in the art, or combinations thereof.
- “Analyzing” can also include methods such as sequencing of nucleic acids.
- ammonia refers to NH 3 , or any salt thereof.
- ammonia may be present as NH 3 , or may be in the form of an ammonium salt or compound.
- ammonia in aqueous solution can exist largely as ammonium hydroxide (depending on the pH), but is generally referred to herein as "ammonia.”
- amine refers to a compound having the structure NR' 3 , or N + R' 4 in which R' is a hydrogen, alkyl (including cycloalkyl), alkenyl, alkynyl, or aryl group, and can be independently selected for each occurrence. Two or more R' groups can be selected such that they form, together with the nitrogen atom to which they are attached, a cyclic amine (for example, pyrrolidine or piperidine). In certain embodiments, aromatic amines such as pyridine are contemplated for use in the subject methods. Where an R 1 group is alkyl, the alkyl group can have from one to twelve carbon atoms in a straight or branched chain.
- Lower alkyls having from one to six carbon atoms in a branched or straight chain are preferred.
- a preferred aryl group is phenyl, which can be substituted or unsubstituted.
- Exemplary amines include ammonia, methylamine, diethylamine, aniline, and diisopropylethylamine.
- quaternary amines such as tetrabutyl ammonium (e.g., as tetrabutylammonium hydroxide), can be used in the methods of the invention.
- Other nitrogen-containing compounds including hydrazine, and derivatives and analogs thereof, can also be used in the invention.
- small amines i.e., those molecules with small steric bulk, e.g., where at least one R' is hydrogen or a small alkyl group such as methyl
- amines in which each R' is sterically small e.g., hydrogen or a small alkyl group such as methyl
- primary amines are more preferred than secondary amines, which are in turn more preferred than tertiary amines, which are in turn more preferred than quaternary amines.
- an amine will be selected according to factors such as cost, efficacy, ease of handling, ease of purification of the desired products, and the like.
- Ammonia is a most preferred amine, at least in part because ammonia effectively cleaves biotin complexes and is inexpensive, readily handled as either the gas or ammonium hydroxide in solution, and easily removed when reaction is complete (e.g., by lyophilization).
- the use of ammonia as the cleaving reagent permits facile purification of biotin compounds by removal of excess ammonia under a vacuum.
- an amine that is sufficiently volatile to be removed by lyophilization is preferred.
- biotin compound or biotin-binding compound can be employed, including, for example, dialysis, gel electrophoresis, capillary zone electrophoresis, affinity chromatography, crystallization, column chromatography (e.g., gel or ionic exchange chromatography), HPLC, and the like.
- the methods of the invention are particularly useful in purification of biotinylated compounds.
- a biotinylated compound can readily be separated from non-biotinylated compounds simply by contacting a reaction mixture with immobilized biotin-binding compound, e.g., covalently bound to a solid support, followed by separation and washing of the immobilized complex of the biotin compound with the biotin-binding compound.
- the biotinylated molecule can then be isolated by dissociation of the biotin - biotin-binding compound complex, followed by separation of the biotin compound from the solid support.
- the purified biotinylated compound can then be lyophilized, further purified by conventional techniques, or the like.
- a biotin-binding compound can be purified by an analogous process, e.g., by contacting a reaction mixture containing a biotin-binding compound with an immobilized biotin compound to form a complex, followed by purification and subsequent dissociation of the complex.
- the biotin-streptavidin system can be used for the isolation of either single- or double-stranded nucleic acids, e.g., DNA.
- a preferred application is the isolation of a double-stranded PCR product, the subsequent removal of the non-biotinylated strand and the downstream processing of the single strands (Mitchell, L. G, et al. (1994) "Advances in Biomagnetic Separation," Eaton
- the ammonia molecules are small enough to diffuse into the biotin complex and disrupt the bonding (e.g., hydrogen bonding) of the biotin moiety with a biotin-binding compound.
- the biotin compound retains the ability to bind to a biotin-binding compound after treatment with ammonia, and the biotin moiety can remain substantially intact.
- the pH of the reaction mixture can affect the rate of complex dissociation.
- the pH of the reaction mixture is in the range from about 7.0 to about 14.0, more preferably from about 8.0 to about 13.0.
- the concentration of the ammonia or other amine is also important.
- a preferred concentration is at least about 5% ammonia or amine, more preferably at least about 10%, and still more preferably at least about 15% (w/v). Higher concentrations will generally result in more rapid complex dissociation. Accordingly, a concentration of about 25 - 28% is preferred. An ammonia concentration of 25 -28% can be readily achieved with commercially available ammonium hydroxide solutions.
- the temperature at which the cleavage reaction is performed also affects the rate of complex dissociation.
- the temperature will be chosen according to considerations such as the rate of reaction (which will be faster at higher temperatures) and the stability of the components (e.g., the biotin compound and biotin-binding compound), which will generally be less stable at higher temperatures.
- the temperature is in the range of from about 25°C to about 100°C, more preferably from about 40°C to about 80°C.
- a preferred temperature is about 60°C.
- the reaction mixture can be an aqueous mixture such as a solution or suspension, or a non-aqueous solvent can be employed, including, e.g., methanol, ethanol, acetonitrile, dimethylformamide, and the like. Mixtures of solvents can also be employed (e.g., water/methanol or water acetonitrile).
- the solvent will in general be selected to be compatible with at least one of the biotin compound, the biotin-binding compound, or the amine. The choice of an appropriate solvent will be routine to the skilled artisan. Aqueous solvents are generally preferred.
- biotin compounds or biotin-binding compounds
- a biotin compound is a biotinylated protein (e.g., a biotinylated antibody)
- vigorous conditions such as high pH and high temperature can denature the protein moiety.
- conditions will in general be selected to avoid undesired denaturation or destruction of at least one of the biotin compound or biotin-binding compound.
- the method of the invention can be used to purify a biotin compound.
- the method comprises the steps of contacting a biotin compound: biotin-binding compound complex with an effective amount of ammonia, under conditions such that the complex is dissociated, thereby forming a biotin compound and a biotin-binding compound.
- the method includes, prior to the dissociating step, the step of purifying the biotin compound :biotin-binding compound complex by separating the complex from at least one impurity.
- the biotin compound can be purified from a complex reaction mixture.
- a reaction mixture comprising a biotin compound with a solid support comprising an immobilized biotin-binding compound
- purification of the complex and subsequent release of the biotin compound from the complex by treatment with an amine can be purified from a complex reaction mixture.
- examples of the purification of, e.g., nucleic acids, by the methods of the invention are provided below. It has been found that the inventive methods are particularly useful where a biotin compound is to be analyzed by mass spectrometry subsequent to complex dissociation. In this embodiment, use of ammonia as the amine is preferred.
- the invention provides a simple method for isolating biotin-conjugated molecules from biotin-streptavidin complexes.
- the method is compatible with subsequent mass spectrometric analysis of the isolated biotin- conjugated molecules.
- the subject method provides a mass spectrometric-compatible process for releasing intact and non-modified biotinylated molecules from biotin-streptavidin complexes by a brief treatment of a complex with an amine (e.g., ammonia, which can be supplied as ammonium hydroxide), preferably at slightly elevated temperatures.
- an amine e.g., ammonia, which can be supplied as ammonium hydroxide
- mass spectrometer formats can be used for detection of the recovered products, including ionization by matrix assisted laser desorption / ionization (MALDI), continuous or pulsed electrospray (ES), or massive cluster impact (MCI); and detection formats including linear or reflectron time-of-flight (TOF), single or multiple quadrupole, single or multiple magnetic sector, Fourier Transform ion cyclotron resonance (ICR), ion trap, and combinations thereof.
- MALDI matrix assisted laser desorption / ionization
- ES continuous or pulsed electrospray
- MCI massive cluster impact
- detection formats including linear or reflectron time-of-flight (TOF), single or multiple quadrupole, single or multiple magnetic sector, Fourier Transform ion cyclotron resonance (ICR), ion trap, and combinations thereof.
- TOF linear or reflectron time-of-flight
- ICR Fourier Transform ion cyclotron resonance
- ICR Fourier Transform ion cyclo
- This new method is of outstanding importance for all processes which are based on a fast and quantitative recovery of biotin-conjugated materials from biotin- streptavidin complexes and subsequent enzymatic reactions and analysis via techniques negatively influenced by organic impurities such as formamide These include, for example, analysis of PCR- or DNA sequencing products with mass spectrometry for diagnostic purposes.
- Figure 1 illustrates one embodiment of the invention.
- Figure 1 is a schematic drawing of the purification of biotinylated PCR products where the reaction was carried out in solution.
- A represents the biotinylated PCR product
- R represents reaction components and impurities
- H represents the streptavidin coated solid support (e.g. streptavidin Dynabeads or multititer plates)
- a PCR reaction is carried out with at least one biotinylated primer.
- the biotin group can be attached either on the 5 '-hydroxyl group of the primer or at an internal base.
- the nature of the solid support may vary, and include, e.g., magnetic particles (e.g., beads), multititer plates with or without filter plates, glass, silicon wafers with or without pits, plastic, paper, flat arrays, capillaries, agarose or sepharose. Streptavidin-coated magnetic beads (Dynabeads , Dynal, Inc) are preferred.
- step 3 of Figure 1 due to the stability of the biotin-streptavidin complex, intensive washing can be performed to remove all excessive reaction components prior to the recovery of the PCR product.
- the complexed and purified PCR product is then treated with a small volume of 25% ammonium hydroxide, preferably at about 50 - 60°C, to overcome the biotin-streptavidin interaction.
- the pure PCR product is accompanied only by ammonium hydroxide.
- the ammonium hydroxide can easily be removed by lyophilization or ethanol precipitation, both methods well known in the art
- the pure PCR product is redissolved, most preferably in ultrapure water.
- Other conditions can be chosen, for example varying buffers as a solvent.
- the PCR product now can be employed in downstream applications, e.g., enzymatic reactions or detection, for example, via mass spectrometry or gel electrophoresis in slab gels or capillaries, as described in the art.
- Using ammonia for the dissociation of the biotin-streptavidin complex is of special interest for detection of DNA using mass spectrometry. It is known that heterogenity of cations leads to a broadening of mass signal and interferes with the detection process. Thus, mass spectrometric detection would benefit if cation homogeneity could be achieved.
- the methods of the invention provide DNA with a homogeneous cation distribution, because after treatment with ammonia, most of the phosphate groups will carry an ammonium counterion. Another advantage is that DNA with ammonium counterions is known to have preferred properties for mass spectrometric (e.g. MALDI-TOF) MS analysis.
- FIG. 2 is a schematic drawing of two different means for detecting Sanger sequencing products.
- a biotinylated primer is used and the reaction is carried out in solution with subsequent immobilization, purification, ammonium hydroxide treatment and detection.
- the reaction is performed as a solid phase reaction.
- B represents biotinylated primer extension products
- R represents reaction components and impurities
- C represents template DNA
- H represents the streptavidin-coated solid support.
- a Sanger sequencing reaction is carried out in solution with a biotinylated primer.
- the products arising from this primer extension reaction are double stranded nucleic acids consisting of the extended biotinylated primer (B) and the template strand (C).
- the biotinylated complex is immobilized on a streptavidin-coated solid support (H) (as described above). Due to the stability of the biotin-streptavidin complex, the immobilized complex can be separated from excess reaction components, by-products and impurities
- the template DNA is denatured from the biotinylated primer extension products (B) by methods well known in the art.
- a solution of 8 M urea was used for the purpose of denaturation. Further washing steps, preferably with ultrapure water, were employed to remove the urea and the template strand.
- the purified biotinylated sequencing product (B) was recovered through treatment with 25% ammonium hydroxide. Removal of ammonium hydroxide can be performed using ethanol precipitation or lyophilization, as described above.
- the biotinylated products can be resuspended in ultrapure water and analyzed by mass spectrometry or gel electrophoresis or subjected to further enzymatic reactions.
- the sequencing reaction is carried out on a solid support.
- Figure 2, right column, illustrates this variation.
- the biotinylated primer is immobilized on a streptavidin-coated solid support (H).
- a template strand is annealed to the immobilized biotinylated primer.
- a sequencing reaction such as Sanger sequencing, is carried out.
- reaction components and impurities (R) are removed through washing.
- the template is denatured from the biotinylated extended primer using urea as described above, and further washing steps are carried out.
- the purified biotinylated extension products (B) are recovered through treatment with ammonium hydroxide as described above, and subjected to analysis, for example, via mass spectrometry, electrophoresis or further enzymatic reactions.
- FIG. 3 is a schematic drawing of different means for detecting PCR digest products with single- or double-stranded specific endo- or exo-nucleases to generate DNA sequence information.
- A represents biotinylated PCR product
- D represents digested biotinylated PCR product
- E represents biotinylated single-stranded PCR digest product
- F represents undigested biotinylated single-stranded PCR digest product
- G represents digested biotinylated single-stranded PCR digest product
- H represents a streptavidin coated solid support
- R represents reaction components and impurities.
- This embodiment features the sequencing of PCR products with endo- or exo-nucleases and the use of the biotin streptavidin complex in this process.
- a PCR reaction is carried out with one biotinylated primer. Prior to further reactions unincorporated primers are removed using ultrafiltration through a molecular weight cutoff membrane (as described above).
- the biotinylated PCR product (A) is subjected to digestion with double- W /
- - 17 - strand specific enzymes This can be carried out using, for example, DNasel, which nicks the double strand DNA statistically at each phosphodiester bond.
- the reaction can be carried out in a way such that each double strand arising from the PCR reaction is nicked once statistically (Low, C. M. L. et al. (1984) Nucleic Acids Res. 12 4865-4879).
- a second approach is the use of exonuclease III, which digests double strand DNA from the
- a third approach uses type 2 restriction-endonucleases to carry out RFLPs in combination with subsequent analysis, for example, via mass spectrometry or electrophoresis.
- the biotinylated digestion products (D) of step 2 are immobilized on a streptavidin coated solid support (H) (as described above).
- the immobilized biotinylated products are separated from reaction components and impurities (R) (as described above) and the hybridized non-biotinylated products are removed using a denaturing agent like urea (as described above for the second embodiment).
- the biotinylated products (E) are released from the solid support by treatment with ammonium hydroxide.
- the biotinylated products (E) can be resuspended in, for example, ultrapure water and analyzed, for example, via mass spectrometry or electrophoresis.
- a variation of this embodiment features the sequencing of PCR products with single strand specific endo- or exo-nucleases and the use of a biotin-streptavidin complex in the process. It is illustrated in figure 3 ("Variation 1 ").
- the biotinylated PCR product (A) is immobilized on a streptavidin coated solid support (H) after ultrafiltration (step 2).
- step 3 the non-biotinylated strand is denatured using urea, and further washing steps are carried out.
- the immobilized biotinylated single-stranded PCR product (F) can be digested with a single strand specific endo- or exo-nuclease.
- the immobilized digestion products (G) are purified with further washing in step 5, and are recovered from the solid support using treatment with ammonium hydroxide. As described previously, the recovered biotinylated products (G) can be analyzed after ethanol precipitation or lyophilization.
- step 5 an immobilized single-strand PCR product (F) (as described above in step 3) is treated with ammonium hydroxide to recover the biotinylated single strand PCR product (F).
- the ammonium hydroxide is removed using, e.g., ethanol precipitation or lyophilization and the DNA is resuspended in ultrapure water.
- step 5 the isolated single stranded PCR product (F) is digested with a single-strand specific endo- or exo ⁇ nuclease, preferably mung bean nuclease, S 1 nuclease or snake venom phosphodiesterase, respectively.
- step 6 the digestion products (G) are then analyzed, for example, via mass spectrometry or electrophoresis.
- biotin-streptavidin complexes can be cleaved under mild conditions, iii) volatile amines, such as ammonia, can be easily and rapidly removed (for example by lyophilization), iv) the recovered material can be subjected to enzymatic reactions or, e.g., mass spectrometric analysis, without further purification, v) a simultaneous biotin-streptavidin complex cleavage and cation exchange.
- the process of the invention will considerably extend the applicability of the biotin-streptavidin system by providing a mild and selective procedure to recover the biomolecules after immobilization for further enzymatic reactions or analysis.
- the invention provides a kit for analyzing a biotinylated biomolecule.
- the kit includes a biotin-binding compound immobilized on a solid support, and an amine.
- the biotin-binding compound and amine are preferably sealed in separate containers.
- the kit further includes instructions for dissociating a biotin compound:biotin-binding compound complex with the amine.
- Examples 1-5 illustrate the utility of the subject methods in various applications in diagnostics and DNA sequencing. In general, the illustrated examples involve at least some of the following steps:
- step la Immobilization of the products of step la by complexing the biotinylated DNA to a biotin-binding protein supported on a solid phase.
- step 4 Separating the complex of step 3 or step lb from the liquid phase. Further options include washing to remove reaction contents and impurities, conditioning of immobilized nucleic acids, enzymatic reactions and isolation of the non- biotinylated strand of a DNA duplex for downstream applications. 5. Treating the separated and manipulated complex of step 4 with ammonium hydroxide for isolation of biotinylated molecules.
- the effect of ammonium hydroxide on the immobilized nucleic acids is a function of temperature and time of incubation. If the immobilized material is incubated for short times at ambient temperature, the main process is the denaturation of the immobilized double-stranded molecules. However, incubation of immobilized DNA with ammonium hydroxide at elevated temperatures (preferably 37- 80°C) leads to the dissociation of the biotin-streptavidin complex.
- Example 1 MALDI-TOF MS spectrum of a biotinylated oligodeoxynucleotide cleaved from streptavidin Dvnabeads using ammonium hydroxide
- biotinylated oligodeoxynucleotide 20mer
- 5'd(bio-AGCTCTATATCGGGAAGCCT)3' SEQ ID NO: l
- streptavidin Dynabeads M-280 50 pmol streptavidin Dynabeads.
- the beads were prepared according to the instructions of the manufacturer.
- the beads were finally resuspended in 50 ⁇ l of B/W-buffer (10 mM Tris-HCl, pH 7.5, ImM EDTA, 2 M NaCl).
- B/W-buffer 10 mM Tris-HCl, pH 7.5, ImM EDTA, 2 M NaCl
- the oligodeoxynucleotide was added in a volume of 1 ⁇ l and the reaction mixture was incubated for 30 minutes at ambient temperature.
- the beads were washed twice with 100 ⁇ l of ammonium citrate buffer (0.07 M). The beads were washed once with ultrapure water, 25 ⁇ l of a 25% solution of ammonium hydroxide was added, and the beads were carefully resuspended. The suspension was incubated at 60°C for 10 minutes, and the beads were separated from the solution using a magnetic particle collector (Dynal, Hamburg, Germany). The supernatant was saved and the procedure was repeated once. Both supernatants were collected in a single tube. The solution was lyophilized for 30 minutes, and redissolved in 4 ⁇ l of ultrapure water. From this solution 0.5 ⁇ l were analyzed with MALDI-TOF mass spectrometry ( Figure 4) as described in example 2, step 4.
- Figure 4 shows a MALDI-TOF MS spectrum of a biotinylated 20mer oligodeoxynucleotide (SEQ ID NO: 1) immobilized on streptavidin Dynabeads and recovered using the method described above.
- the theoretical mass value of the biotinylated oligodeoxynucleotide is 6522 Da.
- the mass value obtained is 6529.8 Da, in agreement with the predicted mass.
- the spectrum demonstrates that a biotinylated poligodeoxynucleotide is removed from the beads. Signals marked with an asterisk are due to depurination which occurs in the process of ionization and desorption also if ammonium hydroxide is not applied.
- biotinylated DNA can be recovered from a biotin-streptavidin complex using ammonium hydroxide at elevated temperatures.
- the oligodeoxynucleotide and the attached biotin group remain intact and unmodified during this process. This can be concluded because no change of molecular weight of the original molecule was observed by MALDI-TOF mass spectrometric analysis after subjecting an oligodeoxynucleotide to the described procedure.
- Further experiments demonstrated that the recovered biotinylated molecule can be complexed again to streptavidin, also suggesting an intact biotin group.
- Step 1 PCR was performed with 1 ⁇ l of a first set of PCR primers directed against the gene for the core protein of hepatitis B virus.
- the nested amplification product has a length of 67 bp.
- 100 pmol of each primer, 2.5 u P/u(exo-) DNA polymerase (Stratagene, Heidelberg, Germany), a final concentration of 200 ⁇ M of each dNTP and 5 ⁇ l ]0x Pfu buffer 200 mM Tris-HCl, pH 8.75, 100 mM Kcl, 100 mM (NH 4 ) 2 SO 4 , 20 mM MgSO 4 , 1% Triton X-100, 1 mg/ml BSA, Stratagene, Heidelberg, Germany
- 200 mM Tris-HCl pH 8.75
- 100 mM Kcl 100 mM (NH 4 ) 2 SO 4 , 20 mM MgSO 4 , 1% Triton X-100, 1 mg/m
- thermocycler OmniGene, MWG- Biotech, Ebersberg, Germany
- temperature program 94°C for 1 minute, 60°C for 1 minute and 72°C for 1 minute with 20 cycles.
- Sequence of oligodeoxynucleotide primers purchased HPLC-purified from MWG-Biotech, Ebersberg, Germany:
- HBV13 5'-d(TTGCCTGAGTGCAGTATGGT-)3' (SEQ ID NO:2)
- HBV15bio 5'd(bio-AGCTCTATATCGGGAAGCCT)3' (SEQ ID NO:3)
- Step 2 Purification of the PCR products obtained in step 1, above, was done according to the following procedure: Ultrafiltration was performed using Ultrafree-MC filtration units (Millipore, Eschbom, Germany) according to the protocol of the manufacturer, with centrifugation at 8000 ⁇ m for 20 minutes. 25 ⁇ l (lO ⁇ g/ ⁇ l) streptavidin Dynabeads M280 (Dynal, Hamburg, Germany) were prepared according to the instructions of the manufacturer and resuspended in 25 ⁇ l of B/W buffer (10 mM Tris- HCl, pH 7.5, ImM EDTA, 2 M NaCl). This suspension was added to the PCR samples
- the beads were resuspended in 25 ⁇ l of 25% NH 4 OH Suprapur (Merck, Darmstadt, Germany) and incubated at 60°C for ten minutes. The supernatant was removed and saved, and the NH 4 OH treatment was repeated once. Both supernatants were dried in a speedvac and resuspended in 4 ⁇ l of ultrapure water (MilliQ UF plus, Millipore, Eschbom, Germany). For MALDI-TOF MS analysis, 0.5 ⁇ l of this preparation was used.
- Figure 5 shows a MALDI-TOF MS spectrum of a PCR product from the hepatitis B core antigen coding DNA region, purified with streptavidin Dynabeads and recovered from the beads using ammonium hydroxide, as described above.
- the theoretical mass value of the non-biotinylated strand is 20792.4 Da.
- the theoretical mass value of the biotinylated strand is 20886.9 Da.
- the average mass of both strands is 20839.7 Da.
- the mass value of the signal obtained is 20812.5 Da. Since double stranded DNA molecules are denatured during the process of ionization and deso ⁇ tion, the PCR products are detected as single-stranded molecules and the mass value obtained represents the average mass of both single strands
- the sequencing products were immobilized on streptavidin beads prepared according to the protocol of the manufacturer. To each reaction, 20 ⁇ l of prewashed beads were added and incubated at ambient temperature for 15 minutes under gentle shaking After immobilization, the beads were washed twice with B/W-buffer (see above) and once with ultrapure water. The template was then denatured from the immobilized strand with ultrapure water at 95°C for 2 minutes. After denaturation the beads were washed twice with 0.07 M ammonium citrate and once with ultrapure water.
- the immobilized sequencing products were cleaved from the beads with 20 ⁇ l of 25% ammonia at 60°C for 10 minutes; the cleavage reaction was performed twice and the supernatants combined. The samples were then lyophilized, resuspended in 4 ⁇ l ultrapure water and directly used for MALDI-TOF-MS.
- Step 4 The reaction products were analyzed using MALDI-TOF MS ( Figure 6) according to the procedure described in example 2, step 4.
- Primer 17 mer (molecular weight 5744.4 Da): 5'd(bioGTAAAACGACGGCCAGT)3'( SEQ ID NO:4),
- Template 50 mer (molecular weight 15338 Da): 5'd(TTGCGTACACACTGGCCGTCGTTTTACAACGTCGTGACTGGGAAAACCTC)
- Both primer and template were synthesized (about 0.2 ⁇ mol) on a Milligen 7500 using ⁇ -cyanoethylphosphoamidite chemistry (Sinha, N. D., et al. (1984) Nucleic Acids Res. 12, 4539-4577), and purified via RP-HPLC.
- Figure 6 shows the reaction of the Sanger sequencing reaction purified with M-280 streptavidin Dynabeads.
- the sequencing reaction was carried out in solution and the sequencing products were captured with Dynabeads.
- the reaction contents such as salts, enzymes, dNTPs and dideoxynucleotide triphosphates (ddNTPs), were removed by washing, and the sequencing products were recovered for MALDI-TOF-MS analysis using ammonium hydroxide, as described above.
- the signals at 5721.3 Da and 15325 Da represent primer and template, respectively.
- the signal at 9131.5 Da is due to a single-nucleotide extension of the run-through product.
- Example 4 demonstrate the utility of the subject methods in DNA sequencing .
- This Example shows that the method is compatible with the analysis of conventional Sanger sequencing.
- Example 4
- the reaction mix contained 200 ⁇ M dCTP, dTTP and 200 ⁇ M C 7 -deaza dATP and C 7 -deaza dGTP, 100 pmol of forward and reverse primer, 100 ng M13mpl8 RF, and 2.5 U of Pfu (exo-) DNA polymerase (Stratagene, Heidelberg, Germany) in a buffered solution (20 mM Tris-HCl, pH 8.75, 10 mM Kcl, 10 mM (NH4)2SO4, 2 mM MgSO4, 0.1% Triton X-100, 0.1 mg/ml BSA, Stratagene, Heidelberg, Germany) of 100 ⁇ l.
- the reactions were performed in a thermocycler (OmniGene, MWG-Biotech,
- the reverse primer was synthesized (about 0.2 ⁇ mol) on a Milligen 7500 and purified with RP-HPLC.
- the biotinylated forward primer was purchased HPLC purified from Pharmacia Biotech.
- Reverse primer 5 d(GAGATCTCCTAGGGGCC)3 ' (SEQ ID NO:7)
- the PCR product was separated from unincorporated primer by ultrafiltration through a 10.000 Da molecular weight cutoff membrane Ultrafiltration was done using Ultrafree-MC filtration units (Millipore, Eschborn, Germany) according to the protocol of the provider with centrifugation at 8000 rpm for 20 minutes.
- 25 ⁇ l (lO ⁇ g/ ⁇ l) streptavidin Dynabeads M-280 with a nominal size of 2.8 ⁇ m were prepared according to the instructions of the manufacturer and resuspended in 25 ⁇ l of B/W buffer (10 mM Tris-HCl, pH 7.5, ImM EDTA, 2 M NaCl). This suspension was added to the PCR samples (still in the filtration unit) and the mixture was incubated with gentle shaking for 15 minutes at ambient temperature. The suspension was transferred to a 1.5 ml Eppendorf tube and the supernatant was separated with the aid of a Magnetic Particle Collector, MPC, (Dynal, Hamburg, Germany).
- MPC Magnetic Particle Collector
- the double stranded PCR product was denatured using 20 ⁇ l 8 M urea. After removing the urea (containing the non-biotinylated strand) the beads were washed twice with 50 ⁇ l of 0.07 M ammonium citrate solution, pH 8.0 (the supernatant was removed each time using the MPC). To perform the cleavage reaction and recover the biotinylated single stranded PCR product, the beads were resuspended in 25 ⁇ l of 25% NH4OH suprapur (Merck, Darmstadt, Germany) and incubated at 60°C for ten minutes. The supernatant was removed and saved, the NH 4 OH treatment was repeated once. Both supernatants were dried in a speedvac and resuspended in 2 ⁇ l of ultrapure water (MilliQ UF plus, Millipore, Eschbom, Germany).
- Step 3 1 ⁇ l of the resuspended DNA from step 2 was mixed with 0.2x10 "3 U of snake venom phosphodiesterase (Boehringer Mannheim, Germany) and incubated for 20 min. at 37°C. The reaction was mixed with 1 ⁇ l matrix solution (0.7 M 3-hydroxypicolinic acid in 50% acetonitrile, 70 mM ammonium citrate) and directly used for MALDI-TOF-
- reaction products were analyzed using MALDI-TOF MS ( Figure 7) according to the procedure described above.
- Figure 7 shows a spectrum of an exonucleolytic digest of a 60 mer PCR product.
- the biotinylated PCR product was immobilized on streptavidin Dynabeads and denatured with 8 M urea.
- the biotinylated single strand was recovered from the beads using treatment with ammonium hydroxide. After lyophilization, the single stranded 60mer was digested with snake venom phosphodiesterase. As described in example 4, the spectrum represents a digestion time of 20 minutes at 37°C. - 28 -
- the immobilized oligonucleotide was digested by addition of 3 ⁇ l snake venom phosphodiesterase (6xl0 "3 U) (Boehringer Mannheim, Germany) at room temperature.
- Step 3 Aliquots of 20 ⁇ l were taken after digestion for 4, 10, 15, 20 and 25 minutes and were subjected to the same purification procedure as described in Example 2, step 2, supra.
- Step 4 The reaction products were analyzed using MALDI-TOF MS according to the procedure described above ( Figure 8).
- Figure 8 shows an exonucleolytic digestion of a biotinylated 25mer immobilized on Dynabeads. After 4 minutes of digestion with snake venom phosphodiesterase the products where purified and removed from the beads, as described above. From this spectrum, the base sequence from base 13 to base 25 can be seen. Examples 4 and 5 demonstrate that the method described herein can be used for isolation of single stranded DNA accessible for subsequent enzymatic degradation.
- Example 4 shows an application where formation of a biotin-streptavidin complex, followed by treatment with ammonium hydroxide, is used to isolate a single strand PCR product for the pu ⁇ ose of digestion with a single-strand-specific exonuclease to determine the nucleotide sequence.
- the subject method provides a process for purification and analysis of biotinylated molecules.
- the inventive method is compatible with mass spectrometric analysis, and with the potential of performing further enzymatic reactions.
- MOLECULE TYPE other nucleic acid
- MOLECULE TYPE other nucleic acid
- MOLECULE TYPE other nucleic acid
- SEQUENCE DESCRIPTION SEQ ID NO:5: TTGCGTACAC ACTGGCCGTC GTTTTACAAC GTCGTGACTG GGAAAACCTC 50
- MOLECULE TYPE other nucleic acid
Abstract
Description
Claims
Priority Applications (7)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CA002253582A CA2253582A1 (en) | 1996-05-13 | 1997-05-13 | Method for dissociating biotin complexes |
AT97926469T ATE215612T1 (en) | 1996-05-13 | 1997-05-13 | METHOD FOR DISSOCIATION OF BIOTIN COMPLEXES |
DE69711632T DE69711632T2 (en) | 1996-05-13 | 1997-05-13 | METHOD FOR DISSOCIATING BIOTINE COMPLEXES |
EP97926469A EP0914471B1 (en) | 1996-05-13 | 1997-05-13 | Method for dissociating biotin complexes |
AU31232/97A AU714707B2 (en) | 1996-05-13 | 1997-05-13 | Method for dissociating biotin complexes |
JP09541041A JP2000510702A (en) | 1996-05-13 | 1997-05-13 | Biotin complex dissociation method |
HK99102761A HK1018967A1 (en) | 1996-05-13 | 1999-06-30 | Method for dissociating biotin complexes |
Applications Claiming Priority (2)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
US08/649,876 US6022688A (en) | 1996-05-13 | 1996-05-13 | Method for dissociating biotin complexes |
US08/649,876 | 1996-05-13 |
Publications (2)
Publication Number | Publication Date |
---|---|
WO1997043617A2 true WO1997043617A2 (en) | 1997-11-20 |
WO1997043617A3 WO1997043617A3 (en) | 1998-02-19 |
Family
ID=24606585
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
PCT/US1997/008052 WO1997043617A2 (en) | 1996-05-13 | 1997-05-13 | Method for dissociating biotin complexes |
Country Status (9)
Country | Link |
---|---|
US (2) | US6022688A (en) |
EP (1) | EP0914471B1 (en) |
JP (1) | JP2000510702A (en) |
AT (1) | ATE215612T1 (en) |
AU (1) | AU714707B2 (en) |
CA (1) | CA2253582A1 (en) |
DE (1) | DE69711632T2 (en) |
HK (1) | HK1018967A1 (en) |
WO (1) | WO1997043617A2 (en) |
Cited By (18)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US6043031A (en) * | 1995-03-17 | 2000-03-28 | Sequenom, Inc. | DNA diagnostics based on mass spectrometry |
US6111251A (en) * | 1996-09-19 | 2000-08-29 | Sequenom, Inc. | Method and apparatus for MALDI analysis |
US6146854A (en) * | 1995-08-31 | 2000-11-14 | Sequenom, Inc. | Filtration processes, kits and devices for isolating plasmids |
US6194144B1 (en) | 1993-01-07 | 2001-02-27 | Sequenom, Inc. | DNA sequencing by mass spectrometry |
US6207370B1 (en) | 1997-09-02 | 2001-03-27 | Sequenom, Inc. | Diagnostics based on mass spectrometric detection of translated target polypeptides |
US6225450B1 (en) | 1993-01-07 | 2001-05-01 | Sequenom, Inc. | DNA sequencing by mass spectrometry |
US6225061B1 (en) | 1999-03-10 | 2001-05-01 | Sequenom, Inc. | Systems and methods for performing reactions in an unsealed environment |
US6303309B1 (en) * | 1996-05-13 | 2001-10-16 | Sequenom, Inc. | Method for dissociating biotin complexes |
US6323351B1 (en) | 1997-06-30 | 2001-11-27 | The Dow Chemical Company | Process for the direct oxidation of olefins to olefin oxides |
US6730517B1 (en) | 1999-04-02 | 2004-05-04 | Sequenom, Inc. | Automated process line |
US7159740B2 (en) | 2001-10-26 | 2007-01-09 | Sequenom, Inc. | Method and apparatus for parallel dispensing of defined volumes of solid particles |
US7917301B1 (en) | 2000-09-19 | 2011-03-29 | Sequenom, Inc. | Method and device for identifying a biological sample |
US8315805B2 (en) | 2001-04-20 | 2012-11-20 | Sequenom, Inc. | Systems and methods for testing a biological sample |
WO2013019361A1 (en) * | 2011-07-07 | 2013-02-07 | Life Technologies Corporation | Sequencing methods |
US9068953B2 (en) | 2007-09-17 | 2015-06-30 | Agena Bioscience, Inc. | Integrated robotic sample transfer device |
WO2016120247A1 (en) * | 2015-01-26 | 2016-08-04 | Deutsches Krebsforschungszentrum Stiftung des öffentlichen Rechts | Methods for a quantitative release of biotinylated peptides and proteins from streptavidin complexes |
US9669376B2 (en) | 2000-10-30 | 2017-06-06 | Agena Bioscience, Inc. | Method and apparatus for delivery of submicroliter volumes onto a substrate |
WO2021158556A1 (en) * | 2020-02-03 | 2021-08-12 | Illumina, Inc. | Biotin-streptavidin cleavage composition and library fragment cleavage |
Families Citing this family (53)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US5795714A (en) * | 1992-11-06 | 1998-08-18 | Trustees Of Boston University | Method for replicating an array of nucleic acid probes |
US6436635B1 (en) * | 1992-11-06 | 2002-08-20 | Boston University | Solid phase sequencing of double-stranded nucleic acids |
US7803529B1 (en) * | 1995-04-11 | 2010-09-28 | Sequenom, Inc. | Solid phase sequencing of biopolymers |
US20060063193A1 (en) * | 1995-04-11 | 2006-03-23 | Dong-Jing Fu | Solid phase sequencing of double-stranded nucleic acids |
AU2069597A (en) | 1996-03-04 | 1997-09-22 | Genetrace Systems, Inc. | Methods of screening nucleic acids using mass spectrometry |
US5965363A (en) * | 1996-09-19 | 1999-10-12 | Genetrace Systems Inc. | Methods of preparing nucleic acids for mass spectrometric analysis |
US6133436A (en) | 1996-11-06 | 2000-10-17 | Sequenom, Inc. | Beads bound to a solid support and to nucleic acids |
EP1164203B1 (en) * | 1996-11-06 | 2007-10-10 | Sequenom, Inc. | DNA Diagnostics based on mass spectrometry |
US7285422B1 (en) * | 1997-01-23 | 2007-10-23 | Sequenom, Inc. | Systems and methods for preparing and analyzing low volume analyte array elements |
DE69735445T2 (en) * | 1996-12-10 | 2006-08-10 | Sequenom, Inc., San Diego | NON-VOLATILE, NON-VOLATILE MOLECULES FOR MASS MARKING |
US20010049438A1 (en) * | 1999-03-19 | 2001-12-06 | Dix Connie Kim | Purification of primer extension products |
US20030207297A1 (en) * | 1999-10-13 | 2003-11-06 | Hubert Koster | Methods for generating databases and databases for identifying polymorphic genetic markers |
US7332275B2 (en) | 1999-10-13 | 2008-02-19 | Sequenom, Inc. | Methods for detecting methylated nucleotides |
JP2001245698A (en) * | 1999-11-22 | 2001-09-11 | Xiao Bing Wang | Method for detecting nucleic acid |
ATE423221T1 (en) * | 2000-06-13 | 2009-03-15 | Univ Boston | USE OF MASS-MATCHED NUCLEOTIDES IN THE ANALYSIS OF OLIGONUCLEOTIDE MIXTURES AND IN HIGH-MULTIPLEX NUCLEIC ACID SEQUENCING |
GB0102568D0 (en) * | 2001-02-01 | 2001-03-21 | Magnetic Biosolutions Sweden A | Method |
US20030036057A1 (en) * | 2001-03-09 | 2003-02-20 | Andreas Braun | Genes and polymorphisms associated with cardiovascular disease and their use |
WO2003092581A2 (en) * | 2001-07-16 | 2003-11-13 | Hk Pharmaceuticals, Inc. | Capture compounds, collections thereof and methods for analyzing the proteome and complex compositions |
WO2003064704A1 (en) * | 2002-01-28 | 2003-08-07 | Mds Proteomics, Inc. | Chemical proteomics |
US20030166007A1 (en) * | 2002-01-28 | 2003-09-04 | Mds Proteomics Inc. | Chemical proteomics |
WO2003066882A2 (en) * | 2002-02-06 | 2003-08-14 | Tethys Bioscience, Inc. | Method and apparatus for validating dna sequences without sequencing |
KR20020041344A (en) * | 2002-02-26 | 2002-06-01 | 김희태 | A method for detecting a amplified nucleic acid using a membrane chromatograph |
DK1502102T3 (en) * | 2002-03-11 | 2009-05-04 | Caprotec Bioanalytics Gmbh | Compounds and Methods for Analyzing the Proteome |
EP1501863A4 (en) * | 2002-05-03 | 2007-01-24 | Sequenom Inc | Kinase anchor protein muteins, peptides thereof, and related methods |
EP1552025A4 (en) * | 2002-10-18 | 2006-12-13 | Cylene Pharmaceuticals Inc | Processes for identifying quadruplex-targeted antiviral molecules |
WO2004050839A2 (en) * | 2002-11-27 | 2004-06-17 | Sequenom, Inc. | Fragmentation-based methods and systems for sequence variation detection and discovery |
WO2004064972A2 (en) * | 2003-01-16 | 2004-08-05 | Hk Pharmaceuticals, Inc. | Capture compounds, collections thereof and methods for analyzing the proteome and complex compositions |
AU2004254552B2 (en) | 2003-01-29 | 2008-04-24 | 454 Life Sciences Corporation | Methods of amplifying and sequencing nucleic acids |
US20070141570A1 (en) * | 2003-03-07 | 2007-06-21 | Sequenom, Inc. | Association of polymorphic kinase anchor proteins with cardiac phenotypes and related methods |
EP1618216A2 (en) * | 2003-04-25 | 2006-01-25 | Sequenom, Inc. | Fragmentation-based methods and systems for de novo sequencing |
EP2918595B1 (en) | 2003-07-05 | 2019-12-11 | The Johns-Hopkins University | Method and compositions for detection and enumeration of genetic variations |
DK1660680T3 (en) | 2003-07-31 | 2009-06-22 | Sequenom Inc | Process for High Level Multiplex Polymerase Chain Reactions and Homogeneous Mass Extension Reactions for Genotyping Polymorphisms |
WO2005074417A2 (en) * | 2003-09-03 | 2005-08-18 | Salk Institute For Biological Studies | Multiple antigen detection assays and reagents |
US9394565B2 (en) * | 2003-09-05 | 2016-07-19 | Agena Bioscience, Inc. | Allele-specific sequence variation analysis |
WO2005073410A2 (en) * | 2004-01-28 | 2005-08-11 | 454 Corporation | Nucleic acid amplification with continuous flow emulsion |
AU2005230936B2 (en) * | 2004-03-26 | 2010-08-05 | Agena Bioscience, Inc. | Base specific cleavage of methylation-specific amplification products in combination with mass analysis |
US7608394B2 (en) | 2004-03-26 | 2009-10-27 | Sequenom, Inc. | Methods and compositions for phenotype identification based on nucleic acid methylation |
US20060073501A1 (en) * | 2004-09-10 | 2006-04-06 | Van Den Boom Dirk J | Methods for long-range sequence analysis of nucleic acids |
WO2007056113A2 (en) * | 2005-11-02 | 2007-05-18 | Cylene Pharmaceuticals, Inc. | Methods for targeting quadruplex sequences |
US8153369B2 (en) | 2006-06-05 | 2012-04-10 | Cancer Care Ontario | Assessment of risk for colorectal cancer |
CA2679954A1 (en) | 2007-03-05 | 2008-09-12 | Cancer Care Ontario | Assessment of risk for colorectal cancer |
US8097422B2 (en) | 2007-06-20 | 2012-01-17 | Salk Institute For Biological Studies | Kir channel modulators |
EP2217721A4 (en) * | 2007-10-29 | 2013-01-09 | Univ California | Osteoarthritis gene therapy |
WO2010012002A1 (en) * | 2008-07-25 | 2010-01-28 | Saryna Medical Corporation | Methods and systems for genetic analysis of fetal nucleated red blood cells |
EP2391714B2 (en) | 2009-01-30 | 2019-07-24 | Whitehead Institute for Biomedical Research | Methods for ligation and uses thereof |
US8685655B2 (en) | 2009-09-17 | 2014-04-01 | Jsr Corporation | Dissociation method and dissociation agent for avidin and biotin derivatives |
US8774488B2 (en) | 2010-03-11 | 2014-07-08 | Cellscape Corporation | Method and device for identification of nucleated red blood cells from a maternal blood sample |
JP6998862B2 (en) | 2015-09-25 | 2022-02-04 | エフ.ホフマン-ラ ロシュ アーゲー | Soluble sortase A |
EP3353314A1 (en) | 2015-09-25 | 2018-08-01 | H. Hoffnabb-La Roche Ag | Transamidation employing sortase a in deep eutectic solvents |
EP3353310B1 (en) | 2015-09-25 | 2020-04-29 | H. Hoffnabb-La Roche Ag | Process for producing thioesters employing a sortase a |
MA45489A (en) | 2015-10-22 | 2018-08-29 | Juno Therapeutics Gmbh | CELL CULTURE PROCESSES, ASSOCIATED KITS AND APPARATUS |
JP6727325B2 (en) | 2016-03-30 | 2020-07-22 | エフ.ホフマン−ラ ロシュ アーゲーF. Hoffmann−La Roche Aktiengesellschaft | Improved sortase |
EP3615653A1 (en) | 2017-04-27 | 2020-03-04 | Juno Therapeutics GmbH | Oligomeric particle reagents and methods of use thereof |
Citations (3)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
EP0456304A1 (en) * | 1990-05-04 | 1991-11-13 | Johnson & Johnson Clinical Diagnostics, Inc. | Preparation and isolation of single-stranded biotinylated nucleic acids by avidin-biotin cleavage |
WO1994016101A2 (en) * | 1993-01-07 | 1994-07-21 | Koester Hubert | Dna sequencing by mass spectrometry |
EP0701001A2 (en) * | 1994-09-07 | 1996-03-13 | Hitachi, Ltd. | DNA separating, fractionating and analyzing method and system therefor |
Family Cites Families (19)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US5283342A (en) * | 1992-06-09 | 1994-02-01 | Neorx Corporation | Biotinylated small molecules |
US4282287A (en) | 1980-01-24 | 1981-08-04 | Giese Roger W | Biochemical avidin-biotin multiple-layer system |
DE3476218D1 (en) * | 1983-02-24 | 1989-02-23 | Ciba Geigy Ag | Reactive dyes, their preparation and their use |
US4762881A (en) | 1987-01-09 | 1988-08-09 | E. I. Du Pont De Nemours And Company | Photoreactive benzoylphenylalanines and related peptides |
US5252743A (en) | 1989-11-13 | 1993-10-12 | Affymax Technologies N.V. | Spatially-addressable immobilization of anti-ligands on surfaces |
WO1991011533A1 (en) * | 1990-01-26 | 1991-08-08 | E.I. Du Pont De Nemours And Company | Method for isolating primer extension products from template-directed dna polymerase reactions |
US5292444A (en) * | 1992-10-02 | 1994-03-08 | Exxon Research And Engineering Company | Lube oil compositions containing fullerene-grafted polymers |
US5605798A (en) | 1993-01-07 | 1997-02-25 | Sequenom, Inc. | DNA diagnostic based on mass spectrometry |
US5527675A (en) * | 1993-08-20 | 1996-06-18 | Millipore Corporation | Method for degradation and sequencing of polymers which sequentially eliminate terminal residues |
US5643722A (en) | 1994-05-11 | 1997-07-01 | Trustees Of Boston University | Methods for the detection and isolation of proteins |
US5830655A (en) | 1995-05-22 | 1998-11-03 | Sri International | Oligonucleotide sizing using cleavable primers |
US5605708A (en) | 1995-09-11 | 1997-02-25 | Cummins Eagle, Inc. | Rounder apparatus for processing bakery dough |
US5928906A (en) | 1996-05-09 | 1999-07-27 | Sequenom, Inc. | Process for direct sequencing during template amplification |
US6022688A (en) * | 1996-05-13 | 2000-02-08 | Sequenom, Inc. | Method for dissociating biotin complexes |
AU746737B2 (en) | 1996-11-06 | 2002-05-02 | Sequenom, Inc. | Compositions and methods for immobilizing nucleic acids to solid supports |
DE69727489T2 (en) | 1996-11-06 | 2004-11-25 | Sequenom, Inc., San Diego | METHOD OF MASS SPECTROMETRY |
US5900481A (en) | 1996-11-06 | 1999-05-04 | Sequenom, Inc. | Bead linkers for immobilizing nucleic acids to solid supports |
EP1164203B1 (en) | 1996-11-06 | 2007-10-10 | Sequenom, Inc. | DNA Diagnostics based on mass spectrometry |
US6133436A (en) | 1996-11-06 | 2000-10-17 | Sequenom, Inc. | Beads bound to a solid support and to nucleic acids |
-
1996
- 1996-05-13 US US08/649,876 patent/US6022688A/en not_active Expired - Lifetime
-
1997
- 1997-05-13 DE DE69711632T patent/DE69711632T2/en not_active Expired - Lifetime
- 1997-05-13 CA CA002253582A patent/CA2253582A1/en not_active Abandoned
- 1997-05-13 EP EP97926469A patent/EP0914471B1/en not_active Expired - Lifetime
- 1997-05-13 AT AT97926469T patent/ATE215612T1/en not_active IP Right Cessation
- 1997-05-13 AU AU31232/97A patent/AU714707B2/en not_active Ceased
- 1997-05-13 WO PCT/US1997/008052 patent/WO1997043617A2/en active IP Right Grant
- 1997-05-13 JP JP09541041A patent/JP2000510702A/en not_active Ceased
-
1999
- 1999-06-21 US US09/337,388 patent/US6303309B1/en not_active Expired - Lifetime
- 1999-06-30 HK HK99102761A patent/HK1018967A1/en not_active IP Right Cessation
Patent Citations (3)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
EP0456304A1 (en) * | 1990-05-04 | 1991-11-13 | Johnson & Johnson Clinical Diagnostics, Inc. | Preparation and isolation of single-stranded biotinylated nucleic acids by avidin-biotin cleavage |
WO1994016101A2 (en) * | 1993-01-07 | 1994-07-21 | Koester Hubert | Dna sequencing by mass spectrometry |
EP0701001A2 (en) * | 1994-09-07 | 1996-03-13 | Hitachi, Ltd. | DNA separating, fractionating and analyzing method and system therefor |
Non-Patent Citations (2)
Title |
---|
GREEN: "Avidin" ADVANCES IN PROTEIN CHEMISTRY, vol. 29, 1975, pages 85-133, XP002050152 * |
See also references of EP0914471A2 * |
Cited By (31)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US6225450B1 (en) | 1993-01-07 | 2001-05-01 | Sequenom, Inc. | DNA sequencing by mass spectrometry |
US6194144B1 (en) | 1993-01-07 | 2001-02-27 | Sequenom, Inc. | DNA sequencing by mass spectrometry |
US6043031A (en) * | 1995-03-17 | 2000-03-28 | Sequenom, Inc. | DNA diagnostics based on mass spectrometry |
US6197498B1 (en) | 1995-03-17 | 2001-03-06 | Sequenom, Inc | DNA diagnostics based on mass spectrometry |
US6277573B1 (en) | 1995-03-17 | 2001-08-21 | Sequenom, Inc. | DNA diagnostics based on mass spectrometry |
US6235478B1 (en) | 1995-03-17 | 2001-05-22 | Sequenom, Inc. | DNA diagnostics based on mass spectrometry |
US6146854A (en) * | 1995-08-31 | 2000-11-14 | Sequenom, Inc. | Filtration processes, kits and devices for isolating plasmids |
US6303309B1 (en) * | 1996-05-13 | 2001-10-16 | Sequenom, Inc. | Method for dissociating biotin complexes |
US6111251A (en) * | 1996-09-19 | 2000-08-29 | Sequenom, Inc. | Method and apparatus for MALDI analysis |
US6812455B2 (en) | 1996-09-19 | 2004-11-02 | Sequenom, Inc. | Method and apparatus for MALDI analysis |
US6423966B2 (en) | 1996-09-19 | 2002-07-23 | Sequenom, Inc. | Method and apparatus for maldi analysis |
US6323351B1 (en) | 1997-06-30 | 2001-11-27 | The Dow Chemical Company | Process for the direct oxidation of olefins to olefin oxides |
US6207370B1 (en) | 1997-09-02 | 2001-03-27 | Sequenom, Inc. | Diagnostics based on mass spectrometric detection of translated target polypeptides |
US6322970B1 (en) | 1997-09-02 | 2001-11-27 | Sequenom, Inc. | Mass spectrometric detection of polypeptides |
US6485913B1 (en) | 1999-03-10 | 2002-11-26 | Sequenom, Inc. | Systems and methods for performing reactions in an unsealed environment |
US6225061B1 (en) | 1999-03-10 | 2001-05-01 | Sequenom, Inc. | Systems and methods for performing reactions in an unsealed environment |
US6730517B1 (en) | 1999-04-02 | 2004-05-04 | Sequenom, Inc. | Automated process line |
US7917301B1 (en) | 2000-09-19 | 2011-03-29 | Sequenom, Inc. | Method and device for identifying a biological sample |
US9669376B2 (en) | 2000-10-30 | 2017-06-06 | Agena Bioscience, Inc. | Method and apparatus for delivery of submicroliter volumes onto a substrate |
US8315805B2 (en) | 2001-04-20 | 2012-11-20 | Sequenom, Inc. | Systems and methods for testing a biological sample |
US7159740B2 (en) | 2001-10-26 | 2007-01-09 | Sequenom, Inc. | Method and apparatus for parallel dispensing of defined volumes of solid particles |
US9068953B2 (en) | 2007-09-17 | 2015-06-30 | Agena Bioscience, Inc. | Integrated robotic sample transfer device |
US10081837B2 (en) | 2011-07-07 | 2018-09-25 | Life Technologies Corporation | Bi-directional sequencing compositions and methods |
US9587269B2 (en) | 2011-07-07 | 2017-03-07 | Life Technologies Corporation | Bi-directional sequencing compositions and methods |
US9139874B2 (en) | 2011-07-07 | 2015-09-22 | Life Technologies Corporation | Bi-directional sequencing compositions and methods |
US9822411B2 (en) | 2011-07-07 | 2017-11-21 | Life Technologies Corporation | Bi-directional sequencing compositions and methods |
WO2013019361A1 (en) * | 2011-07-07 | 2013-02-07 | Life Technologies Corporation | Sequencing methods |
US10508306B2 (en) | 2011-07-07 | 2019-12-17 | Life Technologies Corporation | Bi-directional sequencing compositions and methods |
WO2016120247A1 (en) * | 2015-01-26 | 2016-08-04 | Deutsches Krebsforschungszentrum Stiftung des öffentlichen Rechts | Methods for a quantitative release of biotinylated peptides and proteins from streptavidin complexes |
WO2021158556A1 (en) * | 2020-02-03 | 2021-08-12 | Illumina, Inc. | Biotin-streptavidin cleavage composition and library fragment cleavage |
CN114144523A (en) * | 2020-02-03 | 2022-03-04 | 因美纳有限公司 | Biotin-streptavidin cleavage compositions and library fragment cleavage |
Also Published As
Publication number | Publication date |
---|---|
JP2000510702A (en) | 2000-08-22 |
EP0914471A2 (en) | 1999-05-12 |
DE69711632D1 (en) | 2002-05-08 |
US6303309B1 (en) | 2001-10-16 |
DE69711632T2 (en) | 2002-10-24 |
ATE215612T1 (en) | 2002-04-15 |
US6022688A (en) | 2000-02-08 |
AU714707B2 (en) | 2000-01-06 |
HK1018967A1 (en) | 2000-01-14 |
EP0914471B1 (en) | 2002-04-03 |
CA2253582A1 (en) | 1997-11-20 |
WO1997043617A3 (en) | 1998-02-19 |
AU3123297A (en) | 1997-12-05 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
AU714707B2 (en) | Method for dissociating biotin complexes | |
US8133701B2 (en) | Detection and quantification of biomolecules using mass spectrometry | |
US8383795B2 (en) | Detection and quantification of biomolecules using mass spectrometry | |
CA2671864C (en) | Detection and quantification of biomolecules using mass spectrometry | |
US6235476B1 (en) | Process for detecting nucleic acids by mass determination | |
US6566055B1 (en) | Methods of preparing nucleic acids for mass spectrometric analysis | |
JP4608171B2 (en) | Mass label | |
JP3437184B2 (en) | Oligonucleotide size measurement using cleavable primers | |
US6977146B1 (en) | Method of identifying cytosine methylation patterns in genomic DNA samples | |
Ross et al. | Analysis of short tandem repeat polymorphisms in human DNA by matrix-assisted laser desorption/ionization mass spectrometry | |
Jurinke et al. | Analysis of ligase chain reaction products via matrix-assisted laser Desorption/Ionization time-of-Flight–Mass spectrometry | |
CA2301875A1 (en) | Methods of preparing nucleic acids for mass spectrometric analysis | |
Fei et al. | Analysis of single nucleotide polymorphisms by primer extension and matrix‐assisted laser desorption/ionization time‐of‐flight mass spectrometry | |
WO1991011533A1 (en) | Method for isolating primer extension products from template-directed dna polymerase reactions | |
WO2003080645A2 (en) | Amplification of nucleic acid fragments using nicking agents | |
US20040253584A1 (en) | Method for separating nucleic acids into populations | |
WO2019088069A1 (en) | Method for analyzing dna methylation using next generation sequencer and method for concentrating specific dna fragments | |
JP2001516591A (en) | Method for analyzing nucleic acids by mass spectrometry | |
EP0421469B1 (en) | Method for separating a target oligonucleotide | |
EP1114185B1 (en) | Method of isolating primer extension products with modular oligonucleotides | |
JP2003505036A (en) | Multiple strand displacement for nucleic acid determination | |
CA2415260A1 (en) | Methods of screening nucleic acids using mass spectrometry | |
AU2002345229A1 (en) | Amplification of nucleic acid fragments using nicking agents |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
AK | Designated states |
Kind code of ref document: A2 Designated state(s): AL AM AT AU AZ BA BB BG BR BY CA CH CN CU CZ DE DK EE ES FI GB GE HU IL IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MD MG MK MN MW MX NO NZ PL PT RO RU SD SE SG SI SK TJ TM TR TT UA UG UZ VN AM AZ BY KG KZ MD RU TJ TM |
|
AL | Designated countries for regional patents |
Kind code of ref document: A2 Designated state(s): GH KE LS MW SD SZ UG AT BE CH DE DK ES FI FR GB GR IE IT LU MC NL PT SE BF BJ CF CG |
|
DFPE | Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101) | ||
AK | Designated states |
Kind code of ref document: A3 Designated state(s): AL AM AT AU AZ BA BB BG BR BY CA CH CN CU CZ DE DK EE ES FI GB GE HU IL IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MD MG MK MN MW MX NO NZ PL PT RO RU SD SE SG SI SK TJ TM TR TT UA UG UZ VN AM AZ BY KG KZ MD RU TJ TM |
|
AL | Designated countries for regional patents |
Kind code of ref document: A3 Designated state(s): GH KE LS MW SD SZ UG AT BE CH DE DK ES FI FR GB GR IE IT LU MC NL PT SE BF BJ CF CG |
|
121 | Ep: the epo has been informed by wipo that ep was designated in this application | ||
ENP | Entry into the national phase |
Ref document number: 2253582 Country of ref document: CA Ref country code: CA Ref document number: 2253582 Kind code of ref document: A Format of ref document f/p: F |
|
WWE | Wipo information: entry into national phase |
Ref document number: 1997926469 Country of ref document: EP |
|
REG | Reference to national code |
Ref country code: DE Ref legal event code: 8642 |
|
WWP | Wipo information: published in national office |
Ref document number: 1997926469 Country of ref document: EP |
|
WWG | Wipo information: grant in national office |
Ref document number: 1997926469 Country of ref document: EP |