WO1997037041A2 - Dna sequencing by mass spectrometry - Google Patents
Dna sequencing by mass spectrometry Download PDFInfo
- Publication number
- WO1997037041A2 WO1997037041A2 PCT/US1997/004394 US9704394W WO9737041A2 WO 1997037041 A2 WO1997037041 A2 WO 1997037041A2 US 9704394 W US9704394 W US 9704394W WO 9737041 A2 WO9737041 A2 WO 9737041A2
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- mass
- modified
- nucleic acid
- fragments
- base
- Prior art date
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6869—Methods for sequencing
- C12Q1/6872—Methods for sequencing involving mass spectrometry
Definitions
- DNA sequencing is one of the most fundamental technologies in molecular biology and the life sciences in general. The ease and the rate by which DNA sequences can be obtained greatly affects related technologies such as development and production of new therapeutic agents and new and useful varieties of plants and microorganisms via recombinant DNA technology. In particular, unraveling the DNA sequence helps in understanding human pathological conditions including genetic disorders, cancer and AIDS.
- DNA sequencing is performed by either the chemical degradation method of Maxam and Gilbert (Methods in Enzymology 65. 499-560 (1980)) or the enzymatic dideoxynucleotide termination method of Sanger et al. (Proc. Natl. Acad. Sci. USA IA, 5463-67 (1977)).
- base specific modifications result in a base specific cleavage of the radioactive or fluorescently labeled DNA fragment.
- four sets of nested fragments are produced which are separated according to length by polyacrylamide gel electrophoresis (PAGE). After autoradiography, the sequence can be read directly since each band (fragment) in the gel originates from a base specific cleavage event. Thus, the fragment lengths in the four "ladders” directly translate into a specific position in the DNA sequence.
- the four base specific sets of DNA fragments are formed by starting with a primer/template system elongating the primer into the unknown DNA sequence area and thereby copying the template and synthesizing a complementary strand by DNA polymerases, such as Klenow fragment of E. coli DNA polymerase I, a DNA polymerase from Thermus aquaticus, Taq DNA polymerase, or a modified T7 DNA polymerase, Sequenase (Tabor et al., Proc. Natl. Acad. Sci. USA £4, 4767-4771 (1987)), in the presence of chain-terminating reagents.
- DNA polymerases such as Klenow fragment of E. coli DNA polymerase I, a DNA polymerase from Thermus aquaticus, Taq DNA polymerase, or a modified T7 DNA polymerase, Sequenase (Tabor et al., Proc. Natl. Acad. Sci. USA £4, 4767-4771 (1987)
- the chain-terminating event is achieved by inco ⁇ orating into the four separate reaction mixtures in addition to the four normal deoxynucleoside triphosphates, dATP, dGTP, dTTP and dCTP, only one of the chain-terminating dideoxynucleoside triphosphates, ddATP, ddGTP, ddTTP or ddCTP, respectively, in a limiting small concentration.
- the four sets of resulting fragments produce, after electrophoresis, four base specific ladders from which the DNA sequence can be determined.
- a recent modification of the Sanger sequencing strategy involves the degradation of phosphorothioate-containing DNA fragments obtained by using alpha-thio dNTP instead of the normally used ddNTPs during the primer extension reaction mediated by DNA polymerase (Labeit et al, DNA 5_, 173-177 (1986); Amersham, PCT- Application GB86/00349; Eckstein et al, Nucleic Acids Res. 1£, 9947 (1988)).
- the four sets of base-specific sequencing ladders are obtained by limited digestion with exonuclease III or snake venom phosphodiesterase, subsequent separation on PAGE and visualization by radioisotopic labeling of either the primer or one of the dNTPs.
- the base-specific cleavage is achieved by alkylating the sulphur atom in the modified phosphodiester bond followed by a heat treatment (Max-Planck-technik, DE 3930312 Al). Both methods can be combined with the amplification of the DNA via the Polymerase Chain Reaction (PCR). On the upfront end, the DNA to be sequenced has to be fragmented into sequencable pieces of currently not more than 500 to 1000 nucleotides.
- PCR Polymerase Chain Reaction
- radioisotopes such as P, P, or S is still the most frequently used technique. After PAGE, the gels are exposed to X-ray films and silver grain exposure is analyzed. The use of radioisotopic labeling creates several problems.
- the primer extension products synthesized on the immobilized template strand are purified of enzymes, other sequencing reagents and by-products by a washing step and then released under denaturing conditions by loosing the hydrogen bonds between the Watson-Crick base pairs and subjected to PAGE separation.
- the primer extension products (not the template) from a DNA sequencing reaction are bound to a solid support via biotin/avidin (Du Pont De Nemours, PCT Application WO 91/11533).
- biotin/avidin Du Pont De Nemours, PCT Application WO 91/11533
- the interaction between biotin and avidin is overcome by employing denaturing conditions (formamide EDTA) to release the primer extension products of the sequencing reaction from the solid support for PAGE separation.
- beads e.g., magnetic beads (Dynabeads) and Sepharose beads
- filters e.g., glass beads
- capillaries e.g., glass beads
- plastic dipsticks e.g., polystyrene strips
- microtiter wells e.g., microtiter wells
- PAGE polyacrylamide gel electrophoresis
- CZE capillary zone electrophoresis
- hybridization or fragmentation sequencing (Bains, Biotechnology 10, 757-58 ( 1992) and Mirzabekov et al. , FEBS Letters 256. 118- 122 ( 1989)) utilizing the specific hybridization of known short oligonucleotides (e.g., octadeoxynucleotides which gives 65,536 different sequences) to a complementary DNA sequence. Positive hybridization reveals a short stretch of the unknown sequence. Repeating this process by performing hybridizations with all possible octadeoxynucleotides should theoretically determine the sequence.
- known short oligonucleotides e.g., octadeoxynucleotides which gives 65,536 different sequences
- the enzymes used and the DNA are held in place by solid phases (DEAE-Sepharose and Sepharose) either by ionic interactions or by covalent attachment.
- the amount of pyrophosphate is determined via bioluminescence (luciferase).
- a synthesis approach to DNA sequencing is also used by Tsien et al. (PCT Application No. WO 91/06678).
- the incoming dNTP's are protected at the 3'-end by various blocking groups such as acetyl or phosphate groups and are removed before the next elongation step, which makes this process very slow compared to standard sequencing methods.
- the template DNA is immobilized on a polymer support. To detect incorporation, a fluorescent or radioactive label is additionally inco ⁇ orated into the modified dNTP's.
- the same patent application also describes an apparatus designed to automate the process.
- Mass spectrometry in general, provides a means of "weighing" individual molecules by ionizing the molecules in vacuo and making them “fly” by volatilization. Under the influence of combinations of electric and magnetic fields, the ions follow trajectories depending on their individual mass (m) and charge (z). In the range of molecules with low molecular weight, mass spectrometry has long been part of the routine physical-organic repertoire for analysis and characterization of organic molecules by the determination of the mass of the parent molecular ion In addition, by arranging collisions of this parent molecular ion with other particles (e g., argon atoms), the molecular ion is fragmented forming secondary ions by the so-called collision induced dissociation (CID).
- CID collision induced dissociation
- MALDI mass spectrometry in contrast, can be particularly attractive when a time-of-flight (TOF) configuration is used as a mass analyzer.
- TOF time-of-flight
- the MALDI-TOF mass spectrometry has been introduced by Hillenkamp et al. ("Matrix Assisted UV-Laser Deso ⁇ tion/ionization: A New Approach to Mass Spectrometry of Large Biomolecules," Biological Mass Spectrometry (Burlingame and McCloskey, editors), Elsevier Science Publishers, Amsterdam, pp. 49-60, 1990.) Since, in most cases, no multiple molecular ion peaks are produced with this technique, the mass spectra, in principle, look simpler compared to ES mass spectrometry.
- the polynucleotides obtained are degraded to 3'- nucleotides, cleaved at the N-glycosidic linkage and the isotopically labeled 5'- functionality removed by periodate oxidation and the resulting formaldehyde species determined by mass spectrometry.
- a specific combination of isotopes serves to discriminate base-specifically between internal nucleotides originating from the inco ⁇ oration of NTP's and dNTP's and terminal nucleotides caused by linking ddNTP's to the end of the polynucleotide chain.
- a series of R A DNA fragments is produced, and in one embodiment, separated by electrophoresis, and, with the aid of the so-called matrix method of analysis, the sequence is deduced.
- the sulfur isotopes can be located either in the base or at the alpha-position of the triphosphate moiety whereas the halogen isotopes are located either at the base or at the 3'-position of the sugar ring
- the sequencing reaction mixtures are separated by an electrophoretic technique such as CZE, transferred to a combustion unit in which the sulfur isotopes of the inco ⁇ orated ddNTP's are transformed at about 900 C in an oxygen atmosphere.
- the SO2 generated with masses of 64, 65, 66 or 68 is determined on-line by mass spectrometry using, e.g , as mass analyzer, a quadrupole with a single ion-multiplier to detect the ion current
- the Sanger sequencing reaction mixtures are separated by tube gel electrophoresis
- the effluent is converted into an aerosol by the electrospray/thermospray nebulizer method and then atomized and ionized by a hot plasma (7000 to 8000 K) and analyzed by a simple mass analyzer
- An instrument is proposed which enables one to automate the analysis of the Sanger sequencing reaction mixture consisting of tube electrophoresis, a nebulizer and a mass analyzer
- the invention describes a new method to sequence DNA.
- the improvements over the existing DNA sequencing technologies include high speed, high throughput, no required electrophoresis (and, thus, no gel reading artifacts due to the complete absence of an electrophoretic step), and no costly reagents involving various substitutions with stable isotopes.
- the invention utilizes the Sanger sequencing strategy and assembles the sequence information by analysis of the nested fragments obtained by base-specific chain termination via their different molecular masses using mass spectrometry, for example, MALDI or ES mass spectrometry.
- a further increase in throughput can be obtained by introducing mass modifications in the oligonucleotide primer, the chain-terminating nucleoside triphosphates and/or the chain-elongating nucleoside triphosphates, as well as using integrated tag sequences which allow multiplexing by hybridization of tag specific probes with mass differentiated molecular weights.
- FIGURE 1 is a representation of a process to generate the samples to be analyzed by mass spectrometry.
- This process entails insertion of a DNA fragment of unknown sequence into a cloning vector such as derivatives of M13, pUC or phagemids; transforming the double-stranded form into the single-stranded form; performing the four Sanger sequencing reactions; linking the base-specifically terminated nested fragment family temporarily to a solid support; removing by a washing step all by-products; conditioning the nested DNA or RNA fragments by, for example, cation-ion exchange or modification reagent and presenting the immobilized nested fragments either directly to mass spectrometric analysis or cleaving the purified fragment family off the support and evaporating the cleavage reagent.
- a cloning vector such as derivatives of M13, pUC or phagemids
- FIGURE 2A shows the Sanger sequencing products using ddTTP as terminating deoxynucleoside triphosphate of a hypothetical DNA fragment of 50 nucleotides (SEQ ID NO:3) in length with approximately equally balanced base composition. The molecular masses of the various chain terminated fragments are given.
- FIGURE 2B shows an idealized mass spectrum of such a DNA fragment mixture.
- FIGURES 3 A and 3B show, in analogy to FIGURES 2A and 2B, data for the same model sequence (SEQ ED NO:3) with ddATP as chain terminator
- FIGURES 4A and 4B show data, analogous to FIGURES 2A and 2B when ddGTP is used as a chain terminator for the same model sequence (SEQ ID NO 3)
- FIGURES 5 A and 5B illustrate the results obtained where chain termination is performed with ddCTP as a chain terminator, in a similar way as shown in FIGURES 2A and 2B for the same model sequence (SEQ ID NO:3).
- FIGURE 6 summarizes the results of FIGURES 2A to 5B, showing the correlation of molecular weights of the nested four fragment families to the DNA sequence (SEQ ID NO:3).
- FIGURE 7 illustrates the general structure of mass-modified sequencing nucleic acid primers or tag sequencing probes for either Sanger DNA or Sanger RNA sequencing.
- FIGURE 8 shows the general structure for the mass-modified triphosphates for either Sanger DNA or Sanger RNA sequencing. General formulas of the chain-elongating and the chain-terminating nucleoside triphosphates are demonstrated.
- FIGURE 9 outlines various linking chemistries (X) with either polyethylene glycol or terminally monoalkylated polyethylene glycol (R) as an example
- FIGURE 10 illustrates similar linking chemistries as shown in FIGURE 8 and depicts various mass modifying moieties (R).
- FIGURE 11 outlines how multiplex mass spectrometric sequencing can work using the mass-modified nucleic acid primer (UP).
- FIGURE 12 shows the process of multiplex mass spectrometric sequencing employing mass-modified chain-elongating and/or terminating nucleoside triphosphates.
- FIGURE 13 shows multiplex mass spectrometric sequencing by involving the hybridization of mass-modified tag sequence specific probes
- FIGURE 14 shows a MALDI-TOF spectrum of a mixture of oligothymidylic acids, d(pT) 12-18-
- FIGURE 15 shows a supe ⁇ osition of MALDI-TOF spectra of the 50-mer d(TAACGGTCATTACGGCCATTGACTGTAGGACCTGCATTACATGACTAGCT) (SEQ ID NO:3) (500 fmol) and dT(pdT) 99 (500 fmol).
- FIGURE 16 shows the MALDI-TOF spectra of all 13 DNA sequences representing the nested dT-terminated fragments of the Sanger DNA sequencing simulation of Figure 2, 500 fmol each.
- FIGURE 17 shows the supe ⁇ osition of the spectra of FIGURE 16 The two panels show two different scales and the spectra analyzed at that scale
- FIGURE 18 shows the superimposed MALDI-TOF spectra from MALD1- MS analysis of mass-modified oligonucleotides as described in Example 21
- FIGURE 19 illustrates various linking chemistries between the solid support (P) and the nucleic acid primer (NA) through a strong electrostatic interaction
- FIGURE 20 illustrates various linking chemistries between the solid support (P) and the nucleic acid primer (NA) through a charge transfer complex of a charge transfer acceptor (A) and a charge transfer donor (D).
- FIGURE 21 illustrates various linking chemistries between the solid support (P) and the nucleic acid primer (NA) through a stable organic radical
- FIGURE 22 illustrates a possible linking chemistry between the solid support (P) and the nucleic acid primer (NA) through Watson-Crick base pairing
- FIGURE 23 illustrates linking the solid support (P) and the nucleic acid primer (NA) through a photolytically cleavable bond.
- FIGURE 24 shows the portion of the sequence of pRFcl DNA, which was used as template for PCR amplification of unmodified and 7-deazapurine containing 99-mer and 200-mer nucleic acids as well as the sequences of the 19-mer primers and the two 18-mer reverse primers.
- FIGURE 25 shows the portion of the nucleotide sequence of M13mpl8 RFI DNA, which was used for PCR amplification of unmodified and 7-deazapurine containing 103-mer nucleic acids. Also shown are nucleotide sequences of the 17-mer primers used in the PCR FIGURE 26 shows the result of a polyacrylamide gel electrophoresis of PCR products purified and concentrated for MALDI-TOF MS analysis.
- M chain length marker
- lane 1 7-deazapurine containing 99-mer PCR product
- lane 2 unmodified 99- mer
- lane 3 7-deazapurine containing 103-mer
- lane 4 unmodified 103-mer PCR product.
- FIGURE 27 an autoradiogram of polyacrylamide gel electrophoresis of PCR reactions carried out with 5'-[ T ⁇ -labeled primers 1 and 4.
- Lanes 1 and 2 unmodified and 7 -deazapurine modified 103-mer PCR product (53321 and 23520 counts)
- lanes 3 and 4 unmodified and 7-deazapurine modified 200-mer (71123 and 39582 counts)
- lanes 5 and 6 unmodified and 7-deazapurine modified 99-mer (173216 and 94400 counts).
- FIGURE 28 a) MALDI-TOF mass spectrum of the unmodified 103-mer PCR products (sum of twelve single shot spectra). The mean value of the masses calculated for the two single strands (31768 u and 31759 u) is 31763 u. Mass resolution: 18. b) MALDI-TOF mass spectrum of 7-deazapurine containing 103-mer PCR product
- FIGURE 29 a) MALDI-TOF mass spectrum of the unmodified 99-mer PCR product (sum of twenty single shot spectra). Values of the masses calculated for the two single strands. 30261 u and 30794 u. b) MALDI-TOF mass spectrum of the 7- deazapurine containing 99-mer PCR product (sum of twelve single shot spectra). Values of the masses calculated for the two single strands: 30224 u and 30750 u.
- FIGURE 30 a) MALDI-TOF mass spectrum of the unmodified 200-mer PCR product (sum of 30 single shot spectra). The mean value of the masses calculated for the two single strands (61873 u and 61595 u) is 61734 u. Mass resolution: 28. b)
- MALDI-TOF mass spectrum of 7-deazapurine containing 200-mer PCR product (sum of 30 single shot spectra). The mean value of the masses calculated for the two single strands (61772 u and 61514 u) is 61643 u. Mass resolution: 39.
- FIGURE 31 a) MALDI-TOF mass spectrum of 7-deazapurine containing 100-mer PCR product with ribomodified primers. The mean value of the masses calculated for the two single strands (30529 u and 31095 u) is 30812 u. b) MALDI-TOF mass spectrum of the PCR-product after hydrolytic primer-cleavage The mean value of the masses calculated for the two single strands (25104 u and 25229 u) is 25167 u The mean value of the cleaved primers (5437 u and 5918 u) is 5677 u
- FIGURE 32 A-D shows the MALDI-TOF mass spectrum of the four sequencing ladders obtained from a 39-mer template (SEQ. ID No 13), which was immobilized to streptavidin beads via a 3' biotinylation A 14-mer primer (SEQ ED NO 14) was used in the sequencing
- FIGURE 33 shows a MALDI-TOF mass spectrum of a solid state sequencing of a 78-mer template (SEQ ID No 15), which was immobilized to streptavidin beads via a 3' biotinylation A 18-mer primer (SEQ ED No 16) and ddGTP were used in the sequencing
- FIGURE 34 shows a scheme in which duplex DNA probes with single- stranded overhang capture specific DNA templates and also serve as primers for solid state sequencing
- FIGURE 35 A-D shows MALDI-TOF mass spectra obtained from a 5' fluorescent labeled 23-mer (SEQ ED No 19) annealed to an 3' biotinylated 18-mer (SEQ ED No 20), leaving a 5-base overhang, which captured a 15-mer template (SEQ ID No 21)
- FIGURE 36 shows a stacking flurogram of the same products obtained from the reaction described in FIGURE 35, but run on a conventional DNA sequencer
- This invention describes an improved method of sequencing DNA
- this invention employs mass spectrometry to analyze the Sanger sequencing reaction mixtures
- the DNA sequence can be assigned via supe ⁇ osition (e g , inte ⁇ olation) of the molecular weight peaks of the four individual experiments.
- the molecular weights of the four specifically terminated fragment families can be determined simultaneously by MS, either by mixing the products of all four reactions run in at least two separate reaction vessels (i.e., all run separately, or two together, or three together) or by running one reaction having all four chain-terminating nucleotides (e.g., a reaction mixture comprising dTTP, ddTTP, dATP, ddATP, dCTP, ddCTP, dGTP, ddGTP) in one reaction vessel.
- a reaction mixture comprising dTTP, ddTTP, dATP, ddATP, dCTP, ddCTP, dGTP, ddGTP
- chain-elongating nucleotides and chain-terminating nucleotides are well known in the art.
- chain-elongating nucleotides include 2'-deoxyribonucleotides and chain-terminating nucleotides include 2', 3'-dideoxyribonucleotides.
- chain-elongating nucleotides include ribonucelotides and chain-terminating nucleotides include 3'-deoxyribonucleotides.
- nucleotide is also well known in the art.
- nucleotides include nucleoside mono-, di-, and triphosphates. Nucleotides also include modified nucleotides such as phosphorothioate nucleotides.
- mass spectrometry is a serial method, in contrast to currently used slab gel electrophoresis which allows several samples to be processed in parallel
- a further improvement can be achieved by multiplex mass spectrometric DNA sequencing to allow simultaneous sequencing of more than one DNA or RNA fragment.
- the range of about 300 mass units between one nucleotide addition can be utilized by employing either mass- modified nucleic acid sequencing primers or chain-elongating and/or terminating nucleoside triphosphates so as to shift the molecular weight of the base-specifically terminated fragments of a particular DNA or RNA species being sequenced in a predetermined manner.
- several sequencing reactions can be mass spectrometrically analyzed in parallel.
- multiplex mass spectrometric DNA sequencing can be performed by mass modifying the fragment families through specific oligonucleotides (tag probes) which hybridize to specific tag sequences within each of the fragment families.
- tag probe can be covalently attached to the individual and specific tag sequence prior to mass spectrometry.
- Preferred mass spectrometer formats for use in the invention are matrix assisted laser deso ⁇ tion ionization (MALDI), electrospray (ES), ion cyclotron resonance (ICR) and Fourier Transform.
- MALDI matrix assisted laser deso ⁇ tion ionization
- ES electrospray
- ICR ion cyclotron resonance
- ABI atmospheric pressure ionization interface
- MS/MS quadrupole configuration In MALDI mass spectrometry, various mass analyzers can be used, e.g., magnetic sector/magnetic deflection instruments in single or triple quadrupole mode (MS/MS), Fourier transform and time-of-flight (TOF) configurations as is known in the art of mass spectrometry. For the deso ⁇ tion/ionization process, numerous matrix/laser combinations can be used. Ion-trap and reflectron configurations can also be employed. In one embodiment of the invention, the molecular weight values of at least two base-specifically terminated fragments are determined concurrently using mass spectrometry.
- the molecular weight values of preferably at least five and more preferably at least ten base-specifically terminated fragments are determined by mass spectrometry. Also included in the invention are determinations of the molecular weight values of at least 20 base-specifically terminated fragments and at least 30 base- specifically terminated fragments. Further, the nested base-specifically terminated fragments in a specific set can be purified of all reactants and by-products but are not separated from one another. The entire set of nested base-specifically terminated fragments is analyzed concurrently and the molecular weight values are determined. At least two base-specifically terminated fragments are analyzed concurrently by mass spectrometry when the fragments are contained in the same sample.
- the overall mass spectrometric DNA sequencing process will start with a library of small genomic fragments obtained after first randomly or specifically cutting the genomic DNA into large pieces which then, in several subcloning steps, are reduced in size and inserted into vectors like derivatives of Ml 3 or pUC (e.g., M13mpl8 or M13mpl9) (see FIGURE 1 ).
- the fragments inserted in vectors, such as Ml 3 are obtained via subcloning starting with a cDNA library.
- the DNA fragments to be sequenced are generated by the polymerase chain reaction (e.g., Higuchi et al, "A General Method of in vitro Preparation and Mutagenesis of DNA Fragments: Study of Protein and DNA Interactions," Nucleic Acids Res. ⁇ 16, 7351-67 (1988)).
- the polymerase chain reaction e.g., Higuchi et al, "A General Method of in vitro Preparation and Mutagenesis of DNA Fragments: Study of Protein and DNA Interactions," Nucleic Acids Res. ⁇ 16, 7351-67 (1988)).
- Sanger sequencing can start from one nucleic acid primer (UP) binding to the plus-strand or from another nucleic acid primer binding to the opposite minus-strand
- UP nucleic acid primer
- UP nucleic acid primer
- UP nucleic acid primer
- UP nucleic acid primer
- UP nucleic acid primer
- the nucleic acid primer carries, preferentially at the 5'-end, a linking functionality, L, which can include a spacer of sufficient length and which can interact with a suitable functionality, L', on a solid support to form a reversible linkage such as a photocleavable bond. Since each of the four Sanger sequencing families starts with a nucleic acid primer (L-UP; FIGURE 1) this fragment family can be bound to the solid support by reacting with functional groups, L', on the surface of a solid support and then intensively washed to remove all buffer salts, triphosphates, enzymes, reaction by- products, etc.
- L-UP nucleic acid primer
- the temporary linkage can be such that it is cleaved under the conditions of mass spectrometry, i.e., a photocleavable bond such as a charge transfer complex or a stable organic radical
- the linkage can be formed with L' being a quaternary ammonium group (some examples are given in FIGURE 19)
- the surface of the solid support carries negative charges which repel the negatively charged nucleic acid backbone and thus facilitates deso ⁇ tion Deso ⁇ tion will take place either by the heat created by the laser pulse and/or, depending on L,' by specific abso ⁇ tion of laser energy which is in resonance with the L' chromophore (see, e.g., examples given in FIGURE 19).
- the functionalities, L and L,' can also form a charge transfer complex and thereby form the temporary L-L' linkage.
- Various examples for appropriate functionalities with either acceptor or donator properties are depicted without limitation in FIGURE 20. Since in many cases the "charge-transfer band" can be determined by UV/vis spectrometry (see e.g. Organic Charge Transfer Complexes by R Foster, Academic Press, 1969), the laser energy can be tuned to the corresponding energy of the charge-transfer wavelength and, thus, a specific deso ⁇ tion off the solid support can be initiated.
- the temporary linkage L-L' can be generated by homolytically forming relatively stable radicals as exemplified in FIGURE 21.
- FIGURE 21 a combination of the approaches using charge-transfer complexes and stable organic radicals is shown.
- the nested Sanger DNA RNA fragments are captured via the formation of a charge transfer complex. Under the influence of the laser pulse, deso ⁇ tion (as discussed above) as well as ionization will take place at the radical position.
- the L-L' linkage will be cleaved and the nested Sanger DNA RNA fragments desorbed and subsequently ionized at the radical position formed.
- organic radicals can be selected and that, in relation to the dissociation energies needed to homolytically cleave the bond between them, a corresponding laser wavelength can be selected (see e.g. Reactive Molecules by C. Wentrup, John Wiley & Sons, 1984).
- the nested Sanger DNA/RNA fragments are captured via Watson-Crick base pairing to a solid support- bound oligonucleotide complementary to either the sequence of the nucleic acid primer or the tag oligonucleotide sequence (see FIGURE 22).
- the duplex formed will be cleaved under the influence of the laser pulse and deso ⁇ tion can be initiated.
- the solid support- bound base sequence can be presented through natural oligoribo- or oligodeoxyribonucleotide as well as analogs (e.g. thio-modified phosphodiester or phosphotriester backbone) or employing oligonucleotide mimetics such as PNA analogs (see e.g. Nielsen et al, Science.
- nucleic acids can be "conditioned" by adding positive or negative charges, i.e. charge tags (CTs). CTs increase the mass spectrometer detection sensitivity by increasing the degree of ionization during the mass spectrometric
- a CT can be linked either to the external 3' or 5' position or internally e.g. at the 2' position or at the base, e.g. at C-5 in uracil, C-5 methylgroup of thymine, C-5 at cytosine, at C 7 or C 8 of guanine, adenine and hypoxanthine or at the phosphate ester moiety.
- Charge tags, CTs can function molecules with permanent (i.e. pH-independent) ionization, such as:
- the trityl group is used to anchor the oligonucleotide to a solid support via the tertiary carbon and this bond is cleaved during mass spectrometry (e.g. MALDI), leaving a positive charge on the desorbing and high vacuum flying oligonucleotide. C?J .
- mass spectrometry e.g. MALDI
- a charge tag array in conjunction with another conditioning means.
- Particularly preferred means to be used in conjunction with the CT include treating the phosphodiester bond with trialkylsilyl halides or the phosphomonothiodiester bond with alkyliodides to render the polyanionic backbone neutral.
- Another example of conditioning is modification of the phosphodiester backbone of the nucleic acid molecule (e.g. cation exchange), which can be useful for eliminating peak broadening due to a heterogeneity in the cations bound per nucleotide unit.
- a nucleic acid molecule can be contacted with an alkylating agent such as alkyliodide, iodoacetamide, ⁇ -iodoethanol, or 2,3-epoxy-l- ⁇ ropanol, the monothio phosphodiester bonds of a nucleic acid molecule can be transformed into a phosphotriester bond. Likewise, phosphodiester bonds may be transformed to uncharged derivatives employing trialkylsilyl chlorides.
- alkylating agent such as alkyliodide, iodoacetamide, ⁇ -iodoethanol, or 2,3-epoxy-l- ⁇ ropanol
- Further conditioning involves inco ⁇ orating nucleotides which reduce sensitivity for depurination (fragmentation during MS) such as N7- or N9-deazapurine nucleotides, or RNA building blocks or using oligonucleotide triesters or inco ⁇ orating phosphorothioate functions which are alkylated or employing oligonucleotide mimetics such as PNA.
- nucleotides which reduce sensitivity for depurination (fragmentation during MS) such as N7- or N9-deazapurine nucleotides, or RNA building blocks or using oligonucleotide triesters or inco ⁇ orating phosphorothioate functions which are alkylated or employing oligonucleotide mimetics such as PNA.
- Modification of the phosphodiester backbone can be accomplished by, for example, using alpha-thio modified nucleotides for chain elongation and termination.
- alkylating agents such as akyliodides, iodoacetamide, ⁇ -iodoethanol, 2,3-epoxy-l- propanol (see FIGURE 10)
- the monothio phosphodiester bonds of the nested Sanger fragments are transformed into phosphotriester bonds.
- Multiplexing by mass modification in this case is obtained by mass-modifying the nucleic acid primer (UP) or the nucleoside triphosphates at the sugar or the base moiety.
- UP nucleic acid primer
- nucleoside triphosphates at the sugar or the base moiety.
- the linking chemistry allows one to cleave off the so- purified nested DNA enzymatically, chemically or physically.
- the L- L' chemistry can be of a type of disulfide bond (chemically cleavable, for example, by mercaptoethanol or dithioerythrol), a biotin/streptavidin system, a heterobifunctional derivative of a trityl ether group (Koster et al, "A Versatile Acid-Labile Linker for
- the purification process and/or ion exchange process can be carried out by a number of other methods instead of, or in conjunction with, immobilization on a solid support.
- the base-specifically terminated products can be separated from the reactants by dialysis, filtration (including ultrafiltration), and chromatography.
- these techniques can be used to exchange the cation of the phosphate backbone with a counter-ion which reduces peak broadening.
- the base-specifically terminated fragment families can be generated by standard Sanger sequencing using the Large Klenow fragment of E. coli DNA polymerase I, by Sequenase, Taq DNA polymerase and other DNA polymerases suitable for this pu ⁇ ose, thus generating nested DNA fragments for the mass spectrometric analysis.
- RNA polymerases such as the SP6 or the T7 RNA polymerase can be used on appropriate vectors containing, for example, the SP6 or the T7 promoters (e.g. Axelrod et al, "Transcription from Bacteriophage T7 and SP6 RNA Polymerase Promoters in the Presence of 3'- Deoxyribonucleoside 5'-triphosphate Chain Terminators," Biochemistry 24, 5716-23 (1985)).
- the unknown DNA sequence fragments are inserted downstream from such promoters.
- nucleic acid primer Pitulle et al, "Initiator Oligonucleotides for the Combination of Chemical and Enzymatic RNA Synthesis," Gene 112. 101-105 (1992)
- L linking functionalities
- various solid supports can be used, e.g., beads (silica gel, controlled pore glass, magnetic beads, Sephadex/Sepharose beads, cellulose beads, etc.), capillaries, glass fiber filters, glass surfaces, metal surfaces or plastic material
- useful plastic materials include membranes in filter or microtiter plate formats, the latter allowing the automation of the purification process by employing microtiter plates which, as one embodiment of the invention, carry a permeable membrane in the bottom of the well functionalized with L'.
- Membranes can be based on polyethylene, polypropylene, polyamide, polyvinylidenedifluoride and the like Examples of suitable metal surfaces include steel, gold, silver, aluminum, and copper After purification, cation exchange, and or modification of the phosphodiester backbone of the L-L' bound nested Sanger fragments, they can be cleaved off the solid support chemically, enzymatically or physically. Also, the L-L' bound fragments can be cleaved from the support when they are subjected to mass spectrometric analysis by using appropriately chosen L-L' linkages and corresponding laser energies/intensities as described above and in FIGURES 19-23
- the highly purified, four base-specifically terminated DNA or RNA fragment families are then analyzed with regard to their fragment lengths via determination of their respective molecular weights by MALDI or ES mass spectrometry
- the samples dissolved in water or in a volatile buffer, are injected either continuously or discontinuously into an atmospheric pressure ionization interface (API) and then mass analyzed by a quadrupole
- API atmospheric pressure ionization interface
- the molecular weight peaks are searched for the known molecular weight of the nucleic acid primer (UP) and determined which of the four chain-terminating nucleotides has been added to the UP This represents the first nucleotide of the unknown sequence
- the second, the third, the n extension product can be identified in a similar manner and, by this, the nucleotide sequence is assigned
- the generation of multiple ion peaks which can be obtained using ES mass spectrometry can increase the accuracy of the mass determination
- various mass analyzers can be used
- nucleic acid primer as used herein encompasses primers for both DNA and RNA Sanger sequencing.
- FIGURE 7 presents a general formula of the nucleic acid primer (UP) and the tag probes (TP).
- the mass modifying moiety can be attached, for instance, to either the 5'-end of the oligonucleotide (M ), to the nucleobase (or bases)
- Primer length can vary between 1 and 50 nucleotides in length.
- the primer is preferentially in the range of about 15 to 30 nucleotides in length.
- the length of the primer is preferentially in the range of about 2 to 6 nucleotides. If a tag probe (TP) is to hybridize to the integrated tag sequence of a family chain- terminated fragments, its preferential length is about 20 nucleotides.
- the table in FIGURE 7 depicts some examples of mass-modified primer/tag probe configurations for DNA, as well as RNA Sanger sequencing. This list is, however, not meant to be limiting, since numerous other combinations of mass-modifying functions and positions within the oligonucleotide molecule are possible and are deemed part of the invention.
- the mass-modifying functionality can be, for example, a halogen, an azido, or of the type, XR, wherein X is a linking group and R is a mass-modifying functionality.
- the mass-modifying functionality can thus be used to introduce defined mass increments into the oligonucleotide molecule.
- the nucleotides used for chain-elongation and/or termination are mass-modified. Examples of such modified nucleotides are shown in FIGURE 8.
- the mass-modifying moiety, M can be attached either to the nucleobase, M (in case of the c -deazanucleosides also to C-7, M ), to the triphosphate 3 group at the alpha phosphate, M , or to the 2'-position of the sugar ring of the nucleoside
- the mass-modifying functionality can be added so as to affect chain termination, such as by attaching it to the 3'-position of the sugar
- the list in FIGURE 8 represents examples of possible configurations for generating chain-terminating nucleoside triphosphates for
- FIGURE 9 gives a more detailed description of particular examples of how the mass-modification, M, can be introduced for X in XR as well as using oligo-/polyethylene glycol derivatives for R.
- the oligo/polyethylene glycols can also be monoalkylated by a lower alkyl such as methyl, ethyl, propyl, isopropyl, t- butyl and the like.
- a selection of linking functionalities, X are also illustrated.
- Other chemistries can be used in the mass-modified compounds, as for example, those described recently in Oligonucleotides and Analogues, A Practical Approach. F. Eckstein, editor,
- various mass-modifying functionalities, R can be selected and attached via appropriate linking chemistries, X.
- suitable linking chemistries, X can be selected and attached via appropriate linking chemistries, X.
- FIGURE 10 A simple mass-modification can be achieved by substituting H for halogens like F, CI, Br and/or I, or pseudohalogens such as SCN, NCS, or by using different alkyl, aryl or aralkyl moieties such as methyl, ethyl, propyl, isopropyl, t-butyl, hexyl, phenyl, substituted phenyl, benzyl, or functional groups such as CH2F, CHF2, CF3, Si(CH3) 3 , Si(CH3)2(C 2 H 5 ), Si(CH3)(C 2 H 5 ) 2 , Si(C 2 H 5 ) 3 .
- halogens like F, CI, Br and/or I, or pseudohalogens such as
- mass-modification can be obtained by attaching homo- or heteropeptides through X to the UP, TP or nucleoside triphosphates.
- the superscript 0 (e.g., NTP , UP ) can designate an unmodified species of a particular reactant
- the superscript i (e.g., NTP ,
- NTP , NTP , etc. can designate the i-th mass-modified species of that reactant. If, for example, more than one species of nucleic acids (e.g., DNA clones) are to be concurrently sequenced by multiplex DNA sequencing, then i + 1 different mass-modified nucleic acid primers (UP , UP '...UP ) can be used to distinguish each set of base- specifically terminated fragments, wherein each species of mass-modified UP can be distinguished by mass spectrometry from the rest.
- UP , UP '...UP mass-modified nucleic acid primers
- the first reaction mixture is obtained by standard Sanger DNA sequencing having unknown DNA fragment 1 (clone 1) integrated in an appropriate vector (e.g., M13mpl8), employing an unmodified nucleic acid primer UP , and a standard mixture of the four unmodified deoxynucleoside triphosphates, dNTP , and with 1/lOth of one of the four dideoxynucleoside triphosphates, ddNTP .
- a second reaction mixture for DNA fragment 2 (clone 2) is obtained by employing a mass-modified nucleic acid primer UP and, as before, the four unmodified nucleoside triphosphates,
- extension products then being, for example, UP -
- RNA polymerase e.g , SP6 or T7 RNA polymerase
- NTP and 3 '-dNTP unmodified nucleoside triphosphates
- FIGURE 12 illustrates the process of multiplexing by mass-modified chain- elongating or/and terminating nucleoside triphosphates in which three different DNA fragments (3 clones) are mass analyzed simultaneously.
- the first DNA Sanger sequencing reaction (DNA fragment 1, clone 1) is the standard mixture employing unmodified nucleic acid primer UP , dNTP and in each of the four reactions one of the four ddNTP .
- 0 0 1 0 0 2 clone 3 have the following contents: UP , dNTP , ddNTP and UP , dNTP , ddNTP
- an amplification of the mass increment in mass-modifying the extended DNA fragments can be achieved by either using an equally
- 0 0 0 0 1 0 can be as follows, either UP /dNTP /ddNTP , UP /dNTP /ddNTP and UP°/dNTP 2 /ddNTP° or UP 0 /dNTP 0 /ddNTP°, UP°/dNTP * /ddNTP * and
- DNA sequencing can be performed by
- DNA sequencing by multiplex mass spectrometry can be achieved by cloning the DNA fragments to be sequenced in "plex-vectors" containing vector specific "tag sequences" as described (Koster et al,
- ddT - terminated DNA fragments are respectively detected and memorized. Assignment of, for example, ddT - terminated DNA fragments to a specific fragment family is accomplished by another mass spectrometric analysis after hybridization of the specific tag probe (TP) to the corresponding tag sequence contained in the sequence of this specific fragment family.
- TP specific tag probe
- photoreactive groups such as psoralen and ellipticine
- the DNA sequence is unraveled again by searching for the lowest molecular weight molecular ion peak corresponding to the known UP -tag sequence/tag probe molecular weight plus the first extension product, e.g., ddT , then the second, the third, etc.
- a further increase in multiplexing can be achieved by using, in addition to the tag probe/tag sequence interaction, mass-modified nucleic acid primers (FIGURE 7) and or mass-modified deoxynucleoside, dNTP ' and/or dideoxynucleoside triphosphates, ddNTP .
- FOGURE 7 mass-modified nucleic acid primers
- dNTP ' and/or dideoxynucleoside triphosphates ddNTP .
- tag sequence/tag probe multiplexing approach is not limited to Sanger DNA sequencing generating nested DNA fragments with DNA polymerases.
- the DNA sequence can also be determined by transcribing the unknown DNA sequence from appropriate promoter-containing vectors (see above) with various RNA polymerases and mixtures of NTP /3'-dNTP , thus generating nested RNA fragments.
- the mass-modifying functionality can be introduced by a two or multiple step process.
- kits for sequencing nucleic acids by mass spectrometry which include combinations of the above-described sequencing reactants
- the kit comprises reactants for multiplex mass spectrometric sequencing of several different species of nucleic acid
- the kit can include a solid support having a linking functionality (L ) for immobilization of the base- specifically terminated products, at least one nucleic acid primer having a linking group (L) for reversibly and temporarily linking the primer and solid support through, for example, a photocleavable bond, a set of chain-elongating nucleotides (e.g , dATP, dCTP, dGTP and dTTP, or ATP, CTP, GTP and UTP); a set of chain-terminating nucleotides (such as 2',3'-dideoxynucleotides for DNA synthesis or 3'-deoxynucleotides for RNA synthesis); and an appropriate polymerase for synthesizing complementary nucleot
- L linking functionality
- L
- Primers and/or terminating nucleotides can be mass-modified so that the base-specifically terminated fragments generated from one of the species of nucleic acids to be sequenced can be distinguished by mass spectrometry from all of the others
- a set of tag probes (as described above) can be included in the kit
- the kit can also include appropriate buffers as well as instructions for performing multiplex mass spectrometry to concurrently sequence multiple species of nucleic acids
- a nucleic acid sequencing kit can comprise a solid support as described above, a primer for initiating synthesis of complementary nucleic acid fragments, a set of chain-elongating nucleotides and an appropriate polymerase.
- the mass-modified chain-terminating nucleotides are selected so that the addition of one of the chain terminators to a growing complementary nucleic acid can be distinguished by mass spectrometry.
- the present invention is further illustrated by the following examples which should not be construed as limiting in any way.
- the contents of all cited references including literature references, issued patents, published patent applications (including international patent application Publication Number WO 94/16101, entitled “DNA Sequencing by Mass Spectrometry” by H. Koester; and international patent application Publication Number WO 94/21822 entitled “DNA Sequencing by Mass Spectrometry Via Exonuclease Degradation” by H. Koester), and co-pending patent applications, (including U.S Patent Application Serial No. 08/406,199, entitled “DNA Diagnostics Based on Mass Spectrometry” by H. Koester), as cited throughout this application are hereby expressly inco ⁇ orated by reference.
- Sequelon membranes (Millipore Corp., Bedford, MA) with phenyl isothiocyanate groups are used as a starting material.
- the membrane disks with a diameter of 8 mm, are wetted with a solution of N-methylmo ⁇ holine/water/2- propanol (NMM solution) (2/49/49 v/v/v), the excess liquid removed with filter paper and placed on a piece of plastic film or aluminum foil located on a heating block set to 55 C.
- NMM solution N-methylmo ⁇ holine/water/2- propanol
- a solution of 1 mM 2-mercaptoethylamine (cysteamine) or 2, 2'-dithio- bis(ethylamine) (cystamine) or S-(2-thiopyridyl)-2-thio-ethylamine (10 ul, 10 nmol) in NMM is added per disk and heated at 55 C. After 15 min, 10 ul of NMM solution are added per disk and heated for another 5 min. Excess of isothiocyanate groups may be removed by treatment with 10 ul of a 10 mM solution of glycine in NMM solution.
- the disks are treated with 10 ul of a solution of 1M aqueous dithiothreitol (DTT)/2-propanol (1 : 1 v/v) for 15 min at room temperature. Then, the disks are thoroughly washed in a filtration manifold with 5 aliquots of 1 ml each of the NMM solution, then with 5 aliquots of 1 ml acetonitrile/water (1/1 v/v) and subsequently dried.
- DTT dithiothreitol
- the disks are stored with free thiol groups in a solution of 1M aqueous dithiothreitol/2-propanol (1 : 1 v/v) and, before use, DTT is removed by three washings with 1 ml each of the NMM solution.
- the primer oligonucleotides with 5'-SH functionality can be prepared by various methods (e.g., B.C.F Chu et al, Nucleic Acids Res. 14. 5591-5603 (1986), Sproat et al. Nucleic Acids Res. 15. 4837-48 (1987) and Oligonucleotides and Analogues: A Practical Approach (F. Eckstein, editor), ERL Press Oxford, 1991).
- Sequencing reactions according to the Sanger protocol are performed in a standard way (e.g., H. Swerdlow et al, Nucleic Acids Res. 18. 1415-19 (1990)).
- the free 5'-thiol primer can be used; in other cases, the SH functionality can be protected, e.g., by a trityl group during the Sanger sequencing reactions and removed prior to anchoring to the support in the following way.
- the four sequencing reactions (150 ul each in an Eppendorf tube) are terminated by a 10 min incubation at 70 C to denature the DNA polymerase (such as Klenow fragment, Sequenase) and the reaction mixtures are ethanol precipitated.
- the supernatants are removed and the pellets vortexed with 25 ul of an 1M aqueous silver nitrate solution, and after one hour at room temperature, 50 ul of an 1 M aqueous solution of DTT is added and mixed by vortexing. After 15 min, the mixtures are centrifuged and the pellets are washed twice with 100 ul ethylacetate by vortexing and centrifugation to remove excess DTT.
- the primer extension products with free 5 '-thiol group are now coupled to the thiolated membrane supports under mild oxidizing conditions.
- the oligonucleotide primer is functionalized with an amino group at the 5'-end which is introduced by standard procedures during automated DNA synthesis.
- the primary amino group is reacted with 3-(2-pyridyldithio) propionic acid N-hydroxysuccinimide ester (SPDP) and subsequently coupled to the thiolated supports and monitored by the release of pyridyl-2-thione as described aabboov ⁇ e.
- SPDP 3-(2-pyridyldithio) propionic acid N-hydroxysuccinimide ester
- the supematants are removed and the pellets dissolved in 10 ul 10 mM TEAA buffer pH 7.2 and 10 ul of a 2 mM solution of SPDP in 10 mM TEAA are added.
- the reaction mixture is vortexed and incubated for 30 min at 25 C.
- Excess SPDP is then removed by three extractions (vortexing, centrifugation) with 50 ul each of ethanol and the resulting pellets are dissolved in 10 ul 10 mM TEAA buffer pH 7.2 and coupled to the thiolated supports (see above).
- the primer-extension products are purified by washing the membrane disks three times each with 100 ul NMM solution and three times with 100 ul each of 10 mM TEAA buffer pH 7.2.
- the purified primer-extension products are released by three successive treatments with 10 ul of 10 mM 2-mercaptoethanol in 10 mM TEAA buffer pH 7.2, lyophilized and analyzed by either ES or MALDI mass spectrometry.
- nucleic acid primers UP
- nucleic acid primers UP
- UP nucleic acid primers
- the four reaction mixtures (150 ul each in an Eppendorf tube) are heated to 70 C for 10 min to inactivate the DNA polymerase, ethanol precipitated, centrifuged and resuspended in 10 ul of 10 mM TEAA buffer pH 7.2.
- RNA extension products are immobilized in an analogous way. The procedure can be applied to other solid supports with isothiocyanate groups in a similar manner.
- the immobilized primer-extension products are extensively washed three times with 100 ul each of NMM solution and three times with 100 ul 10 mM TEAA buffer pH 7.2.
- the purified primer-extension products are released by three successive treatments with 10 ul of 100 mM hydrazinium acetate buffer pH 6.5, lyophilized and analyzed by either ES or MALDI mass spectrometry.
- Sequelon DITC membrane disks of 8 mm diameter (Millipore Co ⁇ ., Bedford, MA) are wetted with 10 ul of NMM solution (N-methylmo ⁇ holine/propanaol- 2/water; 2/49/49 v/v/v) and a linker arm introduced by reaction with 10 ul of a 10 mM solution of 1,6-diaminohexane in NMM.
- NMM solution N-methylmo ⁇ holine/propanaol- 2/water; 2/49/49 v/v/v
- the excess diamine is removed by three washing steps with 100 ul of NMM solution.
- the four Sanger DNA sequencing reaction mixtures (150 ul each in Eppendorf tubes) are heated for 10 min at 70 C to inactivate the DNA polymerase, ethanol precipitated, and the pellets resuspended in 10 ul of a solution of N-methylmorpholine, 2-propanol and water (2/10/88 v/v/v). This solution is transferred to the Lys-Lys-DITC membrane disks and coupled on a heating block set at 55 C. After drying, 10 ul of NMM solution is added and the drying process repeated.
- the immobilized primer-extension products are extensively washed three times with 100 ul each of NMM solution and three times with 100 ul each of 10 mM TEAA buffer pH 7.2.
- the bond between the primer- extension products and the solid support is cleaved by treatment with trypsin under standard conditions and the released products analyzed by either ES or MALDI mass spectrometry with trypsin serving as an internal mass standard.
- DITC Sequelon membrane disks of 8 mm diameter
- disks of 8 mm diameter are prepared as described in EXAMPLE 3 and 10 ul of a 10 mM solution of 3-aminopyridine adenine dinucleotide (APAD) (Sigma) in NMM solution added.
- APAD 3-aminopyridine adenine dinucleotide
- the excess APAD is removed by a 10 ul wash of NMM solution and the disks are treated with 10 ui of 10 mM sodium periodate in NMM solution (15 min, 25 C).
- primer-extension products are extensively washed with the NMM solution (3 times with 100 ul each) and 10 mM TEAA buffer pH 7.2 (3 times with 100 ul each) and the purified primer-extension products are released by treatment with either NADase or pyrophosphatase in 10 mM TEAA buffer at pH 7.2 at 37 C for 15 min, lyophilized and analyzed by either ES or MALDI mass spectrometry, the enzymes serving as internal mass standards.
- Oligonucleotides are synthesized by standard automated DNA synthesis using ⁇ -cyanoethylphosphoamidites (H. Koster et al, Nucleic Acids Res. 12. 4539 (1984)) and a 5'-amino group is introduced at the end of solid phase DNA synthesis (e.g. Agrawal et al, Nucleic Acids Res. 14, 6227-45 (1986) or Sproat et al, Nucleic Acids Res. 15. 6181-96 (1987)). The total amount of an oligonucleotide synthesis, starting with 0.25 umol CPG-bound nucleoside, is deprotected with concentrated aqueous
- TM ammonia purified via OligoPAK Cartridges (Millipore Co ⁇ ., Bedford, MA) and lyophilized. This material with a 5'-terminal amino group is dissolved in 100 ul absolute
- N,N-dimethylformamide DMF
- N-Fmoc-glycine pentafluorophenyl ester for 60 min at 25 C.
- the Fmoc group is cleaved off by a 10 min treatment with 100 ul of a solution of 20% piperidine in N,N-dimethylformamide.
- Excess piperidine, DMF and the cleavage product from the Fmoc group are removed by ethanol precipitation and the precipitate lyophilized from 10 mM TEAA buffer pH 7.2.
- This material is now either used as primer for the Sanger DNA sequencing reactions or one or more glycine residues (or other suitable protected amino acid active esters) are added to create a series of mass- modified primer oligonucleotides suitable for Sanger DNA or RNA sequencing.
- 0-i Immobilization of these mass-modified nucleic acid primers UP after primer-extension during the sequencing process can be achieved as described, e g., in EXAMPLES 1 to 4
- This glycine modified thymidine analogue building block for chemical DNA synthesis can be used to substitute one or more of the thymidine/uridine nucleotides in the nucleic acid primer sequence
- the Fmoc group is removed at the end of the solid phase synthesis with a 20 min treatment with a 20 % solution of piperidine in DMF at room temperature DMF is removed by a washing step with acetonitrile and the oligonucleotide deprotected and purified in the standard way
- nucleic acid primer mass-modified at C-5 of the heterocyclic base of a pyrimidine nucleoside with diethylene glycol monomethyl ether was as in previous examples, 5-(3- aminopropynyl-l)-2'-deoxyuridine.
- the mass-modifying functionality was obtained similar to EXAMPLE 8. 12.02 g (100.0 mmole) freshly distilled diethylene glycol monomethyl ether dissolved in 50 ml absolute pyridine was reacted with 10.01 g (100.0 mmole) recrystallized succinic anhydride in the presence of 1.22 g (10.0 mmole) 4-N, N- dimethylaminopyridine (DMAP) overnight at room temperature.
- DMAP N- dimethylaminopyridine
- the mass-modified building block is inco ⁇ orated into automated chemical DNA synthesis according to standard procedures.
- one or more of the thymidine/uridine residues can be substituted by this mass-modified nucleotide.
- the nucleic acid primers of EXAMPLES 8 and 9 would have a mass difference of 44.05 daltons.
- the product fractions were combined, the solvent evaporated, the fractions dissolved in 5 ml dichloromethane and precipitated into 100 ml pentane. Yield was 487 mg (0.76 mmole, 76 %). Transformation into the corresponding nucleoside- ⁇ -cyanoethylphosphoamidite and integration into automated chemical DNA synthesis is performed under standard conditions. During final deprotection with aqueous concentrated ammonia, the methyl group is removed from the glycine moiety.
- the mass-modified building block can substitute one or more deoxyadenosine/adenosine residues in the nucleic acid primer sequence.
- This derivative was prepared in analogy to the glycine derivative of
- the mass-modified deoxythymidine derivative can substitute for one or more of the thymidine residues in the nucleic acid primer.
- the 4-nitrophenyl ester of succinylated diethylene glycol monomethyl ether see EXAMPLE 9
- triethylene glycol monomethyl ether the corresponding mass-modified oligonucleotides are prepared.
- the mass difference between the ethylene, diethylene and triethylene glycol derivatives is 44.05, 88.1 and 132.15 daltons respectively.
- the alkylated oligonucleotide was purified by standard reversed phase HPLC (RP-18 Ultraphere, Beckman; column: 4.5 x 250 mm; 100 mM triethylammonium acetate, pH 7.0 and a gradient of 5 to 40 % acetonitrile).
- the nucleic acid primer containing one or more phosphorothioate phosphodiester bond is used in the Sanger sequencing reactions.
- the primer-extension products of the four sequencing reactions are purified as exemplified in EXAMPLES 1 - 4, cleaved off the solid support, lyophilized and dissolved in 4 ⁇ l each of TE buffer pH 8.0 and alkylated by addition of 2 ⁇ l of a 20 mM solution of 2-iodoethanol in DMF. It is then analyzed by ES and/or MALDI mass spectrometry.
- Detritylation was achieved by a one hour treatment with 80% aqueous acetic acid at room temperature The residue was evaporated to dryness, co-evaporated twice with toluene, suspended in 1 ml dry acetonitrile and 5'-phosphorylated with POCI3 according to literature (Yoshikawa et al, Bull. Chem Soc.
- a glycyl-glycine modified 2'-amino-2'-deoxyuridine-5'-triphosphate was obtained by removing the Fmoc group from 5'-O-(4,4-dimethoxytrityl)-3'-O-acetyl-2'-N- (N-9-fluorenylmethyloxycarbonyl-glycyl)-2'-amino-2'-deoxyuridine by a one-hour treatment with a 20% solution of piperidine in DMF at room temperature, evaporation of solvents, two-fold co-evaporation with toluene and subsequent condensation with N- Fmoc-glycine pentafluorophenyl ester.
- EXAMPLE 15 Synthesis of deoxyuridine-5'-triphosphate mass-modifled at C-5 of the heterocyclic base with glycine, glycyl-glycine and ⁇ -alanine residues.
- the nucleoside triphosphate containing fractions (checked by TLC on polyethyleneimine cellulose plates) were combined and lyophillized. Yield of the 8-glycyI-2'-deoxyadenosine-5'-triphosphate (determined by UV-absorbance of the adenine moiety) was 57% (0.57 mmole). The yield for the 8-glycyl-glycyl-2'-deoxyadenosine-5'-triphosphate was 51% (0.51 mmole).
- Mass-modification of Sanger DNA sequencing fragment ladders by incorporation of chain-elongating 2'-deoxy- and chain-terminating 2 ⁇ 3'-dideoxythymidine-5'- (alpha-S-)-triphosphate and subsequent alkylation with 2-iodoethanol and 3- iodopropanol 2',3'-Dideoxythymidine-5'-(alpha-S)-triphosphate was prepared according to published procedures (e.g., for the alpha-S-triphosphate moiety: Eckstein et al, Biochemistry 1 , 1685 (1976) and Accounts Chem Res. H, 204 (1978) and for the 2',3'- dideoxy moiety: Seela et al.
- the template (2 pmole) and the nucleic acid Ml 3 sequencing primer (4 pmole) modified according to EXAMPLE 1 are annealed by heating to 65°C in 100 ul of 10 mM Tris-HCl pH 7.5, 10 mM MgCl 2 , 50 mM NaCI, 7 mM dithiothreitol (DTT) for 5 min and slowly brought to 37 C during a one hour period.
- the sequencing reaction mixtures contain, as exemplified for the T-specific termination reaction, in a final volume of 150 ul, 200 uM (final concentration) each of dATP, dCTP, dTTP, 300 uM c7-deaza-dGTP, 5 uM 2',3'- dideoxythymidine-5'-(alpha-S)-triphosphate and 40 units Sequenase (United States Biochemicals). Polymerization is performed for 10 min at 37 C, the reaction mixture o heated to 70 C to inactivate the Sequenase, ethanol precipitated and coupled to thiolated
- Sequelon membrane disks (8 mm diameter) as described in EXAMPLE 1 Alkylation is performed by treating the disks with 10 ul of 10 mM solution ofeither 2-iodoethanol or
- Oligothymidylic acid oligo p(dT) j 2_i8, is commercially available (United States Biochemical, Cleveland, OH). Generally, a matrix solution of 0.5 M in ethanol was prepared. Various matrices were used for this Example and Examples 19- 21 such as 3,5-dihydroxybenzoic acid, sinapinic acid, 3-hydroxypicolinic acid, 2,4,6- trihydroxyacetophenone. Oligonucleotides were lyophilized after purification by HPLC and taken up in ultrapure water (MilliQ, Millipore) using amounts to obtain a concentration of 10 pmoles/ ⁇ l as stock solution.
- MALDI-TOF spectra were obtained for this Example and Examples 19-21 on different commercial instruments such as Vision 2000 (Finnigan-MAT), VG TofSpec (Fisons Instruments), LaserTec Research (Vestec). The conditions for this Example were linear negative ion mode with an acceleration voltage of 25 kV.
- the MALDI-TOF spectrum generated is shown in FIGURE 14. Mass calibration was done externally and generally achieved by using defined peptides of appropriate mass range such as insulin, gramicidin S, trypsinogen, bovine serum albumen, and cytochrome C. All spectra were generated by employing a nitrogen laser with 5 nsec pulses at a wavelength of 337 nm.
- oligonucleotides Two large oligonucleotides were analyzed by mass spectrometry.
- the 50- mer d (TAACGGTCATTACGGCCATTGACTGTAGGACCTGCATTACATGACTAGCT) (SEQ ED NO:3) and dT(pdT) ⁇ g were used.
- the oligodeoxynucleotides were synthesized using ⁇ -cyanoethylphosphoamidites and purified using published procedures.(e.g. N.D. Sinha, J. Biernat, J. McManus and H. Koster, Nucleic Acids Res..
- Example 19 The 13 DNA sequences representing the nested dT-terminated fragments of the Sanger DNA sequencing for the 50-mer described in Example 19 (SEQ ED NO:3) were synthesized as described in Example 19. The samples were treated and 500 fmol of each fragment was analyzed by MALDI-MS as described in Example 18. The resulting MALDI-TOF spectra are shown in FIGURE 16 The conditions were reflectron positive ion mode with an acceleration of 5 kV and postacceleration of 20 kV. Calculated molecular masses and experimental molecular masses are shown in Table 1
- a 17-mer was mass-modified at C-5 of one or two deoxyuridine moieties.
- 5-[13-(2-Methoxyethoxyl)-tridecyne-l-yl]-5'-O-(4,4'-dimethoxytrityl)-2'-deoxyuridine-3'- ⁇ -cyanoethyl-N, N-diisopropylphosphoamidite was used to synthesize the modified 17- mers using the methods described in Example 1 .
- the samples were prepared and 500 fmol of each modified 17-mer was analyzed using MALDI-MS as described in Example 18.
- the conditions used were reflectron positive ion mode with an acceleration of 5 kV and postacceleration of 20 kV
- the MALDI-TOF spectra which were generated were superimposed and are shown in FIGURE 18.
- oligodeoxynucleotide primers were either synthesized according to standard phosphoamidite chemistry (Sinha, N.D,. et al., (1983) Tetrahedron Let. Vol. 24, Pp. 5843-5846; Sinha, N.D., et al., (1984) Nucleic Acids Res., Vol. 12, Pp 4539-4557) on a MilliGen 7500 DNA synthesizer (Millipore, Bedford, MA, USA) in 200 nmol scales or purchased from MWG-Biotech (Ebersberg, Germany, primer 3) and Biometra (Goettingen, Germany, primers 6-7)
- primer 1 5 ' - GTCACCCTCGACCTGCAG SEQ. ID NO 6
- primer 2 5 ' - TTGTAAAACGACGGCCAGT
- primer 3 5 * - CTTCCACCGCGATGTTGA (SEQ ED. NO. 8)
- primer 4 5 » - CAGGAAACAGCTATGAC (SEQ. ID NO. 9)
- primer 5 5 ' - GTAAAACGACGGCCAGT
- primer 6 5 ' - GTCACCCTCGACCTGCAgC g: RiboG
- primer 7- 5 ' - GTTGTAAAACGAGGGCCAgT g: RiboG
- the 103-mer DNA strands (modified and unmodified) were amplified from M13mpl8 RFI DNA (100 ng, Pharmacia, Freiburg, Germany) in 100 ⁇ L reaction volume using primers 4 and 5 all other concentrations were unchanged The reaction was performed using the cycle denaturation at 95 °C for 1 min , annealing at 40°C for 1 min and extension at 72 °C for 1 min After 30 cycles for the unmodified and 40 cycles for the modified 103-mer respectively, the samples were incubated for additional 10 min at
- Vent DNA polymerase were able to inco ⁇ orate c -dATP and c -dGTP during PCR as well.
- the overall performance turned out to be best for the exo(-)Pfu DNA polymerase giving least side products during amplification. Using all three polymerases,
- RNA polymerases such as the SP6 or the T7 RNA polymerase, must be used
- the 99-mer, 103-mer and 200-mer PCR products were analyzed by MALDI-TOF MS. Based on past experience, it was known that the degree of depurination depends on the laser energy used for deso ⁇ tion and ionization of the analyte. Since the influence of 7-deazapurine modification on fragmentation due to depurination was to be investigated, all spectra were measured at the same relative laser energy.
- Figures 28a and 28b show the mass spectra of the modified and unmodified 103-mer nucleic acids. In case of the modified 103-mer, fragmentation
- the modified 103-mer still contains about 20% A and G from the oligonucleotide primers, it shows less fragmentation which is featured by much more narrow and symmetric signals Especially peak tailing on the lower mass side due to depurination, is substantially reduced Hence, the difference between measured and calculated mass is strongly reduced although it is
- a complete 7-deaza purine modification of nucleic acids may be achieved either using modified primers in PCR or cleaving the unmodified primers from the partially modified PCR product. Since disadvantages are associated with modified primers, as described above, a 100-mer was synthesized using primers with a ribo- modification. The primers were cleaved hydrolytically with NaOH according to a method developed earlier in our laboratory (Koester, H. et al., Z Physiol. Chem. 359: 1570- 1589). Figures 31a and 3 lb display the spectra of the PCR product before and after primer cleavage.
- Figure 3 lb shows that the hydrolysis was successful: Both hydrolyzed PCR product as well as the two released primers could be detected together with a small signal from residual uncleaved 100-mer. This procedure is especially useful for the MALDI-TOF analysis of very short PCR-products since the share of unmodified purines originating from the primer increases with decreasing length of the amplified sequence
- Depurination may either be accompanied by loss of charge which decreases the total yield of charged species or it may produce charged fragmentation products which decreases the intensity of the non fragmented molecular ion signal.
- Oligonucleotides were purchased from Operon Technologies (Alameda, CA) in an unpurified form Their sequences are listed in Table III Sequencing reactions were performed on a solid surface using reagents from the sequencing kit for Sequenase Version 2.0 (Amersham, Arlington Heights, Illinois) Sequencing a 39-mer target Sequencing complex:
- template strand DNA1 1683 was 3'-biotinylated by terminal deoxynucleotidyl transferase
- a 30 ⁇ l reaction containing 60 pmol of DNA1 1683, 1.3 nmol of biotin 14-dATP (GEBCO BRL, Grand Island, NY), 30 units of terminal transferase (Amersham, Arlington Heights, Illinois), and lx reaction buffer (supplied with enzyme), was incubated at 37°C for 1 hour. The reaction was stopped by heat inactivation of the terminal transferase at 70 °C for 10 min. The resulting product was desalted by passing through a TE-10 spin column (Clonetech).
- Biotin- 14-d ATP More than one molecules of biotin- 14-d ATP could be added to the 3 '-end of DNA11683.
- the biotinylated DNA11683 was incubated with 0.3 mg of Dynal streptavidin beads in 30 ⁇ l lx binding and washing buffer at ambient temperature for 30 min.
- the beads were washed twice with TE and redissolved in 30 ⁇ l TE, 10 ⁇ l aliquot (containing 0.1 mg of beads) was used for sequencing reactions
- the 0.1 mg beads from previous step were resuspended in a lO ⁇ l volume containing 2 ⁇ l of 5x Sequenase buffer (200 mM Tris-HCl, pH 7 5, 100 mM MgC12, and 250 mM NaCI) from the Sequenase kit and 5 pmol of corresponding primer PNA16/DNA
- the annealing mixture was heated to 70 C C and allowed to cool slowly to room temperature over a 20-30 min time period.
- Sequenase (3.25 units) were added.
- the reaction mixture was divided into four aliquots of 3 ⁇ l each and mixed with termination mixes (each consists of 3 ⁇ l of the appropriate termination mix: 32 ⁇ M c7dATP, 32 ⁇ M dCTP, 32 ⁇ M c7dGTP, 32 ⁇ M dTTP and 3.2 ⁇ M of one of the four ddTNPs, in 50 mM NaCI).
- the reaction mixtures were incubated at 37°C for 2 min. After the completion of extension, the beads were precipitated and the supernatant was removed. The beads were washed twice and resuspended in TE and ke ⁇ t at 4°C.
- the target TNR.PLASM2 was biotinylated and sequenced using procedures similar to those described in previous section (sequencing a 39-mer target)
- CM1B3B was immobilized on Dynabeads M280 with streptavidin (Dynal, Norway) by incubating 60 pmol of CM1B3B with 0.3 magnetic beads in 30 ⁇ l 1M NaCI and TE (lx binding and washing buffer) at room temperature for 30 min. The beads were washed twice with TE and redissolved in 30 ⁇ l TE, 10 or 20 ⁇ l aliquot (containing 0.1 or 0.2 mg of beads respectively) was used for sequencing reactions.
- the duplex was formed by annealing corresponding aliquot of beads from previous step with 10 pmol of DFl la5F (or 20 pmol of DFl la5F for 0.2 mg of beads) in a 9 ⁇ l volume containing 2 ⁇ l of 5x Sequenase buffer (200 mM Tris-HCl, pH 7.5, 100 mM MgCll, and 250 mM NaCI) from the Sequenase kit.
- 5x Sequenase buffer 200 mM Tris-HCl, pH 7.5, 100 mM MgCll, and 250 mM NaCI
- the annealing mixture was heated to 65 °C and allowed to cool slowly to 37 °C over a 20-30 min time period
- the duplex primer was then mixed with 10 pmol of TSlo (20 pmol of TS 10 for 0.2 mg of beads) in 1 ⁇ l volume, and the resulting mixture was further incubated at 37 °C for 5 min, room temperature for 5-10 min. Then 1 ⁇ l 0.1 M dithiothreitol solution, 1 ⁇ l Mn buffer (0.15 M sodium isocitrate and 0.1 M MnCl 2 ), and 2 ⁇ l of diluted Sequenase (3.25 units) were added.
- the reaction mixture was divided into four aliquots of 3 ⁇ l each and mixed with termination mixes (each consists of 4 ⁇ l of the appropriate termination mix: 16 ⁇ M dATP, 16 ⁇ M dCTP, 16 ⁇ M dGTP, 16 ⁇ M dTTP and 1.6 ⁇ M of one of the four ddNTPs, in 50 mM NaCI).
- the reaction mixtures were incubated at room temperature for 5 min, and 37° C for 5 min. After the completion of extension, the beads were precipitated and the supernatant was removed. The beads were resuspended in 20 ⁇ l TE and kept at 4°C.
- the sequencing ladder loaded magnetic beads were washed twice using 50 mM ammonium citrate and resuspended in 0.5 ⁇ l pure water. The suspension was then loaded onto the sample target of the mass spectrometer and 0.5 ⁇ l of saturated matrix solution (3-hydropicolinic acid (HPA): ammonium citrate
- the reflectron TOFMS mass spectrometer (Vision 2000, Finnigan MAT, Bremen, Germany) was used for analysis. 5 kV was applied in the ion source and 20 kV was applied for postacceleration. All spectra were taken in the positive ion mode and a nitrogen laser was used. Normally, each spectrum was averaged for more than 100 shots and a standard 25-point smoothing was applied.
- a primer is directly annealed to the template and then extended and terminated in a Sanger dideoxy sequencing.
- a biotinylated primer is used and the sequencing ladders are captured by streptavidin- coated magnetic beads. After washing, the products are eluted from the beads using
- a 39-mer template (SEQ. ED. No. 13) was first biotinylated at the 3' end by adding biotin- 14-d ATP with terminal transferase. More than one biotin- 14-dATP molecule could be added by the enzyme. However, since the template was immobilized and remained on the beads during MALDI, the number of biotin- 14-dATP would not affect the mass spectra.
- a 14-mer primer (SEQ. ED. No. 14) was used for the solid-state sequencing. MALDI-TOF mass spectra of the four sequencing ladders are shown in Figure 32, and the expected theoretical values are shown in Table III. The sequencing reaction produced a relatively homogenous ladder, and the full-length sequence was determined easily.
- a 78-mer template containing a CTG repeat (SEQ. ID. No. 15) was 3'-biotinylated by adding biotin- 14-d ATP with terminal transferase.
- An 18-mer primer (SEQ. ED. No. 16) was annealed right outside the CTG repeat so that the repeat could be sequenced immediately after primer extension.
- the four reactions were washed and analyzed by MALDI-TOFMS as usual.
- An example of the G-reaction is shown in Figure 33 and the expected sequencing ladder is shown in Table IV with theoretical mass values for each ladder component. All sequencing peaks were well resolved except the last component (theoretical value 20577.4) was indistinguishable from the background.
- Duplex DNA probes with single-stranded overhang have been demonstrated to be able to capture specific DNA templates and also serve as primers for solid-state sequencing
- the scheme is shown in Figure 34 Stacking interactions between a duplex probe and a single- stranded template allow only 5-base overhand to be sufficient for capturing Based on this format, a 5' fluorescent-labeled 23-mer (5'-GAT GAT CCG ACG CAT CAC AGC TC) (SEQ ID No. 19) was annealed to a 3'-biotinylated 18-mer (5'-GTG ATG CGT CGG ATC ATC) (SEQ.
- SEQUENCE CHARACTERISTICS (A) LENGTH: 17 base paxrs (B) TYPE: nucleic acxd
Abstract
Description
Claims
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
AU22175/97A AU2217597A (en) | 1996-03-18 | 1997-03-18 | Dna sequencing by mass spectrometry |
Applications Claiming Priority (4)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
US08/617,010 | 1996-03-18 | ||
US08/617,010 US6194144B1 (en) | 1993-01-07 | 1996-03-18 | DNA sequencing by mass spectrometry |
US54783596A | 1996-08-20 | 1996-08-20 | |
US5/547,835 | 1996-08-20 |
Publications (3)
Publication Number | Publication Date |
---|---|
WO1997037041A2 true WO1997037041A2 (en) | 1997-10-09 |
WO1997037041A3 WO1997037041A3 (en) | 1997-12-04 |
WO1997037041A9 WO1997037041A9 (en) | 1997-12-31 |
Family
ID=27068672
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
PCT/US1997/004394 WO1997037041A2 (en) | 1996-03-18 | 1997-03-18 | Dna sequencing by mass spectrometry |
Country Status (2)
Country | Link |
---|---|
AU (1) | AU2217597A (en) |
WO (1) | WO1997037041A2 (en) |
Cited By (98)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO1999014362A1 (en) * | 1997-09-15 | 1999-03-25 | Brax Group Limited | Characterising nucleic acid by mass spectrometry |
WO1999031278A1 (en) * | 1997-12-15 | 1999-06-24 | Sequenom, Inc. | Mass spectrometric methods for sequencing nucleic acids |
WO1999061910A1 (en) * | 1998-05-26 | 1999-12-02 | Board Of Trustees Of The University Of Illinois | Screening of compounds using ultrafiltration and mass spectometry |
WO2000003038A2 (en) * | 1998-07-09 | 2000-01-20 | Hewlett-Packard Company | Method and reagents for analyzing the nucleotide sequence of nucleic acids |
US6043031A (en) * | 1995-03-17 | 2000-03-28 | Sequenom, Inc. | DNA diagnostics based on mass spectrometry |
WO2000044934A2 (en) * | 1999-01-29 | 2000-08-03 | Epigenomics Ag | Method of identifying cytosine methylation patterns in genomic dna samples |
US6111251A (en) * | 1996-09-19 | 2000-08-29 | Sequenom, Inc. | Method and apparatus for MALDI analysis |
WO2000057180A2 (en) * | 1999-03-18 | 2000-09-28 | Exiqon A/S | Use of lna in mass spectrometry |
US6146854A (en) * | 1995-08-31 | 2000-11-14 | Sequenom, Inc. | Filtration processes, kits and devices for isolating plasmids |
US6194144B1 (en) | 1993-01-07 | 2001-02-27 | Sequenom, Inc. | DNA sequencing by mass spectrometry |
US6225450B1 (en) | 1993-01-07 | 2001-05-01 | Sequenom, Inc. | DNA sequencing by mass spectrometry |
US6225061B1 (en) | 1999-03-10 | 2001-05-01 | Sequenom, Inc. | Systems and methods for performing reactions in an unsealed environment |
WO2001046460A2 (en) * | 1999-12-20 | 2001-06-28 | Epigenomics Ag | Method for analyzing nucleic acid sequences |
US6270976B1 (en) | 1998-09-15 | 2001-08-07 | Brax Group Limited | Characterizing nucleic acid by mass spectrometry |
US6322970B1 (en) | 1997-09-02 | 2001-11-27 | Sequenom, Inc. | Mass spectrometric detection of polypeptides |
WO2001068664A3 (en) * | 2000-03-14 | 2002-03-21 | Xzillion Gmbh & Co Kg | Mass labels |
EP1252336A1 (en) * | 2000-02-02 | 2002-10-30 | Advion BioSciences, Inc. | Detection of single nucleotide polymorphisms |
WO2002102820A1 (en) * | 2001-06-20 | 2002-12-27 | Nuevolution A/S | Nucleoside derivatives for library preparation |
WO2004022779A2 (en) * | 2002-09-01 | 2004-03-18 | Epigenomics Ag | Method for the detection of nucleic acid sequences by means of crackable probe molecules |
US6730517B1 (en) | 1999-04-02 | 2004-05-04 | Sequenom, Inc. | Automated process line |
WO2004060278A2 (en) * | 2002-12-06 | 2004-07-22 | Isis Pharmaceuticals, Inc. | Methods for rapid identification of pathogens in humans and animals |
WO2004067775A2 (en) * | 2003-01-30 | 2004-08-12 | Epigenomics Ag | Method for the detection of cytosine methylation patterns with high sensitivity |
US7159740B2 (en) | 2001-10-26 | 2007-01-09 | Sequenom, Inc. | Method and apparatus for parallel dispensing of defined volumes of solid particles |
US7226739B2 (en) | 2001-03-02 | 2007-06-05 | Isis Pharmaceuticals, Inc | Methods for rapid detection and identification of bioagents in epidemiological and forensic investigations |
US7255992B2 (en) | 2001-03-02 | 2007-08-14 | Isis Pharmaceuticals, Inc | Methods for rapid detection and identification of bioagents for environmental and product testing |
US7501245B2 (en) | 1999-06-28 | 2009-03-10 | Helicos Biosciences Corp. | Methods and apparatuses for analyzing polynucleotide sequences |
EP2088209A1 (en) | 1999-10-13 | 2009-08-12 | Sequenom, Inc. | Methods for generating databases and databases for identifying polymorphic genetic markers |
US7645596B2 (en) | 1998-05-01 | 2010-01-12 | Arizona Board Of Regents | Method of determining the nucleotide sequence of oligonucleotides and DNA molecules |
US7666593B2 (en) | 2005-08-26 | 2010-02-23 | Helicos Biosciences Corporation | Single molecule sequencing of captured nucleic acids |
WO2010080616A1 (en) | 2008-12-19 | 2010-07-15 | Abbott Laboratories | Molecular assay for diagnosis of malaria |
WO2010115016A2 (en) | 2009-04-03 | 2010-10-07 | Sequenom, Inc. | Nucleic acid preparation compositions and methods |
US7820378B2 (en) | 2002-11-27 | 2010-10-26 | Sequenom, Inc. | Fragmentation-based methods and systems for sequence variation detection and discovery |
WO2011034631A1 (en) | 2009-09-16 | 2011-03-24 | Sequenom, Inc. | Processes and compositions for methylation-based enrichment of fetal nucleic acid from a maternal sample useful for non invasive prenatal diagnoses |
US7917301B1 (en) | 2000-09-19 | 2011-03-29 | Sequenom, Inc. | Method and device for identifying a biological sample |
EP2302074A1 (en) | 2002-12-06 | 2011-03-30 | Ibis Biosciences, Inc. | Methods for rapid forensic analysis of mitochondrial DNA and characterization of mitochondrial DNA heteroplasmy |
EP2311992A1 (en) | 2001-03-02 | 2011-04-20 | Ibis Biosciences, Inc. | Method for rapid detection and identification of bioagents |
US7956175B2 (en) | 2003-09-11 | 2011-06-07 | Ibis Biosciences, Inc. | Compositions for use in identification of bacteria |
US7964343B2 (en) | 2003-05-13 | 2011-06-21 | Ibis Biosciences, Inc. | Method for rapid purification of nucleic acids for subsequent analysis by mass spectrometry by solution capture |
US7981604B2 (en) | 2004-02-19 | 2011-07-19 | California Institute Of Technology | Methods and kits for analyzing polynucleotide sequences |
WO2011087760A2 (en) | 2009-12-22 | 2011-07-21 | Sequenom, Inc. | Processes and kits for identifying aneuploidy |
EP2395098A1 (en) | 2004-03-26 | 2011-12-14 | Sequenom, Inc. | Base specific cleavage of methylation-specific amplification products in combination with mass analysis |
US8084207B2 (en) | 2005-03-03 | 2011-12-27 | Ibis Bioscience, Inc. | Compositions for use in identification of papillomavirus |
US8088582B2 (en) | 2006-04-06 | 2012-01-03 | Ibis Biosciences, Inc. | Compositions for the use in identification of fungi |
US8097416B2 (en) | 2003-09-11 | 2012-01-17 | Ibis Biosciences, Inc. | Methods for identification of sepsis-causing bacteria |
US8148163B2 (en) | 2008-09-16 | 2012-04-03 | Ibis Biosciences, Inc. | Sample processing units, systems, and related methods |
US8158354B2 (en) | 2003-05-13 | 2012-04-17 | Ibis Biosciences, Inc. | Methods for rapid purification of nucleic acids for subsequent analysis by mass spectrometry by solution capture |
US8158936B2 (en) | 2009-02-12 | 2012-04-17 | Ibis Biosciences, Inc. | Ionization probe assemblies |
US8163895B2 (en) | 2003-12-05 | 2012-04-24 | Ibis Biosciences, Inc. | Compositions for use in identification of orthopoxviruses |
US8173957B2 (en) | 2004-05-24 | 2012-05-08 | Ibis Biosciences, Inc. | Mass spectrometry with selective ion filtration by digital thresholding |
US8182992B2 (en) | 2005-03-03 | 2012-05-22 | Ibis Biosciences, Inc. | Compositions for use in identification of adventitious viruses |
US8187814B2 (en) | 2004-02-18 | 2012-05-29 | Ibis Biosciences, Inc. | Methods for concurrent identification and quantification of an unknown bioagent |
US8214154B2 (en) | 2001-03-02 | 2012-07-03 | Ibis Biosciences, Inc. | Systems for rapid identification of pathogens in humans and animals |
US8298760B2 (en) | 2001-06-26 | 2012-10-30 | Ibis Bioscience, Inc. | Secondary structure defining database and methods for determining identity and geographic origin of an unknown bioagent thereby |
US8315805B2 (en) | 2001-04-20 | 2012-11-20 | Sequenom, Inc. | Systems and methods for testing a biological sample |
WO2012159089A1 (en) | 2011-05-19 | 2012-11-22 | Sequenom, Inc. | Products and processes for multiplex nucleic acid identification |
US8407010B2 (en) | 2004-05-25 | 2013-03-26 | Ibis Biosciences, Inc. | Methods for rapid forensic analysis of mitochondrial DNA |
US8534447B2 (en) | 2008-09-16 | 2013-09-17 | Ibis Biosciences, Inc. | Microplate handling systems and related computer program products and methods |
US8546082B2 (en) | 2003-09-11 | 2013-10-01 | Ibis Biosciences, Inc. | Methods for identification of sepsis-causing bacteria |
US8550694B2 (en) | 2008-09-16 | 2013-10-08 | Ibis Biosciences, Inc. | Mixing cartridges, mixing stations, and related kits, systems, and methods |
US8551738B2 (en) | 2005-07-21 | 2013-10-08 | Ibis Biosciences, Inc. | Systems and methods for rapid identification of nucleic acid variants |
WO2014004796A1 (en) | 2012-06-29 | 2014-01-03 | Sequenom, Inc. | Age-related macular degeneration diagnostics |
WO2014011928A1 (en) | 2012-07-13 | 2014-01-16 | Sequenom, Inc. | Processes and compositions for methylation-based enrichment of fetal nucleic acid from a maternal sample useful for non-invasive prenatal diagnoses |
US8679741B2 (en) | 2006-05-31 | 2014-03-25 | Sequenom, Inc. | Methods and compositions for the extraction and amplification of nucleic acid from a sample |
WO2014055790A2 (en) | 2012-10-04 | 2014-04-10 | Sequenom, Inc. | Methods and processes for non-invasive assessment of genetic variations |
US8871471B2 (en) | 2007-02-23 | 2014-10-28 | Ibis Biosciences, Inc. | Methods for rapid forensic DNA analysis |
US8950604B2 (en) | 2009-07-17 | 2015-02-10 | Ibis Biosciences, Inc. | Lift and mount apparatus |
WO2015075196A1 (en) | 2013-11-21 | 2015-05-28 | Assistance Publique - Hopitaux De Paris | Method for detecting chromosomal rearrangements |
US9051608B2 (en) | 2006-12-05 | 2015-06-09 | Agena Bioscience, Inc. | Detection and quantification of biomolecules using mass spectrometry |
US9068953B2 (en) | 2007-09-17 | 2015-06-30 | Agena Bioscience, Inc. | Integrated robotic sample transfer device |
US9080209B2 (en) | 2009-08-06 | 2015-07-14 | Ibis Biosciences, Inc. | Non-mass determined base compositions for nucleic acid detection |
US9096898B2 (en) | 1998-05-01 | 2015-08-04 | Life Technologies Corporation | Method of determining the nucleotide sequence of oligonucleotides and DNA molecules |
US9149473B2 (en) | 2006-09-14 | 2015-10-06 | Ibis Biosciences, Inc. | Targeted whole genome amplification method for identification of pathogens |
US9194877B2 (en) | 2009-07-17 | 2015-11-24 | Ibis Biosciences, Inc. | Systems for bioagent indentification |
US9393564B2 (en) | 2009-03-30 | 2016-07-19 | Ibis Biosciences, Inc. | Bioagent detection systems, devices, and methods |
US9404150B2 (en) | 2007-08-29 | 2016-08-02 | Sequenom, Inc. | Methods and compositions for universal size-specific PCR |
US9416409B2 (en) | 2009-07-31 | 2016-08-16 | Ibis Biosciences, Inc. | Capture primers and capture sequence linked solid supports for molecular diagnostic tests |
WO2016172579A1 (en) | 2015-04-24 | 2016-10-27 | Agena Bioscience, Inc, | Multiplex methods for detection and quantification of minor variants |
EP3103871A1 (en) | 2008-09-16 | 2016-12-14 | Sequenom, Inc. | Processes and compositions for methylation-based enrichment of fetal nucleic acid from a maternal sample useful for non-invasive prenatal diagnostic |
US9598724B2 (en) | 2007-06-01 | 2017-03-21 | Ibis Biosciences, Inc. | Methods and compositions for multiple displacement amplification of nucleic acids |
US9605313B2 (en) | 2012-03-02 | 2017-03-28 | Sequenom, Inc. | Methods and processes for non-invasive assessment of genetic variations |
US9657344B2 (en) | 2003-11-12 | 2017-05-23 | Fluidigm Corporation | Short cycle methods for sequencing polynucleotides |
US9669376B2 (en) | 2000-10-30 | 2017-06-06 | Agena Bioscience, Inc. | Method and apparatus for delivery of submicroliter volumes onto a substrate |
US9719083B2 (en) | 2009-03-08 | 2017-08-01 | Ibis Biosciences, Inc. | Bioagent detection methods |
US9758840B2 (en) | 2010-03-14 | 2017-09-12 | Ibis Biosciences, Inc. | Parasite detection via endosymbiont detection |
US9873906B2 (en) | 2004-07-14 | 2018-01-23 | Ibis Biosciences, Inc. | Methods for repairing degraded DNA |
US9890408B2 (en) | 2009-10-15 | 2018-02-13 | Ibis Biosciences, Inc. | Multiple displacement amplification |
US9920361B2 (en) | 2012-05-21 | 2018-03-20 | Sequenom, Inc. | Methods and compositions for analyzing nucleic acid |
EP3360972A1 (en) | 2008-01-17 | 2018-08-15 | Sequenom, Inc. | Single molecule nucleic acid sequence analysis processes and compositions |
US10233489B2 (en) | 2015-04-24 | 2019-03-19 | Agena Bioscience, Inc. | Multiplexed method for the identification and quantitation of minor alleles and polymorphisms |
US10426424B2 (en) | 2017-11-21 | 2019-10-01 | General Electric Company | System and method for generating and performing imaging protocol simulations |
WO2019232460A1 (en) | 2018-06-01 | 2019-12-05 | Agena Bioscience, Inc. | Products and processes for nucleic acid detection and quantification |
WO2020051529A1 (en) | 2018-09-07 | 2020-03-12 | Sequenom, Inc. | Methods, and systems to detect transplant rejection |
US10612086B2 (en) | 2008-09-16 | 2020-04-07 | Sequenom, Inc. | Processes and compositions for methylation-based enrichment of fetal nucleic acid from a maternal sample useful for non-invasive prenatal diagnoses |
WO2020172164A1 (en) | 2019-02-19 | 2020-08-27 | Sequenom, Inc. | Compositions, methods, and systems to detect hematopoietic stem cell transplantation status |
US11060145B2 (en) | 2013-03-13 | 2021-07-13 | Sequenom, Inc. | Methods and compositions for identifying presence or absence of hypermethylation or hypomethylation locus |
WO2021174079A2 (en) | 2020-02-28 | 2021-09-02 | Laboratory Corporation Of America Holdings | Compositions, methods, and systems for paternity determination |
US11365447B2 (en) | 2014-03-13 | 2022-06-21 | Sequenom, Inc. | Methods and processes for non-invasive assessment of genetic variations |
US11952569B2 (en) | 2020-04-15 | 2024-04-09 | Sequenom, Inc. | Methods and compositions for the extraction and amplification of nucleic acid from a sample |
Families Citing this family (3)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US6133436A (en) | 1996-11-06 | 2000-10-17 | Sequenom, Inc. | Beads bound to a solid support and to nucleic acids |
WO2004064972A2 (en) | 2003-01-16 | 2004-08-05 | Hk Pharmaceuticals, Inc. | Capture compounds, collections thereof and methods for analyzing the proteome and complex compositions |
US9394565B2 (en) | 2003-09-05 | 2016-07-19 | Agena Bioscience, Inc. | Allele-specific sequence variation analysis |
Citations (3)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO1994016101A2 (en) * | 1993-01-07 | 1994-07-21 | Koester Hubert | Dna sequencing by mass spectrometry |
WO1994021822A1 (en) * | 1993-03-19 | 1994-09-29 | Sequenom, Inc. | Dna sequencing by mass spectrometry via exonuclease degradation |
WO1995014108A1 (en) * | 1993-11-17 | 1995-05-26 | Amersham International Plc | Primer extension mass spectroscopy nucleic acid sequencing method |
-
1997
- 1997-03-18 AU AU22175/97A patent/AU2217597A/en not_active Abandoned
- 1997-03-18 WO PCT/US1997/004394 patent/WO1997037041A2/en active Application Filing
Patent Citations (3)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO1994016101A2 (en) * | 1993-01-07 | 1994-07-21 | Koester Hubert | Dna sequencing by mass spectrometry |
WO1994021822A1 (en) * | 1993-03-19 | 1994-09-29 | Sequenom, Inc. | Dna sequencing by mass spectrometry via exonuclease degradation |
WO1995014108A1 (en) * | 1993-11-17 | 1995-05-26 | Amersham International Plc | Primer extension mass spectroscopy nucleic acid sequencing method |
Non-Patent Citations (3)
Title |
---|
KIRPEKAR, F ET AL: "7-deazapurine bases offer a higher stability in the analysis of DNA by matrix-assisted laser desorption/ionization mass spectrometry" RAPID COMMUN. MASS SPECT., vol. 9, 1995, pages 525-31, XP002041458 * |
NORDHOFF E ET AL: "Ion stability of nucleic acids in infrared matrix-assisted laser desorption/ionization mass specrtrmetry" NUCLEIC ACIDS RESEARCH, vol. 21, no. 15, 25 July 1993, pages 3347-57, XP000537440 * |
SCHNEIDER K ET AL: "Increased stability of nucleic acids containing 7-deaza-guanosine and 7-deaza-adenosine may enable rapid DNA sequencing by matrix-assisted laser desorption spectroscopy" NUCLEIC ACIDS RESEARCH, vol. 23, no. 9, 11 May 1995, pages 1570-75, XP000601668 * |
Cited By (184)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US6194144B1 (en) | 1993-01-07 | 2001-02-27 | Sequenom, Inc. | DNA sequencing by mass spectrometry |
US6225450B1 (en) | 1993-01-07 | 2001-05-01 | Sequenom, Inc. | DNA sequencing by mass spectrometry |
US6277573B1 (en) | 1995-03-17 | 2001-08-21 | Sequenom, Inc. | DNA diagnostics based on mass spectrometry |
US6235478B1 (en) | 1995-03-17 | 2001-05-22 | Sequenom, Inc. | DNA diagnostics based on mass spectrometry |
US6043031A (en) * | 1995-03-17 | 2000-03-28 | Sequenom, Inc. | DNA diagnostics based on mass spectrometry |
US6197498B1 (en) | 1995-03-17 | 2001-03-06 | Sequenom, Inc | DNA diagnostics based on mass spectrometry |
US6146854A (en) * | 1995-08-31 | 2000-11-14 | Sequenom, Inc. | Filtration processes, kits and devices for isolating plasmids |
US6423966B2 (en) | 1996-09-19 | 2002-07-23 | Sequenom, Inc. | Method and apparatus for maldi analysis |
US6812455B2 (en) | 1996-09-19 | 2004-11-02 | Sequenom, Inc. | Method and apparatus for MALDI analysis |
US6111251A (en) * | 1996-09-19 | 2000-08-29 | Sequenom, Inc. | Method and apparatus for MALDI analysis |
US6322970B1 (en) | 1997-09-02 | 2001-11-27 | Sequenom, Inc. | Mass spectrometric detection of polypeptides |
WO1999014362A1 (en) * | 1997-09-15 | 1999-03-25 | Brax Group Limited | Characterising nucleic acid by mass spectrometry |
WO1999031278A1 (en) * | 1997-12-15 | 1999-06-24 | Sequenom, Inc. | Mass spectrometric methods for sequencing nucleic acids |
US9725764B2 (en) | 1998-05-01 | 2017-08-08 | Life Technologies Corporation | Method of determining the nucleotide sequence of oligonucleotides and DNA molecules |
US9212393B2 (en) | 1998-05-01 | 2015-12-15 | Life Technologies Corporation | Method of determining the nucleotide sequence of oligonucleotides and DNA molecules |
US7645596B2 (en) | 1998-05-01 | 2010-01-12 | Arizona Board Of Regents | Method of determining the nucleotide sequence of oligonucleotides and DNA molecules |
US9957561B2 (en) | 1998-05-01 | 2018-05-01 | Life Technologies Corporation | Method of determining the nucleotide sequence of oligonucleotides and DNA molecules |
US10214774B2 (en) | 1998-05-01 | 2019-02-26 | Life Technologies Corporation | Method of determining the nucleotide sequence of oligonucleotides and DNA molecules |
US9458500B2 (en) | 1998-05-01 | 2016-10-04 | Life Technologies Corporation | Method of determining the nucleotide sequence of oligonucleotides and DNA molecules |
US10208341B2 (en) | 1998-05-01 | 2019-02-19 | Life Technologies Corporation | Method of determining the nucleotide sequence of oligonucleotides and DNA molecules |
US9096898B2 (en) | 1998-05-01 | 2015-08-04 | Life Technologies Corporation | Method of determining the nucleotide sequence of oligonucleotides and DNA molecules |
WO1999061910A1 (en) * | 1998-05-26 | 1999-12-02 | Board Of Trustees Of The University Of Illinois | Screening of compounds using ultrafiltration and mass spectometry |
WO2000003038A3 (en) * | 1998-07-09 | 2000-03-16 | Hewlett Packard Co | Method and reagents for analyzing the nucleotide sequence of nucleic acids |
WO2000003038A2 (en) * | 1998-07-09 | 2000-01-20 | Hewlett-Packard Company | Method and reagents for analyzing the nucleotide sequence of nucleic acids |
US6218118B1 (en) | 1998-07-09 | 2001-04-17 | Agilent Technologies, Inc. | Method and mixture reagents for analyzing the nucleotide sequence of nucleic acids by mass spectrometry |
US6270976B1 (en) | 1998-09-15 | 2001-08-07 | Brax Group Limited | Characterizing nucleic acid by mass spectrometry |
WO2000044934A2 (en) * | 1999-01-29 | 2000-08-03 | Epigenomics Ag | Method of identifying cytosine methylation patterns in genomic dna samples |
WO2000044934A3 (en) * | 1999-01-29 | 2000-11-30 | Epigenomics Gmbh | Method of identifying cytosine methylation patterns in genomic dna samples |
US6485913B1 (en) | 1999-03-10 | 2002-11-26 | Sequenom, Inc. | Systems and methods for performing reactions in an unsealed environment |
US6225061B1 (en) | 1999-03-10 | 2001-05-01 | Sequenom, Inc. | Systems and methods for performing reactions in an unsealed environment |
WO2000057180A3 (en) * | 1999-03-18 | 2001-02-08 | Exiqon As | Use of lna in mass spectrometry |
WO2000057180A2 (en) * | 1999-03-18 | 2000-09-28 | Exiqon A/S | Use of lna in mass spectrometry |
US6730517B1 (en) | 1999-04-02 | 2004-05-04 | Sequenom, Inc. | Automated process line |
US7501245B2 (en) | 1999-06-28 | 2009-03-10 | Helicos Biosciences Corp. | Methods and apparatuses for analyzing polynucleotide sequences |
EP2088209A1 (en) | 1999-10-13 | 2009-08-12 | Sequenom, Inc. | Methods for generating databases and databases for identifying polymorphic genetic markers |
WO2001046460A2 (en) * | 1999-12-20 | 2001-06-28 | Epigenomics Ag | Method for analyzing nucleic acid sequences |
WO2001046460A3 (en) * | 1999-12-20 | 2002-02-14 | Epigenomics Ag | Method for analyzing nucleic acid sequences |
EP1252336A1 (en) * | 2000-02-02 | 2002-10-30 | Advion BioSciences, Inc. | Detection of single nucleotide polymorphisms |
EP1252336A4 (en) * | 2000-02-02 | 2005-02-09 | Advion Biosciences Inc | Detection of single nucleotide polymorphisms |
US7825069B2 (en) | 2000-03-14 | 2010-11-02 | Electrophoretics Limited | Mass labels |
EP1806586A1 (en) * | 2000-03-14 | 2007-07-11 | Electrophoretics Limited | Mass labels |
US7294456B2 (en) | 2000-03-14 | 2007-11-13 | Electrophoretics Limited | Mass labels |
US7816304B2 (en) | 2000-03-14 | 2010-10-19 | Electrophoretics Limited | Mass labels |
WO2001068664A3 (en) * | 2000-03-14 | 2002-03-21 | Xzillion Gmbh & Co Kg | Mass labels |
US7917301B1 (en) | 2000-09-19 | 2011-03-29 | Sequenom, Inc. | Method and device for identifying a biological sample |
US9669376B2 (en) | 2000-10-30 | 2017-06-06 | Agena Bioscience, Inc. | Method and apparatus for delivery of submicroliter volumes onto a substrate |
US9416424B2 (en) | 2001-03-02 | 2016-08-16 | Ibis Biosciences, Inc. | Methods for rapid identification of pathogens in humans and animals |
US8268565B2 (en) | 2001-03-02 | 2012-09-18 | Ibis Biosciences, Inc. | Methods for identifying bioagents |
US8815513B2 (en) | 2001-03-02 | 2014-08-26 | Ibis Biosciences, Inc. | Method for rapid detection and identification of bioagents in epidemiological and forensic investigations |
US8265878B2 (en) | 2001-03-02 | 2012-09-11 | Ibis Bioscience, Inc. | Method for rapid detection and identification of bioagents |
US8214154B2 (en) | 2001-03-02 | 2012-07-03 | Ibis Biosciences, Inc. | Systems for rapid identification of pathogens in humans and animals |
US9752184B2 (en) | 2001-03-02 | 2017-09-05 | Ibis Biosciences, Inc. | Methods for rapid forensic analysis of mitochondrial DNA and characterization of mitochondrial DNA heteroplasmy |
US8563250B2 (en) | 2001-03-02 | 2013-10-22 | Ibis Biosciences, Inc. | Methods for identifying bioagents |
US7255992B2 (en) | 2001-03-02 | 2007-08-14 | Isis Pharmaceuticals, Inc | Methods for rapid detection and identification of bioagents for environmental and product testing |
EP2311992A1 (en) | 2001-03-02 | 2011-04-20 | Ibis Biosciences, Inc. | Method for rapid detection and identification of bioagents |
EP2322649A1 (en) | 2001-03-02 | 2011-05-18 | Ibis Biosciences, Inc. | Method for rapid detection and identification of bioagents |
US7226739B2 (en) | 2001-03-02 | 2007-06-05 | Isis Pharmaceuticals, Inc | Methods for rapid detection and identification of bioagents in epidemiological and forensic investigations |
US8802372B2 (en) | 2001-03-02 | 2014-08-12 | Ibis Biosciences, Inc. | Methods for rapid forensic analysis of mitochondrial DNA and characterization of mitochondrial DNA heteroplasmy |
US8315805B2 (en) | 2001-04-20 | 2012-11-20 | Sequenom, Inc. | Systems and methods for testing a biological sample |
WO2002102820A1 (en) * | 2001-06-20 | 2002-12-27 | Nuevolution A/S | Nucleoside derivatives for library preparation |
US8921047B2 (en) | 2001-06-26 | 2014-12-30 | Ibis Biosciences, Inc. | Secondary structure defining database and methods for determining identity and geographic origin of an unknown bioagent thereby |
US8298760B2 (en) | 2001-06-26 | 2012-10-30 | Ibis Bioscience, Inc. | Secondary structure defining database and methods for determining identity and geographic origin of an unknown bioagent thereby |
US8380442B2 (en) | 2001-06-26 | 2013-02-19 | Ibis Bioscience, Inc. | Secondary structure defining database and methods for determining identity and geographic origin of an unknown bioagent thereby |
US7159740B2 (en) | 2001-10-26 | 2007-01-09 | Sequenom, Inc. | Method and apparatus for parallel dispensing of defined volumes of solid particles |
WO2004022779A2 (en) * | 2002-09-01 | 2004-03-18 | Epigenomics Ag | Method for the detection of nucleic acid sequences by means of crackable probe molecules |
WO2004022779A3 (en) * | 2002-09-01 | 2004-06-03 | Epigenomics Ag | Method for the detection of nucleic acid sequences by means of crackable probe molecules |
US7820378B2 (en) | 2002-11-27 | 2010-10-26 | Sequenom, Inc. | Fragmentation-based methods and systems for sequence variation detection and discovery |
WO2004060278A2 (en) * | 2002-12-06 | 2004-07-22 | Isis Pharmaceuticals, Inc. | Methods for rapid identification of pathogens in humans and animals |
WO2004060278A3 (en) * | 2002-12-06 | 2006-03-02 | Isis Pharmaceuticals Inc | Methods for rapid identification of pathogens in humans and animals |
US8822156B2 (en) | 2002-12-06 | 2014-09-02 | Ibis Biosciences, Inc. | Methods for rapid identification of pathogens in humans and animals |
EP2302074A1 (en) | 2002-12-06 | 2011-03-30 | Ibis Biosciences, Inc. | Methods for rapid forensic analysis of mitochondrial DNA and characterization of mitochondrial DNA heteroplasmy |
US9725771B2 (en) | 2002-12-06 | 2017-08-08 | Ibis Biosciences, Inc. | Methods for rapid identification of pathogens in humans and animals |
WO2004067775A3 (en) * | 2003-01-30 | 2004-12-09 | Epigenomics Ag | Method for the detection of cytosine methylation patterns with high sensitivity |
WO2004067775A2 (en) * | 2003-01-30 | 2004-08-12 | Epigenomics Ag | Method for the detection of cytosine methylation patterns with high sensitivity |
US7964343B2 (en) | 2003-05-13 | 2011-06-21 | Ibis Biosciences, Inc. | Method for rapid purification of nucleic acids for subsequent analysis by mass spectrometry by solution capture |
US8476415B2 (en) | 2003-05-13 | 2013-07-02 | Ibis Biosciences, Inc. | Methods for rapid purification of nucleic acids for subsequent analysis by mass spectrometry by solution capture |
US8158354B2 (en) | 2003-05-13 | 2012-04-17 | Ibis Biosciences, Inc. | Methods for rapid purification of nucleic acids for subsequent analysis by mass spectrometry by solution capture |
US8394945B2 (en) | 2003-09-11 | 2013-03-12 | Ibis Biosciences, Inc. | Compositions for use in identification of bacteria |
US8546082B2 (en) | 2003-09-11 | 2013-10-01 | Ibis Biosciences, Inc. | Methods for identification of sepsis-causing bacteria |
US8242254B2 (en) | 2003-09-11 | 2012-08-14 | Ibis Biosciences, Inc. | Compositions for use in identification of bacteria |
US7956175B2 (en) | 2003-09-11 | 2011-06-07 | Ibis Biosciences, Inc. | Compositions for use in identification of bacteria |
US8013142B2 (en) | 2003-09-11 | 2011-09-06 | Ibis Biosciences, Inc. | Compositions for use in identification of bacteria |
US8288523B2 (en) | 2003-09-11 | 2012-10-16 | Ibis Biosciences, Inc. | Compositions for use in identification of bacteria |
US8097416B2 (en) | 2003-09-11 | 2012-01-17 | Ibis Biosciences, Inc. | Methods for identification of sepsis-causing bacteria |
US9657344B2 (en) | 2003-11-12 | 2017-05-23 | Fluidigm Corporation | Short cycle methods for sequencing polynucleotides |
US8163895B2 (en) | 2003-12-05 | 2012-04-24 | Ibis Biosciences, Inc. | Compositions for use in identification of orthopoxviruses |
US9447462B2 (en) | 2004-02-18 | 2016-09-20 | Ibis Biosciences, Inc. | Methods for concurrent identification and quantification of an unknown bioagent |
US8187814B2 (en) | 2004-02-18 | 2012-05-29 | Ibis Biosciences, Inc. | Methods for concurrent identification and quantification of an unknown bioagent |
US7981604B2 (en) | 2004-02-19 | 2011-07-19 | California Institute Of Technology | Methods and kits for analyzing polynucleotide sequences |
EP2395098A1 (en) | 2004-03-26 | 2011-12-14 | Sequenom, Inc. | Base specific cleavage of methylation-specific amplification products in combination with mass analysis |
US8173957B2 (en) | 2004-05-24 | 2012-05-08 | Ibis Biosciences, Inc. | Mass spectrometry with selective ion filtration by digital thresholding |
US8987660B2 (en) | 2004-05-24 | 2015-03-24 | Ibis Biosciences, Inc. | Mass spectrometry with selective ion filtration by digital thresholding |
US9449802B2 (en) | 2004-05-24 | 2016-09-20 | Ibis Biosciences, Inc. | Mass spectrometry with selective ion filtration by digital thresholding |
US8407010B2 (en) | 2004-05-25 | 2013-03-26 | Ibis Biosciences, Inc. | Methods for rapid forensic analysis of mitochondrial DNA |
US9873906B2 (en) | 2004-07-14 | 2018-01-23 | Ibis Biosciences, Inc. | Methods for repairing degraded DNA |
US8084207B2 (en) | 2005-03-03 | 2011-12-27 | Ibis Bioscience, Inc. | Compositions for use in identification of papillomavirus |
US8182992B2 (en) | 2005-03-03 | 2012-05-22 | Ibis Biosciences, Inc. | Compositions for use in identification of adventitious viruses |
US8551738B2 (en) | 2005-07-21 | 2013-10-08 | Ibis Biosciences, Inc. | Systems and methods for rapid identification of nucleic acid variants |
US9868978B2 (en) | 2005-08-26 | 2018-01-16 | Fluidigm Corporation | Single molecule sequencing of captured nucleic acids |
US7666593B2 (en) | 2005-08-26 | 2010-02-23 | Helicos Biosciences Corporation | Single molecule sequencing of captured nucleic acids |
US8088582B2 (en) | 2006-04-06 | 2012-01-03 | Ibis Biosciences, Inc. | Compositions for the use in identification of fungi |
US10662421B2 (en) | 2006-05-31 | 2020-05-26 | Sequenom, Inc. | Methods and compositions for the extraction and amplification of nucleic acid from a sample |
US8679741B2 (en) | 2006-05-31 | 2014-03-25 | Sequenom, Inc. | Methods and compositions for the extraction and amplification of nucleic acid from a sample |
US9453257B2 (en) | 2006-05-31 | 2016-09-27 | Sequenom, Inc. | Methods and compositions for the extraction and amplification of nucleic acid from a sample |
US9149473B2 (en) | 2006-09-14 | 2015-10-06 | Ibis Biosciences, Inc. | Targeted whole genome amplification method for identification of pathogens |
US9051608B2 (en) | 2006-12-05 | 2015-06-09 | Agena Bioscience, Inc. | Detection and quantification of biomolecules using mass spectrometry |
US8871471B2 (en) | 2007-02-23 | 2014-10-28 | Ibis Biosciences, Inc. | Methods for rapid forensic DNA analysis |
US9598724B2 (en) | 2007-06-01 | 2017-03-21 | Ibis Biosciences, Inc. | Methods and compositions for multiple displacement amplification of nucleic acids |
US9404150B2 (en) | 2007-08-29 | 2016-08-02 | Sequenom, Inc. | Methods and compositions for universal size-specific PCR |
US9068953B2 (en) | 2007-09-17 | 2015-06-30 | Agena Bioscience, Inc. | Integrated robotic sample transfer device |
US11708607B2 (en) | 2008-01-17 | 2023-07-25 | Sequenom, Inc. | Compositions containing identifier sequences on solid supports for nucleic acid sequence analysis |
US10731213B2 (en) | 2008-01-17 | 2020-08-04 | Sequenom, Inc. | Compositions containing identifier sequences on solid supports for nucleic acid sequence analysis |
EP3360972A1 (en) | 2008-01-17 | 2018-08-15 | Sequenom, Inc. | Single molecule nucleic acid sequence analysis processes and compositions |
EP3699291A1 (en) | 2008-01-17 | 2020-08-26 | Sequenom, Inc. | Single molecule nucleic acid sequence analysis processes and compositions |
US10144966B2 (en) | 2008-01-17 | 2018-12-04 | Sequenom, Inc. | Methods of nucleic acid sequences analysis using solid supports containing identifier sequences |
US9023655B2 (en) | 2008-09-16 | 2015-05-05 | Ibis Biosciences, Inc. | Sample processing units, systems, and related methods |
US10738358B2 (en) | 2008-09-16 | 2020-08-11 | Sequenom, Inc. | Processes and compositions for methylation-based enrichment of fetal nucleic acid from a maternal sample useful for non-invasive prenatal diagnoses |
US8148163B2 (en) | 2008-09-16 | 2012-04-03 | Ibis Biosciences, Inc. | Sample processing units, systems, and related methods |
US8252599B2 (en) | 2008-09-16 | 2012-08-28 | Ibis Biosciences, Inc. | Sample processing units, systems, and related methods |
US8534447B2 (en) | 2008-09-16 | 2013-09-17 | Ibis Biosciences, Inc. | Microplate handling systems and related computer program products and methods |
US8550694B2 (en) | 2008-09-16 | 2013-10-08 | Ibis Biosciences, Inc. | Mixing cartridges, mixing stations, and related kits, systems, and methods |
US9027730B2 (en) | 2008-09-16 | 2015-05-12 | Ibis Biosciences, Inc. | Microplate handling systems and related computer program products and methods |
EP3770255A1 (en) | 2008-09-16 | 2021-01-27 | Sequenom, Inc. | Processes and compositions for methylation-based enrichment of fetal nucleic acid from a maternal sample useful for non-invasive prenatal diagnoses |
US8609430B2 (en) | 2008-09-16 | 2013-12-17 | Ibis Biosciences, Inc. | Sample processing units, systems, and related methods |
EP3103871A1 (en) | 2008-09-16 | 2016-12-14 | Sequenom, Inc. | Processes and compositions for methylation-based enrichment of fetal nucleic acid from a maternal sample useful for non-invasive prenatal diagnostic |
US10612086B2 (en) | 2008-09-16 | 2020-04-07 | Sequenom, Inc. | Processes and compositions for methylation-based enrichment of fetal nucleic acid from a maternal sample useful for non-invasive prenatal diagnoses |
WO2010080616A1 (en) | 2008-12-19 | 2010-07-15 | Abbott Laboratories | Molecular assay for diagnosis of malaria |
US8158936B2 (en) | 2009-02-12 | 2012-04-17 | Ibis Biosciences, Inc. | Ionization probe assemblies |
US9165740B2 (en) | 2009-02-12 | 2015-10-20 | Ibis Biosciences, Inc. | Ionization probe assemblies |
US8796617B2 (en) | 2009-02-12 | 2014-08-05 | Ibis Biosciences, Inc. | Ionization probe assemblies |
US9719083B2 (en) | 2009-03-08 | 2017-08-01 | Ibis Biosciences, Inc. | Bioagent detection methods |
US9393564B2 (en) | 2009-03-30 | 2016-07-19 | Ibis Biosciences, Inc. | Bioagent detection systems, devices, and methods |
EP3211095A1 (en) | 2009-04-03 | 2017-08-30 | Sequenom, Inc. | Nucleic acid preparation compositions and methods |
EP3514244A1 (en) | 2009-04-03 | 2019-07-24 | Sequenom, Inc. | Nucleic acid preparation compositions and methods |
EP3964586A1 (en) | 2009-04-03 | 2022-03-09 | Sequenom, Inc. | Nucleic acid preparation compositions and methods |
WO2010115016A2 (en) | 2009-04-03 | 2010-10-07 | Sequenom, Inc. | Nucleic acid preparation compositions and methods |
US9850480B2 (en) | 2009-04-03 | 2017-12-26 | Sequenom, Inc. | Nucleic acid preparation compositions and methods |
US9580741B2 (en) | 2009-04-03 | 2017-02-28 | Sequenom, Inc. | Nucleic acid preparation compositions and methods |
US10858645B2 (en) | 2009-04-03 | 2020-12-08 | Sequenom, Inc. | Nucleic acid preparation compositions and methods |
US10053685B2 (en) | 2009-04-03 | 2018-08-21 | Sequenom, Inc. | Nucleic acid preparation compositions and methods |
US9194877B2 (en) | 2009-07-17 | 2015-11-24 | Ibis Biosciences, Inc. | Systems for bioagent indentification |
US8950604B2 (en) | 2009-07-17 | 2015-02-10 | Ibis Biosciences, Inc. | Lift and mount apparatus |
US9416409B2 (en) | 2009-07-31 | 2016-08-16 | Ibis Biosciences, Inc. | Capture primers and capture sequence linked solid supports for molecular diagnostic tests |
US10119164B2 (en) | 2009-07-31 | 2018-11-06 | Ibis Biosciences, Inc. | Capture primers and capture sequence linked solid supports for molecular diagnostic tests |
US9080209B2 (en) | 2009-08-06 | 2015-07-14 | Ibis Biosciences, Inc. | Non-mass determined base compositions for nucleic acid detection |
EP3330382A1 (en) | 2009-09-16 | 2018-06-06 | Sequenom, Inc. | Processes and compositions for methylation-based enrichment of fetal nucleic acid from a maternal sample useful for non-invasive prenatal diagnoses |
EP3722440A1 (en) | 2009-09-16 | 2020-10-14 | Sequenom, Inc. | Processes and compositions for methylation-based enrichment of fetal nucleic acid from a maternal sample useful for non-invasive prenatal diagnoses |
WO2011034631A1 (en) | 2009-09-16 | 2011-03-24 | Sequenom, Inc. | Processes and compositions for methylation-based enrichment of fetal nucleic acid from a maternal sample useful for non invasive prenatal diagnoses |
US9890408B2 (en) | 2009-10-15 | 2018-02-13 | Ibis Biosciences, Inc. | Multiple displacement amplification |
US9926593B2 (en) | 2009-12-22 | 2018-03-27 | Sequenom, Inc. | Processes and kits for identifying aneuploidy |
WO2011087760A2 (en) | 2009-12-22 | 2011-07-21 | Sequenom, Inc. | Processes and kits for identifying aneuploidy |
EP3660165A1 (en) | 2009-12-22 | 2020-06-03 | Sequenom, Inc. | Processes and kits for identifying aneuploidy |
US11180799B2 (en) | 2009-12-22 | 2021-11-23 | Sequenom, Inc. | Processes and kits for identifying aneuploidy |
EP3088532A1 (en) | 2009-12-22 | 2016-11-02 | Sequenom, Inc. | Processes and kits for identifying aneuploidy |
US9758840B2 (en) | 2010-03-14 | 2017-09-12 | Ibis Biosciences, Inc. | Parasite detection via endosymbiont detection |
US11667958B2 (en) | 2011-05-19 | 2023-06-06 | Agena Bioscience, Inc. | Products and processes for multiplex nucleic acid identification |
US10604791B2 (en) | 2011-05-19 | 2020-03-31 | Agena Bioscience, Inc. | Products and processes for multiplex nucleic acid identification |
WO2012159089A1 (en) | 2011-05-19 | 2012-11-22 | Sequenom, Inc. | Products and processes for multiplex nucleic acid identification |
US9605313B2 (en) | 2012-03-02 | 2017-03-28 | Sequenom, Inc. | Methods and processes for non-invasive assessment of genetic variations |
US11312997B2 (en) | 2012-03-02 | 2022-04-26 | Sequenom, Inc. | Methods and processes for non-invasive assessment of genetic variations |
US10738359B2 (en) | 2012-03-02 | 2020-08-11 | Sequenom, Inc. | Methods and processes for non-invasive assessment of genetic variations |
US9920361B2 (en) | 2012-05-21 | 2018-03-20 | Sequenom, Inc. | Methods and compositions for analyzing nucleic acid |
US11306354B2 (en) | 2012-05-21 | 2022-04-19 | Sequenom, Inc. | Methods and compositions for analyzing nucleic acid |
WO2014004796A1 (en) | 2012-06-29 | 2014-01-03 | Sequenom, Inc. | Age-related macular degeneration diagnostics |
US11332791B2 (en) | 2012-07-13 | 2022-05-17 | Sequenom, Inc. | Processes and compositions for methylation-based enrichment of fetal nucleic acid from a maternal sample useful for non-invasive prenatal diagnoses |
WO2014011928A1 (en) | 2012-07-13 | 2014-01-16 | Sequenom, Inc. | Processes and compositions for methylation-based enrichment of fetal nucleic acid from a maternal sample useful for non-invasive prenatal diagnoses |
EP4009329A1 (en) | 2012-10-04 | 2022-06-08 | Sequenom, Inc. | Methods and processes for non-invasive assessment of genetic variations |
WO2014055790A2 (en) | 2012-10-04 | 2014-04-10 | Sequenom, Inc. | Methods and processes for non-invasive assessment of genetic variations |
US11060145B2 (en) | 2013-03-13 | 2021-07-13 | Sequenom, Inc. | Methods and compositions for identifying presence or absence of hypermethylation or hypomethylation locus |
WO2015075196A1 (en) | 2013-11-21 | 2015-05-28 | Assistance Publique - Hopitaux De Paris | Method for detecting chromosomal rearrangements |
US10385401B2 (en) | 2013-11-21 | 2019-08-20 | Assistance Publique Hopitaux De Paris | Method for detecting chromosomal rearrangements |
US11365447B2 (en) | 2014-03-13 | 2022-06-21 | Sequenom, Inc. | Methods and processes for non-invasive assessment of genetic variations |
WO2016172579A1 (en) | 2015-04-24 | 2016-10-27 | Agena Bioscience, Inc, | Multiplex methods for detection and quantification of minor variants |
US10233489B2 (en) | 2015-04-24 | 2019-03-19 | Agena Bioscience, Inc. | Multiplexed method for the identification and quantitation of minor alleles and polymorphisms |
US10865439B2 (en) | 2015-04-24 | 2020-12-15 | Agena Bioscience, Inc. | Multiplexed method for the identification and quantitation of minor alleles and polymorphisms |
US10640817B2 (en) | 2015-04-24 | 2020-05-05 | Agena Bioscience, Inc. | Multiplex methods for detection and quantification of minor variants |
US10513728B2 (en) | 2015-04-24 | 2019-12-24 | Agena Bioscience, Inc. | Multiplexed method for the identification and quantitation of minor alleles and polymorphisms |
US11680289B2 (en) | 2015-04-24 | 2023-06-20 | Agena Bioscience, Inc. | Multiplexed method for the identification and quantitation of minor alleles and polymorphisms |
US10426424B2 (en) | 2017-11-21 | 2019-10-01 | General Electric Company | System and method for generating and performing imaging protocol simulations |
WO2019232460A1 (en) | 2018-06-01 | 2019-12-05 | Agena Bioscience, Inc. | Products and processes for nucleic acid detection and quantification |
WO2020051529A1 (en) | 2018-09-07 | 2020-03-12 | Sequenom, Inc. | Methods, and systems to detect transplant rejection |
WO2020172164A1 (en) | 2019-02-19 | 2020-08-27 | Sequenom, Inc. | Compositions, methods, and systems to detect hematopoietic stem cell transplantation status |
WO2021174079A2 (en) | 2020-02-28 | 2021-09-02 | Laboratory Corporation Of America Holdings | Compositions, methods, and systems for paternity determination |
US11952569B2 (en) | 2020-04-15 | 2024-04-09 | Sequenom, Inc. | Methods and compositions for the extraction and amplification of nucleic acid from a sample |
Also Published As
Publication number | Publication date |
---|---|
AU2217597A (en) | 1997-10-22 |
WO1997037041A3 (en) | 1997-12-04 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
US6194144B1 (en) | DNA sequencing by mass spectrometry | |
EP0679196B1 (en) | Dna sequencing by mass spectrometry | |
WO1997037041A2 (en) | Dna sequencing by mass spectrometry | |
WO1997037041A9 (en) | Dna sequencing by mass spectrometry | |
US6428955B1 (en) | DNA diagnostics based on mass spectrometry | |
US7501251B2 (en) | DNA diagnostics based on mass spectrometry | |
AU725966B2 (en) | Mass label linked hybridisation probes | |
US6043031A (en) | DNA diagnostics based on mass spectrometry | |
EP0689610B1 (en) | Dna sequencing by mass spectrometry via exonuclease degradation | |
US6140053A (en) | DNA sequencing by mass spectrometry via exonuclease degradation | |
US6074823A (en) | DNA sequencing by mass spectrometry via exonuclease degradation | |
CA2218188A1 (en) | Solid phase sequencing of biopolymers | |
US6699668B1 (en) | Mass label linked hybridisation probes | |
AU694940C (en) | DNA sequencing by mass spectrometry | |
AU738203B2 (en) | DNA sequencing by mass spectrometry | |
AU7613101A (en) | DNA diagnostics based on mass spectrometry |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
AK | Designated states |
Kind code of ref document: A2 Designated state(s): AL AM AT AU AZ BB BG BR BY CA CH CN CU CZ DE DK EE ES FI GB GE HU IL IS JP KE KP KZ LC LK LR LS LT LU LV MD MG MK MN MW MX NO NZ PL PT RO RU SD SE SG SI SK TJ TM TR TT UA UG UZ AM AZ BY KG KZ MD RU TJ TM |
|
AL | Designated countries for regional patents |
Kind code of ref document: A2 Designated state(s): GH KE LS MW SD SZ UG AT BE CH DE DK ES FI FR GB GR IE IT LU MC NL PT SE BF BJ CF CG CI CM GA GN |
|
DFPE | Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101) | ||
AK | Designated states |
Kind code of ref document: A3 Designated state(s): AL AM AT AU AZ BB BG BR BY CA CH CN CU CZ DE DK EE ES FI GB GE HU IL IS JP KE KP KZ LC LK LR LS LT LU LV MD MG MK MN MW MX NO NZ PL PT RO RU SD SE SG SI SK TJ TM TR TT UA UG UZ AM AZ BY KG KZ MD RU TJ TM |
|
AL | Designated countries for regional patents |
Kind code of ref document: A3 Designated state(s): GH KE LS MW SD SZ UG AT BE CH DE DK ES FI FR GB GR IE IT LU MC NL PT SE BF BJ CF CG CI CM GA GN |
|
COP | Corrected version of pamphlet |
Free format text: PAGES 1/43-43/43,DRAWINGS,REPLACED BY NEW PAGES 1/54-54/54;DUE TO LATE TRANSMITTAL BY THE RECEIVINGOFFICE |
|
121 | Ep: the epo has been informed by wipo that ep was designated in this application | ||
NENP | Non-entry into the national phase in: |
Ref country code: JP Ref document number: 97535304 Format of ref document f/p: F |
|
REG | Reference to national code |
Ref country code: DE Ref legal event code: 8642 |
|
122 | Ep: pct application non-entry in european phase | ||
NENP | Non-entry into the national phase in: |
Ref country code: CA |